>Feature sequence01 1149 373 gene locus_tag LOCUS_00010 1149 373 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198410.1 protein_id gnl|my_center|LOCUS_00010 1301 2047 gene locus_tag LOCUS_00020 1301 2047 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945965.1 protein_id gnl|my_center|LOCUS_00020 2076 3356 gene locus_tag LOCUS_00030 2076 3356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3359 3841 gene locus_tag LOCUS_00040 3359 3841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 3890 4873 gene locus_tag LOCUS_00050 3890 4873 CDS product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064835.1 protein_id gnl|my_center|LOCUS_00050 4884 6728 gene locus_tag LOCUS_00060 4884 6728 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527796.1 protein_id gnl|my_center|LOCUS_00060 7510 6722 gene locus_tag LOCUS_00070 gene trpC 7510 6722 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815394.1 protein_id gnl|my_center|LOCUS_00070 8557 7520 gene locus_tag LOCUS_00080 gene trpD 8557 7520 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186823.1 protein_id gnl|my_center|LOCUS_00080 9190 8606 gene locus_tag LOCUS_00090 9190 8606 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113175.1 protein_id gnl|my_center|LOCUS_00090 9813 9280 gene locus_tag LOCUS_00100 9813 9280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 11436 9931 gene locus_tag LOCUS_00110 gene trpE 11436 9931 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186866.1 protein_id gnl|my_center|LOCUS_00110 12113 11433 gene locus_tag LOCUS_00120 12113 11433 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815386.1 protein_id gnl|my_center|LOCUS_00120 12800 12120 gene locus_tag LOCUS_00130 gene rpe 12800 12120 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522003.1 protein_id gnl|my_center|LOCUS_00130 12952 13335 gene locus_tag LOCUS_00140 gene apaG 12952 13335 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815381.1 protein_id gnl|my_center|LOCUS_00140 13633 14721 gene locus_tag LOCUS_00150 13633 14721 CDS product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815379.1 protein_id gnl|my_center|LOCUS_00150 15550 14741 gene locus_tag LOCUS_00160 15550 14741 CDS product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186871.1 protein_id gnl|my_center|LOCUS_00160 16863 15637 gene locus_tag LOCUS_00170 16863 15637 CDS product UbiH/UbiF family hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521997.1 protein_id gnl|my_center|LOCUS_00170 16991 17066 gene locus_tag LOCUS_t00010 16991 17066 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 17235 19622 gene locus_tag LOCUS_00180 17235 19622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 19652 20812 gene locus_tag LOCUS_00190 19652 20812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 20809 21264 gene locus_tag LOCUS_00200 20809 21264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 21561 21295 gene locus_tag LOCUS_00210 21561 21295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 23043 21607 gene locus_tag LOCUS_00220 23043 21607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 23616 23206 gene locus_tag LOCUS_00230 23616 23206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 24332 23709 gene locus_tag LOCUS_00240 24332 23709 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027547672.1 protein_id gnl|my_center|LOCUS_00240 26594 24378 gene locus_tag LOCUS_00250 26594 24378 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389593.1 protein_id gnl|my_center|LOCUS_00250 27713 26916 gene locus_tag LOCUS_00260 27713 26916 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103688.1 protein_id gnl|my_center|LOCUS_00260 29166 27727 gene locus_tag LOCUS_00270 29166 27727 CDS product coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529049.1 protein_id gnl|my_center|LOCUS_00270 31647 29305 gene locus_tag LOCUS_00280 31647 29305 CDS product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115638.1 protein_id gnl|my_center|LOCUS_00280 32849 31677 gene locus_tag LOCUS_00290 32849 31677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 34287 32920 gene locus_tag LOCUS_00300 34287 32920 CDS product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103009.1 protein_id gnl|my_center|LOCUS_00300 36171 34315 gene locus_tag LOCUS_00310 36171 34315 CDS product DUF1302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103441.1 protein_id gnl|my_center|LOCUS_00310 37206 36547 gene locus_tag LOCUS_00320 37206 36547 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966869.1 protein_id gnl|my_center|LOCUS_00320 39399 37264 gene locus_tag LOCUS_00330 39399 37264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 40371 39484 gene locus_tag LOCUS_00340 40371 39484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 41615 40446 gene locus_tag LOCUS_00350 41615 40446 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532735.1 protein_id gnl|my_center|LOCUS_00350 42251 41670 gene locus_tag LOCUS_00360 gene cysC 42251 41670 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043054.1 protein_id gnl|my_center|LOCUS_00360 43375 42245 gene locus_tag LOCUS_00370 43375 42245 CDS product TIGR03032 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141839.1 protein_id gnl|my_center|LOCUS_00370 50844 43453 gene locus_tag LOCUS_00380 50844 43453 CDS product ESPR-type extended signal peptide-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035898.1 protein_id gnl|my_center|LOCUS_00380 51461 50853 gene locus_tag LOCUS_00390 51461 50853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 52218 51535 gene locus_tag LOCUS_00400 52218 51535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 53142 52258 gene locus_tag LOCUS_00410 53142 52258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 53620 53135 gene locus_tag LOCUS_00420 53620 53135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 54486 53617 gene locus_tag LOCUS_00430 54486 53617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 55740 54490 gene locus_tag LOCUS_00440 55740 54490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 57443 55743 gene locus_tag LOCUS_00450 57443 55743 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460289.1 protein_id gnl|my_center|LOCUS_00450 58346 57456 gene locus_tag LOCUS_00460 58346 57456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 60041 58353 gene locus_tag LOCUS_00470 60041 58353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 60118 60588 gene locus_tag LOCUS_00480 60118 60588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 60601 61887 gene locus_tag LOCUS_00490 60601 61887 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086798.1 protein_id gnl|my_center|LOCUS_00490 61862 62026 gene locus_tag LOCUS_00500 61862 62026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 62788 62039 gene locus_tag LOCUS_00510 62788 62039 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390180.1 protein_id gnl|my_center|LOCUS_00510 63173 62781 gene locus_tag LOCUS_00520 63173 62781 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122011.1 protein_id gnl|my_center|LOCUS_00520 63262 63930 gene locus_tag LOCUS_00530 63262 63930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 65764 63995 gene locus_tag LOCUS_00540 65764 63995 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199468.1 protein_id gnl|my_center|LOCUS_00540 67011 66010 gene locus_tag LOCUS_00550 67011 66010 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082450.1 protein_id gnl|my_center|LOCUS_00550 69641 67296 gene locus_tag LOCUS_00560 69641 67296 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421594.1 protein_id gnl|my_center|LOCUS_00560 71800 69656 gene locus_tag LOCUS_00570 71800 69656 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100703.1 protein_id gnl|my_center|LOCUS_00570 73027 71822 gene locus_tag LOCUS_00580 73027 71822 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087747.1 protein_id gnl|my_center|LOCUS_00580 73600 73175 gene locus_tag LOCUS_00590 73600 73175 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010015189.1 protein_id gnl|my_center|LOCUS_00590 73603 73758 gene locus_tag LOCUS_00600 73603 73758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 73861 74517 gene locus_tag LOCUS_00610 73861 74517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 74575 75828 gene locus_tag LOCUS_00620 74575 75828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 75943 77148 gene locus_tag LOCUS_00630 75943 77148 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207506.1 protein_id gnl|my_center|LOCUS_00630 77863 77162 gene locus_tag LOCUS_00640 77863 77162 CDS product DUF599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106486.1 protein_id gnl|my_center|LOCUS_00640 81157 77879 gene locus_tag LOCUS_00650 81157 77879 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704913.1 protein_id gnl|my_center|LOCUS_00650 85213 81170 gene locus_tag LOCUS_00660 85213 81170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 86940 85210 gene locus_tag LOCUS_00670 86940 85210 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204930.1 protein_id gnl|my_center|LOCUS_00670 87360 90599 gene locus_tag LOCUS_00680 87360 90599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 90716 91543 gene locus_tag LOCUS_00690 90716 91543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 92692 91619 gene locus_tag LOCUS_00700 92692 91619 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086459.1 protein_id gnl|my_center|LOCUS_00700 93907 92705 gene locus_tag LOCUS_00710 93907 92705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 94087 94731 gene locus_tag LOCUS_00720 94087 94731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 94858 95601 gene locus_tag LOCUS_00730 94858 95601 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193573.1 protein_id gnl|my_center|LOCUS_00730 95656 96924 gene locus_tag LOCUS_00740 gene hemA 95656 96924 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807616.1 protein_id gnl|my_center|LOCUS_00740 96925 98007 gene locus_tag LOCUS_00750 gene prfA 96925 98007 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222130.1 protein_id gnl|my_center|LOCUS_00750 98004 98927 gene locus_tag LOCUS_00760 gene prmC 98004 98927 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002230051.1 protein_id gnl|my_center|LOCUS_00760 98940 99284 gene locus_tag LOCUS_00770 gene grxD 98940 99284 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807622.1 protein_id gnl|my_center|LOCUS_00770 99338 99940 gene locus_tag LOCUS_00780 99338 99940 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521981.1 protein_id gnl|my_center|LOCUS_00780 100807 99941 gene locus_tag LOCUS_00790 100807 99941 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812386.1 protein_id gnl|my_center|LOCUS_00790 101516 101441 gene locus_tag LOCUS_t00020 101516 101441 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 102100 101531 gene locus_tag LOCUS_00800 102100 101531 CDS product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527881.1 protein_id gnl|my_center|LOCUS_00800 102641 102111 gene locus_tag LOCUS_00810 102641 102111 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185176.1 protein_id gnl|my_center|LOCUS_00810 103544 102789 gene locus_tag LOCUS_00820 103544 102789 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521940.1 protein_id gnl|my_center|LOCUS_00820 104839 103574 gene locus_tag LOCUS_00830 104839 103574 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815816.1 protein_id gnl|my_center|LOCUS_00830 105470 104865 gene locus_tag LOCUS_00840 gene petA 105470 104865 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064798.1 protein_id gnl|my_center|LOCUS_00840 106245 105616 gene locus_tag LOCUS_00850 106245 105616 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706625.1 protein_id gnl|my_center|LOCUS_00850 106401 107555 gene locus_tag LOCUS_00860 106401 107555 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521939.1 protein_id gnl|my_center|LOCUS_00860 108316 107579 gene locus_tag LOCUS_00870 gene tatC 108316 107579 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815810.1 protein_id gnl|my_center|LOCUS_00870 108757 108332 gene locus_tag LOCUS_00880 gene tatB 108757 108332 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014906112.1 protein_id gnl|my_center|LOCUS_00880 109018 108782 gene locus_tag LOCUS_00890 gene tatA 109018 108782 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815808.1 protein_id gnl|my_center|LOCUS_00890 109411 109055 gene locus_tag LOCUS_00900 109411 109055 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085225.1 protein_id gnl|my_center|LOCUS_00900 109743 109408 gene locus_tag LOCUS_00910 109743 109408 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202813.1 protein_id gnl|my_center|LOCUS_00910 110182 109757 gene locus_tag LOCUS_00920 gene hisI 110182 109757 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403068.1 protein_id gnl|my_center|LOCUS_00920 110959 110195 gene locus_tag LOCUS_00930 gene hisF 110959 110195 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550994.1 protein_id gnl|my_center|LOCUS_00930 111708 110959 gene locus_tag LOCUS_00940 gene hisA 111708 110959 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927224.1 protein_id gnl|my_center|LOCUS_00940 112394 111762 gene locus_tag LOCUS_00950 gene hisH 112394 111762 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199907.1 protein_id gnl|my_center|LOCUS_00950 112978 112391 gene locus_tag LOCUS_00960 gene hisB 112978 112391 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096088.1 protein_id gnl|my_center|LOCUS_00960 114093 112993 gene locus_tag LOCUS_00970 gene hisC 114093 112993 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199913.1 protein_id gnl|my_center|LOCUS_00970 115423 114101 gene locus_tag LOCUS_00980 gene hisD 115423 114101 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931641.1 protein_id gnl|my_center|LOCUS_00980 116097 115444 gene locus_tag LOCUS_00990 gene hisG 116097 115444 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199915.1 protein_id gnl|my_center|LOCUS_00990 117350 116094 gene locus_tag LOCUS_01000 gene murA 117350 116094 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927222.1 protein_id gnl|my_center|LOCUS_01000 117608 117366 gene locus_tag LOCUS_01010 117608 117366 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815785.1 protein_id gnl|my_center|LOCUS_01010 118397 117642 gene locus_tag LOCUS_01020 118397 117642 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199919.1 protein_id gnl|my_center|LOCUS_01020 119302 118394 gene locus_tag LOCUS_01030 119302 118394 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521934.1 protein_id gnl|my_center|LOCUS_01030 119588 119337 gene locus_tag LOCUS_01040 119588 119337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 120213 119590 gene locus_tag LOCUS_01050 120213 119590 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199924.1 protein_id gnl|my_center|LOCUS_01050 121170 120286 gene locus_tag LOCUS_01060 121170 120286 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114777.1 protein_id gnl|my_center|LOCUS_01060 121659 121186 gene locus_tag LOCUS_01070 gene mlaD 121659 121186 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199927.1 protein_id gnl|my_center|LOCUS_01070 122457 121672 gene locus_tag LOCUS_01080 gene mlaE 122457 121672 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815775.1 protein_id gnl|my_center|LOCUS_01080 123242 122454 gene locus_tag LOCUS_01090 123242 122454 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199931.1 protein_id gnl|my_center|LOCUS_01090 123446 125350 gene locus_tag LOCUS_01100 123446 125350 CDS product type II and III secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387870.1 protein_id gnl|my_center|LOCUS_01100 125347 126345 gene locus_tag LOCUS_01110 125347 126345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 126329 127372 gene locus_tag LOCUS_01120 126329 127372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 127384 128229 gene locus_tag LOCUS_01130 127384 128229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 128202 128771 gene locus_tag LOCUS_01140 128202 128771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 128768 129883 gene locus_tag LOCUS_01150 128768 129883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 129880 130629 gene locus_tag LOCUS_01160 129880 130629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 130673 131275 gene locus_tag LOCUS_01170 130673 131275 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387873.1 protein_id gnl|my_center|LOCUS_01170 133284 131284 gene locus_tag LOCUS_01180 133284 131284 CDS product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195204.1 protein_id gnl|my_center|LOCUS_01180 133391 134383 gene locus_tag LOCUS_01190 133391 134383 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195206.1 protein_id gnl|my_center|LOCUS_01190 134383 134922 gene locus_tag LOCUS_01200 134383 134922 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815172.1 protein_id gnl|my_center|LOCUS_01200 134919 135506 gene locus_tag LOCUS_01210 134919 135506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 135503 136045 gene locus_tag LOCUS_01220 135503 136045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 136042 136797 gene locus_tag LOCUS_01230 gene lptB 136042 136797 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815177.1 protein_id gnl|my_center|LOCUS_01230 136810 138330 gene locus_tag LOCUS_01240 136810 138330 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195216.1 protein_id gnl|my_center|LOCUS_01240 138371 138700 gene locus_tag LOCUS_01250 gene raiA 138371 138700 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815178.1 protein_id gnl|my_center|LOCUS_01250 138811 139281 gene locus_tag LOCUS_01260 gene ptsN 138811 139281 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534308.1 protein_id gnl|my_center|LOCUS_01260 139286 140269 gene locus_tag LOCUS_01270 gene hprK 139286 140269 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929965.1 protein_id gnl|my_center|LOCUS_01270 140262 141131 gene locus_tag LOCUS_01280 gene rapZ 140262 141131 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815183.1 protein_id gnl|my_center|LOCUS_01280 142205 141084 gene locus_tag LOCUS_01290 gene mutY 142205 141084 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064920.1 protein_id gnl|my_center|LOCUS_01290 143020 142202 gene locus_tag LOCUS_01300 gene mutM 143020 142202 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522858.1 protein_id gnl|my_center|LOCUS_01300 143100 144878 gene locus_tag LOCUS_01310 143100 144878 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195237.1 protein_id gnl|my_center|LOCUS_01310 144883 145452 gene locus_tag LOCUS_01320 144883 145452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 145456 146373 gene locus_tag LOCUS_01330 gene ispE 145456 146373 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266731.1 protein_id gnl|my_center|LOCUS_01330 146390 146466 gene locus_tag LOCUS_t00030 146390 146466 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 146540 147493 gene locus_tag LOCUS_01340 146540 147493 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195243.1 protein_id gnl|my_center|LOCUS_01340 147595 148182 gene locus_tag LOCUS_01350 147595 148182 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200150.1 protein_id gnl|my_center|LOCUS_01350 148289 148921 gene locus_tag LOCUS_01360 148289 148921 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330704.1 protein_id gnl|my_center|LOCUS_01360 149412 148933 gene locus_tag LOCUS_01370 149412 148933 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304871.1 protein_id gnl|my_center|LOCUS_01370 149541 151211 gene locus_tag LOCUS_01380 gene leuA 149541 151211 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114718.1 protein_id gnl|my_center|LOCUS_01380 151304 151987 gene locus_tag LOCUS_01390 151304 151987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 151984 152577 gene locus_tag LOCUS_01400 gene pth 151984 152577 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931308.1 protein_id gnl|my_center|LOCUS_01400 152574 153686 gene locus_tag LOCUS_01410 152574 153686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113385.1 protein_id gnl|my_center|LOCUS_01410 153733 154824 gene locus_tag LOCUS_01420 gene ychF 153733 154824 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186874.1 protein_id gnl|my_center|LOCUS_01420 155487 154858 gene locus_tag LOCUS_01430 155487 154858 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388625.1 protein_id gnl|my_center|LOCUS_01430 156324 155503 gene locus_tag LOCUS_01440 156324 155503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 157001 156342 gene locus_tag LOCUS_01450 157001 156342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 157564 156998 gene locus_tag LOCUS_01460 157564 156998 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965738.1 protein_id gnl|my_center|LOCUS_01460 160599 157660 gene locus_tag LOCUS_01470 160599 157660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 160955 160596 gene locus_tag LOCUS_01480 160955 160596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 161086 161319 gene locus_tag LOCUS_01490 161086 161319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 162018 161539 gene locus_tag LOCUS_01500 162018 161539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 163774 162215 gene locus_tag LOCUS_01510 163774 162215 CDS product DUF4384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388628.1 protein_id gnl|my_center|LOCUS_01510 164101 163781 gene locus_tag LOCUS_01520 164101 163781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 164464 164162 gene locus_tag LOCUS_01530 164464 164162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 165430 164531 gene locus_tag LOCUS_01540 165430 164531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 165568 166842 gene locus_tag LOCUS_01550 165568 166842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 167096 166779 gene locus_tag LOCUS_01560 167096 166779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 167609 167106 gene locus_tag LOCUS_01570 gene coaD 167609 167106 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195249.1 protein_id gnl|my_center|LOCUS_01570 168232 167669 gene locus_tag LOCUS_01580 gene rsmD 168232 167669 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522861.1 protein_id gnl|my_center|LOCUS_01580 169634 168267 gene locus_tag LOCUS_01590 169634 168267 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763632.1 protein_id gnl|my_center|LOCUS_01590 171068 169656 gene locus_tag LOCUS_01600 171068 169656 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948371.1 protein_id gnl|my_center|LOCUS_01600 171185 172126 gene locus_tag LOCUS_01610 171185 172126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 172123 172857 gene locus_tag LOCUS_01620 gene ftsE 172123 172857 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617864.1 protein_id gnl|my_center|LOCUS_01620 172879 173787 gene locus_tag LOCUS_01630 172879 173787 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927126.1 protein_id gnl|my_center|LOCUS_01630 174750 173803 gene locus_tag LOCUS_01640 gene rfbD 174750 173803 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186608.1 protein_id gnl|my_center|LOCUS_01640 176483 175455 gene locus_tag LOCUS_01650 gene rfbB 176483 175455 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096179.1 protein_id gnl|my_center|LOCUS_01650 176618 177016 gene locus_tag LOCUS_01660 176618 177016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 177116 177496 gene locus_tag LOCUS_01670 177116 177496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 178017 177478 gene locus_tag LOCUS_01680 gene rfaH 178017 177478 CDS product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957829.1 protein_id gnl|my_center|LOCUS_01680 178136 180268 gene locus_tag LOCUS_01690 178136 180268 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103628.1 protein_id gnl|my_center|LOCUS_01690 180820 180269 gene locus_tag LOCUS_01700 gene rfbC 180820 180269 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706041.1 protein_id gnl|my_center|LOCUS_01700 180847 181251 gene locus_tag LOCUS_01710 180847 181251 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693848.1 protein_id gnl|my_center|LOCUS_01710 181651 181532 gene locus_tag LOCUS_01720 181651 181532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 181706 182875 gene locus_tag LOCUS_01730 181706 182875 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402650.1 protein_id gnl|my_center|LOCUS_01730 183196 182858 gene locus_tag LOCUS_01740 183196 182858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 184028 183168 gene locus_tag LOCUS_01750 184028 183168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 184208 185941 gene locus_tag LOCUS_01760 184208 185941 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173235.1 protein_id gnl|my_center|LOCUS_01760 186533 186132 gene locus_tag LOCUS_01770 186533 186132 CDS product HI0074 family nucleotidyltransferase substrate-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118912.1 protein_id gnl|my_center|LOCUS_01770 186837 186571 gene locus_tag LOCUS_01780 186837 186571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 188162 187002 gene locus_tag LOCUS_01790 188162 187002 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_01790 188315 188767 gene locus_tag LOCUS_01800 188315 188767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 188764 189930 gene locus_tag LOCUS_01810 gene ugd 188764 189930 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097850.1 protein_id gnl|my_center|LOCUS_01810 189930 190808 gene locus_tag LOCUS_01820 gene rfbA 189930 190808 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073074.1 protein_id gnl|my_center|LOCUS_01820 191357 191839 gene locus_tag LOCUS_01830 191357 191839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 191836 192498 gene locus_tag LOCUS_01840 191836 192498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 192495 193184 gene locus_tag LOCUS_01850 192495 193184 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407623.1 protein_id gnl|my_center|LOCUS_01850 193184 194314 gene locus_tag LOCUS_01860 gene rffA 193184 194314 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099273.1 protein_id gnl|my_center|LOCUS_01860 194311 195000 gene locus_tag LOCUS_01870 194311 195000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 194997 196439 gene locus_tag LOCUS_01880 gene wzxC 194997 196439 CDS product colanic acid undecaprenyl disphosphate flippase WzxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058442.1 protein_id gnl|my_center|LOCUS_01880 196604 196840 gene locus_tag LOCUS_01890 196604 196840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 197039 198013 gene locus_tag LOCUS_01900 197039 198013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 198010 199197 gene locus_tag LOCUS_01910 198010 199197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288206.1 protein_id gnl|my_center|LOCUS_01910 199417 199187 gene locus_tag LOCUS_01920 199417 199187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 199963 199751 gene locus_tag LOCUS_01930 199963 199751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 200483 201520 gene locus_tag LOCUS_01940 200483 201520 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261047.1 protein_id gnl|my_center|LOCUS_01940 201526 202659 gene locus_tag LOCUS_01950 201526 202659 CDS product capsular polysaccharide biosynthesis protein CapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024126.1 protein_id gnl|my_center|LOCUS_01950 202664 203800 gene locus_tag LOCUS_01960 gene wecB 202664 203800 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261049.1 protein_id gnl|my_center|LOCUS_01960 203797 204999 gene locus_tag LOCUS_01970 203797 204999 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686571.1 protein_id gnl|my_center|LOCUS_01970 207823 204980 gene locus_tag LOCUS_01980 207823 204980 CDS product YjbH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205406.1 protein_id gnl|my_center|LOCUS_01980 208416 207820 gene locus_tag LOCUS_01990 208416 207820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 208845 208666 gene locus_tag LOCUS_02000 208845 208666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 210221 209013 gene locus_tag LOCUS_02010 210221 209013 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529927.1 protein_id gnl|my_center|LOCUS_02010 212633 210234 gene locus_tag LOCUS_02020 212633 210234 CDS product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009956704.1 protein_id gnl|my_center|LOCUS_02020 213721 212711 gene locus_tag LOCUS_02030 213721 212711 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880302.1 protein_id gnl|my_center|LOCUS_02030 215323 214193 gene locus_tag LOCUS_02040 215323 214193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 217781 215391 gene locus_tag LOCUS_02050 217781 215391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 218427 217894 gene locus_tag LOCUS_02060 218427 217894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02060 220158 218971 gene locus_tag LOCUS_02070 220158 218971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 220567 220151 gene locus_tag LOCUS_02080 220567 220151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 220790 221272 gene locus_tag LOCUS_02090 220790 221272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 221416 221940 gene locus_tag LOCUS_02100 221416 221940 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234782294.1 protein_id gnl|my_center|LOCUS_02100 223136 221952 gene locus_tag LOCUS_02110 223136 221952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 223546 223133 gene locus_tag LOCUS_02120 223546 223133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 223828 224760 gene locus_tag LOCUS_02130 223828 224760 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003029668.1 protein_id gnl|my_center|LOCUS_02130 224745 225632 gene locus_tag LOCUS_02140 gene rfbA 224745 225632 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202440.1 protein_id gnl|my_center|LOCUS_02140 226559 225618 gene locus_tag LOCUS_02150 226559 225618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963974.1 protein_id gnl|my_center|LOCUS_02150 227476 226559 gene locus_tag LOCUS_02160 227476 226559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096015.1 protein_id gnl|my_center|LOCUS_02160 228156 227473 gene locus_tag LOCUS_02170 228156 227473 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407619.1 protein_id gnl|my_center|LOCUS_02170 229061 228159 gene locus_tag LOCUS_02180 229061 228159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 230325 229066 gene locus_tag LOCUS_02190 gene wzxE 230325 229066 CDS product lipid III flippase WzxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176202.1 protein_id gnl|my_center|LOCUS_02190 231440 230340 gene locus_tag LOCUS_02200 231440 230340 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057184.1 protein_id gnl|my_center|LOCUS_02200 231844 231437 gene locus_tag LOCUS_02210 231844 231437 CDS product FdtA/QdtA family cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057183.1 protein_id gnl|my_center|LOCUS_02210 233744 231831 gene locus_tag LOCUS_02220 233744 231831 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404223.1 protein_id gnl|my_center|LOCUS_02220 234919 233741 gene locus_tag LOCUS_02230 234919 233741 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222986.1 protein_id gnl|my_center|LOCUS_02230 235560 234922 gene locus_tag LOCUS_02240 gene perB 235560 234922 CDS product GDP-perosamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055391.1 protein_id gnl|my_center|LOCUS_02240 236158 235562 gene locus_tag LOCUS_02250 236158 235562 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462478.1 protein_id gnl|my_center|LOCUS_02250 237288 236155 gene locus_tag LOCUS_02260 237288 236155 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010147499.1 protein_id gnl|my_center|LOCUS_02260 238156 237278 gene locus_tag LOCUS_02270 238156 237278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 239131 238157 gene locus_tag LOCUS_02280 239131 238157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 240453 239371 gene locus_tag LOCUS_02290 240453 239371 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419507.1 protein_id gnl|my_center|LOCUS_02290 242522 240519 gene locus_tag LOCUS_02300 242522 240519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 242763 244757 gene locus_tag LOCUS_02310 242763 244757 CDS product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097695.1 protein_id gnl|my_center|LOCUS_02310 244892 245404 gene locus_tag LOCUS_02320 244892 245404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 245406 245762 gene locus_tag LOCUS_02330 gene erpA 245406 245762 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087527.1 protein_id gnl|my_center|LOCUS_02330 245822 246292 gene locus_tag LOCUS_02340 245822 246292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 246293 247015 gene locus_tag LOCUS_02350 246293 247015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 247301 247002 gene locus_tag LOCUS_02360 247301 247002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 247346 247651 gene locus_tag LOCUS_02370 247346 247651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 247596 248066 gene locus_tag LOCUS_02380 gene vapC 247596 248066 CDS product tRNA(fMet)-specific endonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770950.1 protein_id gnl|my_center|LOCUS_02380 248354 248118 gene locus_tag LOCUS_02390 248354 248118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 253204 248357 gene locus_tag LOCUS_02400 253204 248357 CDS product RHS repeat-associated core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105498.1 protein_id gnl|my_center|LOCUS_02400 253607 253326 gene locus_tag LOCUS_02410 253607 253326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 255019 253631 gene locus_tag LOCUS_02420 255019 253631 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940551.1 protein_id gnl|my_center|LOCUS_02420 256671 255016 gene locus_tag LOCUS_02430 256671 255016 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101357.1 protein_id gnl|my_center|LOCUS_02430 256832 257077 gene locus_tag LOCUS_02440 256832 257077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 257077 257424 gene locus_tag LOCUS_02450 257077 257424 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217440.1 protein_id gnl|my_center|LOCUS_02450 258999 257446 gene locus_tag LOCUS_02460 258999 257446 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110579.1 protein_id gnl|my_center|LOCUS_02460 259164 259592 gene locus_tag LOCUS_02470 259164 259592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 259583 260650 gene locus_tag LOCUS_02480 259583 260650 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550696.1 protein_id gnl|my_center|LOCUS_02480 261482 260628 gene locus_tag LOCUS_02490 261482 260628 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906792.1 protein_id gnl|my_center|LOCUS_02490 261708 262814 gene locus_tag LOCUS_02500 261708 262814 CDS product YVTN family beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975090.1 protein_id gnl|my_center|LOCUS_02500 262811 263266 gene locus_tag LOCUS_02510 262811 263266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 263439 263927 gene locus_tag LOCUS_02520 263439 263927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 264108 263986 gene locus_tag LOCUS_02530 264108 263986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 264807 264151 gene locus_tag LOCUS_02540 264807 264151 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088037.1 protein_id gnl|my_center|LOCUS_02540 266147 264804 gene locus_tag LOCUS_02550 266147 264804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 266819 266157 gene locus_tag LOCUS_02560 266819 266157 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122041.1 protein_id gnl|my_center|LOCUS_02560 266931 267329 gene locus_tag LOCUS_02570 266931 267329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 267336 268583 gene locus_tag LOCUS_02580 267336 268583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 268655 269581 gene locus_tag LOCUS_02590 gene rpoH 268655 269581 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815756.1 protein_id gnl|my_center|LOCUS_02590 269649 270332 gene locus_tag LOCUS_02600 269649 270332 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920683.1 protein_id gnl|my_center|LOCUS_02600 270338 271054 gene locus_tag LOCUS_02610 270338 271054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 271174 271809 gene locus_tag LOCUS_02620 271174 271809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 272340 271810 gene locus_tag LOCUS_02630 272340 271810 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197988.1 protein_id gnl|my_center|LOCUS_02630 273341 272427 gene locus_tag LOCUS_02640 gene cyoE 273341 272427 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522902.1 protein_id gnl|my_center|LOCUS_02640 274358 273351 gene locus_tag LOCUS_02650 274358 273351 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931623.1 protein_id gnl|my_center|LOCUS_02650 274979 274374 gene locus_tag LOCUS_02660 274979 274374 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931624.1 protein_id gnl|my_center|LOCUS_02660 275791 274976 gene locus_tag LOCUS_02670 275791 274976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119510.1 protein_id gnl|my_center|LOCUS_02670 275845 276045 gene locus_tag LOCUS_02680 275845 276045 CDS product twin transmembrane helix small protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815736.1 protein_id gnl|my_center|LOCUS_02680 276986 276132 gene locus_tag LOCUS_02690 276986 276132 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815738.1 protein_id gnl|my_center|LOCUS_02690 277280 277050 gene locus_tag LOCUS_02700 277280 277050 CDS product DUF2970 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815740.1 protein_id gnl|my_center|LOCUS_02700 277846 277280 gene locus_tag LOCUS_02710 277846 277280 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185071.1 protein_id gnl|my_center|LOCUS_02710 278016 277879 gene locus_tag LOCUS_02720 278016 277879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 279734 278130 gene locus_tag LOCUS_02730 gene ctaD 279734 278130 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931626.1 protein_id gnl|my_center|LOCUS_02730 280932 279757 gene locus_tag LOCUS_02740 gene coxB 280932 279757 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029443774.1 protein_id gnl|my_center|LOCUS_02740 281377 280982 gene locus_tag LOCUS_02750 281377 280982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 282510 281677 gene locus_tag LOCUS_02760 282510 281677 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049788683.1 protein_id gnl|my_center|LOCUS_02760 282893 283375 gene locus_tag LOCUS_02770 282893 283375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 283372 283842 gene locus_tag LOCUS_02780 gene trmL 283372 283842 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522909.1 protein_id gnl|my_center|LOCUS_02780 285489 284476 gene locus_tag LOCUS_02790 285489 284476 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536061.1 protein_id gnl|my_center|LOCUS_02790 285981 285502 gene locus_tag LOCUS_02800 gene secB 285981 285502 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807422.1 protein_id gnl|my_center|LOCUS_02800 286300 286025 gene locus_tag LOCUS_02810 gene grxC 286300 286025 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200200.1 protein_id gnl|my_center|LOCUS_02810 286825 286343 gene locus_tag LOCUS_02820 286825 286343 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958278.1 protein_id gnl|my_center|LOCUS_02820 286931 287677 gene locus_tag LOCUS_02830 gene gpmA 286931 287677 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807430.1 protein_id gnl|my_center|LOCUS_02830 287684 288967 gene locus_tag LOCUS_02840 287684 288967 CDS product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123645.1 protein_id gnl|my_center|LOCUS_02840 288973 290358 gene locus_tag LOCUS_02850 gene cptA 288973 290358 CDS product protease CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446625.1 protein_id gnl|my_center|LOCUS_02850 290382 291143 gene locus_tag LOCUS_02860 gene moeB 290382 291143 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038762.1 protein_id gnl|my_center|LOCUS_02860 291832 291140 gene locus_tag LOCUS_02870 291832 291140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 291838 292308 gene locus_tag LOCUS_02880 291838 292308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 292305 293078 gene locus_tag LOCUS_02890 292305 293078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 293491 293075 gene locus_tag LOCUS_02900 293491 293075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 293891 294340 gene locus_tag LOCUS_02910 gene gspG 293891 294340 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196811.1 protein_id gnl|my_center|LOCUS_02910 294312 294821 gene locus_tag LOCUS_02920 294312 294821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 294818 295192 gene locus_tag LOCUS_02930 294818 295192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 295189 295878 gene locus_tag LOCUS_02940 295189 295878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 295878 296828 gene locus_tag LOCUS_02950 gene gspK 295878 296828 CDS product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112726.1 protein_id gnl|my_center|LOCUS_02950 296829 298082 gene locus_tag LOCUS_02960 296829 298082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 298079 298606 gene locus_tag LOCUS_02970 298079 298606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 298603 299334 gene locus_tag LOCUS_02980 298603 299334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 299334 301757 gene locus_tag LOCUS_02990 gene gspD 299334 301757 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009315212.1 protein_id gnl|my_center|LOCUS_02990 301754 303217 gene locus_tag LOCUS_03000 gene gspE 301754 303217 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533498.1 protein_id gnl|my_center|LOCUS_03000 303224 304438 gene locus_tag LOCUS_03010 gene gspF 303224 304438 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196821.1 protein_id gnl|my_center|LOCUS_03010 304435 305148 gene locus_tag LOCUS_03020 304435 305148 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063801.1 protein_id gnl|my_center|LOCUS_03020 305153 307066 gene locus_tag LOCUS_03030 305153 307066 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811551.1 protein_id gnl|my_center|LOCUS_03030 307063 307776 gene locus_tag LOCUS_03040 307063 307776 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063801.1 protein_id gnl|my_center|LOCUS_03040 307773 309680 gene locus_tag LOCUS_03050 307773 309680 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039896.1 protein_id gnl|my_center|LOCUS_03050 310655 309711 gene locus_tag LOCUS_03060 310655 309711 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038737.1 protein_id gnl|my_center|LOCUS_03060 312703 310652 gene locus_tag LOCUS_03070 312703 310652 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204428.1 protein_id gnl|my_center|LOCUS_03070 313517 312720 gene locus_tag LOCUS_03080 313517 312720 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039999.1 protein_id gnl|my_center|LOCUS_03080 315174 313564 gene locus_tag LOCUS_03090 315174 313564 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201021.1 protein_id gnl|my_center|LOCUS_03090 315785 315177 gene locus_tag LOCUS_03100 315785 315177 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115035.1 protein_id gnl|my_center|LOCUS_03100 316559 315867 gene locus_tag LOCUS_03110 316559 315867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 316703 317086 gene locus_tag LOCUS_03120 316703 317086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 318651 317140 gene locus_tag LOCUS_03130 318651 317140 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207742.1 protein_id gnl|my_center|LOCUS_03130 318784 319509 gene locus_tag LOCUS_03140 318784 319509 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994509.1 protein_id gnl|my_center|LOCUS_03140 321819 319990 gene locus_tag LOCUS_03150 gene aceK 321819 319990 CDS product bifunctional isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040776.1 protein_id gnl|my_center|LOCUS_03150 321919 323163 gene locus_tag LOCUS_03160 321919 323163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 324349 323168 gene locus_tag LOCUS_03170 324349 323168 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815950.1 protein_id gnl|my_center|LOCUS_03170 324445 325467 gene locus_tag LOCUS_03180 324445 325467 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815946.1 protein_id gnl|my_center|LOCUS_03180 325546 326514 gene locus_tag LOCUS_03190 325546 326514 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193905664.1 protein_id gnl|my_center|LOCUS_03190 326567 326992 gene locus_tag LOCUS_03200 gene dksA 326567 326992 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807164.1 protein_id gnl|my_center|LOCUS_03200 327831 328679 gene locus_tag LOCUS_03210 327831 328679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 329750 328743 gene locus_tag LOCUS_03220 gene rsmI 329750 328743 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929780.1 protein_id gnl|my_center|LOCUS_03220 329668 330171 gene locus_tag LOCUS_03230 329668 330171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 330263 330865 gene locus_tag LOCUS_03240 330263 330865 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418801.1 protein_id gnl|my_center|LOCUS_03240 330855 331526 gene locus_tag LOCUS_03250 330855 331526 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196853.1 protein_id gnl|my_center|LOCUS_03250 331531 332022 gene locus_tag LOCUS_03260 331531 332022 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815191.1 protein_id gnl|my_center|LOCUS_03260 332504 332049 gene locus_tag LOCUS_03270 332504 332049 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194347.1 protein_id gnl|my_center|LOCUS_03270 332594 333703 gene locus_tag LOCUS_03280 gene dmlA 332594 333703 CDS product multifunctional D-malate/3-isopropylmalate/tartarate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978495.1 protein_id gnl|my_center|LOCUS_03280 334366 333722 gene locus_tag LOCUS_03290 334366 333722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 335841 334450 gene locus_tag LOCUS_03300 335841 334450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 338512 335846 gene locus_tag LOCUS_03310 gene tssH 338512 335846 CDS product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115056.1 protein_id gnl|my_center|LOCUS_03310 339525 338509 gene locus_tag LOCUS_03320 gene tssG 339525 338509 CDS product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104969.1 protein_id gnl|my_center|LOCUS_03320 341384 339540 gene locus_tag LOCUS_03330 gene tssF 341384 339540 CDS product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115055.1 protein_id gnl|my_center|LOCUS_03330 341908 341405 gene locus_tag LOCUS_03340 gene tssE 341908 341405 CDS product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096188.1 protein_id gnl|my_center|LOCUS_03340 342383 341901 gene locus_tag LOCUS_03350 gene hcp 342383 341901 CDS product type VI secretion system receptor/chaperone Hcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083670.1 protein_id gnl|my_center|LOCUS_03350 342886 342404 gene locus_tag LOCUS_03360 gene hcp 342886 342404 CDS product type VI secretion system receptor/chaperone Hcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083670.1 protein_id gnl|my_center|LOCUS_03360 344416 342926 gene locus_tag LOCUS_03370 gene tssC 344416 342926 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111626.1 protein_id gnl|my_center|LOCUS_03370 344907 344419 gene locus_tag LOCUS_03380 gene tssB 344907 344419 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083666.1 protein_id gnl|my_center|LOCUS_03380 346026 344953 gene locus_tag LOCUS_03390 gene tssA 346026 344953 CDS product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665703.1 protein_id gnl|my_center|LOCUS_03390 347457 346096 gene locus_tag LOCUS_03400 gene gor 347457 346096 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388440.1 protein_id gnl|my_center|LOCUS_03400 350150 348003 gene locus_tag LOCUS_03410 350150 348003 CDS product bifunctional TVP38/TMEM64 family protein/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705444.1 protein_id gnl|my_center|LOCUS_03410 350308 351123 gene locus_tag LOCUS_03420 350308 351123 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268115.1 protein_id gnl|my_center|LOCUS_03420 351729 351139 gene locus_tag LOCUS_03430 351729 351139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 352724 351792 gene locus_tag LOCUS_03440 352724 351792 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705598.1 protein_id gnl|my_center|LOCUS_03440 354011 352821 gene locus_tag LOCUS_03450 gene egtB 354011 352821 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339021.1 protein_id gnl|my_center|LOCUS_03450 354095 355030 gene locus_tag LOCUS_03460 gene oxyR 354095 355030 CDS product LysR family transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117503.1 protein_id gnl|my_center|LOCUS_03460 355124 355831 gene locus_tag LOCUS_03470 355124 355831 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877731.1 protein_id gnl|my_center|LOCUS_03470 355857 356438 gene locus_tag LOCUS_03480 355857 356438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207867.1 protein_id gnl|my_center|LOCUS_03480 356479 357066 gene locus_tag LOCUS_03490 356479 357066 CDS product NnrU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396060.1 protein_id gnl|my_center|LOCUS_03490 358423 357071 gene locus_tag LOCUS_03500 358423 357071 CDS product putative Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929970.1 protein_id gnl|my_center|LOCUS_03500 358546 360729 gene locus_tag LOCUS_03510 358546 360729 CDS product TonB-dependent receptor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918028.1 protein_id gnl|my_center|LOCUS_03510 361518 360976 gene locus_tag LOCUS_03520 361518 360976 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198315.1 protein_id gnl|my_center|LOCUS_03520 362774 361515 gene locus_tag LOCUS_03530 362774 361515 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198314.1 protein_id gnl|my_center|LOCUS_03530 362974 365034 gene locus_tag LOCUS_03540 362974 365034 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265970.1 protein_id gnl|my_center|LOCUS_03540 366760 365279 gene locus_tag LOCUS_03550 366760 365279 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963892.1 protein_id gnl|my_center|LOCUS_03550 366877 368793 gene locus_tag LOCUS_03560 366877 368793 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035993.1 protein_id gnl|my_center|LOCUS_03560 369821 368802 gene locus_tag LOCUS_03570 369821 368802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 369934 370956 gene locus_tag LOCUS_03580 369934 370956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 372099 370975 gene locus_tag LOCUS_03590 372099 370975 CDS product lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483054.1 protein_id gnl|my_center|LOCUS_03590 373151 372777 gene locus_tag LOCUS_03600 373151 372777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 374220 373459 gene locus_tag LOCUS_03610 374220 373459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 374384 374662 gene locus_tag LOCUS_03620 374384 374662 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605676.1 protein_id gnl|my_center|LOCUS_03620 374662 374955 gene locus_tag LOCUS_03630 374662 374955 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816231.1 protein_id gnl|my_center|LOCUS_03630 375748 374972 gene locus_tag LOCUS_03640 gene fpr 375748 374972 CDS product ferredoxin-NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091832.1 protein_id gnl|my_center|LOCUS_03640 376041 375748 gene locus_tag LOCUS_03650 376041 375748 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113105.1 protein_id gnl|my_center|LOCUS_03650 376409 376038 gene locus_tag LOCUS_03660 376409 376038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 376768 376409 gene locus_tag LOCUS_03670 376768 376409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 377754 376765 gene locus_tag LOCUS_03680 377754 376765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 379221 377758 gene locus_tag LOCUS_03690 379221 377758 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966056.1 protein_id gnl|my_center|LOCUS_03690 379653 379312 gene locus_tag LOCUS_03700 379653 379312 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931551.1 protein_id gnl|my_center|LOCUS_03700 380612 379665 gene locus_tag LOCUS_03710 380612 379665 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113104.1 protein_id gnl|my_center|LOCUS_03710 380859 380626 gene locus_tag LOCUS_03720 380859 380626 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085981.1 protein_id gnl|my_center|LOCUS_03720 382618 380894 gene locus_tag LOCUS_03730 382618 380894 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113100.1 protein_id gnl|my_center|LOCUS_03730 383409 382630 gene locus_tag LOCUS_03740 383409 382630 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113099.1 protein_id gnl|my_center|LOCUS_03740 384595 383558 gene locus_tag LOCUS_03750 384595 383558 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208790.1 protein_id gnl|my_center|LOCUS_03750 384689 385561 gene locus_tag LOCUS_03760 384689 385561 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909376.1 protein_id gnl|my_center|LOCUS_03760 386131 385580 gene locus_tag LOCUS_03770 386131 385580 CDS product DUF3455 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266352.1 protein_id gnl|my_center|LOCUS_03770 387054 386227 gene locus_tag LOCUS_03780 387054 386227 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940049.1 protein_id gnl|my_center|LOCUS_03780 387987 387070 gene locus_tag LOCUS_03790 gene mdcH 387987 387070 CDS product malonate decarboxylase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038699.1 protein_id gnl|my_center|LOCUS_03790 388862 387984 gene locus_tag LOCUS_03800 gene mdcB 388862 387984 CDS product triphosphoribosyl-dephospho-CoA synthase MdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083097.1 protein_id gnl|my_center|LOCUS_03800 389581 388859 gene locus_tag LOCUS_03810 389581 388859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 390293 389568 gene locus_tag LOCUS_03820 gene mdcE 390293 389568 CDS product biotin-independent malonate decarboxylase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038696.1 protein_id gnl|my_center|LOCUS_03820 391189 390290 gene locus_tag LOCUS_03830 391189 390290 CDS product biotin-independent malonate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994153.1 protein_id gnl|my_center|LOCUS_03830 391502 391179 gene locus_tag LOCUS_03840 gene mdcC 391502 391179 CDS product malonate decarboxylase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038694.1 protein_id gnl|my_center|LOCUS_03840 393179 391515 gene locus_tag LOCUS_03850 gene mdcA 393179 391515 CDS product malonate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038693.1 protein_id gnl|my_center|LOCUS_03850 394537 393194 gene locus_tag LOCUS_03860 394537 393194 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087200.1 protein_id gnl|my_center|LOCUS_03860 395090 394539 gene locus_tag LOCUS_03870 395090 394539 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087201.1 protein_id gnl|my_center|LOCUS_03870 396196 395177 gene locus_tag LOCUS_03880 gene dctP 396196 395177 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087202.1 protein_id gnl|my_center|LOCUS_03880 397045 396293 gene locus_tag LOCUS_03890 397045 396293 CDS product Asp/Glu racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807356.1 protein_id gnl|my_center|LOCUS_03890 397787 397068 gene locus_tag LOCUS_03900 397787 397068 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106623.1 protein_id gnl|my_center|LOCUS_03900 397957 398628 gene locus_tag LOCUS_03910 397957 398628 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967085.1 protein_id gnl|my_center|LOCUS_03910 399246 398638 gene locus_tag LOCUS_03920 399246 398638 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880571.1 protein_id gnl|my_center|LOCUS_03920 399320 400657 gene locus_tag LOCUS_03930 399320 400657 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072045.1 protein_id gnl|my_center|LOCUS_03930 401206 400658 gene locus_tag LOCUS_03940 401206 400658 CDS product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350817.1 protein_id gnl|my_center|LOCUS_03940 402576 401239 gene locus_tag LOCUS_03950 402576 401239 CDS product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103009.1 protein_id gnl|my_center|LOCUS_03950 404060 402603 gene locus_tag LOCUS_03960 404060 402603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 404162 404827 gene locus_tag LOCUS_03970 404162 404827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 406183 404822 gene locus_tag LOCUS_03980 406183 404822 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256609.1 protein_id gnl|my_center|LOCUS_03980 407060 406203 gene locus_tag LOCUS_03990 407060 406203 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971321.1 protein_id gnl|my_center|LOCUS_03990 407238 408356 gene locus_tag LOCUS_04000 407238 408356 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096012.1 protein_id gnl|my_center|LOCUS_04000 408349 409494 gene locus_tag LOCUS_04010 408349 409494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 409519 410634 gene locus_tag LOCUS_04020 409519 410634 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338817.1 protein_id gnl|my_center|LOCUS_04020 410653 412551 gene locus_tag LOCUS_04030 410653 412551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 412756 413964 gene locus_tag LOCUS_04040 412756 413964 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118841.1 protein_id gnl|my_center|LOCUS_04040 413973 418022 gene locus_tag LOCUS_04050 413973 418022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 418571 418023 gene locus_tag LOCUS_04060 gene cobC 418571 418023 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787967.1 protein_id gnl|my_center|LOCUS_04060 419401 418571 gene locus_tag LOCUS_04070 419401 418571 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718969.1 protein_id gnl|my_center|LOCUS_04070 420510 419398 gene locus_tag LOCUS_04080 gene cobT 420510 419398 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067582.1 protein_id gnl|my_center|LOCUS_04080 421970 420507 gene locus_tag LOCUS_04090 421970 420507 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012695322.1 protein_id gnl|my_center|LOCUS_04090 422938 421967 gene locus_tag LOCUS_04100 422938 421967 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926108.1 protein_id gnl|my_center|LOCUS_04100 423894 422935 gene locus_tag LOCUS_04110 gene cbiB 423894 422935 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174539.1 protein_id gnl|my_center|LOCUS_04110 424598 423897 gene locus_tag LOCUS_04120 gene bluB 424598 423897 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404272.1 protein_id gnl|my_center|LOCUS_04120 425190 424609 gene locus_tag LOCUS_04130 gene cobO 425190 424609 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229235.1 protein_id gnl|my_center|LOCUS_04130 426001 425207 gene locus_tag LOCUS_04140 426001 425207 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985861.1 protein_id gnl|my_center|LOCUS_04140 426989 426003 gene locus_tag LOCUS_04150 426989 426003 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228166.1 protein_id gnl|my_center|LOCUS_04150 427822 426986 gene locus_tag LOCUS_04160 427822 426986 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228165.1 protein_id gnl|my_center|LOCUS_04160 428397 427819 gene locus_tag LOCUS_04170 gene cobU 428397 427819 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404268.1 protein_id gnl|my_center|LOCUS_04170 430270 428411 gene locus_tag LOCUS_04180 430270 428411 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931557.1 protein_id gnl|my_center|LOCUS_04180 431126 430581 gene locus_tag LOCUS_04190 431126 430581 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037571.1 protein_id gnl|my_center|LOCUS_04190 431599 431210 gene locus_tag LOCUS_04200 431599 431210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 432187 431633 gene locus_tag LOCUS_04210 432187 431633 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141166.1 protein_id gnl|my_center|LOCUS_04210 432726 432268 gene locus_tag LOCUS_04220 432726 432268 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207573.1 protein_id gnl|my_center|LOCUS_04220 433429 432806 gene locus_tag LOCUS_04230 433429 432806 CDS product cold shock and DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091021504.1 protein_id gnl|my_center|LOCUS_04230 434022 433435 gene locus_tag LOCUS_04240 434022 433435 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338230.1 protein_id gnl|my_center|LOCUS_04240 434574 434173 gene locus_tag LOCUS_04250 434574 434173 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028904.1 protein_id gnl|my_center|LOCUS_04250 435550 434630 gene locus_tag LOCUS_04260 435550 434630 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_04260 435840 437993 gene locus_tag LOCUS_04270 gene ovoA 435840 437993 CDS product 5-histidylcysteine sulfoxide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704222.1 protein_id gnl|my_center|LOCUS_04270 438483 438313 gene locus_tag LOCUS_04280 438483 438313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 438487 439083 gene locus_tag LOCUS_04290 438487 439083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 440783 444661 gene locus_tag LOCUS_04300 440783 444661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 444662 445585 gene locus_tag LOCUS_04310 444662 445585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 448026 448682 gene locus_tag LOCUS_04320 448026 448682 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812436.1 protein_id gnl|my_center|LOCUS_04320 449590 448691 gene locus_tag LOCUS_04330 gene oruR 449590 448691 CDS product ornithine utilization transcriptional regulator OruR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114220.1 protein_id gnl|my_center|LOCUS_04330 449884 450204 gene locus_tag LOCUS_04340 449884 450204 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086615.1 protein_id gnl|my_center|LOCUS_04340 450220 451632 gene locus_tag LOCUS_04350 450220 451632 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086616.1 protein_id gnl|my_center|LOCUS_04350 451765 452997 gene locus_tag LOCUS_04360 451765 452997 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086617.1 protein_id gnl|my_center|LOCUS_04360 453175 455445 gene locus_tag LOCUS_04370 453175 455445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 455479 457149 gene locus_tag LOCUS_04380 455479 457149 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529566.1 protein_id gnl|my_center|LOCUS_04380 457142 458920 gene locus_tag LOCUS_04390 457142 458920 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079800.1 protein_id gnl|my_center|LOCUS_04390 458904 459929 gene locus_tag LOCUS_04400 gene oruR 458904 459929 CDS product ornithine utilization transcriptional regulator OruR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114220.1 protein_id gnl|my_center|LOCUS_04400 461042 460011 gene locus_tag LOCUS_04410 461042 460011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207738.1 protein_id gnl|my_center|LOCUS_04410 462545 461058 gene locus_tag LOCUS_04420 462545 461058 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810111.1 protein_id gnl|my_center|LOCUS_04420 463653 462739 gene locus_tag LOCUS_04430 463653 462739 CDS product DUF6091 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207691.1 protein_id gnl|my_center|LOCUS_04430 466132 465719 gene locus_tag LOCUS_04440 466132 465719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 467701 466250 gene locus_tag LOCUS_04450 467701 466250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 468849 467698 gene locus_tag LOCUS_04460 468849 467698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 470306 468852 gene locus_tag LOCUS_04470 470306 468852 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013658.1 protein_id gnl|my_center|LOCUS_04470 470528 470316 gene locus_tag LOCUS_04480 470528 470316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 470683 470865 gene locus_tag LOCUS_04490 470683 470865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 470870 471571 gene locus_tag LOCUS_04500 470870 471571 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257775.1 protein_id gnl|my_center|LOCUS_04500 472724 471795 gene locus_tag LOCUS_04510 472724 471795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 472977 473174 gene locus_tag LOCUS_04520 472977 473174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 474254 473244 gene locus_tag LOCUS_04530 474254 473244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 474279 474527 gene locus_tag LOCUS_04540 474279 474527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 476556 474598 gene locus_tag LOCUS_04550 476556 474598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 477158 477083 gene locus_tag LOCUS_t00040 477158 477083 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 477236 480400 gene locus_tag LOCUS_04560 477236 480400 CDS product DUF748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263656.1 protein_id gnl|my_center|LOCUS_04560 481317 480412 gene locus_tag LOCUS_04570 481317 480412 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206176.1 protein_id gnl|my_center|LOCUS_04570 481475 482209 gene locus_tag LOCUS_04580 481475 482209 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114755.1 protein_id gnl|my_center|LOCUS_04580 482259 485126 gene locus_tag LOCUS_04590 482259 485126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 485252 485818 gene locus_tag LOCUS_04600 485252 485818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 487117 485834 gene locus_tag LOCUS_04610 487117 485834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 488193 487207 gene locus_tag LOCUS_04620 488193 487207 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815066.1 protein_id gnl|my_center|LOCUS_04620 489017 488190 gene locus_tag LOCUS_04630 489017 488190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 490049 489030 gene locus_tag LOCUS_04640 490049 489030 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266806.1 protein_id gnl|my_center|LOCUS_04640 490891 490046 gene locus_tag LOCUS_04650 490891 490046 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531783.1 protein_id gnl|my_center|LOCUS_04650 490960 491406 gene locus_tag LOCUS_04660 490960 491406 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815410.1 protein_id gnl|my_center|LOCUS_04660 491441 491797 gene locus_tag LOCUS_04670 491441 491797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 493406 491805 gene locus_tag LOCUS_04680 493406 491805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 494338 493433 gene locus_tag LOCUS_04690 494338 493433 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881132.1 protein_id gnl|my_center|LOCUS_04690 497263 494546 gene locus_tag LOCUS_04700 497263 494546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 498039 497260 gene locus_tag LOCUS_04710 498039 497260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 501108 498385 gene locus_tag LOCUS_04720 gene qqaR 501108 498385 CDS product N-acyl homoserine lactone acylase QqaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889514.1 protein_id gnl|my_center|LOCUS_04720 501325 502836 gene locus_tag LOCUS_04730 501325 502836 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808433.1 protein_id gnl|my_center|LOCUS_04730 502890 505070 gene locus_tag LOCUS_04740 502890 505070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 505156 505881 gene locus_tag LOCUS_04750 505156 505881 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085663.1 protein_id gnl|my_center|LOCUS_04750 506104 506700 gene locus_tag LOCUS_04760 506104 506700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 507581 506697 gene locus_tag LOCUS_04770 507581 506697 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529258.1 protein_id gnl|my_center|LOCUS_04770 507705 508715 gene locus_tag LOCUS_04780 507705 508715 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104462.1 protein_id gnl|my_center|LOCUS_04780 509376 508783 gene locus_tag LOCUS_04790 509376 508783 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194433.1 protein_id gnl|my_center|LOCUS_04790 509949 509392 gene locus_tag LOCUS_04800 509949 509392 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202184.1 protein_id gnl|my_center|LOCUS_04800 510483 509986 gene locus_tag LOCUS_04810 510483 509986 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194252.1 protein_id gnl|my_center|LOCUS_04810 510734 511288 gene locus_tag LOCUS_04820 510734 511288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 512031 511363 gene locus_tag LOCUS_04830 512031 511363 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224580.1 protein_id gnl|my_center|LOCUS_04830 512144 513040 gene locus_tag LOCUS_04840 512144 513040 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202679.1 protein_id gnl|my_center|LOCUS_04840 513114 513776 gene locus_tag LOCUS_04850 513114 513776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529957.1 protein_id gnl|my_center|LOCUS_04850 513813 514178 gene locus_tag LOCUS_04860 513813 514178 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002658059.1 protein_id gnl|my_center|LOCUS_04860 516175 514175 gene locus_tag LOCUS_04870 516175 514175 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524472.1 protein_id gnl|my_center|LOCUS_04870 518185 516221 gene locus_tag LOCUS_04880 518185 516221 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247688.1 protein_id gnl|my_center|LOCUS_04880 519690 518596 gene locus_tag LOCUS_04890 gene hemE 519690 518596 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524502.1 protein_id gnl|my_center|LOCUS_04890 520144 519716 gene locus_tag LOCUS_04900 520144 519716 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393898.1 protein_id gnl|my_center|LOCUS_04900 520985 520176 gene locus_tag LOCUS_04910 520985 520176 CDS product hydroxypyruvate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184793.1 protein_id gnl|my_center|LOCUS_04910 521806 520982 gene locus_tag LOCUS_04920 521806 520982 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101593.1 protein_id gnl|my_center|LOCUS_04920 521927 522013 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 522457 522068 gene locus_tag LOCUS_04930 522457 522068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 523026 522607 gene locus_tag LOCUS_04940 523026 522607 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195832.1 protein_id gnl|my_center|LOCUS_04940 524487 523096 gene locus_tag LOCUS_04950 gene atpD 524487 523096 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185243.1 protein_id gnl|my_center|LOCUS_04950 525395 524526 gene locus_tag LOCUS_04960 gene atpG 525395 524526 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195831.1 protein_id gnl|my_center|LOCUS_04960 527010 525469 gene locus_tag LOCUS_04970 gene atpA 527010 525469 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524507.1 protein_id gnl|my_center|LOCUS_04970 527576 527043 gene locus_tag LOCUS_04980 527576 527043 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524508.1 protein_id gnl|my_center|LOCUS_04980 528009 527602 gene locus_tag LOCUS_04990 528009 527602 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815350.1 protein_id gnl|my_center|LOCUS_04990 528390 528148 gene locus_tag LOCUS_05000 gene atpE 528390 528148 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815363.1 protein_id gnl|my_center|LOCUS_05000 529310 528450 gene locus_tag LOCUS_05010 gene atpB 529310 528450 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538602.1 protein_id gnl|my_center|LOCUS_05010 530675 529794 gene locus_tag LOCUS_05020 530675 529794 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195818.1 protein_id gnl|my_center|LOCUS_05020 531488 530712 gene locus_tag LOCUS_05030 531488 530712 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806879.1 protein_id gnl|my_center|LOCUS_05030 531725 531519 gene locus_tag LOCUS_05040 531725 531519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 532194 531727 gene locus_tag LOCUS_05050 532194 531727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05050 534143 532191 gene locus_tag LOCUS_05060 gene mnmG 534143 532191 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818282.1 protein_id gnl|my_center|LOCUS_05060 535644 534844 gene locus_tag LOCUS_05070 535644 534844 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994212.1 protein_id gnl|my_center|LOCUS_05070 537583 535742 gene locus_tag LOCUS_05080 537583 535742 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817018.1 protein_id gnl|my_center|LOCUS_05080 537842 538447 gene locus_tag LOCUS_05090 537842 538447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 539482 538454 gene locus_tag LOCUS_05100 539482 538454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 539792 539523 gene locus_tag LOCUS_05110 539792 539523 CDS product TIGR03643 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001890111.1 protein_id gnl|my_center|LOCUS_05110 539859 540320 gene locus_tag LOCUS_05120 539859 540320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 540441 542816 gene locus_tag LOCUS_05130 540441 542816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 543331 542819 gene locus_tag LOCUS_05140 543331 542819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 543553 544227 gene locus_tag LOCUS_05150 543553 544227 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037326.1 protein_id gnl|my_center|LOCUS_05150 544264 547260 gene locus_tag LOCUS_05160 544264 547260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 547450 547854 gene locus_tag LOCUS_05170 547450 547854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 547874 548473 gene locus_tag LOCUS_05180 547874 548473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549603.1 protein_id gnl|my_center|LOCUS_05180 549137 548481 gene locus_tag LOCUS_05190 549137 548481 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049832585.1 protein_id gnl|my_center|LOCUS_05190 549440 549763 gene locus_tag LOCUS_05200 549440 549763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 551113 549770 gene locus_tag LOCUS_05210 gene mnmE 551113 549770 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931687.1 protein_id gnl|my_center|LOCUS_05210 552821 551121 gene locus_tag LOCUS_05220 gene yidC 552821 551121 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033451345.1 protein_id gnl|my_center|LOCUS_05220 553328 553062 gene locus_tag LOCUS_05230 553328 553062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 553870 555261 gene locus_tag LOCUS_05240 gene dnaA 553870 555261 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929554.1 protein_id gnl|my_center|LOCUS_05240 555490 556596 gene locus_tag LOCUS_05250 gene dnaN 555490 556596 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196275.1 protein_id gnl|my_center|LOCUS_05250 556629 559154 gene locus_tag LOCUS_05260 gene gyrB 556629 559154 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196276.1 protein_id gnl|my_center|LOCUS_05260 559695 559228 gene locus_tag LOCUS_05270 559695 559228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 560111 559695 gene locus_tag LOCUS_05280 560111 559695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 560545 560108 gene locus_tag LOCUS_05290 560545 560108 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918284.1 protein_id gnl|my_center|LOCUS_05290 561791 560631 gene locus_tag LOCUS_05300 gene cfa 561791 560631 CDS product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098879.1 protein_id gnl|my_center|LOCUS_05300 563723 561861 gene locus_tag LOCUS_05310 563723 561861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 566613 563875 gene locus_tag LOCUS_05320 gene fdhF 566613 563875 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085105.1 protein_id gnl|my_center|LOCUS_05320 568331 566610 gene locus_tag LOCUS_05330 568331 566610 CDS product NADH-ubiquinone oxidoreductase-F iron-sulfur binding region domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085104.1 protein_id gnl|my_center|LOCUS_05330 568523 569482 gene locus_tag LOCUS_05340 568523 569482 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207516.1 protein_id gnl|my_center|LOCUS_05340 569502 570200 gene locus_tag LOCUS_05350 569502 570200 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262765.1 protein_id gnl|my_center|LOCUS_05350 570224 570913 gene locus_tag LOCUS_05360 570224 570913 CDS product DUF4197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144308590.1 protein_id gnl|my_center|LOCUS_05360 570919 571470 gene locus_tag LOCUS_05370 570919 571470 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087647.1 protein_id gnl|my_center|LOCUS_05370 573546 571486 gene locus_tag LOCUS_05380 573546 571486 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101985.1 protein_id gnl|my_center|LOCUS_05380 573990 573643 gene locus_tag LOCUS_05390 573990 573643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 574965 574057 gene locus_tag LOCUS_05400 574965 574057 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763674.1 protein_id gnl|my_center|LOCUS_05400 576765 575026 gene locus_tag LOCUS_05410 gene phoD 576765 575026 CDS product alkaline phosphatase PhoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969242.1 protein_id gnl|my_center|LOCUS_05410 578192 576801 gene locus_tag LOCUS_05420 578192 576801 CDS product DUF839 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056019.1 protein_id gnl|my_center|LOCUS_05420 579971 578325 gene locus_tag LOCUS_05430 579971 578325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 580533 579982 gene locus_tag LOCUS_05440 580533 579982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549603.1 protein_id gnl|my_center|LOCUS_05440 580818 581399 gene locus_tag LOCUS_05450 580818 581399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 581477 582481 gene locus_tag LOCUS_05460 581477 582481 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901674.1 protein_id gnl|my_center|LOCUS_05460 582569 584773 gene locus_tag LOCUS_05470 582569 584773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 585181 584756 gene locus_tag LOCUS_05480 585181 584756 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817041.1 protein_id gnl|my_center|LOCUS_05480 585626 585195 gene locus_tag LOCUS_05490 585626 585195 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038731.1 protein_id gnl|my_center|LOCUS_05490 585765 586829 gene locus_tag LOCUS_05500 585765 586829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 589400 586842 gene locus_tag LOCUS_05510 589400 586842 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525850.1 protein_id gnl|my_center|LOCUS_05510 590610 589522 gene locus_tag LOCUS_05520 gene dprA 590610 589522 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064703.1 protein_id gnl|my_center|LOCUS_05520 590706 591215 gene locus_tag LOCUS_05530 gene def 590706 591215 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201745.1 protein_id gnl|my_center|LOCUS_05530 591230 592213 gene locus_tag LOCUS_05540 gene fmt 591230 592213 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549892.1 protein_id gnl|my_center|LOCUS_05540 592300 593169 gene locus_tag LOCUS_05550 gene htpX 592300 593169 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189409.1 protein_id gnl|my_center|LOCUS_05550 593166 594533 gene locus_tag LOCUS_05560 gene rsmB 593166 594533 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064692.1 protein_id gnl|my_center|LOCUS_05560 594543 595160 gene locus_tag LOCUS_05570 594543 595160 CDS product DUF4390 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188929.1 protein_id gnl|my_center|LOCUS_05570 595157 597430 gene locus_tag LOCUS_05580 595157 597430 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038749.1 protein_id gnl|my_center|LOCUS_05580 597449 598171 gene locus_tag LOCUS_05590 gene esaR 597449 598171 CDS product response regulator transcription factor EsaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009935896.1 protein_id gnl|my_center|LOCUS_05590 598168 599544 gene locus_tag LOCUS_05600 gene trkA 598168 599544 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166392.1 protein_id gnl|my_center|LOCUS_05600 599560 601020 gene locus_tag LOCUS_05610 599560 601020 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807338.1 protein_id gnl|my_center|LOCUS_05610 601017 601424 gene locus_tag LOCUS_05620 601017 601424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 601508 601756 gene locus_tag LOCUS_05630 601508 601756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 603097 601811 gene locus_tag LOCUS_05640 603097 601811 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947133.1 protein_id gnl|my_center|LOCUS_05640 604442 603783 gene locus_tag LOCUS_05650 gene eda 604442 603783 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224222.1 protein_id gnl|my_center|LOCUS_05650 606250 604457 gene locus_tag LOCUS_05660 gene edd 606250 604457 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691226.1 protein_id gnl|my_center|LOCUS_05660 606358 607824 gene locus_tag LOCUS_05670 gene zwf 606358 607824 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186165.1 protein_id gnl|my_center|LOCUS_05670 607821 610565 gene locus_tag LOCUS_05680 gene ppc 607821 610565 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085739.1 protein_id gnl|my_center|LOCUS_05680 610579 611373 gene locus_tag LOCUS_05690 610579 611373 CDS product FRG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921712.1 protein_id gnl|my_center|LOCUS_05690 612596 611376 gene locus_tag LOCUS_05700 612596 611376 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173522.1 protein_id gnl|my_center|LOCUS_05700 612708 613250 gene locus_tag LOCUS_05710 612708 613250 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185716.1 protein_id gnl|my_center|LOCUS_05710 613830 613219 gene locus_tag LOCUS_05720 613830 613219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 614484 613840 gene locus_tag LOCUS_05730 614484 613840 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265678.1 protein_id gnl|my_center|LOCUS_05730 614585 614914 gene locus_tag LOCUS_05740 614585 614914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 615531 614917 gene locus_tag LOCUS_05750 615531 614917 CDS product alternative oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261331.1 protein_id gnl|my_center|LOCUS_05750 615731 616204 gene locus_tag LOCUS_05760 615731 616204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 617613 616246 gene locus_tag LOCUS_05770 617613 616246 CDS product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899946.1 protein_id gnl|my_center|LOCUS_05770 618212 617610 gene locus_tag LOCUS_05780 618212 617610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 618294 619295 gene locus_tag LOCUS_05790 618294 619295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 620535 619306 gene locus_tag LOCUS_05800 620535 619306 CDS product NADH:flavin oxidoreductase/NADH oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705326.1 protein_id gnl|my_center|LOCUS_05800 620699 621112 gene locus_tag LOCUS_05810 620699 621112 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705325.1 protein_id gnl|my_center|LOCUS_05810 621525 621139 gene locus_tag LOCUS_05820 621525 621139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 622571 621516 gene locus_tag LOCUS_05830 622571 621516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 623048 622767 gene locus_tag LOCUS_05840 623048 622767 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010201208.1 protein_id gnl|my_center|LOCUS_05840 623304 623038 gene locus_tag LOCUS_05850 623304 623038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 623676 625745 gene locus_tag LOCUS_05860 623676 625745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 627295 625757 gene locus_tag LOCUS_05870 627295 625757 CDS product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816130.1 protein_id gnl|my_center|LOCUS_05870 627683 627387 gene locus_tag LOCUS_05880 627683 627387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 628834 627827 gene locus_tag LOCUS_05890 628834 627827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 630322 629906 gene locus_tag LOCUS_05900 630322 629906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 630853 632196 gene locus_tag LOCUS_05910 630853 632196 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816876.1 protein_id gnl|my_center|LOCUS_05910 632193 632684 gene locus_tag LOCUS_05920 632193 632684 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821327.1 protein_id gnl|my_center|LOCUS_05920 633344 632700 gene locus_tag LOCUS_05930 633344 632700 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186100.1 protein_id gnl|my_center|LOCUS_05930 633723 633346 gene locus_tag LOCUS_05940 633723 633346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 633993 635867 gene locus_tag LOCUS_05950 633993 635867 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963528.1 protein_id gnl|my_center|LOCUS_05950 635901 637187 gene locus_tag LOCUS_05960 635901 637187 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640165.1 protein_id gnl|my_center|LOCUS_05960 637237 637893 gene locus_tag LOCUS_05970 637237 637893 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075543.1 protein_id gnl|my_center|LOCUS_05970 638862 637909 gene locus_tag LOCUS_05980 638862 637909 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087717.1 protein_id gnl|my_center|LOCUS_05980 638967 639788 gene locus_tag LOCUS_05990 638967 639788 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063673.1 protein_id gnl|my_center|LOCUS_05990 641070 639739 gene locus_tag LOCUS_06000 641070 639739 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339198.1 protein_id gnl|my_center|LOCUS_06000 641489 641178 gene locus_tag LOCUS_06010 641489 641178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 641677 642393 gene locus_tag LOCUS_06020 641677 642393 CDS product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815117.1 protein_id gnl|my_center|LOCUS_06020 642420 643736 gene locus_tag LOCUS_06030 642420 643736 CDS product heavy metal sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266840.1 protein_id gnl|my_center|LOCUS_06030 643784 644080 gene locus_tag LOCUS_06040 643784 644080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 644104 645501 gene locus_tag LOCUS_06050 644104 645501 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189952.1 protein_id gnl|my_center|LOCUS_06050 645498 646886 gene locus_tag LOCUS_06060 645498 646886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 646883 650017 gene locus_tag LOCUS_06070 646883 650017 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817193.1 protein_id gnl|my_center|LOCUS_06070 650117 650632 gene locus_tag LOCUS_06080 650117 650632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 650787 651515 gene locus_tag LOCUS_06090 gene phnF 650787 651515 CDS product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001346550.1 protein_id gnl|my_center|LOCUS_06090 651533 652477 gene locus_tag LOCUS_06100 651533 652477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 652489 653292 gene locus_tag LOCUS_06110 652489 653292 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903534.1 protein_id gnl|my_center|LOCUS_06110 653318 654343 gene locus_tag LOCUS_06120 653318 654343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 654356 654823 gene locus_tag LOCUS_06130 654356 654823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 654816 655361 gene locus_tag LOCUS_06140 gene phnH 654816 655361 CDS product phosphonate C-P lyase system protein PhnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965300.1 protein_id gnl|my_center|LOCUS_06140 655361 656479 gene locus_tag LOCUS_06150 655361 656479 CDS product carbon-phosphorus lyase complex subunit PhnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258836.1 protein_id gnl|my_center|LOCUS_06150 656466 657401 gene locus_tag LOCUS_06160 656466 657401 CDS product alpha-D-ribose 1-methylphosphonate 5-phosphate C-P-lyase PhnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704078.1 protein_id gnl|my_center|LOCUS_06160 657398 658228 gene locus_tag LOCUS_06170 657398 658228 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435860.1 protein_id gnl|my_center|LOCUS_06170 658243 658953 gene locus_tag LOCUS_06180 gene phnL 658243 658953 CDS product phosphonate C-P lyase system protein PhnL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529517.1 protein_id gnl|my_center|LOCUS_06180 658950 660152 gene locus_tag LOCUS_06190 658950 660152 CDS product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258832.1 protein_id gnl|my_center|LOCUS_06190 660118 660711 gene locus_tag LOCUS_06200 gene phnN 660118 660711 CDS product ribose 1,5-bisphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145993.1 protein_id gnl|my_center|LOCUS_06200 660702 661472 gene locus_tag LOCUS_06210 gene phnP 660702 661472 CDS product phosphonate metabolism protein PhnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113125.1 protein_id gnl|my_center|LOCUS_06210 661469 662317 gene locus_tag LOCUS_06220 661469 662317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 662367 662675 gene locus_tag LOCUS_06230 662367 662675 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097704.1 protein_id gnl|my_center|LOCUS_06230 662681 663349 gene locus_tag LOCUS_06240 662681 663349 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246025.1 protein_id gnl|my_center|LOCUS_06240 663346 664656 gene locus_tag LOCUS_06250 gene carS 663346 664656 CDS product two-component system sensor histidine kinase CarS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090493.1 protein_id gnl|my_center|LOCUS_06250 664988 664653 gene locus_tag LOCUS_06260 664988 664653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 670053 665074 gene locus_tag LOCUS_06270 670053 665074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 670128 671003 gene locus_tag LOCUS_06280 670128 671003 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243358.1 protein_id gnl|my_center|LOCUS_06280 671670 671104 gene locus_tag LOCUS_06290 671670 671104 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439348.1 protein_id gnl|my_center|LOCUS_06290 672363 671797 gene locus_tag LOCUS_06300 672363 671797 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531226.1 protein_id gnl|my_center|LOCUS_06300 673225 672452 gene locus_tag LOCUS_06310 673225 672452 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096920.1 protein_id gnl|my_center|LOCUS_06310 676372 673295 gene locus_tag LOCUS_06320 676372 673295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 676505 677071 gene locus_tag LOCUS_06330 676505 677071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 677376 681173 gene locus_tag LOCUS_06340 gene metH 677376 681173 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064919.1 protein_id gnl|my_center|LOCUS_06340 681525 682589 gene locus_tag LOCUS_06350 681525 682589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 682601 683014 gene locus_tag LOCUS_06360 682601 683014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 683004 683303 gene locus_tag LOCUS_06370 683004 683303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 683273 685390 gene locus_tag LOCUS_06380 gene lcrD 683273 685390 CDS product SctV family type III secretion system export apparatus subunit LcrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117635.1 protein_id gnl|my_center|LOCUS_06380 685413 686435 gene locus_tag LOCUS_06390 685413 686435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 686444 687796 gene locus_tag LOCUS_06400 gene vscN 686444 687796 CDS product SctN family type III secretion system ATPase VscN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477722.1 protein_id gnl|my_center|LOCUS_06400 687796 688236 gene locus_tag LOCUS_06410 687796 688236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 688289 688906 gene locus_tag LOCUS_06420 688289 688906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 688899 689945 gene locus_tag LOCUS_06430 688899 689945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 689942 690604 gene locus_tag LOCUS_06440 gene bscR 689942 690604 CDS product SctR family type III secretion system export apparatus subunit BscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809905.1 protein_id gnl|my_center|LOCUS_06440 690601 690870 gene locus_tag LOCUS_06450 gene pscS 690601 690870 CDS product SctS family type III secretion system export apparatus subunit PscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087672.1 protein_id gnl|my_center|LOCUS_06450 690867 691670 gene locus_tag LOCUS_06460 gene bscT 690867 691670 CDS product SctT family type III secretion system export apparatus subunit BscT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809909.1 protein_id gnl|my_center|LOCUS_06460 691687 692772 gene locus_tag LOCUS_06470 gene yscU 691687 692772 CDS product type III secretion system export apparatus switch protein YscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176440.1 protein_id gnl|my_center|LOCUS_06470 694542 692800 gene locus_tag LOCUS_06480 gene bscC 694542 692800 CDS product SctC family type III secretion system outer membrane ring subunit BscC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930813.1 protein_id gnl|my_center|LOCUS_06480 694787 694557 gene locus_tag LOCUS_06490 694787 694557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 695465 694800 gene locus_tag LOCUS_06500 695465 694800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 696881 696012 gene locus_tag LOCUS_06510 696881 696012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 697282 696893 gene locus_tag LOCUS_06520 697282 696893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 697482 698159 gene locus_tag LOCUS_06530 697482 698159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 698234 698830 gene locus_tag LOCUS_06540 698234 698830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 699069 700079 gene locus_tag LOCUS_06550 699069 700079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 700093 700755 gene locus_tag LOCUS_06560 700093 700755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 702523 700844 gene locus_tag LOCUS_06570 702523 700844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 703906 702776 gene locus_tag LOCUS_06580 703906 702776 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172653.1 protein_id gnl|my_center|LOCUS_06580 705852 703918 gene locus_tag LOCUS_06590 705852 703918 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083807.1 protein_id gnl|my_center|LOCUS_06590 707008 705845 gene locus_tag LOCUS_06600 gene atuD 707008 705845 CDS product citronellyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101733.1 protein_id gnl|my_center|LOCUS_06600 708675 707047 gene locus_tag LOCUS_06610 708675 707047 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083806.1 protein_id gnl|my_center|LOCUS_06610 709680 708772 gene locus_tag LOCUS_06620 709680 708772 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090991.1 protein_id gnl|my_center|LOCUS_06620 710431 709802 gene locus_tag LOCUS_06630 710431 709802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 710605 711294 gene locus_tag LOCUS_06640 710605 711294 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086937.1 protein_id gnl|my_center|LOCUS_06640 711915 711295 gene locus_tag LOCUS_06650 711915 711295 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406317.1 protein_id gnl|my_center|LOCUS_06650 712038 713276 gene locus_tag LOCUS_06660 712038 713276 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937371.1 protein_id gnl|my_center|LOCUS_06660 713289 716453 gene locus_tag LOCUS_06670 713289 716453 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937372.1 protein_id gnl|my_center|LOCUS_06670 716446 717891 gene locus_tag LOCUS_06680 716446 717891 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096703.1 protein_id gnl|my_center|LOCUS_06680 718036 718371 gene locus_tag LOCUS_06690 718036 718371 CDS product YegP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207563.1 protein_id gnl|my_center|LOCUS_06690 719036 718422 gene locus_tag LOCUS_06700 719036 718422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 719480 719037 gene locus_tag LOCUS_06710 719480 719037 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928694.1 protein_id gnl|my_center|LOCUS_06710 719596 720558 gene locus_tag LOCUS_06720 719596 720558 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207753.1 protein_id gnl|my_center|LOCUS_06720 720574 722754 gene locus_tag LOCUS_06730 720574 722754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 722847 723233 gene locus_tag LOCUS_06740 722847 723233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 723296 723580 gene locus_tag LOCUS_06750 723296 723580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 723577 725001 gene locus_tag LOCUS_06760 723577 725001 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529972.1 protein_id gnl|my_center|LOCUS_06760 725019 726431 gene locus_tag LOCUS_06770 725019 726431 CDS product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973486.1 protein_id gnl|my_center|LOCUS_06770 726457 726951 gene locus_tag LOCUS_06780 726457 726951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 726971 727336 gene locus_tag LOCUS_06790 726971 727336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 728103 727339 gene locus_tag LOCUS_06800 728103 727339 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190271.1 protein_id gnl|my_center|LOCUS_06800 729186 728110 gene locus_tag LOCUS_06810 729186 728110 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206917.1 protein_id gnl|my_center|LOCUS_06810 730415 729186 gene locus_tag LOCUS_06820 730415 729186 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206918.1 protein_id gnl|my_center|LOCUS_06820 730500 731621 gene locus_tag LOCUS_06830 730500 731621 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112360.1 protein_id gnl|my_center|LOCUS_06830 731653 732159 gene locus_tag LOCUS_06840 731653 732159 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811209.1 protein_id gnl|my_center|LOCUS_06840 732187 732798 gene locus_tag LOCUS_06850 732187 732798 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970922.1 protein_id gnl|my_center|LOCUS_06850 732795 733514 gene locus_tag LOCUS_06860 732795 733514 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266350.1 protein_id gnl|my_center|LOCUS_06860 735367 733583 gene locus_tag LOCUS_06870 735367 733583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 736166 735456 gene locus_tag LOCUS_06880 736166 735456 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107720.1 protein_id gnl|my_center|LOCUS_06880 736309 736830 gene locus_tag LOCUS_06890 736309 736830 CDS product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103092.1 protein_id gnl|my_center|LOCUS_06890 737221 736850 gene locus_tag LOCUS_06900 737221 736850 CDS product DUF1840 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189319.1 protein_id gnl|my_center|LOCUS_06900 737273 737815 gene locus_tag LOCUS_06910 737273 737815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 737815 739125 gene locus_tag LOCUS_06920 737815 739125 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135178900.1 protein_id gnl|my_center|LOCUS_06920 739128 740504 gene locus_tag LOCUS_06930 739128 740504 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548886.1 protein_id gnl|my_center|LOCUS_06930 742075 740492 gene locus_tag LOCUS_06940 742075 740492 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926358.1 protein_id gnl|my_center|LOCUS_06940 742374 742144 gene locus_tag LOCUS_06950 742374 742144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 742586 743305 gene locus_tag LOCUS_06960 742586 743305 CDS product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073341.1 protein_id gnl|my_center|LOCUS_06960 743377 743715 gene locus_tag LOCUS_06970 743377 743715 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198020.1 protein_id gnl|my_center|LOCUS_06970 743737 745182 gene locus_tag LOCUS_06980 gene amt 743737 745182 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707418.1 protein_id gnl|my_center|LOCUS_06980 745345 746634 gene locus_tag LOCUS_06990 gene gshA 745345 746634 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522914.1 protein_id gnl|my_center|LOCUS_06990 746631 747593 gene locus_tag LOCUS_07000 gene gshB 746631 747593 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593287.1 protein_id gnl|my_center|LOCUS_07000 747590 748057 gene locus_tag LOCUS_07010 747590 748057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 748026 748295 gene locus_tag LOCUS_07020 748026 748295 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198013.1 protein_id gnl|my_center|LOCUS_07020 748299 750050 gene locus_tag LOCUS_07030 gene ptsP 748299 750050 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522912.1 protein_id gnl|my_center|LOCUS_07030 750146 751282 gene locus_tag LOCUS_07040 750146 751282 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198305.1 protein_id gnl|my_center|LOCUS_07040 751279 751920 gene locus_tag LOCUS_07050 gene metW 751279 751920 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817748.1 protein_id gnl|my_center|LOCUS_07050 751930 752259 gene locus_tag LOCUS_07060 751930 752259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 752219 755521 gene locus_tag LOCUS_07070 752219 755521 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224369.1 protein_id gnl|my_center|LOCUS_07070 756134 756793 gene locus_tag LOCUS_07080 756134 756793 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478128.1 protein_id gnl|my_center|LOCUS_07080 756928 759360 gene locus_tag LOCUS_07090 756928 759360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 759414 761480 gene locus_tag LOCUS_07100 759414 761480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 762215 761556 gene locus_tag LOCUS_07110 762215 761556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 762261 762956 gene locus_tag LOCUS_07120 gene lipB 762261 762956 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553813.1 protein_id gnl|my_center|LOCUS_07120 762996 763979 gene locus_tag LOCUS_07130 gene lipA 762996 763979 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189177.1 protein_id gnl|my_center|LOCUS_07130 764304 763906 gene locus_tag LOCUS_07140 764304 763906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 764978 764493 gene locus_tag LOCUS_07150 764978 764493 CDS product DM13 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704152.1 protein_id gnl|my_center|LOCUS_07150 766048 765041 gene locus_tag LOCUS_07160 gene adeT1 766048 765041 CDS product putative multidrug efflux protein AdeT1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206789.1 protein_id gnl|my_center|LOCUS_07160 767753 766119 gene locus_tag LOCUS_07170 767753 766119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 768274 767750 gene locus_tag LOCUS_07180 768274 767750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 771816 768343 gene locus_tag LOCUS_07190 gene tssM 771816 768343 CDS product type VI secretion system membrane subunit TssM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925954.1 protein_id gnl|my_center|LOCUS_07190 773208 771835 gene locus_tag LOCUS_07200 773208 771835 CDS product DotU family type VI secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808318.1 protein_id gnl|my_center|LOCUS_07200 774569 773205 gene locus_tag LOCUS_07210 gene tssK 774569 773205 CDS product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808316.1 protein_id gnl|my_center|LOCUS_07210 774729 775271 gene locus_tag LOCUS_07220 774729 775271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 775292 777349 gene locus_tag LOCUS_07230 gene vgrG1a 775292 777349 CDS product type VI secretion system spike protein VgrG1a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895494.1 protein_id gnl|my_center|LOCUS_07230 777359 777835 gene locus_tag LOCUS_07240 777359 777835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 777832 779199 gene locus_tag LOCUS_07250 777832 779199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 779192 779950 gene locus_tag LOCUS_07260 779192 779950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 779960 780946 gene locus_tag LOCUS_07270 779960 780946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 780937 781722 gene locus_tag LOCUS_07280 780937 781722 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096185.1 protein_id gnl|my_center|LOCUS_07280 781844 783505 gene locus_tag LOCUS_07290 781844 783505 CDS product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895677.1 protein_id gnl|my_center|LOCUS_07290 783519 791234 gene locus_tag LOCUS_07300 783519 791234 CDS product filamentous hemagglutinin N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036966.1 protein_id gnl|my_center|LOCUS_07300 791329 791736 gene locus_tag LOCUS_07310 791329 791736 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926942.1 protein_id gnl|my_center|LOCUS_07310 791864 792211 gene locus_tag LOCUS_07320 791864 792211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 792204 792722 gene locus_tag LOCUS_07330 gene mepS 792204 792722 CDS product bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706124.1 protein_id gnl|my_center|LOCUS_07330 793663 792785 gene locus_tag LOCUS_07340 gene htpX 793663 792785 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813142.1 protein_id gnl|my_center|LOCUS_07340 794007 793660 gene locus_tag LOCUS_07350 794007 793660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 794115 795026 gene locus_tag LOCUS_07360 gene nhaR 794115 795026 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104144.1 protein_id gnl|my_center|LOCUS_07360 795086 795958 gene locus_tag LOCUS_07370 795086 795958 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706015.1 protein_id gnl|my_center|LOCUS_07370 797848 795890 gene locus_tag LOCUS_07380 797848 795890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 798536 797928 gene locus_tag LOCUS_07390 gene msrA 798536 797928 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945865.1 protein_id gnl|my_center|LOCUS_07390 798653 800635 gene locus_tag LOCUS_07400 gene rlhA 798653 800635 CDS product 23S rRNA 5-hydroxycytidine C2501 synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001313806.1 protein_id gnl|my_center|LOCUS_07400 800769 801719 gene locus_tag LOCUS_07410 gene pstC 800769 801719 CDS product phosphate ABC transporter permease PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193912.1 protein_id gnl|my_center|LOCUS_07410 801723 802640 gene locus_tag LOCUS_07420 gene pstA 801723 802640 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251985.1 protein_id gnl|my_center|LOCUS_07420 802663 803439 gene locus_tag LOCUS_07430 gene pstB 802663 803439 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930167.1 protein_id gnl|my_center|LOCUS_07430 803588 804628 gene locus_tag LOCUS_07440 gene pstS 803588 804628 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099410.1 protein_id gnl|my_center|LOCUS_07440 804781 805641 gene locus_tag LOCUS_07450 804781 805641 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174564975.1 protein_id gnl|my_center|LOCUS_07450 806296 805610 gene locus_tag LOCUS_07460 806296 805610 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919378.1 protein_id gnl|my_center|LOCUS_07460 806791 806303 gene locus_tag LOCUS_07470 806791 806303 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184680.1 protein_id gnl|my_center|LOCUS_07470 807288 806788 gene locus_tag LOCUS_07480 807288 806788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 807616 807281 gene locus_tag LOCUS_07490 807616 807281 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198701.1 protein_id gnl|my_center|LOCUS_07490 808942 807719 gene locus_tag LOCUS_07500 808942 807719 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207192.1 protein_id gnl|my_center|LOCUS_07500 810399 809608 gene locus_tag LOCUS_07510 810399 809608 CDS product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202847.1 protein_id gnl|my_center|LOCUS_07510 810511 811521 gene locus_tag LOCUS_07520 810511 811521 CDS product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807763.1 protein_id gnl|my_center|LOCUS_07520 811514 812419 gene locus_tag LOCUS_07530 811514 812419 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556463.1 protein_id gnl|my_center|LOCUS_07530 812434 813195 gene locus_tag LOCUS_07540 812434 813195 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206620.1 protein_id gnl|my_center|LOCUS_07540 814266 813199 gene locus_tag LOCUS_07550 814266 813199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 814225 814476 gene locus_tag LOCUS_07560 814225 814476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 814476 814916 gene locus_tag LOCUS_07570 814476 814916 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094122848.1 protein_id gnl|my_center|LOCUS_07570 815057 815728 gene locus_tag LOCUS_07580 815057 815728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 816429 815737 gene locus_tag LOCUS_07590 816429 815737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 816581 817348 gene locus_tag LOCUS_07600 816581 817348 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114490.1 protein_id gnl|my_center|LOCUS_07600 817690 817361 gene locus_tag LOCUS_07610 817690 817361 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970224.1 protein_id gnl|my_center|LOCUS_07610 818949 817708 gene locus_tag LOCUS_07620 818949 817708 CDS product NADH:flavin oxidoreductase/NADH oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528855.1 protein_id gnl|my_center|LOCUS_07620 819010 819921 gene locus_tag LOCUS_07630 819010 819921 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113465.1 protein_id gnl|my_center|LOCUS_07630 819955 821085 gene locus_tag LOCUS_07640 819955 821085 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404282.1 protein_id gnl|my_center|LOCUS_07640 822084 821164 gene locus_tag LOCUS_07650 822084 821164 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202681.1 protein_id gnl|my_center|LOCUS_07650 822633 822229 gene locus_tag LOCUS_07660 822633 822229 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118829160.1 protein_id gnl|my_center|LOCUS_07660 823257 822637 gene locus_tag LOCUS_07670 823257 822637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 823311 824114 gene locus_tag LOCUS_07680 823311 824114 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070911.1 protein_id gnl|my_center|LOCUS_07680 824194 825612 gene locus_tag LOCUS_07690 824194 825612 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064414.1 protein_id gnl|my_center|LOCUS_07690 825831 825622 gene locus_tag LOCUS_07700 825831 825622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 827547 825844 gene locus_tag LOCUS_07710 gene bcsG 827547 825844 CDS product cellulose biosynthesis protein BcsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191563.1 protein_id gnl|my_center|LOCUS_07710 830038 827552 gene locus_tag LOCUS_07720 gene bcsA 830038 827552 CDS product UDP-forming cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528862.1 protein_id gnl|my_center|LOCUS_07720 830775 830035 gene locus_tag LOCUS_07730 gene bcsQ 830775 830035 CDS product cellulose biosynthesis protein BcsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537224.1 protein_id gnl|my_center|LOCUS_07730 830981 830772 gene locus_tag LOCUS_07740 830981 830772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 832384 830978 gene locus_tag LOCUS_07750 832384 830978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 834742 832385 gene locus_tag LOCUS_07760 834742 832385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 835973 834822 gene locus_tag LOCUS_07770 835973 834822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 838183 835976 gene locus_tag LOCUS_07780 gene bcsB 838183 835976 CDS product cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205645.1 protein_id gnl|my_center|LOCUS_07780 838439 838777 gene locus_tag LOCUS_07790 838439 838777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 838784 841867 gene locus_tag LOCUS_07800 838784 841867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 842750 841878 gene locus_tag LOCUS_07810 842750 841878 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184845.1 protein_id gnl|my_center|LOCUS_07810 842812 843900 gene locus_tag LOCUS_07820 842812 843900 CDS product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036611.1 protein_id gnl|my_center|LOCUS_07820 843891 844769 gene locus_tag LOCUS_07830 843891 844769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 846672 844774 gene locus_tag LOCUS_07840 846672 844774 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941581.1 protein_id gnl|my_center|LOCUS_07840 847535 846675 gene locus_tag LOCUS_07850 847535 846675 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931628.1 protein_id gnl|my_center|LOCUS_07850 848670 847546 gene locus_tag LOCUS_07860 gene rodA 848670 847546 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189171.1 protein_id gnl|my_center|LOCUS_07860 850589 848667 gene locus_tag LOCUS_07870 gene mrdA 850589 848667 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204769.1 protein_id gnl|my_center|LOCUS_07870 851110 850586 gene locus_tag LOCUS_07880 gene mreD 851110 850586 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189260.1 protein_id gnl|my_center|LOCUS_07880 852065 851100 gene locus_tag LOCUS_07890 gene mreC 852065 851100 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189331.1 protein_id gnl|my_center|LOCUS_07890 853173 852130 gene locus_tag LOCUS_07900 853173 852130 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189550.1 protein_id gnl|my_center|LOCUS_07900 853407 853706 gene locus_tag LOCUS_07910 gene gatC 853407 853706 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929772.1 protein_id gnl|my_center|LOCUS_07910 853770 855254 gene locus_tag LOCUS_07920 gene gatA 853770 855254 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525859.1 protein_id gnl|my_center|LOCUS_07920 855269 856708 gene locus_tag LOCUS_07930 gene gatB 855269 856708 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929770.1 protein_id gnl|my_center|LOCUS_07930 857804 857022 gene locus_tag LOCUS_07940 857804 857022 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686889.1 protein_id gnl|my_center|LOCUS_07940 857835 858533 gene locus_tag LOCUS_07950 gene pyrE 857835 858533 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929769.1 protein_id gnl|my_center|LOCUS_07950 858824 858540 gene locus_tag LOCUS_07960 858824 858540 CDS product YbeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818417.1 protein_id gnl|my_center|LOCUS_07960 860021 858828 gene locus_tag LOCUS_07970 860021 858828 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064727.1 protein_id gnl|my_center|LOCUS_07970 860706 860068 gene locus_tag LOCUS_07980 860706 860068 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522936.1 protein_id gnl|my_center|LOCUS_07980 861014 860703 gene locus_tag LOCUS_07990 861014 860703 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530970.1 protein_id gnl|my_center|LOCUS_07990 862201 861056 gene locus_tag LOCUS_08000 862201 861056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 862290 863042 gene locus_tag LOCUS_08010 862290 863042 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447888.1 protein_id gnl|my_center|LOCUS_08010 863039 863857 gene locus_tag LOCUS_08020 863039 863857 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189091.1 protein_id gnl|my_center|LOCUS_08020 863854 864585 gene locus_tag LOCUS_08030 863854 864585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 865684 864587 gene locus_tag LOCUS_08040 865684 864587 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951292.1 protein_id gnl|my_center|LOCUS_08040 865683 866570 gene locus_tag LOCUS_08050 865683 866570 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389873.1 protein_id gnl|my_center|LOCUS_08050 866567 866959 gene locus_tag LOCUS_08060 866567 866959 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199336.1 protein_id gnl|my_center|LOCUS_08060 866975 867847 gene locus_tag LOCUS_08070 gene ttcA 866975 867847 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189298.1 protein_id gnl|my_center|LOCUS_08070 869369 867849 gene locus_tag LOCUS_08080 gene ilvA 869369 867849 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064913.1 protein_id gnl|my_center|LOCUS_08080 869622 870122 gene locus_tag LOCUS_08090 869622 870122 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927242.1 protein_id gnl|my_center|LOCUS_08090 870129 870770 gene locus_tag LOCUS_08100 870129 870770 CDS product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403888.1 protein_id gnl|my_center|LOCUS_08100 870786 871784 gene locus_tag LOCUS_08110 870786 871784 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815184.1 protein_id gnl|my_center|LOCUS_08110 871843 872406 gene locus_tag LOCUS_08120 gene hslV 871843 872406 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818422.1 protein_id gnl|my_center|LOCUS_08120 872411 873742 gene locus_tag LOCUS_08130 gene hslU 872411 873742 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523084.1 protein_id gnl|my_center|LOCUS_08130 873830 874717 gene locus_tag LOCUS_08140 gene argB 873830 874717 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815193.1 protein_id gnl|my_center|LOCUS_08140 874759 875409 gene locus_tag LOCUS_08150 874759 875409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 875410 876681 gene locus_tag LOCUS_08160 875410 876681 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403248.1 protein_id gnl|my_center|LOCUS_08160 876696 878063 gene locus_tag LOCUS_08170 gene glmU 876696 878063 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818080.1 protein_id gnl|my_center|LOCUS_08170 878080 879921 gene locus_tag LOCUS_08180 gene glmS 878080 879921 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064828.1 protein_id gnl|my_center|LOCUS_08180 880729 879908 gene locus_tag LOCUS_08190 880729 879908 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206793.1 protein_id gnl|my_center|LOCUS_08190 881646 880750 gene locus_tag LOCUS_08200 881646 880750 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114217.1 protein_id gnl|my_center|LOCUS_08200 881756 882778 gene locus_tag LOCUS_08210 881756 882778 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114843.1 protein_id gnl|my_center|LOCUS_08210 883846 882728 gene locus_tag LOCUS_08220 883846 882728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 884002 884087 gene locus_tag LOCUS_t00050 884002 884087 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 884141 884214 gene locus_tag LOCUS_t00060 884141 884214 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 884232 884306 gene locus_tag LOCUS_t00070 884232 884306 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 884356 885549 gene locus_tag LOCUS_08230 gene tuf 884356 885549 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198356.1 protein_id gnl|my_center|LOCUS_08230 885564 885639 gene locus_tag LOCUS_t00080 885564 885639 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 885697 886080 gene locus_tag LOCUS_08240 gene secE 885697 886080 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185179.1 protein_id gnl|my_center|LOCUS_08240 886080 886613 gene locus_tag LOCUS_08250 gene nusG 886080 886613 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806885.1 protein_id gnl|my_center|LOCUS_08250 886729 887160 gene locus_tag LOCUS_08260 gene rplK 886729 887160 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198368.1 protein_id gnl|my_center|LOCUS_08260 887161 887859 gene locus_tag LOCUS_08270 gene rplA 887161 887859 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185135.1 protein_id gnl|my_center|LOCUS_08270 888071 888601 gene locus_tag LOCUS_08280 gene rplJ 888071 888601 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806888.1 protein_id gnl|my_center|LOCUS_08280 888649 889026 gene locus_tag LOCUS_08290 gene rplL 888649 889026 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806889.1 protein_id gnl|my_center|LOCUS_08290 889165 893274 gene locus_tag LOCUS_08300 gene rpoB 889165 893274 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198365.1 protein_id gnl|my_center|LOCUS_08300 893298 897527 gene locus_tag LOCUS_08310 gene rpoC 893298 897527 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818292.1 protein_id gnl|my_center|LOCUS_08310 897671 898054 gene locus_tag LOCUS_08320 gene rpsL 897671 898054 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521903.1 protein_id gnl|my_center|LOCUS_08320 898159 898629 gene locus_tag LOCUS_08330 gene rpsG 898159 898629 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198359.1 protein_id gnl|my_center|LOCUS_08330 898648 900750 gene locus_tag LOCUS_08340 gene fusA 898648 900750 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198357.1 protein_id gnl|my_center|LOCUS_08340 900785 901978 gene locus_tag LOCUS_08350 gene tuf 900785 901978 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198356.1 protein_id gnl|my_center|LOCUS_08350 902078 902389 gene locus_tag LOCUS_08360 gene rpsJ 902078 902389 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806903.1 protein_id gnl|my_center|LOCUS_08360 902489 903133 gene locus_tag LOCUS_08370 gene rplC 902489 903133 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925687.1 protein_id gnl|my_center|LOCUS_08370 903144 903764 gene locus_tag LOCUS_08380 gene rplD 903144 903764 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199276.1 protein_id gnl|my_center|LOCUS_08380 903761 904057 gene locus_tag LOCUS_08390 gene rplW 903761 904057 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199275.1 protein_id gnl|my_center|LOCUS_08390 904059 904886 gene locus_tag LOCUS_08400 gene rplB 904059 904886 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806907.1 protein_id gnl|my_center|LOCUS_08400 904902 905177 gene locus_tag LOCUS_08410 gene rpsS 904902 905177 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199273.1 protein_id gnl|my_center|LOCUS_08410 905188 905517 gene locus_tag LOCUS_08420 gene rplV 905188 905517 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215424.1 protein_id gnl|my_center|LOCUS_08420 905527 906333 gene locus_tag LOCUS_08430 gene rpsC 905527 906333 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185240.1 protein_id gnl|my_center|LOCUS_08430 906348 906764 gene locus_tag LOCUS_08440 gene rplP 906348 906764 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199857.1 protein_id gnl|my_center|LOCUS_08440 906768 906962 gene locus_tag LOCUS_08450 gene rpmC 906768 906962 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806912.1 protein_id gnl|my_center|LOCUS_08450 906959 907231 gene locus_tag LOCUS_08460 gene rpsQ 906959 907231 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201274.1 protein_id gnl|my_center|LOCUS_08460 907340 907708 gene locus_tag LOCUS_08470 gene rplN 907340 907708 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806916.1 protein_id gnl|my_center|LOCUS_08470 907716 908030 gene locus_tag LOCUS_08480 gene rplX 907716 908030 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038655.1 protein_id gnl|my_center|LOCUS_08480 908355 908450 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 908688 908993 gene locus_tag LOCUS_08490 gene rpsN 908688 908993 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197948.1 protein_id gnl|my_center|LOCUS_08490 909006 909401 gene locus_tag LOCUS_08500 gene rpsH 909006 909401 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185153.1 protein_id gnl|my_center|LOCUS_08500 909414 909947 gene locus_tag LOCUS_08510 gene rplF 909414 909947 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116801.1 protein_id gnl|my_center|LOCUS_08510 909966 910328 gene locus_tag LOCUS_08520 gene rplR 909966 910328 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215441.1 protein_id gnl|my_center|LOCUS_08520 910338 910862 gene locus_tag LOCUS_08530 gene rpsE 910338 910862 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197945.1 protein_id gnl|my_center|LOCUS_08530 910865 911047 gene locus_tag LOCUS_08540 gene rpmD 910865 911047 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806924.1 protein_id gnl|my_center|LOCUS_08540 911047 911481 gene locus_tag LOCUS_08550 gene rplO 911047 911481 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215449.1 protein_id gnl|my_center|LOCUS_08550 911493 912821 gene locus_tag LOCUS_08560 gene secY 911493 912821 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197940.1 protein_id gnl|my_center|LOCUS_08560 912825 913043 gene locus_tag LOCUS_08570 gene infA 912825 913043 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521905.1 protein_id gnl|my_center|LOCUS_08570 913197 913562 gene locus_tag LOCUS_08580 gene rpsM 913197 913562 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197938.1 protein_id gnl|my_center|LOCUS_08580 913590 913985 gene locus_tag LOCUS_08590 gene rpsK 913590 913985 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806930.1 protein_id gnl|my_center|LOCUS_08590 914062 914685 gene locus_tag LOCUS_08600 gene rpsD 914062 914685 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197926.1 protein_id gnl|my_center|LOCUS_08600 914758 915738 gene locus_tag LOCUS_08610 gene rpoA 914758 915738 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197925.1 protein_id gnl|my_center|LOCUS_08610 915772 916170 gene locus_tag LOCUS_08620 gene rplQ 915772 916170 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197924.1 protein_id gnl|my_center|LOCUS_08620 916308 917237 gene locus_tag LOCUS_08630 916308 917237 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810478.1 protein_id gnl|my_center|LOCUS_08630 917230 917997 gene locus_tag LOCUS_08640 917230 917997 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192376.1 protein_id gnl|my_center|LOCUS_08640 917994 918338 gene locus_tag LOCUS_08650 917994 918338 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632829.1 protein_id gnl|my_center|LOCUS_08650 918331 920229 gene locus_tag LOCUS_08660 gene dsbD 918331 920229 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064751.1 protein_id gnl|my_center|LOCUS_08660 921292 920243 gene locus_tag LOCUS_08670 921292 920243 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208248.1 protein_id gnl|my_center|LOCUS_08670 922287 921292 gene locus_tag LOCUS_08680 gene hemB 922287 921292 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521908.1 protein_id gnl|my_center|LOCUS_08680 922946 922284 gene locus_tag LOCUS_08690 gene yihA 922946 922284 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521909.1 protein_id gnl|my_center|LOCUS_08690 923110 923775 gene locus_tag LOCUS_08700 923110 923775 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557316.1 protein_id gnl|my_center|LOCUS_08700 923927 926059 gene locus_tag LOCUS_08710 923927 926059 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527907.1 protein_id gnl|my_center|LOCUS_08710 926056 927396 gene locus_tag LOCUS_08720 gene ccsB 926056 927396 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931573.1 protein_id gnl|my_center|LOCUS_08720 928711 927404 gene locus_tag LOCUS_08730 gene lysA 928711 927404 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806944.1 protein_id gnl|my_center|LOCUS_08730 928933 928739 gene locus_tag LOCUS_08740 928933 928739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 928896 929222 gene locus_tag LOCUS_08750 gene cyaY 928896 929222 CDS product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806945.1 protein_id gnl|my_center|LOCUS_08750 931706 929229 gene locus_tag LOCUS_08760 931706 929229 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110255951.1 protein_id gnl|my_center|LOCUS_08760 931887 932855 gene locus_tag LOCUS_08770 931887 932855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 932846 933424 gene locus_tag LOCUS_08780 932846 933424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 933411 934055 gene locus_tag LOCUS_08790 933411 934055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 934052 934561 gene locus_tag LOCUS_08800 934052 934561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 934558 936639 gene locus_tag LOCUS_08810 gene pilQ 934558 936639 CDS product type IV pilus secretin PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946666.1 protein_id gnl|my_center|LOCUS_08810 936689 937249 gene locus_tag LOCUS_08820 936689 937249 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806947.1 protein_id gnl|my_center|LOCUS_08820 937246 938340 gene locus_tag LOCUS_08830 gene aroB 937246 938340 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196751.1 protein_id gnl|my_center|LOCUS_08830 938343 939476 gene locus_tag LOCUS_08840 938343 939476 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196750.1 protein_id gnl|my_center|LOCUS_08840 939485 940189 gene locus_tag LOCUS_08850 939485 940189 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196743.1 protein_id gnl|my_center|LOCUS_08850 940346 945070 gene locus_tag LOCUS_08860 940346 945070 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196742.1 protein_id gnl|my_center|LOCUS_08860 945100 946587 gene locus_tag LOCUS_08870 945100 946587 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527896.1 protein_id gnl|my_center|LOCUS_08870 947581 946679 gene locus_tag LOCUS_08880 947581 946679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 950546 947640 gene locus_tag LOCUS_08890 gene uvrA 950546 947640 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195192.1 protein_id gnl|my_center|LOCUS_08890 950637 951914 gene locus_tag LOCUS_08900 950637 951914 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951164.1 protein_id gnl|my_center|LOCUS_08900 952015 952512 gene locus_tag LOCUS_08910 gene ssb 952015 952512 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806953.1 protein_id gnl|my_center|LOCUS_08910 952644 953069 gene locus_tag LOCUS_08920 952644 953069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 953135 953794 gene locus_tag LOCUS_08930 953135 953794 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941248.1 protein_id gnl|my_center|LOCUS_08930 953808 954296 gene locus_tag LOCUS_08940 953808 954296 CDS product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929652.1 protein_id gnl|my_center|LOCUS_08940 954389 957331 gene locus_tag LOCUS_08950 954389 957331 CDS product monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268309.1 protein_id gnl|my_center|LOCUS_08950 957331 957675 gene locus_tag LOCUS_08960 957331 957675 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268310.1 protein_id gnl|my_center|LOCUS_08960 957672 959369 gene locus_tag LOCUS_08970 957672 959369 CDS product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771172.1 protein_id gnl|my_center|LOCUS_08970 959369 959857 gene locus_tag LOCUS_08980 959369 959857 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003397128.1 protein_id gnl|my_center|LOCUS_08980 959854 960132 gene locus_tag LOCUS_08990 959854 960132 CDS product K+/H+ antiporter subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554071.1 protein_id gnl|my_center|LOCUS_08990 960129 960521 gene locus_tag LOCUS_09000 960129 960521 CDS product Na+/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771168.1 protein_id gnl|my_center|LOCUS_09000 961572 960529 gene locus_tag LOCUS_09010 961572 960529 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208461.1 protein_id gnl|my_center|LOCUS_09010 961687 962808 gene locus_tag LOCUS_09020 961687 962808 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208462.1 protein_id gnl|my_center|LOCUS_09020 962990 963316 gene locus_tag LOCUS_09030 962990 963316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 963306 964007 gene locus_tag LOCUS_09040 963306 964007 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224946.1 protein_id gnl|my_center|LOCUS_09040 964004 965809 gene locus_tag LOCUS_09050 gene aspS 964004 965809 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189849.1 protein_id gnl|my_center|LOCUS_09050 965830 966339 gene locus_tag LOCUS_09060 gene nudB 965830 966339 CDS product dihydroneopterin triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189197.1 protein_id gnl|my_center|LOCUS_09060 966544 967338 gene locus_tag LOCUS_09070 966544 967338 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010204659.1 protein_id gnl|my_center|LOCUS_09070 967329 968681 gene locus_tag LOCUS_09080 gene clsB 967329 968681 CDS product cardiolipin synthase ClsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929973.1 protein_id gnl|my_center|LOCUS_09080 968707 969717 gene locus_tag LOCUS_09090 968707 969717 CDS product ligase-associated DNA damage response exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104885.1 protein_id gnl|my_center|LOCUS_09090 969714 971462 gene locus_tag LOCUS_09100 969714 971462 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268710.1 protein_id gnl|my_center|LOCUS_09100 971459 972355 gene locus_tag LOCUS_09110 971459 972355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 973752 972352 gene locus_tag LOCUS_09120 973752 972352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 974453 973767 gene locus_tag LOCUS_09130 974453 973767 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704710.1 protein_id gnl|my_center|LOCUS_09130 974589 975098 gene locus_tag LOCUS_09140 974589 975098 CDS product CpxP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005487153.1 protein_id gnl|my_center|LOCUS_09140 975195 975971 gene locus_tag LOCUS_09150 975195 975971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 976087 976746 gene locus_tag LOCUS_09160 gene can 976087 976746 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036740.1 protein_id gnl|my_center|LOCUS_09160 976830 977042 gene locus_tag LOCUS_09170 976830 977042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 977051 977473 gene locus_tag LOCUS_09180 977051 977473 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405100.1 protein_id gnl|my_center|LOCUS_09180 977488 978081 gene locus_tag LOCUS_09190 977488 978081 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524888.1 protein_id gnl|my_center|LOCUS_09190 978913 978152 gene locus_tag LOCUS_09200 978913 978152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 980868 979054 gene locus_tag LOCUS_09210 980868 979054 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114739.1 protein_id gnl|my_center|LOCUS_09210 981395 980925 gene locus_tag LOCUS_09220 981395 980925 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002001056.1 protein_id gnl|my_center|LOCUS_09220 981484 982512 gene locus_tag LOCUS_09230 981484 982512 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976142.1 protein_id gnl|my_center|LOCUS_09230 982509 983447 gene locus_tag LOCUS_09240 gene rocF 982509 983447 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808362.1 protein_id gnl|my_center|LOCUS_09240 983437 986793 gene locus_tag LOCUS_09250 gene putA 983437 986793 CDS product trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974305.1 protein_id gnl|my_center|LOCUS_09250 986855 989497 gene locus_tag LOCUS_09260 986855 989497 CDS product ligase-associated DNA damage response DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268715.1 protein_id gnl|my_center|LOCUS_09260 990037 989498 gene locus_tag LOCUS_09270 990037 989498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 990153 990812 gene locus_tag LOCUS_09280 gene pdeM 990153 990812 CDS product ligase-associated DNA damage response endonuclease PdeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268716.1 protein_id gnl|my_center|LOCUS_09280 991281 990829 gene locus_tag LOCUS_09290 991281 990829 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976297.1 protein_id gnl|my_center|LOCUS_09290 991507 992121 gene locus_tag LOCUS_09300 991507 992121 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189774.1 protein_id gnl|my_center|LOCUS_09300 992139 993929 gene locus_tag LOCUS_09310 992139 993929 CDS product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526128.1 protein_id gnl|my_center|LOCUS_09310 994005 996410 gene locus_tag LOCUS_09320 994005 996410 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189629.1 protein_id gnl|my_center|LOCUS_09320 996426 997625 gene locus_tag LOCUS_09330 996426 997625 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537877.1 protein_id gnl|my_center|LOCUS_09330 997716 998483 gene locus_tag LOCUS_09340 997716 998483 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201757.1 protein_id gnl|my_center|LOCUS_09340 998508 999308 gene locus_tag LOCUS_09350 998508 999308 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267408.1 protein_id gnl|my_center|LOCUS_09350 999358 999702 gene locus_tag LOCUS_09360 999358 999702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 1000005 1001333 gene locus_tag LOCUS_09370 1000005 1001333 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926684.1 protein_id gnl|my_center|LOCUS_09370 1001345 1001668 gene locus_tag LOCUS_09380 1001345 1001668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 1001734 1002021 gene locus_tag LOCUS_09390 1001734 1002021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 1002397 1003374 gene locus_tag LOCUS_09400 1002397 1003374 CDS product tripartite tricarboxylate transporter substrate binding protein BugD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969733.1 protein_id gnl|my_center|LOCUS_09400 1003394 1003846 gene locus_tag LOCUS_09410 1003394 1003846 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050979900.1 protein_id gnl|my_center|LOCUS_09410 1003849 1005351 gene locus_tag LOCUS_09420 1003849 1005351 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034850911.1 protein_id gnl|my_center|LOCUS_09420 1005497 1006372 gene locus_tag LOCUS_09430 1005497 1006372 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814390.1 protein_id gnl|my_center|LOCUS_09430 1006787 1006383 gene locus_tag LOCUS_09440 1006787 1006383 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189082.1 protein_id gnl|my_center|LOCUS_09440 1006934 1007335 gene locus_tag LOCUS_09450 1006934 1007335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 1008170 1007352 gene locus_tag LOCUS_09460 1008170 1007352 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070794.1 protein_id gnl|my_center|LOCUS_09460 1008266 1010104 gene locus_tag LOCUS_09470 1008266 1010104 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189741.1 protein_id gnl|my_center|LOCUS_09470 1010085 1010996 gene locus_tag LOCUS_09480 1010085 1010996 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194310.1 protein_id gnl|my_center|LOCUS_09480 1011100 1012551 gene locus_tag LOCUS_09490 gene aspA 1011100 1012551 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224033.1 protein_id gnl|my_center|LOCUS_09490 1012630 1013529 gene locus_tag LOCUS_09500 1012630 1013529 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090327.1 protein_id gnl|my_center|LOCUS_09500 1013625 1014365 gene locus_tag LOCUS_09510 1013625 1014365 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194293.1 protein_id gnl|my_center|LOCUS_09510 1014365 1015051 gene locus_tag LOCUS_09520 1014365 1015051 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090325.1 protein_id gnl|my_center|LOCUS_09520 1015064 1015792 gene locus_tag LOCUS_09530 1015064 1015792 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082761.1 protein_id gnl|my_center|LOCUS_09530 1016777 1015971 gene locus_tag LOCUS_09540 1016777 1015971 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813226.1 protein_id gnl|my_center|LOCUS_09540 1016897 1017829 gene locus_tag LOCUS_09550 gene waaC 1016897 1017829 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532246.1 protein_id gnl|my_center|LOCUS_09550 1017826 1019154 gene locus_tag LOCUS_09560 gene waaA 1017826 1019154 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185503.1 protein_id gnl|my_center|LOCUS_09560 1020585 1019173 gene locus_tag LOCUS_09570 1020585 1019173 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815100.1 protein_id gnl|my_center|LOCUS_09570 1021267 1020599 gene locus_tag LOCUS_09580 1021267 1020599 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522277.1 protein_id gnl|my_center|LOCUS_09580 1021970 1021317 gene locus_tag LOCUS_09590 1021970 1021317 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174863573.1 protein_id gnl|my_center|LOCUS_09590 1022113 1023033 gene locus_tag LOCUS_09600 1022113 1023033 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039182.1 protein_id gnl|my_center|LOCUS_09600 1023040 1023243 gene locus_tag LOCUS_09610 1023040 1023243 CDS product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814195.1 protein_id gnl|my_center|LOCUS_09610 1023240 1024277 gene locus_tag LOCUS_09620 gene waaF 1023240 1024277 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105268.1 protein_id gnl|my_center|LOCUS_09620 1024315 1025169 gene locus_tag LOCUS_09630 gene purU 1024315 1025169 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522850.1 protein_id gnl|my_center|LOCUS_09630 1025185 1025640 gene locus_tag LOCUS_09640 1025185 1025640 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814197.1 protein_id gnl|my_center|LOCUS_09640 1025656 1026654 gene locus_tag LOCUS_09650 1025656 1026654 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189905.1 protein_id gnl|my_center|LOCUS_09650 1026602 1027288 gene locus_tag LOCUS_09660 1026602 1027288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 1027285 1028406 gene locus_tag LOCUS_09670 1027285 1028406 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921980.1 protein_id gnl|my_center|LOCUS_09670 1028406 1029200 gene locus_tag LOCUS_09680 1028406 1029200 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065028.1 protein_id gnl|my_center|LOCUS_09680 1029739 1029197 gene locus_tag LOCUS_09690 gene msrA 1029739 1029197 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_09690 1029881 1030216 gene locus_tag LOCUS_09700 gene yajC 1029881 1030216 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064323.1 protein_id gnl|my_center|LOCUS_09700 1030226 1032118 gene locus_tag LOCUS_09710 gene secD 1030226 1032118 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809414.1 protein_id gnl|my_center|LOCUS_09710 1032150 1033103 gene locus_tag LOCUS_09720 gene secF 1032150 1033103 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522118.1 protein_id gnl|my_center|LOCUS_09720 1033128 1034063 gene locus_tag LOCUS_09730 1033128 1034063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 1034671 1034459 gene locus_tag LOCUS_09740 1034671 1034459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 1034802 1035695 gene locus_tag LOCUS_09750 1034802 1035695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 1035700 1038492 gene locus_tag LOCUS_09760 1035700 1038492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 1039057 1039527 gene locus_tag LOCUS_09770 1039057 1039527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 1040929 1039553 gene locus_tag LOCUS_09780 gene purB 1040929 1039553 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446450.1 protein_id gnl|my_center|LOCUS_09780 1041121 1041732 gene locus_tag LOCUS_09790 1041121 1041732 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200504.1 protein_id gnl|my_center|LOCUS_09790 1042861 1041794 gene locus_tag LOCUS_09800 gene mnmA 1042861 1041794 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544237.1 protein_id gnl|my_center|LOCUS_09800 1043382 1042867 gene locus_tag LOCUS_09810 1043382 1042867 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194031.1 protein_id gnl|my_center|LOCUS_09810 1043840 1045861 gene locus_tag LOCUS_09820 1043840 1045861 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038165.1 protein_id gnl|my_center|LOCUS_09820 1046069 1047196 gene locus_tag LOCUS_09830 1046069 1047196 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112662.1 protein_id gnl|my_center|LOCUS_09830 1047210 1047503 gene locus_tag LOCUS_09840 1047210 1047503 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083974.1 protein_id gnl|my_center|LOCUS_09840 1047528 1048973 gene locus_tag LOCUS_09850 1047528 1048973 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813039.1 protein_id gnl|my_center|LOCUS_09850 1049921 1049046 gene locus_tag LOCUS_09860 1049921 1049046 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918244.1 protein_id gnl|my_center|LOCUS_09860 1050994 1049918 gene locus_tag LOCUS_09870 gene queA 1050994 1049918 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002248769.1 protein_id gnl|my_center|LOCUS_09870 1051107 1051021 gene locus_tag LOCUS_t00090 1051107 1051021 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1051246 1052853 gene locus_tag LOCUS_09880 1051246 1052853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 1053076 1052843 gene locus_tag LOCUS_09890 1053076 1052843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 1053198 1054127 gene locus_tag LOCUS_09900 1053198 1054127 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693583.1 protein_id gnl|my_center|LOCUS_09900 1054247 1055848 gene locus_tag LOCUS_09910 1054247 1055848 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194757.1 protein_id gnl|my_center|LOCUS_09910 1056741 1055845 gene locus_tag LOCUS_09920 gene gluQRS 1056741 1055845 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818220.1 protein_id gnl|my_center|LOCUS_09920 1057692 1056754 gene locus_tag LOCUS_09930 1057692 1056754 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811174.1 protein_id gnl|my_center|LOCUS_09930 1057763 1058473 gene locus_tag LOCUS_09940 1057763 1058473 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568463.1 protein_id gnl|my_center|LOCUS_09940 1058500 1059060 gene locus_tag LOCUS_09950 1058500 1059060 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197907.1 protein_id gnl|my_center|LOCUS_09950 1059122 1062652 gene locus_tag LOCUS_09960 gene dnaE 1059122 1062652 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813231.1 protein_id gnl|my_center|LOCUS_09960 1062985 1064751 gene locus_tag LOCUS_09970 gene msbA 1062985 1064751 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957851.1 protein_id gnl|my_center|LOCUS_09970 1065782 1064724 gene locus_tag LOCUS_09980 gene rfaQ 1065782 1064724 CDS product putative lipopolysaccharide heptosyltransferase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703803.1 protein_id gnl|my_center|LOCUS_09980 1065930 1067063 gene locus_tag LOCUS_09990 1065930 1067063 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000975743.1 protein_id gnl|my_center|LOCUS_09990 1067063 1067872 gene locus_tag LOCUS_10000 1067063 1067872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 1068165 1069289 gene locus_tag LOCUS_10010 gene omp38 1068165 1069289 CDS product porin Omp38 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528149.1 protein_id gnl|my_center|LOCUS_10010 1069834 1069445 gene locus_tag LOCUS_10020 1069834 1069445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 1071025 1070030 gene locus_tag LOCUS_10030 gene bioB 1071025 1070030 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926132.1 protein_id gnl|my_center|LOCUS_10030 1072381 1071035 gene locus_tag LOCUS_10040 gene bioA 1072381 1071035 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057770.1 protein_id gnl|my_center|LOCUS_10040 1073012 1072395 gene locus_tag LOCUS_10050 1073012 1072395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10050 1073809 1073009 gene locus_tag LOCUS_10060 1073809 1073009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10060 1074570 1073827 gene locus_tag LOCUS_10070 1074570 1073827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 1075757 1074567 gene locus_tag LOCUS_10080 gene bioF 1075757 1074567 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033449714.1 protein_id gnl|my_center|LOCUS_10080 1077242 1075764 gene locus_tag LOCUS_10090 gene rng 1077242 1075764 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522445.1 protein_id gnl|my_center|LOCUS_10090 1077850 1077260 gene locus_tag LOCUS_10100 1077850 1077260 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185695.1 protein_id gnl|my_center|LOCUS_10100 1078410 1077940 gene locus_tag LOCUS_10110 gene rlmH 1078410 1077940 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186098.1 protein_id gnl|my_center|LOCUS_10110 1078848 1078426 gene locus_tag LOCUS_10120 1078848 1078426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 1079448 1078891 gene locus_tag LOCUS_10130 1079448 1078891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 1080221 1080679 gene locus_tag LOCUS_10140 1080221 1080679 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128238.1 protein_id gnl|my_center|LOCUS_10140 1081643 1080738 gene locus_tag LOCUS_10150 gene hemF 1081643 1080738 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526433.1 protein_id gnl|my_center|LOCUS_10150 1082929 1081658 gene locus_tag LOCUS_10160 gene purD 1082929 1081658 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186246.1 protein_id gnl|my_center|LOCUS_10160 1083676 1082951 gene locus_tag LOCUS_10170 1083676 1082951 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813187.1 protein_id gnl|my_center|LOCUS_10170 1083828 1084268 gene locus_tag LOCUS_10180 gene mscL 1083828 1084268 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192898.1 protein_id gnl|my_center|LOCUS_10180 1084569 1085858 gene locus_tag LOCUS_10190 1084569 1085858 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040091.1 protein_id gnl|my_center|LOCUS_10190 1085905 1087722 gene locus_tag LOCUS_10200 1085905 1087722 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820957.1 protein_id gnl|my_center|LOCUS_10200 1087767 1089827 gene locus_tag LOCUS_10210 1087767 1089827 CDS product site-specific recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207492.1 protein_id gnl|my_center|LOCUS_10210 1090390 1089830 gene locus_tag LOCUS_10220 1090390 1089830 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201622.1 protein_id gnl|my_center|LOCUS_10220 1090658 1092574 gene locus_tag LOCUS_10230 gene thiC 1090658 1092574 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929683.1 protein_id gnl|my_center|LOCUS_10230 1092839 1094146 gene locus_tag LOCUS_10240 1092839 1094146 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932228.1 protein_id gnl|my_center|LOCUS_10240 1095357 1094212 gene locus_tag LOCUS_10250 gene hfaB 1095357 1094212 CDS product holdfast anchoring protein HfaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920482.1 protein_id gnl|my_center|LOCUS_10250 1095721 1095401 gene locus_tag LOCUS_10260 gene hfaA 1095721 1095401 CDS product holdfast attachment protein HfaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920481.1 protein_id gnl|my_center|LOCUS_10260 1096449 1095820 gene locus_tag LOCUS_10270 1096449 1095820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 1096617 1097768 gene locus_tag LOCUS_10280 gene nadA 1096617 1097768 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185886.1 protein_id gnl|my_center|LOCUS_10280 1097765 1098631 gene locus_tag LOCUS_10290 gene nadC 1097765 1098631 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185611.1 protein_id gnl|my_center|LOCUS_10290 1100241 1098640 gene locus_tag LOCUS_10300 gene nadB 1100241 1098640 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186553.1 protein_id gnl|my_center|LOCUS_10300 1102350 1100347 gene locus_tag LOCUS_10310 1102350 1100347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 1103145 1102441 gene locus_tag LOCUS_10320 gene trmB 1103145 1102441 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931594.1 protein_id gnl|my_center|LOCUS_10320 1103945 1103142 gene locus_tag LOCUS_10330 1103945 1103142 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931559.1 protein_id gnl|my_center|LOCUS_10330 1104171 1103968 gene locus_tag LOCUS_10340 gene thiS 1104171 1103968 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807812.1 protein_id gnl|my_center|LOCUS_10340 1104313 1105269 gene locus_tag LOCUS_10350 gene arsS 1104313 1105269 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121078.1 protein_id gnl|my_center|LOCUS_10350 1106600 1105233 gene locus_tag LOCUS_10360 1106600 1105233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 1106786 1106622 gene locus_tag LOCUS_10370 1106786 1106622 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814980.1 protein_id gnl|my_center|LOCUS_10370 1106880 1107695 gene locus_tag LOCUS_10380 1106880 1107695 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010427216.1 protein_id gnl|my_center|LOCUS_10380 1107688 1108353 gene locus_tag LOCUS_10390 gene thiE 1107688 1108353 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763279.1 protein_id gnl|my_center|LOCUS_10390 1108378 1109673 gene locus_tag LOCUS_10400 gene hemL 1108378 1109673 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814987.1 protein_id gnl|my_center|LOCUS_10400 1110153 1109749 gene locus_tag LOCUS_10410 1110153 1109749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 1111761 1110259 gene locus_tag LOCUS_10420 1111761 1110259 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259342.1 protein_id gnl|my_center|LOCUS_10420 1111858 1112442 gene locus_tag LOCUS_10430 1111858 1112442 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185441.1 protein_id gnl|my_center|LOCUS_10430 1112446 1112880 gene locus_tag LOCUS_10440 gene ruvX 1112446 1112880 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017108.1 protein_id gnl|my_center|LOCUS_10440 1112877 1113383 gene locus_tag LOCUS_10450 gene pyrR 1112877 1113383 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185915.1 protein_id gnl|my_center|LOCUS_10450 1113380 1114351 gene locus_tag LOCUS_10460 1113380 1114351 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534003.1 protein_id gnl|my_center|LOCUS_10460 1114373 1115689 gene locus_tag LOCUS_10470 1114373 1115689 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186353.1 protein_id gnl|my_center|LOCUS_10470 1115701 1116459 gene locus_tag LOCUS_10480 1115701 1116459 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186297.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10480 1117321 1116476 gene locus_tag LOCUS_10490 1117321 1116476 CDS product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000035032.1 protein_id gnl|my_center|LOCUS_10490 1117435 1118826 gene locus_tag LOCUS_10500 1117435 1118826 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522260.1 protein_id gnl|my_center|LOCUS_10500 1118827 1119399 gene locus_tag LOCUS_10510 1118827 1119399 CDS product DUF1415 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022607.1 protein_id gnl|my_center|LOCUS_10510 1119488 1119892 gene locus_tag LOCUS_10520 1119488 1119892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 1120246 1120896 gene locus_tag LOCUS_10530 gene queE 1120246 1120896 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931061.1 protein_id gnl|my_center|LOCUS_10530 1120893 1121243 gene locus_tag LOCUS_10540 gene queD 1120893 1121243 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090505.1 protein_id gnl|my_center|LOCUS_10540 1124187 1121791 gene locus_tag LOCUS_10550 1124187 1121791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 1125608 1124184 gene locus_tag LOCUS_10560 1125608 1124184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 1126527 1125706 gene locus_tag LOCUS_10570 1126527 1125706 CDS product rRNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811964.1 protein_id gnl|my_center|LOCUS_10570 1126482 1126730 gene locus_tag LOCUS_10580 1126482 1126730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 1129843 1126787 gene locus_tag LOCUS_10590 1129843 1126787 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920956.1 protein_id gnl|my_center|LOCUS_10590 1130895 1129849 gene locus_tag LOCUS_10600 1130895 1129849 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625967.1 protein_id gnl|my_center|LOCUS_10600 1132355 1130892 gene locus_tag LOCUS_10610 1132355 1130892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 1133017 1132352 gene locus_tag LOCUS_10620 1133017 1132352 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990882.1 protein_id gnl|my_center|LOCUS_10620 1133180 1133833 gene locus_tag LOCUS_10630 1133180 1133833 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073182.1 protein_id gnl|my_center|LOCUS_10630 1134010 1135359 gene locus_tag LOCUS_10640 gene gdhA 1134010 1135359 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962445.1 protein_id gnl|my_center|LOCUS_10640 1135412 1136173 gene locus_tag LOCUS_10650 1135412 1136173 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102071.1 protein_id gnl|my_center|LOCUS_10650 1136895 1136287 gene locus_tag LOCUS_10660 1136895 1136287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 1137183 1138271 gene locus_tag LOCUS_10670 1137183 1138271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 1138268 1138891 gene locus_tag LOCUS_10680 1138268 1138891 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546220.1 protein_id gnl|my_center|LOCUS_10680 1139019 1139699 gene locus_tag LOCUS_10690 1139019 1139699 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020574.1 protein_id gnl|my_center|LOCUS_10690 1139713 1141074 gene locus_tag LOCUS_10700 1139713 1141074 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088478.1 protein_id gnl|my_center|LOCUS_10700 1141080 1141928 gene locus_tag LOCUS_10710 gene ntrB 1141080 1141928 CDS product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967199.1 protein_id gnl|my_center|LOCUS_10710 1141935 1142921 gene locus_tag LOCUS_10720 1141935 1142921 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088476.1 protein_id gnl|my_center|LOCUS_10720 1142918 1143361 gene locus_tag LOCUS_10730 gene cynS 1142918 1143361 CDS product cyanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082956.1 protein_id gnl|my_center|LOCUS_10730 1143442 1143810 gene locus_tag LOCUS_10740 1143442 1143810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 1145112 1144423 gene locus_tag LOCUS_10750 1145112 1144423 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277074.1 protein_id gnl|my_center|LOCUS_10750 1147412 1145124 gene locus_tag LOCUS_10760 gene selD 1147412 1145124 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036891662.1 protein_id gnl|my_center|LOCUS_10760 1148451 1147399 gene locus_tag LOCUS_10770 1148451 1147399 CDS product GPMC system family 4 glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039643499.1 protein_id gnl|my_center|LOCUS_10770 1148570 1149763 gene locus_tag LOCUS_10780 1148570 1149763 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535007.1 protein_id gnl|my_center|LOCUS_10780 1151371 1150400 gene locus_tag LOCUS_10790 gene egtD 1151371 1150400 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931515.1 protein_id gnl|my_center|LOCUS_10790 1152215 1151397 gene locus_tag LOCUS_10800 gene phnE 1152215 1151397 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266574.1 protein_id gnl|my_center|LOCUS_10800 1153060 1152212 gene locus_tag LOCUS_10810 1153060 1152212 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103283.1 protein_id gnl|my_center|LOCUS_10810 1153899 1153057 gene locus_tag LOCUS_10820 1153899 1153057 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113154.1 protein_id gnl|my_center|LOCUS_10820 1154834 1153959 gene locus_tag LOCUS_10830 1154834 1153959 CDS product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169047059.1 protein_id gnl|my_center|LOCUS_10830 1154782 1154937 gene locus_tag LOCUS_10840 1154782 1154937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 1155549 1154956 gene locus_tag LOCUS_10850 1155549 1154956 CDS product YHS domain-containing (seleno)protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050984080.1 protein_id gnl|my_center|LOCUS_10850 1156907 1155552 gene locus_tag LOCUS_10860 1156907 1155552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 1157731 1156925 gene locus_tag LOCUS_10870 1157731 1156925 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853568.1 protein_id gnl|my_center|LOCUS_10870 1157866 1158213 gene locus_tag LOCUS_10880 1157866 1158213 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068360.1 protein_id gnl|my_center|LOCUS_10880 1158610 1158227 gene locus_tag LOCUS_10890 1158610 1158227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 1158724 1159821 gene locus_tag LOCUS_10900 1158724 1159821 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 protein_id gnl|my_center|LOCUS_10900 1159829 1160923 gene locus_tag LOCUS_10910 1159829 1160923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 1160920 1161813 gene locus_tag LOCUS_10920 1160920 1161813 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405888.1 protein_id gnl|my_center|LOCUS_10920 1161837 1164446 gene locus_tag LOCUS_10930 gene ndvB 1161837 1164446 CDS product glycosyltransferase NdvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115817.1 protein_id gnl|my_center|LOCUS_10930 1164443 1166125 gene locus_tag LOCUS_10940 1164443 1166125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 1166157 1166810 gene locus_tag LOCUS_10950 1166157 1166810 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385122.1 protein_id gnl|my_center|LOCUS_10950 1168260 1166815 gene locus_tag LOCUS_10960 1168260 1166815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528441.1 protein_id gnl|my_center|LOCUS_10960 1170464 1168257 gene locus_tag LOCUS_10970 1170464 1168257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 1170855 1170592 gene locus_tag LOCUS_10980 1170855 1170592 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296560.1 protein_id gnl|my_center|LOCUS_10980 1171094 1170852 gene locus_tag LOCUS_10990 1171094 1170852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 1172043 1171162 gene locus_tag LOCUS_11000 1172043 1171162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 1173105 1172077 gene locus_tag LOCUS_11010 1173105 1172077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 1173367 1173292 gene locus_tag LOCUS_t00100 1173367 1173292 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1173957 1173460 gene locus_tag LOCUS_11020 gene ybeY 1173957 1173460 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105185.1 protein_id gnl|my_center|LOCUS_11020 1174963 1173947 gene locus_tag LOCUS_11030 1174963 1173947 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189139.1 protein_id gnl|my_center|LOCUS_11030 1176460 1175003 gene locus_tag LOCUS_11040 1176460 1175003 CDS product sensor histidine kinase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526207.1 protein_id gnl|my_center|LOCUS_11040 1177178 1176474 gene locus_tag LOCUS_11050 1177178 1176474 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526208.1 protein_id gnl|my_center|LOCUS_11050 1178113 1177253 gene locus_tag LOCUS_11060 gene pyrF 1178113 1177253 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194144.1 protein_id gnl|my_center|LOCUS_11060 1178312 1179130 gene locus_tag LOCUS_11070 1178312 1179130 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087048.1 protein_id gnl|my_center|LOCUS_11070 1179723 1180736 gene locus_tag LOCUS_11080 1179723 1180736 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941999.1 protein_id gnl|my_center|LOCUS_11080 1180737 1181426 gene locus_tag LOCUS_11090 1180737 1181426 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074244.1 protein_id gnl|my_center|LOCUS_11090 1181529 1182383 gene locus_tag LOCUS_11100 gene cysT 1181529 1182383 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928930.1 protein_id gnl|my_center|LOCUS_11100 1182383 1183264 gene locus_tag LOCUS_11110 gene cysW 1182383 1183264 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118746.1 protein_id gnl|my_center|LOCUS_11110 1183277 1184371 gene locus_tag LOCUS_11120 1183277 1184371 CDS product sulfate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704575.1 protein_id gnl|my_center|LOCUS_11120 1184368 1185297 gene locus_tag LOCUS_11130 1184368 1185297 CDS product CysB family HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118601.1 protein_id gnl|my_center|LOCUS_11130 1186365 1185841 gene locus_tag LOCUS_11140 1186365 1185841 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189275.1 protein_id gnl|my_center|LOCUS_11140 1186506 1187648 gene locus_tag LOCUS_11150 gene tgt 1186506 1187648 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194199.1 protein_id gnl|my_center|LOCUS_11150 1189176 1187596 gene locus_tag LOCUS_11160 1189176 1187596 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771214.1 protein_id gnl|my_center|LOCUS_11160 1191992 1189173 gene locus_tag LOCUS_11170 1191992 1189173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 1192299 1192559 gene locus_tag LOCUS_11180 1192299 1192559 CDS product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458022.1 protein_id gnl|my_center|LOCUS_11180 1192571 1194376 gene locus_tag LOCUS_11190 1192571 1194376 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338330.1 protein_id gnl|my_center|LOCUS_11190 1194944 1194495 gene locus_tag LOCUS_11200 1194944 1194495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 1195047 1195496 gene locus_tag LOCUS_11210 1195047 1195496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 1195496 1196572 gene locus_tag LOCUS_11220 gene adeT1 1195496 1196572 CDS product putative multidrug efflux protein AdeT1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206789.1 protein_id gnl|my_center|LOCUS_11220 1197085 1196585 gene locus_tag LOCUS_11230 1197085 1196585 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090000.1 protein_id gnl|my_center|LOCUS_11230 1197906 1197088 gene locus_tag LOCUS_11240 1197906 1197088 CDS product YgcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189948.1 protein_id gnl|my_center|LOCUS_11240 1198547 1197954 gene locus_tag LOCUS_11250 1198547 1197954 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550955.1 protein_id gnl|my_center|LOCUS_11250 1199900 1198644 gene locus_tag LOCUS_11260 gene rho 1199900 1198644 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521321.1 protein_id gnl|my_center|LOCUS_11260 1200352 1200023 gene locus_tag LOCUS_11270 gene trxA 1200352 1200023 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380053.1 protein_id gnl|my_center|LOCUS_11270 1200536 1203052 gene locus_tag LOCUS_11280 1200536 1203052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 1203045 1206296 gene locus_tag LOCUS_11290 1203045 1206296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 1206439 1208205 gene locus_tag LOCUS_11300 1206439 1208205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 1208222 1208554 gene locus_tag LOCUS_11310 1208222 1208554 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809572.1 protein_id gnl|my_center|LOCUS_11310 1208564 1209199 gene locus_tag LOCUS_11320 gene recR 1208564 1209199 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521324.1 protein_id gnl|my_center|LOCUS_11320 1209222 1210442 gene locus_tag LOCUS_11330 1209222 1210442 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809576.1 protein_id gnl|my_center|LOCUS_11330 1211385 1210435 gene locus_tag LOCUS_11340 gene tal 1211385 1210435 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533671.1 protein_id gnl|my_center|LOCUS_11340 1211514 1211864 gene locus_tag LOCUS_11350 1211514 1211864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 1211871 1212374 gene locus_tag LOCUS_11360 1211871 1212374 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406623.1 protein_id gnl|my_center|LOCUS_11360 1212636 1212358 gene locus_tag LOCUS_11370 1212636 1212358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 1212815 1213900 gene locus_tag LOCUS_11380 1212815 1213900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 1214880 1213897 gene locus_tag LOCUS_11390 1214880 1213897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 1215191 1214889 gene locus_tag LOCUS_11400 1215191 1214889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 1216024 1215188 gene locus_tag LOCUS_11410 1216024 1215188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11410 1216981 1216028 gene locus_tag LOCUS_11420 1216981 1216028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 1217902 1216994 gene locus_tag LOCUS_11430 1217902 1216994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 1219272 1217899 gene locus_tag LOCUS_11440 1219272 1217899 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521658.1 protein_id gnl|my_center|LOCUS_11440 1220468 1219269 gene locus_tag LOCUS_11450 1220468 1219269 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193624.1 protein_id gnl|my_center|LOCUS_11450 1221842 1220481 gene locus_tag LOCUS_11460 1221842 1220481 CDS product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192085.1 protein_id gnl|my_center|LOCUS_11460 1222804 1221839 gene locus_tag LOCUS_11470 gene cpaB 1222804 1221839 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930681.1 protein_id gnl|my_center|LOCUS_11470 1223323 1222829 gene locus_tag LOCUS_11480 1223323 1222829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 1223530 1223345 gene locus_tag LOCUS_11490 1223530 1223345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 1223811 1224497 gene locus_tag LOCUS_11500 1223811 1224497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 1224609 1228193 gene locus_tag LOCUS_11510 1224609 1228193 CDS product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523124.1 protein_id gnl|my_center|LOCUS_11510 1228174 1229109 gene locus_tag LOCUS_11520 1228174 1229109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189747.1 protein_id gnl|my_center|LOCUS_11520 1229154 1229540 gene locus_tag LOCUS_11530 1229154 1229540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 1229639 1230775 gene locus_tag LOCUS_11540 1229639 1230775 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263282.1 protein_id gnl|my_center|LOCUS_11540 1231266 1230772 gene locus_tag LOCUS_11550 gene rfaE2 1231266 1230772 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686901.1 protein_id gnl|my_center|LOCUS_11550 1232144 1231281 gene locus_tag LOCUS_11560 1232144 1231281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534300.1 protein_id gnl|my_center|LOCUS_11560 1232763 1232275 gene locus_tag LOCUS_11570 1232763 1232275 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388486.1 protein_id gnl|my_center|LOCUS_11570 1233556 1232747 gene locus_tag LOCUS_11580 1233556 1232747 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388487.1 protein_id gnl|my_center|LOCUS_11580 1234135 1233569 gene locus_tag LOCUS_11590 1234135 1233569 CDS product DUF3833 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407549.1 protein_id gnl|my_center|LOCUS_11590 1235517 1234132 gene locus_tag LOCUS_11600 1235517 1234132 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388484.1 protein_id gnl|my_center|LOCUS_11600 1236104 1235535 gene locus_tag LOCUS_11610 1236104 1235535 CDS product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104050.1 protein_id gnl|my_center|LOCUS_11610 1237327 1236101 gene locus_tag LOCUS_11620 1237327 1236101 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640238.1 protein_id gnl|my_center|LOCUS_11620 1238142 1237324 gene locus_tag LOCUS_11630 1238142 1237324 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338709.1 protein_id gnl|my_center|LOCUS_11630 1239455 1238142 gene locus_tag LOCUS_11640 1239455 1238142 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163651105.1 protein_id gnl|my_center|LOCUS_11640 1240371 1239565 gene locus_tag LOCUS_11650 gene folE2 1240371 1239565 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195713.1 protein_id gnl|my_center|LOCUS_11650 1241046 1240393 gene locus_tag LOCUS_11660 1241046 1240393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 1241202 1242143 gene locus_tag LOCUS_11670 1241202 1242143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 1242324 1243865 gene locus_tag LOCUS_11680 1242324 1243865 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922119.1 protein_id gnl|my_center|LOCUS_11680 1243919 1244914 gene locus_tag LOCUS_11690 1243919 1244914 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767387.1 protein_id gnl|my_center|LOCUS_11690 1244938 1246128 gene locus_tag LOCUS_11700 1244938 1246128 CDS product CCA-adding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958469.1 protein_id gnl|my_center|LOCUS_11700 1246201 1246512 gene locus_tag LOCUS_11710 gene sugE 1246201 1246512 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171053.1 protein_id gnl|my_center|LOCUS_11710 1246509 1247075 gene locus_tag LOCUS_11720 1246509 1247075 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929870.1 protein_id gnl|my_center|LOCUS_11720 1247081 1247608 gene locus_tag LOCUS_11730 1247081 1247608 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104495.1 protein_id gnl|my_center|LOCUS_11730 1247616 1248365 gene locus_tag LOCUS_11740 1247616 1248365 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530562.1 protein_id gnl|my_center|LOCUS_11740 1248409 1248807 gene locus_tag LOCUS_11750 1248409 1248807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 1248812 1249444 gene locus_tag LOCUS_11760 1248812 1249444 CDS product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532164.1 protein_id gnl|my_center|LOCUS_11760 1249496 1249750 gene locus_tag LOCUS_11770 1249496 1249750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921466.1 protein_id gnl|my_center|LOCUS_11770 1249760 1251007 gene locus_tag LOCUS_11780 1249760 1251007 CDS product DUF2254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018208816.1 protein_id gnl|my_center|LOCUS_11780 1251064 1252803 gene locus_tag LOCUS_11790 gene argS 1251064 1252803 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189649.1 protein_id gnl|my_center|LOCUS_11790 1252934 1256914 gene locus_tag LOCUS_11800 1252934 1256914 CDS product FAD/FMN-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815152.1 protein_id gnl|my_center|LOCUS_11800 1256886 1257365 gene locus_tag LOCUS_11810 1256886 1257365 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925740.1 protein_id gnl|my_center|LOCUS_11810 1259165 1257819 gene locus_tag LOCUS_11820 gene phoR 1259165 1257819 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815115.1 protein_id gnl|my_center|LOCUS_11820 1259913 1259206 gene locus_tag LOCUS_11830 gene phoB 1259913 1259206 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815113.1 protein_id gnl|my_center|LOCUS_11830 1260098 1260523 gene locus_tag LOCUS_11840 1260098 1260523 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190130.1 protein_id gnl|my_center|LOCUS_11840 1260529 1261269 gene locus_tag LOCUS_11850 gene ubiE 1260529 1261269 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815111.1 protein_id gnl|my_center|LOCUS_11850 1261318 1262325 gene locus_tag LOCUS_11860 1261318 1262325 CDS product Tim44-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791677.1 protein_id gnl|my_center|LOCUS_11860 1262404 1263111 gene locus_tag LOCUS_11870 1262404 1263111 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064918.1 protein_id gnl|my_center|LOCUS_11870 1263108 1264703 gene locus_tag LOCUS_11880 gene ubiB 1263108 1264703 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189815.1 protein_id gnl|my_center|LOCUS_11880 1264765 1266210 gene locus_tag LOCUS_11890 1264765 1266210 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121872.1 protein_id gnl|my_center|LOCUS_11890 1266252 1267154 gene locus_tag LOCUS_11900 gene cysM 1266252 1267154 CDS product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532363.1 protein_id gnl|my_center|LOCUS_11900 1268218 1267163 gene locus_tag LOCUS_11910 gene mltB 1268218 1267163 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926823.1 protein_id gnl|my_center|LOCUS_11910 1268334 1269254 gene locus_tag LOCUS_11920 1268334 1269254 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039480.1 protein_id gnl|my_center|LOCUS_11920 1269251 1269940 gene locus_tag LOCUS_11930 gene can 1269251 1269940 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003345939.1 protein_id gnl|my_center|LOCUS_11930 1270056 1270814 gene locus_tag LOCUS_11940 1270056 1270814 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064586.1 protein_id gnl|my_center|LOCUS_11940 1270839 1271768 gene locus_tag LOCUS_11950 1270839 1271768 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813337.1 protein_id gnl|my_center|LOCUS_11950 1271796 1273601 gene locus_tag LOCUS_11960 1271796 1273601 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533897.1 protein_id gnl|my_center|LOCUS_11960 1273669 1274061 gene locus_tag LOCUS_11970 1273669 1274061 CDS product DUF2784 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525171.1 protein_id gnl|my_center|LOCUS_11970 1274267 1274058 gene locus_tag LOCUS_11980 1274267 1274058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 1274643 1274383 gene locus_tag LOCUS_11990 1274643 1274383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 1274734 1275681 gene locus_tag LOCUS_12000 1274734 1275681 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003143867.1 protein_id gnl|my_center|LOCUS_12000 1275886 1276041 gene locus_tag LOCUS_12010 1275886 1276041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 1276359 1276054 gene locus_tag LOCUS_12020 1276359 1276054 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970224.1 protein_id gnl|my_center|LOCUS_12020 1277579 1276377 gene locus_tag LOCUS_12030 1277579 1276377 CDS product sulfite oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970225.1 protein_id gnl|my_center|LOCUS_12030 1278194 1277601 gene locus_tag LOCUS_12040 1278194 1277601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 1278729 1278187 gene locus_tag LOCUS_12050 gene sigL 1278729 1278187 CDS product sigma-70 family RNA polymerase sigma factor SigL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403731.1 protein_id gnl|my_center|LOCUS_12050 1278828 1279031 gene locus_tag LOCUS_12060 1278828 1279031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 1279059 1279916 gene locus_tag LOCUS_12070 1279059 1279916 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445511.1 protein_id gnl|my_center|LOCUS_12070 1280081 1281256 gene locus_tag LOCUS_12080 gene carA 1280081 1281256 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224759.1 protein_id gnl|my_center|LOCUS_12080 1281318 1284548 gene locus_tag LOCUS_12090 gene carB 1281318 1284548 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809588.1 protein_id gnl|my_center|LOCUS_12090 1284630 1285106 gene locus_tag LOCUS_12100 gene greA 1284630 1285106 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192392.1 protein_id gnl|my_center|LOCUS_12100 1285135 1285626 gene locus_tag LOCUS_12110 1285135 1285626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 1285998 1285627 gene locus_tag LOCUS_12120 1285998 1285627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 1286027 1286662 gene locus_tag LOCUS_12130 1286027 1286662 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930175.1 protein_id gnl|my_center|LOCUS_12130 1286846 1288735 gene locus_tag LOCUS_12140 gene ftsH 1286846 1288735 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039235.1 protein_id gnl|my_center|LOCUS_12140 1289258 1290094 gene locus_tag LOCUS_12150 gene folP 1289258 1290094 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809626.1 protein_id gnl|my_center|LOCUS_12150 1290091 1291083 gene locus_tag LOCUS_12160 1290091 1291083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 1291112 1292455 gene locus_tag LOCUS_12170 gene glmM 1291112 1292455 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550648.1 protein_id gnl|my_center|LOCUS_12170 1293394 1292465 gene locus_tag LOCUS_12180 1293394 1292465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 1293440 1294333 gene locus_tag LOCUS_12190 1293440 1294333 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367416.1 protein_id gnl|my_center|LOCUS_12190 1294361 1294437 gene locus_tag LOCUS_t00110 1294361 1294437 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1294468 1294544 gene locus_tag LOCUS_t00120 1294468 1294544 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1294569 1294644 gene locus_tag LOCUS_t00130 1294569 1294644 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1295025 1295981 gene locus_tag LOCUS_12200 1295025 1295981 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027134.1 protein_id gnl|my_center|LOCUS_12200 1296692 1295982 gene locus_tag LOCUS_12210 1296692 1295982 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382873.1 protein_id gnl|my_center|LOCUS_12210 1296856 1298310 gene locus_tag LOCUS_12220 1296856 1298310 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229069.1 protein_id gnl|my_center|LOCUS_12220 1298321 1299151 gene locus_tag LOCUS_12230 1298321 1299151 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257237.1 protein_id gnl|my_center|LOCUS_12230 1299157 1299939 gene locus_tag LOCUS_12240 1299157 1299939 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393278.1 protein_id gnl|my_center|LOCUS_12240 1299969 1300886 gene locus_tag LOCUS_12250 1299969 1300886 CDS product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419251.1 protein_id gnl|my_center|LOCUS_12250 1300897 1301925 gene locus_tag LOCUS_12260 gene dmpG 1300897 1301925 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013499.1 protein_id gnl|my_center|LOCUS_12260 1301922 1302710 gene locus_tag LOCUS_12270 1301922 1302710 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393278.1 protein_id gnl|my_center|LOCUS_12270 1302722 1302913 gene locus_tag LOCUS_12280 1302722 1302913 CDS product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147171.1 protein_id gnl|my_center|LOCUS_12280 1303001 1304005 gene locus_tag LOCUS_12290 1303001 1304005 CDS product YCF48-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046237280.1 protein_id gnl|my_center|LOCUS_12290 1304002 1306410 gene locus_tag LOCUS_12300 1304002 1306410 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072544.1 protein_id gnl|my_center|LOCUS_12300 1306455 1308419 gene locus_tag LOCUS_12310 1306455 1308419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 1308461 1309765 gene locus_tag LOCUS_12320 1308461 1309765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 1311273 1309972 gene locus_tag LOCUS_12330 1311273 1309972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 1312232 1311300 gene locus_tag LOCUS_12340 1312232 1311300 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086138.1 protein_id gnl|my_center|LOCUS_12340 1313868 1312261 gene locus_tag LOCUS_12350 1313868 1312261 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728663.1 protein_id gnl|my_center|LOCUS_12350 1314078 1316867 gene locus_tag LOCUS_12360 gene malT 1314078 1316867 CDS product HTH-type transcriptional regulator MalT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420753.1 protein_id gnl|my_center|LOCUS_12360 1318476 1316812 gene locus_tag LOCUS_12370 1318476 1316812 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267928.1 protein_id gnl|my_center|LOCUS_12370 1319553 1318618 gene locus_tag LOCUS_12380 gene hpaD 1319553 1318618 CDS product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085751.1 protein_id gnl|my_center|LOCUS_12380 1319910 1319584 gene locus_tag LOCUS_12390 1319910 1319584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 1320984 1319926 gene locus_tag LOCUS_12400 1320984 1319926 CDS product phenol 2-monooxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206216.1 protein_id gnl|my_center|LOCUS_12400 1321366 1321004 gene locus_tag LOCUS_12410 1321366 1321004 CDS product phenol hydroxylase subunit P4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005132745.1 protein_id gnl|my_center|LOCUS_12410 1322930 1321389 gene locus_tag LOCUS_12420 1322930 1321389 CDS product aromatic/alkene/methane monooxygenase hydroxylase/oxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206217.1 protein_id gnl|my_center|LOCUS_12420 1323278 1322976 gene locus_tag LOCUS_12430 1323278 1322976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 1324288 1323275 gene locus_tag LOCUS_12440 1324288 1323275 CDS product aromatic/alkene monooxygenase hydroxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206218.1 protein_id gnl|my_center|LOCUS_12440 1324619 1324323 gene locus_tag LOCUS_12450 1324619 1324323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 1325220 1325295 gene locus_tag LOCUS_t00140 1325220 1325295 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1326118 1325813 gene locus_tag LOCUS_12460 1326118 1325813 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061280.1 protein_id gnl|my_center|LOCUS_12460 1327095 1326292 gene locus_tag LOCUS_12470 1327095 1326292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 1327183 1328097 gene locus_tag LOCUS_12480 1327183 1328097 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024697938.1 protein_id gnl|my_center|LOCUS_12480 1329623 1328634 gene locus_tag LOCUS_12490 1329623 1328634 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967019.1 protein_id gnl|my_center|LOCUS_12490 1330695 1329673 gene locus_tag LOCUS_12500 1330695 1329673 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643768.1 protein_id gnl|my_center|LOCUS_12500 1331740 1330778 gene locus_tag LOCUS_12510 1331740 1330778 CDS product LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122374.1 protein_id gnl|my_center|LOCUS_12510 1332155 1331850 gene locus_tag LOCUS_12520 1332155 1331850 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061280.1 protein_id gnl|my_center|LOCUS_12520 1333401 1332232 gene locus_tag LOCUS_12530 1333401 1332232 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198074.1 protein_id gnl|my_center|LOCUS_12530 1334075 1333470 gene locus_tag LOCUS_12540 1334075 1333470 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104371.1 protein_id gnl|my_center|LOCUS_12540 1335306 1334578 gene locus_tag LOCUS_12550 1335306 1334578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12550 1335569 1335420 gene locus_tag LOCUS_12560 1335569 1335420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 1335673 1335906 gene locus_tag LOCUS_12570 1335673 1335906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 1336089 1336376 gene locus_tag LOCUS_12580 1336089 1336376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 1337614 1336709 gene locus_tag LOCUS_12590 1337614 1336709 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531763.1 protein_id gnl|my_center|LOCUS_12590 1337743 1338201 gene locus_tag LOCUS_12600 1337743 1338201 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808116.1 protein_id gnl|my_center|LOCUS_12600 1338214 1340421 gene locus_tag LOCUS_12610 1338214 1340421 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063689.1 protein_id gnl|my_center|LOCUS_12610 1340434 1341456 gene locus_tag LOCUS_12620 1340434 1341456 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525879.1 protein_id gnl|my_center|LOCUS_12620 1341470 1342081 gene locus_tag LOCUS_12630 1341470 1342081 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524160.1 protein_id gnl|my_center|LOCUS_12630 1342374 1342449 gene locus_tag LOCUS_t00150 1342374 1342449 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1342617 1344887 gene locus_tag LOCUS_12640 1342617 1344887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 1344901 1345374 gene locus_tag LOCUS_12650 1344901 1345374 CDS product TM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615575.1 protein_id gnl|my_center|LOCUS_12650 1345881 1345381 gene locus_tag LOCUS_12660 1345881 1345381 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731118.1 protein_id gnl|my_center|LOCUS_12660 1345944 1346132 gene locus_tag LOCUS_12670 1345944 1346132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 1346278 1346643 gene locus_tag LOCUS_12680 1346278 1346643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 1346880 1347989 gene locus_tag LOCUS_12690 1346880 1347989 CDS product OprO/OprP family phosphate-selective porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037719.1 protein_id gnl|my_center|LOCUS_12690 1348096 1349709 gene locus_tag LOCUS_12700 1348096 1349709 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265692.1 protein_id gnl|my_center|LOCUS_12700 1349706 1350431 gene locus_tag LOCUS_12710 1349706 1350431 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919170.1 protein_id gnl|my_center|LOCUS_12710 1350566 1351129 gene locus_tag LOCUS_12720 1350566 1351129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265691.1 protein_id gnl|my_center|LOCUS_12720 1351175 1352107 gene locus_tag LOCUS_12730 1351175 1352107 CDS product DUF3034 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052844658.1 protein_id gnl|my_center|LOCUS_12730 1352120 1352557 gene locus_tag LOCUS_12740 1352120 1352557 CDS product group 1 truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764777.1 protein_id gnl|my_center|LOCUS_12740 1352804 1353277 gene locus_tag LOCUS_12750 1352804 1353277 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203374.1 protein_id gnl|my_center|LOCUS_12750 1354661 1353258 gene locus_tag LOCUS_12760 1354661 1353258 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400962.1 protein_id gnl|my_center|LOCUS_12760 1354964 1355446 gene locus_tag LOCUS_12770 1354964 1355446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 1355604 1356467 gene locus_tag LOCUS_12780 1355604 1356467 CDS product aliphatic nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877947.1 protein_id gnl|my_center|LOCUS_12780 1356454 1357530 gene locus_tag LOCUS_12790 1356454 1357530 CDS product MSMEG_0568 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876804.1 protein_id gnl|my_center|LOCUS_12790 1357552 1358103 gene locus_tag LOCUS_12800 1357552 1358103 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550006.1 protein_id gnl|my_center|LOCUS_12800 1358100 1359116 gene locus_tag LOCUS_12810 1358100 1359116 CDS product methanogenesis marker 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061160.1 protein_id gnl|my_center|LOCUS_12810 1359097 1359381 gene locus_tag LOCUS_12820 1359097 1359381 CDS product MSMEG_0570 family nitrogen starvation response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891991.1 protein_id gnl|my_center|LOCUS_12820 1359393 1360664 gene locus_tag LOCUS_12830 1359393 1360664 CDS product MSMEG_0569 family flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891990.1 protein_id gnl|my_center|LOCUS_12830 1361148 1360657 gene locus_tag LOCUS_12840 1361148 1360657 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986893.1 protein_id gnl|my_center|LOCUS_12840 1363453 1361333 gene locus_tag LOCUS_12850 1363453 1361333 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267792.1 protein_id gnl|my_center|LOCUS_12850 1363694 1365298 gene locus_tag LOCUS_12860 1363694 1365298 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477808.1 protein_id gnl|my_center|LOCUS_12860 1365309 1367168 gene locus_tag LOCUS_12870 1365309 1367168 CDS product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421488.1 protein_id gnl|my_center|LOCUS_12870 1367165 1367920 gene locus_tag LOCUS_12880 1367165 1367920 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483201.1 protein_id gnl|my_center|LOCUS_12880 1367935 1369299 gene locus_tag LOCUS_12890 1367935 1369299 CDS product outer membrane beta barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071616.1 protein_id gnl|my_center|LOCUS_12890 1370493 1369300 gene locus_tag LOCUS_12900 1370493 1369300 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275411.1 protein_id gnl|my_center|LOCUS_12900 1372731 1370521 gene locus_tag LOCUS_12910 gene katG 1372731 1370521 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814129.1 protein_id gnl|my_center|LOCUS_12910 1373808 1372894 gene locus_tag LOCUS_12920 1373808 1372894 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811380.1 protein_id gnl|my_center|LOCUS_12920 1373932 1374552 gene locus_tag LOCUS_12930 gene ycaC 1373932 1374552 CDS product isochorismate family cysteine hydrolase YcaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165876.1 protein_id gnl|my_center|LOCUS_12930 1374576 1375442 gene locus_tag LOCUS_12940 1374576 1375442 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112455.1 protein_id gnl|my_center|LOCUS_12940 1375500 1376711 gene locus_tag LOCUS_12950 1375500 1376711 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083642.1 protein_id gnl|my_center|LOCUS_12950 1376713 1377486 gene locus_tag LOCUS_12960 1376713 1377486 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090610.1 protein_id gnl|my_center|LOCUS_12960 1377496 1378518 gene locus_tag LOCUS_12970 1377496 1378518 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000995968.1 protein_id gnl|my_center|LOCUS_12970 1378511 1378885 gene locus_tag LOCUS_12980 1378511 1378885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 1378882 1379556 gene locus_tag LOCUS_12990 1378882 1379556 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113600.1 protein_id gnl|my_center|LOCUS_12990 1379966 1379580 gene locus_tag LOCUS_13000 1379966 1379580 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082795.1 protein_id gnl|my_center|LOCUS_13000 1380343 1379963 gene locus_tag LOCUS_13010 1380343 1379963 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082795.1 protein_id gnl|my_center|LOCUS_13010 1380765 1380340 gene locus_tag LOCUS_13020 1380765 1380340 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089903.1 protein_id gnl|my_center|LOCUS_13020 1381196 1380780 gene locus_tag LOCUS_13030 1381196 1380780 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444185.1 protein_id gnl|my_center|LOCUS_13030 1382528 1381287 gene locus_tag LOCUS_13040 1382528 1381287 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082803.1 protein_id gnl|my_center|LOCUS_13040 1382611 1384758 gene locus_tag LOCUS_13050 1382611 1384758 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920765.1 protein_id gnl|my_center|LOCUS_13050 1385558 1384755 gene locus_tag LOCUS_13060 1385558 1384755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 1385857 1386966 gene locus_tag LOCUS_13070 1385857 1386966 CDS product DUF6091 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207691.1 protein_id gnl|my_center|LOCUS_13070 1388232 1386988 gene locus_tag LOCUS_13080 1388232 1386988 CDS product DUF3089 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918560.1 protein_id gnl|my_center|LOCUS_13080 1390697 1388247 gene locus_tag LOCUS_13090 gene cerN 1390697 1388247 CDS product ceramidase CerN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114226.1 protein_id gnl|my_center|LOCUS_13090 1390928 1392202 gene locus_tag LOCUS_13100 1390928 1392202 CDS product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081157931.1 protein_id gnl|my_center|LOCUS_13100 1392811 1392209 gene locus_tag LOCUS_13110 1392811 1392209 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123320.1 protein_id gnl|my_center|LOCUS_13110 1393909 1392911 gene locus_tag LOCUS_13120 1393909 1392911 CDS product catalase family peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703375.1 protein_id gnl|my_center|LOCUS_13120 1395239 1394025 gene locus_tag LOCUS_13130 1395239 1394025 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814294.1 protein_id gnl|my_center|LOCUS_13130 1395415 1397448 gene locus_tag LOCUS_13140 1395415 1397448 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207578.1 protein_id gnl|my_center|LOCUS_13140 1397555 1398658 gene locus_tag LOCUS_13150 1397555 1398658 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207192.1 protein_id gnl|my_center|LOCUS_13150 1399976 1398663 gene locus_tag LOCUS_13160 1399976 1398663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 1400918 1400223 gene locus_tag LOCUS_13170 1400918 1400223 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229546.1 protein_id gnl|my_center|LOCUS_13170 1401070 1401594 gene locus_tag LOCUS_13180 1401070 1401594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 1401600 1402424 gene locus_tag LOCUS_13190 1401600 1402424 CDS product ChaN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338346.1 protein_id gnl|my_center|LOCUS_13190 1402523 1403119 gene locus_tag LOCUS_13200 1402523 1403119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 1403179 1404045 gene locus_tag LOCUS_13210 1403179 1404045 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143390.1 protein_id gnl|my_center|LOCUS_13210 1404193 1404630 gene locus_tag LOCUS_13220 1404193 1404630 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268553.1 protein_id gnl|my_center|LOCUS_13220 1404755 1405177 gene locus_tag LOCUS_13230 1404755 1405177 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083560.1 protein_id gnl|my_center|LOCUS_13230 1405260 1406249 gene locus_tag LOCUS_13240 1405260 1406249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 1406306 1406905 gene locus_tag LOCUS_13250 1406306 1406905 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438111.1 protein_id gnl|my_center|LOCUS_13250 1406913 1407344 gene locus_tag LOCUS_13260 1406913 1407344 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162304069.1 protein_id gnl|my_center|LOCUS_13260 1407377 1408087 gene locus_tag LOCUS_13270 gene arsH 1407377 1408087 CDS product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087170.1 protein_id gnl|my_center|LOCUS_13270 1408129 1408893 gene locus_tag LOCUS_13280 gene modA 1408129 1408893 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074080.1 protein_id gnl|my_center|LOCUS_13280 1408890 1409558 gene locus_tag LOCUS_13290 gene modB 1408890 1409558 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074079.1 protein_id gnl|my_center|LOCUS_13290 1409555 1410700 gene locus_tag LOCUS_13300 1409555 1410700 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074078.1 protein_id gnl|my_center|LOCUS_13300 1410821 1413409 gene locus_tag LOCUS_13310 1410821 1413409 CDS product DUF6351 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225776.1 protein_id gnl|my_center|LOCUS_13310 1413550 1415118 gene locus_tag LOCUS_13320 1413550 1415118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 1415185 1416015 gene locus_tag LOCUS_13330 gene hexR 1415185 1416015 CDS product DNA-binding transcriptional regulator HexR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213148.1 protein_id gnl|my_center|LOCUS_13330 1416887 1416003 gene locus_tag LOCUS_13340 1416887 1416003 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103398.1 protein_id gnl|my_center|LOCUS_13340 1418434 1416887 gene locus_tag LOCUS_13350 gene pgi 1418434 1416887 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918111.1 protein_id gnl|my_center|LOCUS_13350 1418945 1418532 gene locus_tag LOCUS_13360 1418945 1418532 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200660.1 protein_id gnl|my_center|LOCUS_13360 1419668 1418949 gene locus_tag LOCUS_13370 1419668 1418949 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525409.1 protein_id gnl|my_center|LOCUS_13370 1420418 1419699 gene locus_tag LOCUS_13380 1420418 1419699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 1420806 1421282 gene locus_tag LOCUS_13390 gene bfr 1420806 1421282 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188572.1 protein_id gnl|my_center|LOCUS_13390 1421383 1421583 gene locus_tag LOCUS_13400 1421383 1421583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 1422368 1421619 gene locus_tag LOCUS_13410 1422368 1421619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 1423593 1422430 gene locus_tag LOCUS_13420 1423593 1422430 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460650.1 protein_id gnl|my_center|LOCUS_13420 1425340 1423574 gene locus_tag LOCUS_13430 1425340 1423574 CDS product siderophore biosynthesis protein PvsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477449.1 protein_id gnl|my_center|LOCUS_13430 1426506 1425286 gene locus_tag LOCUS_13440 1426506 1425286 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038168.1 protein_id gnl|my_center|LOCUS_13440 1428209 1426503 gene locus_tag LOCUS_13450 1428209 1426503 CDS product IucA/IucC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038167.1 protein_id gnl|my_center|LOCUS_13450 1429363 1428206 gene locus_tag LOCUS_13460 1429363 1428206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477486.1 protein_id gnl|my_center|LOCUS_13460 1430153 1429365 gene locus_tag LOCUS_13470 1430153 1429365 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038164.1 protein_id gnl|my_center|LOCUS_13470 1430355 1432415 gene locus_tag LOCUS_13480 gene pvuA 1430355 1432415 CDS product TonB-dependent siderophore vibrioferrin receptor PvuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460644.1 protein_id gnl|my_center|LOCUS_13480 1434370 1432469 gene locus_tag LOCUS_13490 1434370 1432469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 1436567 1434450 gene locus_tag LOCUS_13500 1436567 1434450 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039372.1 protein_id gnl|my_center|LOCUS_13500 1436958 1438103 gene locus_tag LOCUS_13510 1436958 1438103 CDS product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101418.1 protein_id gnl|my_center|LOCUS_13510 1438117 1439535 gene locus_tag LOCUS_13520 1438117 1439535 CDS product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895673.1 protein_id gnl|my_center|LOCUS_13520 1439535 1440602 gene locus_tag LOCUS_13530 1439535 1440602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 1440608 1441672 gene locus_tag LOCUS_13540 1440608 1441672 CDS product DUF1513 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067717.1 protein_id gnl|my_center|LOCUS_13540 1443440 1441644 gene locus_tag LOCUS_13550 1443440 1441644 CDS product PQQ-dependent methanol/ethanol family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895174.1 protein_id gnl|my_center|LOCUS_13550 1443569 1443730 gene locus_tag LOCUS_13560 1443569 1443730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 1444940 1443750 gene locus_tag LOCUS_13570 1444940 1443750 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094632.1 protein_id gnl|my_center|LOCUS_13570 1445975 1445031 gene locus_tag LOCUS_13580 1445975 1445031 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766467.1 protein_id gnl|my_center|LOCUS_13580 1446094 1446651 gene locus_tag LOCUS_13590 1446094 1446651 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265800.1 protein_id gnl|my_center|LOCUS_13590 1447028 1446657 gene locus_tag LOCUS_13600 1447028 1446657 CDS product DUF779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057670999.1 protein_id gnl|my_center|LOCUS_13600 1448624 1447104 gene locus_tag LOCUS_13610 1448624 1447104 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035359.1 protein_id gnl|my_center|LOCUS_13610 1449941 1448865 gene locus_tag LOCUS_13620 1449941 1448865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 1450083 1450859 gene locus_tag LOCUS_13630 1450083 1450859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 1450856 1451842 gene locus_tag LOCUS_13640 1450856 1451842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 1452143 1453888 gene locus_tag LOCUS_13650 1452143 1453888 CDS product PQQ-dependent methanol/ethanol family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399374.1 protein_id gnl|my_center|LOCUS_13650 1454330 1455067 gene locus_tag LOCUS_13660 1454330 1455067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 1455064 1455441 gene locus_tag LOCUS_13670 1455064 1455441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 1456764 1455487 gene locus_tag LOCUS_13680 1456764 1455487 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810111.1 protein_id gnl|my_center|LOCUS_13680 1457702 1456887 gene locus_tag LOCUS_13690 1457702 1456887 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209604864.1 protein_id gnl|my_center|LOCUS_13690 1458490 1457705 gene locus_tag LOCUS_13700 1458490 1457705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 1459683 1458487 gene locus_tag LOCUS_13710 gene pqqE 1459683 1458487 CDS product pyrroloquinoline quinone biosynthesis protein PqqE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119136.1 protein_id gnl|my_center|LOCUS_13710 1459961 1459680 gene locus_tag LOCUS_13720 gene pqqD 1459961 1459680 CDS product pyrroloquinoline quinone biosynthesis peptide chaperone PqqD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088542.1 protein_id gnl|my_center|LOCUS_13720 1460683 1459958 gene locus_tag LOCUS_13730 gene pqqC 1460683 1459958 CDS product pyrroloquinoline-quinone synthase PqqC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005614033.1 protein_id gnl|my_center|LOCUS_13730 1461612 1460680 gene locus_tag LOCUS_13740 gene pqqB 1461612 1460680 CDS product pyrroloquinoline quinone biosynthesis protein PqqB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763801.1 protein_id gnl|my_center|LOCUS_13740 1463224 1462034 gene locus_tag LOCUS_13750 1463224 1462034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 1465646 1463574 gene locus_tag LOCUS_13760 1465646 1463574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 1465666 1465755 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1466523 1466978 gene locus_tag LOCUS_13770 gene pedF 1466523 1466978 CDS product cytochrome c-550 PedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113462.1 protein_id gnl|my_center|LOCUS_13770 1467084 1467932 gene locus_tag LOCUS_13780 1467084 1467932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 1468182 1468655 gene locus_tag LOCUS_13790 1468182 1468655 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869225.1 protein_id gnl|my_center|LOCUS_13790 1468688 1470535 gene locus_tag LOCUS_13800 1468688 1470535 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941578.1 protein_id gnl|my_center|LOCUS_13800 1470532 1471905 gene locus_tag LOCUS_13810 1470532 1471905 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392245.1 protein_id gnl|my_center|LOCUS_13810 1471872 1472123 gene locus_tag LOCUS_13820 1471872 1472123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 1472128 1472430 gene locus_tag LOCUS_13830 1472128 1472430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 1473336 1472938 gene locus_tag LOCUS_13840 1473336 1472938 CDS product DUF1850 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528643.1 protein_id gnl|my_center|LOCUS_13840 1475339 1473333 gene locus_tag LOCUS_13850 1475339 1473333 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336882.1 protein_id gnl|my_center|LOCUS_13850 1476486 1475530 gene locus_tag LOCUS_13860 1476486 1475530 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528641.1 protein_id gnl|my_center|LOCUS_13860 1477336 1476626 gene locus_tag LOCUS_13870 1477336 1476626 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088037.1 protein_id gnl|my_center|LOCUS_13870 1478483 1477326 gene locus_tag LOCUS_13880 1478483 1477326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 1478660 1481185 gene locus_tag LOCUS_13890 1478660 1481185 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038570.1 protein_id gnl|my_center|LOCUS_13890 1481252 1482268 gene locus_tag LOCUS_13900 1481252 1482268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 1482355 1483005 gene locus_tag LOCUS_13910 1482355 1483005 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088432.1 protein_id gnl|my_center|LOCUS_13910 1483011 1483619 gene locus_tag LOCUS_13920 1483011 1483619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088431.1 protein_id gnl|my_center|LOCUS_13920 1483616 1484131 gene locus_tag LOCUS_13930 1483616 1484131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 1484135 1484848 gene locus_tag LOCUS_13940 1484135 1484848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 1485404 1484865 gene locus_tag LOCUS_13950 1485404 1484865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 1489744 1485479 gene locus_tag LOCUS_13960 1489744 1485479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 1490431 1489826 gene locus_tag LOCUS_13970 1490431 1489826 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002163161.1 protein_id gnl|my_center|LOCUS_13970 1490525 1491412 gene locus_tag LOCUS_13980 1490525 1491412 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095420.1 protein_id gnl|my_center|LOCUS_13980 1491425 1492351 gene locus_tag LOCUS_13990 1491425 1492351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094778.1 protein_id gnl|my_center|LOCUS_13990 1492369 1493961 gene locus_tag LOCUS_14000 1492369 1493961 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095417.1 protein_id gnl|my_center|LOCUS_14000 1494415 1494038 gene locus_tag LOCUS_14010 1494415 1494038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 1494487 1495851 gene locus_tag LOCUS_14020 gene chrA 1494487 1495851 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096587.1 protein_id gnl|my_center|LOCUS_14020 1496286 1495765 gene locus_tag LOCUS_14030 1496286 1495765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 1496373 1496783 gene locus_tag LOCUS_14040 1496373 1496783 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104529.1 protein_id gnl|my_center|LOCUS_14040 1496795 1497346 gene locus_tag LOCUS_14050 1496795 1497346 CDS product NAD(P)H-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082483.1 protein_id gnl|my_center|LOCUS_14050 >Feature sequence02 178 2271 gene locus_tag LOCUS_14060 178 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 2280 3263 gene locus_tag LOCUS_14070 2280 3263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 3260 4732 gene locus_tag LOCUS_14080 3260 4732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 4800 5267 gene locus_tag LOCUS_14090 4800 5267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 6292 7149 gene locus_tag LOCUS_14100 6292 7149 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207936.1 protein_id gnl|my_center|LOCUS_14100 7784 7470 gene locus_tag LOCUS_14110 gene merT 7784 7470 CDS product mercuric ion transporter MerT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294667.1 protein_id gnl|my_center|LOCUS_14110 7854 8261 gene locus_tag LOCUS_14120 gene merR 7854 8261 CDS product Hg(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429836.1 protein_id gnl|my_center|LOCUS_14120 8947 8555 gene locus_tag LOCUS_14130 gene cadR 8947 8555 CDS product Cd(II)/Pb(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405262.1 protein_id gnl|my_center|LOCUS_14130 9026 9649 gene locus_tag LOCUS_14140 9026 9649 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075543.1 protein_id gnl|my_center|LOCUS_14140 9726 10028 gene locus_tag LOCUS_14150 9726 10028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 10114 11361 gene locus_tag LOCUS_14160 10114 11361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 11358 11936 gene locus_tag LOCUS_14170 11358 11936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 11939 13051 gene locus_tag LOCUS_14180 11939 13051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 13064 16183 gene locus_tag LOCUS_14190 13064 16183 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790618.1 protein_id gnl|my_center|LOCUS_14190 16208 16600 gene locus_tag LOCUS_14200 16208 16600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 17630 16707 gene locus_tag LOCUS_14210 17630 16707 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207989.1 protein_id gnl|my_center|LOCUS_14210 18183 17761 gene locus_tag LOCUS_14220 gene cadR 18183 17761 CDS product Cd(II)/Pb(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195850.1 protein_id gnl|my_center|LOCUS_14220 18302 19306 gene locus_tag LOCUS_14230 18302 19306 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004574643.1 protein_id gnl|my_center|LOCUS_14230 19303 19800 gene locus_tag LOCUS_14240 gene lspA 19303 19800 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157006.1 protein_id gnl|my_center|LOCUS_14240 20123 19902 gene locus_tag LOCUS_14250 20123 19902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 21556 20213 gene locus_tag LOCUS_14260 21556 20213 CDS product heavy metal sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815118.1 protein_id gnl|my_center|LOCUS_14260 22254 21559 gene locus_tag LOCUS_14270 22254 21559 CDS product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815117.1 protein_id gnl|my_center|LOCUS_14270 22422 22751 gene locus_tag LOCUS_14280 22422 22751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 22816 23196 gene locus_tag LOCUS_14290 22816 23196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 23249 23575 gene locus_tag LOCUS_14300 23249 23575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 23575 24990 gene locus_tag LOCUS_14310 23575 24990 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529972.1 protein_id gnl|my_center|LOCUS_14310 25010 26425 gene locus_tag LOCUS_14320 25010 26425 CDS product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244411.1 protein_id gnl|my_center|LOCUS_14320 26436 26963 gene locus_tag LOCUS_14330 26436 26963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 26960 27490 gene locus_tag LOCUS_14340 26960 27490 CDS product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454003.1 protein_id gnl|my_center|LOCUS_14340 27526 27888 gene locus_tag LOCUS_14350 27526 27888 CDS product copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529974.1 protein_id gnl|my_center|LOCUS_14350 27904 28896 gene locus_tag LOCUS_14360 27904 28896 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010355679.1 protein_id gnl|my_center|LOCUS_14360 29260 28952 gene locus_tag LOCUS_14370 29260 28952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 30203 29478 gene locus_tag LOCUS_14380 30203 29478 CDS product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073550.1 protein_id gnl|my_center|LOCUS_14380 31725 30331 gene locus_tag LOCUS_14390 31725 30331 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478369.1 protein_id gnl|my_center|LOCUS_14390 32306 31722 gene locus_tag LOCUS_14400 32306 31722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 32438 32644 gene locus_tag LOCUS_14410 32438 32644 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463131.1 protein_id gnl|my_center|LOCUS_14410 33826 32648 gene locus_tag LOCUS_14420 33826 32648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 33952 34962 gene locus_tag LOCUS_14430 33952 34962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 >Feature sequence03 158 52 gene locus_tag LOCUS_r00010 158 52 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3283 405 gene locus_tag LOCUS_r00020 3283 405 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3770 3695 gene locus_tag LOCUS_t00160 3770 3695 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3876 3800 gene locus_tag LOCUS_t00170 3876 3800 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 5567 4041 gene locus_tag LOCUS_r00030 5567 4041 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence04 92 2089 gene locus_tag LOCUS_14440 92 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 2216 2434 gene locus_tag LOCUS_14450 2216 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 >Feature sequence05 71 334 gene locus_tag LOCUS_14460 71 334 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028578677.1 protein_id gnl|my_center|LOCUS_14460 328 1194 gene locus_tag LOCUS_14470 328 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14470 >Feature sequence06 >Feature sequence07 316 552 gene locus_tag LOCUS_14480 316 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 549 971 gene locus_tag LOCUS_14490 549 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 1653 943 gene locus_tag LOCUS_14500 1653 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 1765 2844 gene locus_tag LOCUS_14510 1765 2844 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946467.1 protein_id gnl|my_center|LOCUS_14510 2873 4114 gene locus_tag LOCUS_14520 gene purT 2873 4114 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522466.1 protein_id gnl|my_center|LOCUS_14520 5820 4222 gene locus_tag LOCUS_14530 5820 4222 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447525.1 protein_id gnl|my_center|LOCUS_14530 6839 5910 gene locus_tag LOCUS_14540 gene ldcA 6839 5910 CDS product muramoyltetrapeptide carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705839.1 protein_id gnl|my_center|LOCUS_14540 7602 6904 gene locus_tag LOCUS_14550 7602 6904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 8752 7769 gene locus_tag LOCUS_14560 8752 7769 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195809.1 protein_id gnl|my_center|LOCUS_14560 9650 8766 gene locus_tag LOCUS_14570 9650 8766 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813860.1 protein_id gnl|my_center|LOCUS_14570 10929 9724 gene locus_tag LOCUS_14580 10929 9724 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185183.1 protein_id gnl|my_center|LOCUS_14580 11697 10975 gene locus_tag LOCUS_14590 11697 10975 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195807.1 protein_id gnl|my_center|LOCUS_14590 12467 11697 gene locus_tag LOCUS_14600 12467 11697 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195806.1 protein_id gnl|my_center|LOCUS_14600 14285 12663 gene locus_tag LOCUS_14610 gene guaA 14285 12663 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812366.1 protein_id gnl|my_center|LOCUS_14610 15334 14342 gene locus_tag LOCUS_14620 15334 14342 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114426.1 protein_id gnl|my_center|LOCUS_14620 16821 15361 gene locus_tag LOCUS_14630 gene guaB 16821 15361 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812368.1 protein_id gnl|my_center|LOCUS_14630 17267 16911 gene locus_tag LOCUS_14640 17267 16911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 17710 17267 gene locus_tag LOCUS_14650 17710 17267 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192775.1 protein_id gnl|my_center|LOCUS_14650 17812 18261 gene locus_tag LOCUS_14660 gene smpB 17812 18261 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811754.1 protein_id gnl|my_center|LOCUS_14660 19184 18279 gene locus_tag LOCUS_14670 19184 18279 CDS product stomatin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063757.1 protein_id gnl|my_center|LOCUS_14670 19653 19231 gene locus_tag LOCUS_14680 19653 19231 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063756.1 protein_id gnl|my_center|LOCUS_14680 22017 19669 gene locus_tag LOCUS_14690 gene ppsA 22017 19669 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193522.1 protein_id gnl|my_center|LOCUS_14690 22214 23050 gene locus_tag LOCUS_14700 22214 23050 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192738.1 protein_id gnl|my_center|LOCUS_14700 24730 23057 gene locus_tag LOCUS_14710 24730 23057 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256609.1 protein_id gnl|my_center|LOCUS_14710 25599 24778 gene locus_tag LOCUS_14720 25599 24778 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222468.1 protein_id gnl|my_center|LOCUS_14720 26264 25608 gene locus_tag LOCUS_14730 gene rnhB 26264 25608 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021956.1 protein_id gnl|my_center|LOCUS_14730 27426 26257 gene locus_tag LOCUS_14740 gene lpxB 27426 26257 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205135.1 protein_id gnl|my_center|LOCUS_14740 28218 27430 gene locus_tag LOCUS_14750 gene lpxA 28218 27430 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811774.1 protein_id gnl|my_center|LOCUS_14750 28664 28230 gene locus_tag LOCUS_14760 gene fabZ 28664 28230 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192266.1 protein_id gnl|my_center|LOCUS_14760 29802 28717 gene locus_tag LOCUS_14770 gene lpxD 29802 28717 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063748.1 protein_id gnl|my_center|LOCUS_14770 30327 29812 gene locus_tag LOCUS_14780 30327 29812 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811782.1 protein_id gnl|my_center|LOCUS_14780 32660 30354 gene locus_tag LOCUS_14790 gene bamA 32660 30354 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535505.1 protein_id gnl|my_center|LOCUS_14790 34055 32712 gene locus_tag LOCUS_14800 gene rseP 34055 32712 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205137.1 protein_id gnl|my_center|LOCUS_14800 35268 34069 gene locus_tag LOCUS_14810 35268 34069 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527290.1 protein_id gnl|my_center|LOCUS_14810 36119 35277 gene locus_tag LOCUS_14820 36119 35277 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521189.1 protein_id gnl|my_center|LOCUS_14820 36932 36144 gene locus_tag LOCUS_14830 gene uppS 36932 36144 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930350.1 protein_id gnl|my_center|LOCUS_14830 37500 36940 gene locus_tag LOCUS_14840 gene frr 37500 36940 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192143.1 protein_id gnl|my_center|LOCUS_14840 38277 37567 gene locus_tag LOCUS_14850 gene pyrH 38277 37567 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926571.1 protein_id gnl|my_center|LOCUS_14850 39283 38393 gene locus_tag LOCUS_14860 gene tsf 39283 38393 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926570.1 protein_id gnl|my_center|LOCUS_14860 40119 39364 gene locus_tag LOCUS_14870 gene rpsB 40119 39364 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193246.1 protein_id gnl|my_center|LOCUS_14870 40325 41134 gene locus_tag LOCUS_14880 gene map 40325 41134 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193235.1 protein_id gnl|my_center|LOCUS_14880 41136 43745 gene locus_tag LOCUS_14890 41136 43745 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197089.1 protein_id gnl|my_center|LOCUS_14890 44522 43776 gene locus_tag LOCUS_14900 44522 43776 CDS product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765040.1 protein_id gnl|my_center|LOCUS_14900 45401 44526 gene locus_tag LOCUS_14910 gene galU 45401 44526 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192544.1 protein_id gnl|my_center|LOCUS_14910 47550 45478 gene locus_tag LOCUS_14920 gene ligA 47550 45478 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009937986.1 protein_id gnl|my_center|LOCUS_14920 48629 47547 gene locus_tag LOCUS_14930 48629 47547 CDS product cell division protein ZipA C-terminal FtsZ-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813876.1 protein_id gnl|my_center|LOCUS_14930 52075 48626 gene locus_tag LOCUS_14940 gene smc 52075 48626 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198894.1 protein_id gnl|my_center|LOCUS_14940 52338 52757 gene locus_tag LOCUS_14950 gene queF 52338 52757 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056073.1 protein_id gnl|my_center|LOCUS_14950 52770 53954 gene locus_tag LOCUS_14960 gene dapC 52770 53954 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448163.1 protein_id gnl|my_center|LOCUS_14960 53969 54799 gene locus_tag LOCUS_14970 gene dapD 53969 54799 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191680.1 protein_id gnl|my_center|LOCUS_14970 54815 55159 gene locus_tag LOCUS_14980 54815 55159 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004206564.1 protein_id gnl|my_center|LOCUS_14980 55156 56070 gene locus_tag LOCUS_14990 gene prmB 55156 56070 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812540.1 protein_id gnl|my_center|LOCUS_14990 56080 57993 gene locus_tag LOCUS_15000 56080 57993 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099041.1 protein_id gnl|my_center|LOCUS_15000 59654 58011 gene locus_tag LOCUS_15010 59654 58011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 59732 60376 gene locus_tag LOCUS_15020 59732 60376 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208403.1 protein_id gnl|my_center|LOCUS_15020 60453 62132 gene locus_tag LOCUS_15030 60453 62132 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000241.1 protein_id gnl|my_center|LOCUS_15030 62905 62180 gene locus_tag LOCUS_15040 62905 62180 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039550.1 protein_id gnl|my_center|LOCUS_15040 63135 63527 gene locus_tag LOCUS_15050 63135 63527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 63726 64295 gene locus_tag LOCUS_15060 63726 64295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 64376 65692 gene locus_tag LOCUS_15070 64376 65692 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013994.1 protein_id gnl|my_center|LOCUS_15070 66990 65701 gene locus_tag LOCUS_15080 gene serS 66990 65701 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186129.1 protein_id gnl|my_center|LOCUS_15080 68425 67073 gene locus_tag LOCUS_15090 68425 67073 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185515.1 protein_id gnl|my_center|LOCUS_15090 69057 68422 gene locus_tag LOCUS_15100 gene lolA 69057 68422 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930946.1 protein_id gnl|my_center|LOCUS_15100 71419 69155 gene locus_tag LOCUS_15110 71419 69155 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814032.1 protein_id gnl|my_center|LOCUS_15110 71576 72541 gene locus_tag LOCUS_15120 gene trxB 71576 72541 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065064.1 protein_id gnl|my_center|LOCUS_15120 72587 73210 gene locus_tag LOCUS_15130 72587 73210 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186084.1 protein_id gnl|my_center|LOCUS_15130 73237 74157 gene locus_tag LOCUS_15140 gene estB 73237 74157 CDS product esterase EstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206070.1 protein_id gnl|my_center|LOCUS_15140 75641 74196 gene locus_tag LOCUS_15150 gene fumC 75641 74196 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065019.1 protein_id gnl|my_center|LOCUS_15150 76085 75747 gene locus_tag LOCUS_15160 76085 75747 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193987.1 protein_id gnl|my_center|LOCUS_15160 77737 76082 gene locus_tag LOCUS_15170 77737 76082 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931082.1 protein_id gnl|my_center|LOCUS_15170 77767 78984 gene locus_tag LOCUS_15180 77767 78984 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011832356.1 protein_id gnl|my_center|LOCUS_15180 79562 79035 gene locus_tag LOCUS_15190 gene ppa 79562 79035 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812734.1 protein_id gnl|my_center|LOCUS_15190 80803 79613 gene locus_tag LOCUS_15200 80803 79613 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526333.1 protein_id gnl|my_center|LOCUS_15200 82749 80800 gene locus_tag LOCUS_15210 gene hemDX 82749 80800 CDS product fused uroporphyrinogen-III synthase HemD/membrane protein HemX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193146.1 protein_id gnl|my_center|LOCUS_15210 83652 82759 gene locus_tag LOCUS_15220 gene hemC 83652 82759 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812742.1 protein_id gnl|my_center|LOCUS_15220 83841 85265 gene locus_tag LOCUS_15230 gene argH 83841 85265 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191886.1 protein_id gnl|my_center|LOCUS_15230 85268 85786 gene locus_tag LOCUS_15240 85268 85786 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528212.1 protein_id gnl|my_center|LOCUS_15240 85813 87225 gene locus_tag LOCUS_15250 85813 87225 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173616429.1 protein_id gnl|my_center|LOCUS_15250 88394 87246 gene locus_tag LOCUS_15260 88394 87246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 89073 88405 gene locus_tag LOCUS_15270 89073 88405 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228286.1 protein_id gnl|my_center|LOCUS_15270 90376 89288 gene locus_tag LOCUS_15280 90376 89288 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227769.1 protein_id gnl|my_center|LOCUS_15280 91748 90396 gene locus_tag LOCUS_15290 gene pmbA 91748 90396 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522380.1 protein_id gnl|my_center|LOCUS_15290 91764 92330 gene locus_tag LOCUS_15300 gene yjgA 91764 92330 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522378.1 protein_id gnl|my_center|LOCUS_15300 92327 92932 gene locus_tag LOCUS_15310 gene mog 92327 92932 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647046.1 protein_id gnl|my_center|LOCUS_15310 92929 93600 gene locus_tag LOCUS_15320 92929 93600 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931226.1 protein_id gnl|my_center|LOCUS_15320 93672 93926 gene locus_tag LOCUS_15330 93672 93926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 95311 93947 gene locus_tag LOCUS_15340 95311 93947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 95235 96089 gene locus_tag LOCUS_15350 95235 96089 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091874.1 protein_id gnl|my_center|LOCUS_15350 96628 96086 gene locus_tag LOCUS_15360 96628 96086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 96908 98398 gene locus_tag LOCUS_15370 96908 98398 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389068.1 protein_id gnl|my_center|LOCUS_15370 99841 98399 gene locus_tag LOCUS_15380 99841 98399 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036632.1 protein_id gnl|my_center|LOCUS_15380 102966 99838 gene locus_tag LOCUS_15390 102966 99838 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972023.1 protein_id gnl|my_center|LOCUS_15390 103982 102963 gene locus_tag LOCUS_15400 103982 102963 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337326.1 protein_id gnl|my_center|LOCUS_15400 103950 104141 gene locus_tag LOCUS_15410 103950 104141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 104456 104187 gene locus_tag LOCUS_15420 104456 104187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 104540 104465 gene locus_tag LOCUS_t00180 104540 104465 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 104632 104557 gene locus_tag LOCUS_t00190 104632 104557 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 104824 105390 gene locus_tag LOCUS_15430 104824 105390 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193229.1 protein_id gnl|my_center|LOCUS_15430 105387 106115 gene locus_tag LOCUS_15440 gene aat 105387 106115 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814164.1 protein_id gnl|my_center|LOCUS_15440 106102 106839 gene locus_tag LOCUS_15450 106102 106839 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820991.1 protein_id gnl|my_center|LOCUS_15450 106904 107953 gene locus_tag LOCUS_15460 106904 107953 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193208.1 protein_id gnl|my_center|LOCUS_15460 109366 107957 gene locus_tag LOCUS_15470 109366 107957 CDS product lactate utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191338.1 protein_id gnl|my_center|LOCUS_15470 110124 109384 gene locus_tag LOCUS_15480 110124 109384 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193278.1 protein_id gnl|my_center|LOCUS_15480 110264 111064 gene locus_tag LOCUS_15490 110264 111064 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524720.1 protein_id gnl|my_center|LOCUS_15490 111948 111067 gene locus_tag LOCUS_15500 gene pbpG 111948 111067 CDS product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809563.1 protein_id gnl|my_center|LOCUS_15500 113053 112085 gene locus_tag LOCUS_15510 113053 112085 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257729.1 protein_id gnl|my_center|LOCUS_15510 113199 113756 gene locus_tag LOCUS_15520 113199 113756 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199567.1 protein_id gnl|my_center|LOCUS_15520 114622 113840 gene locus_tag LOCUS_15530 114622 113840 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192990.1 protein_id gnl|my_center|LOCUS_15530 115405 114641 gene locus_tag LOCUS_15540 115405 114641 CDS product EI24 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065045.1 protein_id gnl|my_center|LOCUS_15540 119310 115417 gene locus_tag LOCUS_15550 gene hrpA 119310 115417 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202033.1 protein_id gnl|my_center|LOCUS_15550 119461 120801 gene locus_tag LOCUS_15560 gene argA 119461 120801 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192168.1 protein_id gnl|my_center|LOCUS_15560 120824 122041 gene locus_tag LOCUS_15570 120824 122041 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191808.1 protein_id gnl|my_center|LOCUS_15570 124310 122055 gene locus_tag LOCUS_15580 124310 122055 CDS product arginine/lysine/ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808393.1 protein_id gnl|my_center|LOCUS_15580 124427 125614 gene locus_tag LOCUS_15590 124427 125614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 126150 125584 gene locus_tag LOCUS_15600 gene dcd 126150 125584 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808382.1 protein_id gnl|my_center|LOCUS_15600 126606 126205 gene locus_tag LOCUS_15610 126606 126205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 127811 126795 gene locus_tag LOCUS_15620 gene pip 127811 126795 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414210.1 protein_id gnl|my_center|LOCUS_15620 128923 127832 gene locus_tag LOCUS_15630 gene apbC 128923 127832 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567450.1 protein_id gnl|my_center|LOCUS_15630 129173 129337 gene locus_tag LOCUS_15640 129173 129337 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098329.1 protein_id gnl|my_center|LOCUS_15640 130361 129351 gene locus_tag LOCUS_15650 130361 129351 CDS product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098754.1 protein_id gnl|my_center|LOCUS_15650 131543 130452 gene locus_tag LOCUS_15660 131543 130452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 132903 131632 gene locus_tag LOCUS_15670 132903 131632 CDS product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208114.1 protein_id gnl|my_center|LOCUS_15670 133081 134322 gene locus_tag LOCUS_15680 133081 134322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230324.1 protein_id gnl|my_center|LOCUS_15680 135303 134389 gene locus_tag LOCUS_15690 135303 134389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 135540 136316 gene locus_tag LOCUS_15700 135540 136316 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811187.1 protein_id gnl|my_center|LOCUS_15700 136804 136400 gene locus_tag LOCUS_15710 136804 136400 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814363.1 protein_id gnl|my_center|LOCUS_15710 137255 136794 gene locus_tag LOCUS_15720 137255 136794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 137338 137637 gene locus_tag LOCUS_15730 137338 137637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 139420 137654 gene locus_tag LOCUS_15740 139420 137654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 140285 139581 gene locus_tag LOCUS_15750 140285 139581 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198629.1 protein_id gnl|my_center|LOCUS_15750 140466 140735 gene locus_tag LOCUS_15760 140466 140735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 140753 141817 gene locus_tag LOCUS_15770 140753 141817 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019082059.1 protein_id gnl|my_center|LOCUS_15770 142273 141860 gene locus_tag LOCUS_15780 142273 141860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 143905 142490 gene locus_tag LOCUS_15790 143905 142490 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206633.1 protein_id gnl|my_center|LOCUS_15790 145341 144016 gene locus_tag LOCUS_15800 145341 144016 CDS product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 protein_id gnl|my_center|LOCUS_15800 146253 145381 gene locus_tag LOCUS_15810 146253 145381 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093206.1 protein_id gnl|my_center|LOCUS_15810 146642 146262 gene locus_tag LOCUS_15820 146642 146262 CDS product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259291.1 protein_id gnl|my_center|LOCUS_15820 147095 146646 gene locus_tag LOCUS_15830 147095 146646 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957885.1 protein_id gnl|my_center|LOCUS_15830 147818 147147 gene locus_tag LOCUS_15840 147818 147147 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687893.1 protein_id gnl|my_center|LOCUS_15840 148711 147911 gene locus_tag LOCUS_15850 gene asd 148711 147911 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089371.1 protein_id gnl|my_center|LOCUS_15850 148846 150519 gene locus_tag LOCUS_15860 148846 150519 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089372.1 protein_id gnl|my_center|LOCUS_15860 151088 150456 gene locus_tag LOCUS_15870 151088 150456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089373.1 protein_id gnl|my_center|LOCUS_15870 152917 151730 gene locus_tag LOCUS_15880 152917 151730 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118240.1 protein_id gnl|my_center|LOCUS_15880 153715 152945 gene locus_tag LOCUS_15890 153715 152945 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102518.1 protein_id gnl|my_center|LOCUS_15890 154636 153845 gene locus_tag LOCUS_15900 154636 153845 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141003.1 protein_id gnl|my_center|LOCUS_15900 154814 155806 gene locus_tag LOCUS_15910 154814 155806 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124396.1 protein_id gnl|my_center|LOCUS_15910 155900 156397 gene locus_tag LOCUS_15920 155900 156397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 156387 156830 gene locus_tag LOCUS_15930 156387 156830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 157769 156843 gene locus_tag LOCUS_15940 157769 156843 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189234.1 protein_id gnl|my_center|LOCUS_15940 157866 160214 gene locus_tag LOCUS_15950 gene metE 157866 160214 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114925.1 protein_id gnl|my_center|LOCUS_15950 160295 161488 gene locus_tag LOCUS_15960 160295 161488 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190136.1 protein_id gnl|my_center|LOCUS_15960 161506 163266 gene locus_tag LOCUS_15970 161506 163266 CDS product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071668.1 protein_id gnl|my_center|LOCUS_15970 163269 164168 gene locus_tag LOCUS_15980 163269 164168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 167026 164138 gene locus_tag LOCUS_15990 167026 164138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 167745 167032 gene locus_tag LOCUS_16000 167745 167032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 167938 169164 gene locus_tag LOCUS_16010 167938 169164 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087741.1 protein_id gnl|my_center|LOCUS_16010 170237 169188 gene locus_tag LOCUS_16020 170237 169188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 170330 171337 gene locus_tag LOCUS_16030 170330 171337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 171431 171691 gene locus_tag LOCUS_16040 171431 171691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 171713 171958 gene locus_tag LOCUS_16050 171713 171958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 172632 171970 gene locus_tag LOCUS_16060 172632 171970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 172948 174417 gene locus_tag LOCUS_16070 172948 174417 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 protein_id gnl|my_center|LOCUS_16070 174423 176141 gene locus_tag LOCUS_16080 174423 176141 CDS product bifunctional protein-serine/threonine kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965821.1 protein_id gnl|my_center|LOCUS_16080 178147 176150 gene locus_tag LOCUS_16090 178147 176150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 178356 179858 gene locus_tag LOCUS_16100 178356 179858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 180010 181023 gene locus_tag LOCUS_16110 180010 181023 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206062.1 protein_id gnl|my_center|LOCUS_16110 181108 181518 gene locus_tag LOCUS_16120 181108 181518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 181515 182084 gene locus_tag LOCUS_16130 181515 182084 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729066.1 protein_id gnl|my_center|LOCUS_16130 182161 183036 gene locus_tag LOCUS_16140 182161 183036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 183110 183937 gene locus_tag LOCUS_16150 183110 183937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 183961 185256 gene locus_tag LOCUS_16160 183961 185256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 186298 185261 gene locus_tag LOCUS_16170 186298 185261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 186326 187051 gene locus_tag LOCUS_16180 186326 187051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 189154 187073 gene locus_tag LOCUS_16190 189154 187073 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071046.1 protein_id gnl|my_center|LOCUS_16190 189494 189255 gene locus_tag LOCUS_16200 189494 189255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 191127 189505 gene locus_tag LOCUS_16210 191127 189505 CDS product DUF4331 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929156.1 protein_id gnl|my_center|LOCUS_16210 191289 191981 gene locus_tag LOCUS_16220 191289 191981 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174123.1 protein_id gnl|my_center|LOCUS_16220 192495 191965 gene locus_tag LOCUS_16230 192495 191965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 193915 192572 gene locus_tag LOCUS_16240 193915 192572 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974991.1 protein_id gnl|my_center|LOCUS_16240 195165 194269 gene locus_tag LOCUS_16250 195165 194269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 195213 195896 gene locus_tag LOCUS_16260 195213 195896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 196757 195900 gene locus_tag LOCUS_16270 196757 195900 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071452.1 protein_id gnl|my_center|LOCUS_16270 197542 196763 gene locus_tag LOCUS_16280 197542 196763 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167663.1 protein_id gnl|my_center|LOCUS_16280 198450 197542 gene locus_tag LOCUS_16290 198450 197542 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004790086.1 protein_id gnl|my_center|LOCUS_16290 198647 199414 gene locus_tag LOCUS_16300 198647 199414 CDS product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403429.1 protein_id gnl|my_center|LOCUS_16300 199525 200355 gene locus_tag LOCUS_16310 199525 200355 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087258.1 protein_id gnl|my_center|LOCUS_16310 200560 202041 gene locus_tag LOCUS_16320 200560 202041 CDS product OmpP1/FadL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221819.1 protein_id gnl|my_center|LOCUS_16320 202815 202087 gene locus_tag LOCUS_16330 202815 202087 CDS product DUF533 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106298.1 protein_id gnl|my_center|LOCUS_16330 203640 202834 gene locus_tag LOCUS_16340 203640 202834 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112282.1 protein_id gnl|my_center|LOCUS_16340 206080 203651 gene locus_tag LOCUS_16350 206080 203651 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086677.1 protein_id gnl|my_center|LOCUS_16350 206189 207277 gene locus_tag LOCUS_16360 206189 207277 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640427.1 protein_id gnl|my_center|LOCUS_16360 207271 207837 gene locus_tag LOCUS_16370 207271 207837 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919061.1 protein_id gnl|my_center|LOCUS_16370 208435 207842 gene locus_tag LOCUS_16380 208435 207842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 208551 209681 gene locus_tag LOCUS_16390 208551 209681 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640427.1 protein_id gnl|my_center|LOCUS_16390 209678 210427 gene locus_tag LOCUS_16400 209678 210427 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228742.1 protein_id gnl|my_center|LOCUS_16400 210435 211238 gene locus_tag LOCUS_16410 210435 211238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 211235 212239 gene locus_tag LOCUS_16420 211235 212239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 212232 214556 gene locus_tag LOCUS_16430 212232 214556 CDS product DUF3604 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081158863.1 protein_id gnl|my_center|LOCUS_16430 214569 215636 gene locus_tag LOCUS_16440 214569 215636 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640168.1 protein_id gnl|my_center|LOCUS_16440 215701 217449 gene locus_tag LOCUS_16450 215701 217449 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111122.1 protein_id gnl|my_center|LOCUS_16450 217477 217845 gene locus_tag LOCUS_16460 217477 217845 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265654.1 protein_id gnl|my_center|LOCUS_16460 217850 218548 gene locus_tag LOCUS_16470 217850 218548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 219610 218564 gene locus_tag LOCUS_16480 219610 218564 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813011.1 protein_id gnl|my_center|LOCUS_16480 219833 220642 gene locus_tag LOCUS_16490 219833 220642 CDS product DUF1223 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195184.1 protein_id gnl|my_center|LOCUS_16490 220682 221185 gene locus_tag LOCUS_16500 220682 221185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 221189 221791 gene locus_tag LOCUS_16510 gene msrA 221189 221791 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945865.1 protein_id gnl|my_center|LOCUS_16510 223454 221814 gene locus_tag LOCUS_16520 223454 221814 CDS product 3-(methylthio)propionyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539668.1 protein_id gnl|my_center|LOCUS_16520 223889 223518 gene locus_tag LOCUS_16530 223889 223518 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405486.1 protein_id gnl|my_center|LOCUS_16530 224530 223889 gene locus_tag LOCUS_16540 224530 223889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 225065 224532 gene locus_tag LOCUS_16550 225065 224532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 227359 225047 gene locus_tag LOCUS_16560 227359 225047 CDS product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114701.1 protein_id gnl|my_center|LOCUS_16560 228105 227377 gene locus_tag LOCUS_16570 228105 227377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 228447 228196 gene locus_tag LOCUS_16580 228447 228196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 228422 228670 gene locus_tag LOCUS_16590 228422 228670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 229093 229017 gene locus_tag LOCUS_t00200 229093 229017 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 230677 229166 gene locus_tag LOCUS_16600 230677 229166 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931050.1 protein_id gnl|my_center|LOCUS_16600 232160 230670 gene locus_tag LOCUS_16610 gene glpK 232160 230670 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888563.1 protein_id gnl|my_center|LOCUS_16610 232632 232183 gene locus_tag LOCUS_16620 232632 232183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 232688 233461 gene locus_tag LOCUS_16630 232688 233461 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087987.1 protein_id gnl|my_center|LOCUS_16630 234298 233474 gene locus_tag LOCUS_16640 234298 233474 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061558.1 protein_id gnl|my_center|LOCUS_16640 235821 234295 gene locus_tag LOCUS_16650 235821 234295 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895574.1 protein_id gnl|my_center|LOCUS_16650 236001 237311 gene locus_tag LOCUS_16660 236001 237311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 237397 239286 gene locus_tag LOCUS_16670 237397 239286 CDS product choice-of-anchor I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385247.1 protein_id gnl|my_center|LOCUS_16670 240668 239373 gene locus_tag LOCUS_16680 240668 239373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 241127 241038 gene locus_tag LOCUS_t00210 241127 241038 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 241196 241609 gene locus_tag LOCUS_16690 241196 241609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 241948 243267 gene locus_tag LOCUS_16700 241948 243267 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085587.1 protein_id gnl|my_center|LOCUS_16700 243264 244130 gene locus_tag LOCUS_16710 gene ntrB 243264 244130 CDS product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085588.1 protein_id gnl|my_center|LOCUS_16710 244154 245005 gene locus_tag LOCUS_16720 244154 245005 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397937.1 protein_id gnl|my_center|LOCUS_16720 245191 246312 gene locus_tag LOCUS_16730 245191 246312 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816541.1 protein_id gnl|my_center|LOCUS_16730 246388 246957 gene locus_tag LOCUS_16740 246388 246957 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810992.1 protein_id gnl|my_center|LOCUS_16740 246969 248840 gene locus_tag LOCUS_16750 246969 248840 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810990.1 protein_id gnl|my_center|LOCUS_16750 249227 249138 gene locus_tag LOCUS_t00220 249227 249138 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 250643 249297 gene locus_tag LOCUS_16760 250643 249297 CDS product DUF3422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391173.1 protein_id gnl|my_center|LOCUS_16760 251228 250665 gene locus_tag LOCUS_16770 gene pgsA 251228 250665 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810356.1 protein_id gnl|my_center|LOCUS_16770 253305 251320 gene locus_tag LOCUS_16780 gene uvrC 253305 251320 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113354.1 protein_id gnl|my_center|LOCUS_16780 253993 253316 gene locus_tag LOCUS_16790 253993 253316 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087828.1 protein_id gnl|my_center|LOCUS_16790 258049 253994 gene locus_tag LOCUS_16800 gene purL 258049 253994 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039715.1 protein_id gnl|my_center|LOCUS_16800 258154 259821 gene locus_tag LOCUS_16810 258154 259821 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004547316.1 protein_id gnl|my_center|LOCUS_16810 260460 259780 gene locus_tag LOCUS_16820 260460 259780 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928863.1 protein_id gnl|my_center|LOCUS_16820 260459 261112 gene locus_tag LOCUS_16830 260459 261112 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447512.1 protein_id gnl|my_center|LOCUS_16830 263135 261231 gene locus_tag LOCUS_16840 263135 261231 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527215.1 protein_id gnl|my_center|LOCUS_16840 263356 263280 gene locus_tag LOCUS_t00230 263356 263280 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 263457 263382 gene locus_tag LOCUS_t00240 263457 263382 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 263837 263565 gene locus_tag LOCUS_16850 263837 263565 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812968.1 protein_id gnl|my_center|LOCUS_16850 266460 264052 gene locus_tag LOCUS_16860 gene lon 266460 264052 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193454.1 protein_id gnl|my_center|LOCUS_16860 267894 266623 gene locus_tag LOCUS_16870 gene clpX 267894 266623 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521258.1 protein_id gnl|my_center|LOCUS_16870 268627 267959 gene locus_tag LOCUS_16880 gene clpP 268627 267959 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812508.1 protein_id gnl|my_center|LOCUS_16880 269932 268628 gene locus_tag LOCUS_16890 gene tig 269932 268628 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521257.1 protein_id gnl|my_center|LOCUS_16890 270183 270099 gene locus_tag LOCUS_t00250 270183 270099 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 270271 271116 gene locus_tag LOCUS_16900 270271 271116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 274208 271131 gene locus_tag LOCUS_16910 274208 271131 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024698545.1 protein_id gnl|my_center|LOCUS_16910 275305 274205 gene locus_tag LOCUS_16920 275305 274205 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969409.1 protein_id gnl|my_center|LOCUS_16920 276762 275380 gene locus_tag LOCUS_16930 gene radA 276762 275380 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928233.1 protein_id gnl|my_center|LOCUS_16930 277881 276784 gene locus_tag LOCUS_16940 gene alr 277881 276784 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191260.1 protein_id gnl|my_center|LOCUS_16940 278041 279318 gene locus_tag LOCUS_16950 gene lplT 278041 279318 CDS product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266648.1 protein_id gnl|my_center|LOCUS_16950 280034 279327 gene locus_tag LOCUS_16960 280034 279327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 280492 280034 gene locus_tag LOCUS_16970 gene rimI 280492 280034 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191864.1 protein_id gnl|my_center|LOCUS_16970 281180 280479 gene locus_tag LOCUS_16980 gene tsaB 281180 280479 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199104.1 protein_id gnl|my_center|LOCUS_16980 281674 281180 gene locus_tag LOCUS_16990 gene ispF 281674 281180 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191369.1 protein_id gnl|my_center|LOCUS_16990 282315 281671 gene locus_tag LOCUS_17000 282315 281671 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130039072.1 protein_id gnl|my_center|LOCUS_17000 282498 285992 gene locus_tag LOCUS_17010 gene mfd 282498 285992 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521239.1 protein_id gnl|my_center|LOCUS_17010 285997 287037 gene locus_tag LOCUS_17020 285997 287037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 287034 287906 gene locus_tag LOCUS_17030 gene serB 287034 287906 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193217.1 protein_id gnl|my_center|LOCUS_17030 289148 287967 gene locus_tag LOCUS_17040 289148 287967 CDS product acetyl-CoA C-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192518.1 protein_id gnl|my_center|LOCUS_17040 290556 289195 gene locus_tag LOCUS_17050 gene rimO 290556 289195 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521351.1 protein_id gnl|my_center|LOCUS_17050 291165 290566 gene locus_tag LOCUS_17060 gene phaR 291165 290566 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813585.1 protein_id gnl|my_center|LOCUS_17060 292115 291372 gene locus_tag LOCUS_17070 292115 291372 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193701.1 protein_id gnl|my_center|LOCUS_17070 293339 292161 gene locus_tag LOCUS_17080 293339 292161 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527150.1 protein_id gnl|my_center|LOCUS_17080 295198 293360 gene locus_tag LOCUS_17090 gene phaC 295198 293360 CDS product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930216.1 protein_id gnl|my_center|LOCUS_17090 295331 295630 gene locus_tag LOCUS_17100 295331 295630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 296294 295527 gene locus_tag LOCUS_17110 gene pgeF 296294 295527 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266592.1 protein_id gnl|my_center|LOCUS_17110 297507 296341 gene locus_tag LOCUS_17120 297507 296341 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203970.1 protein_id gnl|my_center|LOCUS_17120 297587 298471 gene locus_tag LOCUS_17130 297587 298471 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813594.1 protein_id gnl|my_center|LOCUS_17130 300499 298535 gene locus_tag LOCUS_17140 300499 298535 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930213.1 protein_id gnl|my_center|LOCUS_17140 300745 300530 gene locus_tag LOCUS_17150 300745 300530 CDS product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388803.1 protein_id gnl|my_center|LOCUS_17150 301243 300845 gene locus_tag LOCUS_17160 301243 300845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 301256 303619 gene locus_tag LOCUS_17170 301256 303619 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192485.1 protein_id gnl|my_center|LOCUS_17170 304717 303626 gene locus_tag LOCUS_17180 gene zapE 304717 303626 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550551.1 protein_id gnl|my_center|LOCUS_17180 306238 304802 gene locus_tag LOCUS_17190 gene lpdA 306238 304802 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534933.1 protein_id gnl|my_center|LOCUS_17190 307536 306250 gene locus_tag LOCUS_17200 gene odhB 307536 306250 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192735.1 protein_id gnl|my_center|LOCUS_17200 310535 307605 gene locus_tag LOCUS_17210 310535 307605 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191889.1 protein_id gnl|my_center|LOCUS_17210 312078 310771 gene locus_tag LOCUS_17220 312078 310771 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065159.1 protein_id gnl|my_center|LOCUS_17220 312305 312105 gene locus_tag LOCUS_17230 312305 312105 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813647.1 protein_id gnl|my_center|LOCUS_17230 313166 312450 gene locus_tag LOCUS_17240 313166 312450 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065157.1 protein_id gnl|my_center|LOCUS_17240 314970 313189 gene locus_tag LOCUS_17250 gene sdhA 314970 313189 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813651.1 protein_id gnl|my_center|LOCUS_17250 315350 314973 gene locus_tag LOCUS_17260 gene sdhD 315350 314973 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813653.1 protein_id gnl|my_center|LOCUS_17260 315766 315353 gene locus_tag LOCUS_17270 gene sdhC 315766 315353 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813654.1 protein_id gnl|my_center|LOCUS_17270 316691 315963 gene locus_tag LOCUS_17280 316691 315963 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196014.1 protein_id gnl|my_center|LOCUS_17280 316852 317838 gene locus_tag LOCUS_17290 316852 317838 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187735.1 protein_id gnl|my_center|LOCUS_17290 317913 318890 gene locus_tag LOCUS_17300 317913 318890 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188261.1 protein_id gnl|my_center|LOCUS_17300 319435 318887 gene locus_tag LOCUS_17310 319435 318887 CDS product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460763.1 protein_id gnl|my_center|LOCUS_17310 319725 319441 gene locus_tag LOCUS_17320 gene cmaL 319725 319441 CDS product coronamic acid biosynthesis protein CmaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005888835.1 protein_id gnl|my_center|LOCUS_17320 320107 322068 gene locus_tag LOCUS_17330 320107 322068 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105228.1 protein_id gnl|my_center|LOCUS_17330 322065 322973 gene locus_tag LOCUS_17340 gene rlmF 322065 322973 CDS product 23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070538.1 protein_id gnl|my_center|LOCUS_17340 323198 322977 gene locus_tag LOCUS_17350 323198 322977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 323599 323267 gene locus_tag LOCUS_17360 323599 323267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 324022 323864 gene locus_tag LOCUS_17370 324022 323864 CDS product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084988.1 protein_id gnl|my_center|LOCUS_17370 324528 324121 gene locus_tag LOCUS_17380 gene arfB 324528 324121 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314723.1 protein_id gnl|my_center|LOCUS_17380 326128 324533 gene locus_tag LOCUS_17390 gene prpR 326128 324533 CDS product propionate catabolism operon regulatory protein PrpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941041.1 protein_id gnl|my_center|LOCUS_17390 326324 327205 gene locus_tag LOCUS_17400 gene prpB 326324 327205 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103044.1 protein_id gnl|my_center|LOCUS_17400 327265 328425 gene locus_tag LOCUS_17410 gene prpC 327265 328425 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036232.1 protein_id gnl|my_center|LOCUS_17410 328434 331058 gene locus_tag LOCUS_17420 gene acnD 328434 331058 CDS product Fe/S-dependent 2-methylisocitrate dehydratase AcnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115200.1 protein_id gnl|my_center|LOCUS_17420 331055 332266 gene locus_tag LOCUS_17430 gene prpF 331055 332266 CDS product 2-methylaconitate cis-trans isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065151.1 protein_id gnl|my_center|LOCUS_17430 333768 332263 gene locus_tag LOCUS_17440 333768 332263 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618874.1 protein_id gnl|my_center|LOCUS_17440 333957 334325 gene locus_tag LOCUS_17450 333957 334325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 336954 334372 gene locus_tag LOCUS_17460 gene acnB 336954 334372 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064143.1 protein_id gnl|my_center|LOCUS_17460 338142 337138 gene locus_tag LOCUS_17470 338142 337138 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206790.1 protein_id gnl|my_center|LOCUS_17470 338233 339204 gene locus_tag LOCUS_17480 338233 339204 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091085.1 protein_id gnl|my_center|LOCUS_17480 339313 340242 gene locus_tag LOCUS_17490 339313 340242 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477210.1 protein_id gnl|my_center|LOCUS_17490 340289 341530 gene locus_tag LOCUS_17500 340289 341530 CDS product DUF2863 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199318.1 protein_id gnl|my_center|LOCUS_17500 341556 344279 gene locus_tag LOCUS_17510 gene acnA 341556 344279 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187807.1 protein_id gnl|my_center|LOCUS_17510 345915 344293 gene locus_tag LOCUS_17520 345915 344293 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388526.1 protein_id gnl|my_center|LOCUS_17520 346032 347084 gene locus_tag LOCUS_17530 346032 347084 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092092.1 protein_id gnl|my_center|LOCUS_17530 347921 347088 gene locus_tag LOCUS_17540 347921 347088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 349449 348016 gene locus_tag LOCUS_17550 349449 348016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 351277 349583 gene locus_tag LOCUS_17560 351277 349583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 352644 351286 gene locus_tag LOCUS_17570 352644 351286 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938317.1 protein_id gnl|my_center|LOCUS_17570 354572 352644 gene locus_tag LOCUS_17580 354572 352644 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073977.1 protein_id gnl|my_center|LOCUS_17580 355003 354587 gene locus_tag LOCUS_17590 355003 354587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 355648 355013 gene locus_tag LOCUS_17600 355648 355013 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084991.1 protein_id gnl|my_center|LOCUS_17600 356069 356755 gene locus_tag LOCUS_17610 356069 356755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 356871 357575 gene locus_tag LOCUS_17620 gene queC 356871 357575 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190026.1 protein_id gnl|my_center|LOCUS_17620 357739 357814 gene locus_tag LOCUS_t00260 357739 357814 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 357881 357954 gene locus_tag LOCUS_t00270 357881 357954 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 357971 358063 gene locus_tag LOCUS_t00280 357971 358063 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 358140 360215 gene locus_tag LOCUS_17630 gene metG 358140 360215 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203868.1 protein_id gnl|my_center|LOCUS_17630 360226 361932 gene locus_tag LOCUS_17640 gene sulP 360226 361932 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937588.1 protein_id gnl|my_center|LOCUS_17640 361978 362160 gene locus_tag LOCUS_17650 361978 362160 CDS product DUF3460 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193782.1 protein_id gnl|my_center|LOCUS_17650 362173 363051 gene locus_tag LOCUS_17660 362173 363051 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192594.1 protein_id gnl|my_center|LOCUS_17660 363350 363162 gene locus_tag LOCUS_17670 363350 363162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 364631 363504 gene locus_tag LOCUS_17680 gene dnaJ 364631 363504 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821186.1 protein_id gnl|my_center|LOCUS_17680 366727 364775 gene locus_tag LOCUS_17690 gene dnaK 366727 364775 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039219.1 protein_id gnl|my_center|LOCUS_17690 367439 366840 gene locus_tag LOCUS_17700 gene grpE 367439 366840 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194243.1 protein_id gnl|my_center|LOCUS_17700 368692 367586 gene locus_tag LOCUS_17710 gene hemH 368692 367586 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527679.1 protein_id gnl|my_center|LOCUS_17710 369777 368758 gene locus_tag LOCUS_17720 gene hrcA 369777 368758 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814090.1 protein_id gnl|my_center|LOCUS_17720 369884 370819 gene locus_tag LOCUS_17730 369884 370819 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533590.1 protein_id gnl|my_center|LOCUS_17730 370809 372464 gene locus_tag LOCUS_17740 gene recN 370809 372464 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930962.1 protein_id gnl|my_center|LOCUS_17740 372910 372482 gene locus_tag LOCUS_17750 gene fur 372910 372482 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194273.1 protein_id gnl|my_center|LOCUS_17750 373015 373524 gene locus_tag LOCUS_17760 373015 373524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 373531 374349 gene locus_tag LOCUS_17770 gene dapB 373531 374349 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557251.1 protein_id gnl|my_center|LOCUS_17770 374454 374681 gene locus_tag LOCUS_17780 374454 374681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 374682 375017 gene locus_tag LOCUS_17790 374682 375017 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039082.1 protein_id gnl|my_center|LOCUS_17790 375288 376100 gene locus_tag LOCUS_17800 375288 376100 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813022.1 protein_id gnl|my_center|LOCUS_17800 376976 376128 gene locus_tag LOCUS_17810 gene lgt 376976 376128 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814606.1 protein_id gnl|my_center|LOCUS_17810 377121 378809 gene locus_tag LOCUS_17820 gene ilvD 377121 378809 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191611.1 protein_id gnl|my_center|LOCUS_17820 379167 379475 gene locus_tag LOCUS_17830 gene nirM 379167 379475 CDS product cytochrome C-551 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084872.1 protein_id gnl|my_center|LOCUS_17830 380697 379543 gene locus_tag LOCUS_17840 380697 379543 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525689.1 protein_id gnl|my_center|LOCUS_17840 380866 381831 gene locus_tag LOCUS_17850 380866 381831 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526290.1 protein_id gnl|my_center|LOCUS_17850 381828 382901 gene locus_tag LOCUS_17860 381828 382901 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039587.1 protein_id gnl|my_center|LOCUS_17860 382883 383671 gene locus_tag LOCUS_17870 382883 383671 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194783.1 protein_id gnl|my_center|LOCUS_17870 383664 384401 gene locus_tag LOCUS_17880 383664 384401 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185649.1 protein_id gnl|my_center|LOCUS_17880 385436 384414 gene locus_tag LOCUS_17890 385436 384414 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185343.1 protein_id gnl|my_center|LOCUS_17890 385542 386390 gene locus_tag LOCUS_17900 385542 386390 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194782.1 protein_id gnl|my_center|LOCUS_17900 386685 386410 gene locus_tag LOCUS_17910 386685 386410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 387863 386736 gene locus_tag LOCUS_17920 387863 386736 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810994.1 protein_id gnl|my_center|LOCUS_17920 388456 387866 gene locus_tag LOCUS_17930 388456 387866 CDS product lactate utilization protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192015.1 protein_id gnl|my_center|LOCUS_17930 388720 389043 gene locus_tag LOCUS_17940 388720 389043 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931551.1 protein_id gnl|my_center|LOCUS_17940 389077 389883 gene locus_tag LOCUS_17950 389077 389883 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813853.1 protein_id gnl|my_center|LOCUS_17950 389999 391234 gene locus_tag LOCUS_17960 gene phaZ 389999 391234 CDS product polyhydroxyalkanoate depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813854.1 protein_id gnl|my_center|LOCUS_17960 391305 391868 gene locus_tag LOCUS_17970 391305 391868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 391865 392497 gene locus_tag LOCUS_17980 gene nth 391865 392497 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092050.1 protein_id gnl|my_center|LOCUS_17980 392494 393588 gene locus_tag LOCUS_17990 392494 393588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 393608 394042 gene locus_tag LOCUS_18000 393608 394042 CDS product DUF1841 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814061.1 protein_id gnl|my_center|LOCUS_18000 394469 394137 gene locus_tag LOCUS_18010 394469 394137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 394833 394492 gene locus_tag LOCUS_18020 394833 394492 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814065.1 protein_id gnl|my_center|LOCUS_18020 395044 395886 gene locus_tag LOCUS_18030 395044 395886 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526405.1 protein_id gnl|my_center|LOCUS_18030 395901 397076 gene locus_tag LOCUS_18040 395901 397076 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186167.1 protein_id gnl|my_center|LOCUS_18040 397146 397736 gene locus_tag LOCUS_18050 397146 397736 CDS product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815724.1 protein_id gnl|my_center|LOCUS_18050 397878 398339 gene locus_tag LOCUS_18060 397878 398339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 400250 398352 gene locus_tag LOCUS_18070 gene htpG 400250 398352 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038845.1 protein_id gnl|my_center|LOCUS_18070 402668 400347 gene locus_tag LOCUS_18080 gene parC 402668 400347 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186334.1 protein_id gnl|my_center|LOCUS_18080 403421 402687 gene locus_tag LOCUS_18090 gene rlmB 403421 402687 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191786.1 protein_id gnl|my_center|LOCUS_18090 405952 403436 gene locus_tag LOCUS_18100 gene rnr 405952 403436 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931522.1 protein_id gnl|my_center|LOCUS_18100 405997 406083 gene locus_tag LOCUS_t00290 405997 406083 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 407268 406213 gene locus_tag LOCUS_18110 407268 406213 CDS product DUF481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942983.1 protein_id gnl|my_center|LOCUS_18110 407855 407379 gene locus_tag LOCUS_18120 407855 407379 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527158.1 protein_id gnl|my_center|LOCUS_18120 409174 407873 gene locus_tag LOCUS_18130 409174 407873 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222698.1 protein_id gnl|my_center|LOCUS_18130 410373 409171 gene locus_tag LOCUS_18140 410373 409171 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192327.1 protein_id gnl|my_center|LOCUS_18140 410580 410401 gene locus_tag LOCUS_18150 410580 410401 CDS product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089295.1 protein_id gnl|my_center|LOCUS_18150 411516 410650 gene locus_tag LOCUS_18160 gene hflC 411516 410650 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810713.1 protein_id gnl|my_center|LOCUS_18160 412817 411519 gene locus_tag LOCUS_18170 gene hflK 412817 411519 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928767.1 protein_id gnl|my_center|LOCUS_18170 413981 412860 gene locus_tag LOCUS_18180 gene hflX 413981 412860 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191816.1 protein_id gnl|my_center|LOCUS_18180 414251 414018 gene locus_tag LOCUS_18190 gene hfq 414251 414018 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192796.1 protein_id gnl|my_center|LOCUS_18190 415834 414431 gene locus_tag LOCUS_18200 415834 414431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 415849 416454 gene locus_tag LOCUS_18210 gene wrbA 415849 416454 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193704.1 protein_id gnl|my_center|LOCUS_18210 416454 416837 gene locus_tag LOCUS_18220 416454 416837 CDS product DUF2069 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222851.1 protein_id gnl|my_center|LOCUS_18220 416842 418272 gene locus_tag LOCUS_18230 416842 418272 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191226.1 protein_id gnl|my_center|LOCUS_18230 418748 418269 gene locus_tag LOCUS_18240 418748 418269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 419782 418799 gene locus_tag LOCUS_18250 gene dusA 419782 418799 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199459.1 protein_id gnl|my_center|LOCUS_18250 421671 419851 gene locus_tag LOCUS_18260 gene typA 421671 419851 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810554.1 protein_id gnl|my_center|LOCUS_18260 422690 421668 gene locus_tag LOCUS_18270 gene truB 422690 421668 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203915.1 protein_id gnl|my_center|LOCUS_18270 423066 422662 gene locus_tag LOCUS_18280 gene rbfA 423066 422662 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199441.1 protein_id gnl|my_center|LOCUS_18280 425919 423094 gene locus_tag LOCUS_18290 gene infB 425919 423094 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526850.1 protein_id gnl|my_center|LOCUS_18290 427461 425992 gene locus_tag LOCUS_18300 gene nusA 427461 425992 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810546.1 protein_id gnl|my_center|LOCUS_18300 427975 427472 gene locus_tag LOCUS_18310 gene rimP 427975 427472 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193908.1 protein_id gnl|my_center|LOCUS_18310 429538 428162 gene locus_tag LOCUS_18320 429538 428162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 430124 429510 gene locus_tag LOCUS_18330 430124 429510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 430801 430586 gene locus_tag LOCUS_18340 430801 430586 CDS product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191494.1 protein_id gnl|my_center|LOCUS_18340 431305 430811 gene locus_tag LOCUS_18350 431305 430811 CDS product hotdog fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099189.1 protein_id gnl|my_center|LOCUS_18350 431433 431509 gene locus_tag LOCUS_t00300 431433 431509 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 432473 431763 gene locus_tag LOCUS_18360 432473 431763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 434738 433746 gene locus_tag LOCUS_18370 434738 433746 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083692.1 protein_id gnl|my_center|LOCUS_18370 435903 434968 gene locus_tag LOCUS_18380 435903 434968 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206473.1 protein_id gnl|my_center|LOCUS_18380 436014 436412 gene locus_tag LOCUS_18390 436014 436412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 437431 436475 gene locus_tag LOCUS_18400 437431 436475 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974553.1 protein_id gnl|my_center|LOCUS_18400 438518 437610 gene locus_tag LOCUS_18410 438518 437610 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084684.1 protein_id gnl|my_center|LOCUS_18410 438830 439126 gene locus_tag LOCUS_18420 438830 439126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 440420 439158 gene locus_tag LOCUS_18430 440420 439158 CDS product NADH:flavin oxidoreductase/NADH oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528855.1 protein_id gnl|my_center|LOCUS_18430 441238 440417 gene locus_tag LOCUS_18440 441238 440417 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245058.1 protein_id gnl|my_center|LOCUS_18440 441354 441797 gene locus_tag LOCUS_18450 441354 441797 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170904.1 protein_id gnl|my_center|LOCUS_18450 442772 441822 gene locus_tag LOCUS_18460 442772 441822 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207868.1 protein_id gnl|my_center|LOCUS_18460 442950 443936 gene locus_tag LOCUS_18470 442950 443936 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073578.1 protein_id gnl|my_center|LOCUS_18470 444496 443918 gene locus_tag LOCUS_18480 444496 443918 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103689.1 protein_id gnl|my_center|LOCUS_18480 444933 444532 gene locus_tag LOCUS_18490 444933 444532 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078608.1 protein_id gnl|my_center|LOCUS_18490 445478 444948 gene locus_tag LOCUS_18500 445478 444948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 446421 445471 gene locus_tag LOCUS_18510 446421 445471 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206965.1 protein_id gnl|my_center|LOCUS_18510 447055 446519 gene locus_tag LOCUS_18520 447055 446519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 447100 448395 gene locus_tag LOCUS_18530 gene egtB 447100 448395 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027439.1 protein_id gnl|my_center|LOCUS_18530 448402 449151 gene locus_tag LOCUS_18540 448402 449151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18540 451276 449162 gene locus_tag LOCUS_18550 451276 449162 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112888.1 protein_id gnl|my_center|LOCUS_18550 451396 452397 gene locus_tag LOCUS_18560 451396 452397 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123109.1 protein_id gnl|my_center|LOCUS_18560 452552 452947 gene locus_tag LOCUS_18570 452552 452947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 453094 453801 gene locus_tag LOCUS_18580 453094 453801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 453805 455568 gene locus_tag LOCUS_18590 453805 455568 CDS product PilN family type IVB pilus formation outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817106.1 protein_id gnl|my_center|LOCUS_18590 455585 456874 gene locus_tag LOCUS_18600 455585 456874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 456864 457442 gene locus_tag LOCUS_18610 456864 457442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 457445 459175 gene locus_tag LOCUS_18620 457445 459175 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537540.1 protein_id gnl|my_center|LOCUS_18620 459178 460329 gene locus_tag LOCUS_18630 459178 460329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 460445 460993 gene locus_tag LOCUS_18640 460445 460993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 461064 462068 gene locus_tag LOCUS_18650 461064 462068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 462070 462600 gene locus_tag LOCUS_18660 462070 462600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 462754 463335 gene locus_tag LOCUS_18670 462754 463335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 463343 463957 gene locus_tag LOCUS_18680 463343 463957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 464211 463954 gene locus_tag LOCUS_18690 464211 463954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 465097 464297 gene locus_tag LOCUS_18700 465097 464297 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086933.1 protein_id gnl|my_center|LOCUS_18700 465654 465094 gene locus_tag LOCUS_18710 465654 465094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 466229 465726 gene locus_tag LOCUS_18720 466229 465726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 466378 467277 gene locus_tag LOCUS_18730 466378 467277 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812788.1 protein_id gnl|my_center|LOCUS_18730 467482 468645 gene locus_tag LOCUS_18740 467482 468645 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116208.1 protein_id gnl|my_center|LOCUS_18740 469564 468650 gene locus_tag LOCUS_18750 469564 468650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 469822 469610 gene locus_tag LOCUS_18760 469822 469610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 470123 469836 gene locus_tag LOCUS_18770 470123 469836 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019402.1 protein_id gnl|my_center|LOCUS_18770 470441 470163 gene locus_tag LOCUS_18780 470441 470163 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019401.1 protein_id gnl|my_center|LOCUS_18780 472184 470538 gene locus_tag LOCUS_18790 472184 470538 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393021.1 protein_id gnl|my_center|LOCUS_18790 472404 474593 gene locus_tag LOCUS_18800 472404 474593 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038670.1 protein_id gnl|my_center|LOCUS_18800 475452 474931 gene locus_tag LOCUS_18810 475452 474931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 476390 476088 gene locus_tag LOCUS_18820 476390 476088 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061280.1 protein_id gnl|my_center|LOCUS_18820 >Feature sequence08 318 91 gene locus_tag LOCUS_18830 318 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 1051 1227 gene locus_tag LOCUS_18840 1051 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 1410 2396 gene locus_tag LOCUS_18850 1410 2396 CDS product LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122374.1 protein_id gnl|my_center|LOCUS_18850 2530 2835 gene locus_tag LOCUS_18860 gene pyeR 2530 2835 CDS product ArsR family transcriptional repressor PyeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093978.1 protein_id gnl|my_center|LOCUS_18860 3048 4037 gene locus_tag LOCUS_18870 3048 4037 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967019.1 protein_id gnl|my_center|LOCUS_18870 5194 4166 gene locus_tag LOCUS_18880 5194 4166 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704948.1 protein_id gnl|my_center|LOCUS_18880 5258 5560 gene locus_tag LOCUS_18890 5258 5560 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061280.1 protein_id gnl|my_center|LOCUS_18890 6374 5970 gene locus_tag LOCUS_18900 6374 5970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 6831 6535 gene locus_tag LOCUS_18910 6831 6535 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812968.1 protein_id gnl|my_center|LOCUS_18910 7250 6936 gene locus_tag LOCUS_18920 7250 6936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 9251 7389 gene locus_tag LOCUS_18930 9251 7389 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919291.1 protein_id gnl|my_center|LOCUS_18930 12163 9248 gene locus_tag LOCUS_18940 12163 9248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 13104 12211 gene locus_tag LOCUS_18950 13104 12211 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083964.1 protein_id gnl|my_center|LOCUS_18950 13206 14081 gene locus_tag LOCUS_18960 13206 14081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 14668 14078 gene locus_tag LOCUS_18970 14668 14078 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208136.1 protein_id gnl|my_center|LOCUS_18970 15504 14674 gene locus_tag LOCUS_18980 15504 14674 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530170.1 protein_id gnl|my_center|LOCUS_18980 16793 15564 gene locus_tag LOCUS_18990 16793 15564 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208135.1 protein_id gnl|my_center|LOCUS_18990 18930 16849 gene locus_tag LOCUS_19000 18930 16849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 19203 19036 gene locus_tag LOCUS_19010 19203 19036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 19150 19440 gene locus_tag LOCUS_19020 19150 19440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 19454 19834 gene locus_tag LOCUS_19030 19454 19834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 21574 19862 gene locus_tag LOCUS_19040 21574 19862 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114325.1 protein_id gnl|my_center|LOCUS_19040 21728 22051 gene locus_tag LOCUS_19050 21728 22051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 22126 22329 gene locus_tag LOCUS_19060 22126 22329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 22954 22349 gene locus_tag LOCUS_19070 22954 22349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 23071 24213 gene locus_tag LOCUS_19080 23071 24213 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224351.1 protein_id gnl|my_center|LOCUS_19080 24523 26142 gene locus_tag LOCUS_19090 24523 26142 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037458.1 protein_id gnl|my_center|LOCUS_19090 26170 27234 gene locus_tag LOCUS_19100 26170 27234 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770011.1 protein_id gnl|my_center|LOCUS_19100 27251 27616 gene locus_tag LOCUS_19110 27251 27616 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704967.1 protein_id gnl|my_center|LOCUS_19110 27644 27952 gene locus_tag LOCUS_19120 27644 27952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 27942 29921 gene locus_tag LOCUS_19130 27942 29921 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266629.1 protein_id gnl|my_center|LOCUS_19130 29940 30446 gene locus_tag LOCUS_19140 29940 30446 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381223.1 protein_id gnl|my_center|LOCUS_19140 30468 31160 gene locus_tag LOCUS_19150 30468 31160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 31975 31166 gene locus_tag LOCUS_19160 31975 31166 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102992.1 protein_id gnl|my_center|LOCUS_19160 32129 32878 gene locus_tag LOCUS_19170 32129 32878 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206673.1 protein_id gnl|my_center|LOCUS_19170 33023 33559 gene locus_tag LOCUS_19180 33023 33559 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058086430.1 protein_id gnl|my_center|LOCUS_19180 33640 33969 gene locus_tag LOCUS_19190 33640 33969 CDS product H-NS histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337920.1 protein_id gnl|my_center|LOCUS_19190 35250 34036 gene locus_tag LOCUS_19200 35250 34036 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530350.1 protein_id gnl|my_center|LOCUS_19200 36668 35247 gene locus_tag LOCUS_19210 gene gltX 36668 35247 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814917.1 protein_id gnl|my_center|LOCUS_19210 36733 37368 gene locus_tag LOCUS_19220 36733 37368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 37462 39705 gene locus_tag LOCUS_19230 37462 39705 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810151.1 protein_id gnl|my_center|LOCUS_19230 39705 40682 gene locus_tag LOCUS_19240 39705 40682 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810153.1 protein_id gnl|my_center|LOCUS_19240 40696 42093 gene locus_tag LOCUS_19250 40696 42093 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926305.1 protein_id gnl|my_center|LOCUS_19250 42098 43942 gene locus_tag LOCUS_19260 42098 43942 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025862444.1 protein_id gnl|my_center|LOCUS_19260 45197 43950 gene locus_tag LOCUS_19270 45197 43950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 46135 45362 gene locus_tag LOCUS_19280 gene gloB 46135 45362 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072516.1 protein_id gnl|my_center|LOCUS_19280 46126 46944 gene locus_tag LOCUS_19290 46126 46944 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192921.1 protein_id gnl|my_center|LOCUS_19290 46963 47418 gene locus_tag LOCUS_19300 gene rnhA 46963 47418 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814734.1 protein_id gnl|my_center|LOCUS_19300 47415 48137 gene locus_tag LOCUS_19310 gene dnaQ 47415 48137 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531112.1 protein_id gnl|my_center|LOCUS_19310 48150 50447 gene locus_tag LOCUS_19320 48150 50447 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808566.1 protein_id gnl|my_center|LOCUS_19320 50528 52267 gene locus_tag LOCUS_19330 50528 52267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 52298 53077 gene locus_tag LOCUS_19340 52298 53077 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546308.1 protein_id gnl|my_center|LOCUS_19340 53096 54736 gene locus_tag LOCUS_19350 53096 54736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 54748 60006 gene locus_tag LOCUS_19360 54748 60006 CDS product filamentous hemagglutinin N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208725.1 protein_id gnl|my_center|LOCUS_19360 60018 61472 gene locus_tag LOCUS_19370 60018 61472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 61486 63750 gene locus_tag LOCUS_19380 61486 63750 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444419.1 protein_id gnl|my_center|LOCUS_19380 66243 63781 gene locus_tag LOCUS_19390 66243 63781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 67581 66247 gene locus_tag LOCUS_19400 67581 66247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 71490 67585 gene locus_tag LOCUS_19410 71490 67585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 73738 71501 gene locus_tag LOCUS_19420 73738 71501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 75705 73723 gene locus_tag LOCUS_19430 75705 73723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 77275 75809 gene locus_tag LOCUS_19440 77275 75809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 78097 77282 gene locus_tag LOCUS_19450 78097 77282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 78227 79474 gene locus_tag LOCUS_19460 78227 79474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 79471 80787 gene locus_tag LOCUS_19470 79471 80787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 80790 81482 gene locus_tag LOCUS_19480 gene ccmC 80790 81482 CDS product heme ABC transporter permease CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063823.1 protein_id gnl|my_center|LOCUS_19480 81501 81674 gene locus_tag LOCUS_19490 81501 81674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 81667 82074 gene locus_tag LOCUS_19500 gene ccmE 81667 82074 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765255.1 protein_id gnl|my_center|LOCUS_19500 82071 84062 gene locus_tag LOCUS_19510 82071 84062 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114291.1 protein_id gnl|my_center|LOCUS_19510 84059 84628 gene locus_tag LOCUS_19520 84059 84628 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083302.1 protein_id gnl|my_center|LOCUS_19520 84625 85023 gene locus_tag LOCUS_19530 84625 85023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 86364 85036 gene locus_tag LOCUS_19540 86364 85036 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920611.1 protein_id gnl|my_center|LOCUS_19540 86663 86361 gene locus_tag LOCUS_19550 86663 86361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 87385 87861 gene locus_tag LOCUS_19560 87385 87861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 87980 88807 gene locus_tag LOCUS_19570 87980 88807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 88896 89951 gene locus_tag LOCUS_19580 88896 89951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095387.1 protein_id gnl|my_center|LOCUS_19580 89958 90527 gene locus_tag LOCUS_19590 89958 90527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 90643 91836 gene locus_tag LOCUS_19600 90643 91836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 93675 92014 gene locus_tag LOCUS_19610 gene ettA 93675 92014 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814257.1 protein_id gnl|my_center|LOCUS_19610 94856 93714 gene locus_tag LOCUS_19620 94856 93714 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269384.1 protein_id gnl|my_center|LOCUS_19620 95119 95958 gene locus_tag LOCUS_19630 95119 95958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 97087 96032 gene locus_tag LOCUS_19640 97087 96032 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462750.1 protein_id gnl|my_center|LOCUS_19640 97605 97141 gene locus_tag LOCUS_19650 97605 97141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 97993 100488 gene locus_tag LOCUS_19660 97993 100488 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705253.1 protein_id gnl|my_center|LOCUS_19660 100565 102403 gene locus_tag LOCUS_19670 100565 102403 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009937746.1 protein_id gnl|my_center|LOCUS_19670 102603 104567 gene locus_tag LOCUS_19680 102603 104567 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814863.1 protein_id gnl|my_center|LOCUS_19680 104596 105849 gene locus_tag LOCUS_19690 104596 105849 CDS product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814861.1 protein_id gnl|my_center|LOCUS_19690 105860 107326 gene locus_tag LOCUS_19700 105860 107326 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814858.1 protein_id gnl|my_center|LOCUS_19700 107316 108293 gene locus_tag LOCUS_19710 gene cobD 107316 108293 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390401.1 protein_id gnl|my_center|LOCUS_19710 108764 108297 gene locus_tag LOCUS_19720 108764 108297 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065147.1 protein_id gnl|my_center|LOCUS_19720 109233 108826 gene locus_tag LOCUS_19730 109233 108826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 109741 109253 gene locus_tag LOCUS_19740 109741 109253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 110298 109738 gene locus_tag LOCUS_19750 110298 109738 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186304.1 protein_id gnl|my_center|LOCUS_19750 110690 112402 gene locus_tag LOCUS_19760 110690 112402 CDS product acetolactate synthase 3 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814007.1 protein_id gnl|my_center|LOCUS_19760 112419 112910 gene locus_tag LOCUS_19770 gene ilvN 112419 112910 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186134.1 protein_id gnl|my_center|LOCUS_19770 112949 113965 gene locus_tag LOCUS_19780 gene ilvC 112949 113965 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218988.1 protein_id gnl|my_center|LOCUS_19780 114143 114787 gene locus_tag LOCUS_19790 114143 114787 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531897.1 protein_id gnl|my_center|LOCUS_19790 114790 115608 gene locus_tag LOCUS_19800 gene pssA 114790 115608 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814004.1 protein_id gnl|my_center|LOCUS_19800 115719 117260 gene locus_tag LOCUS_19810 115719 117260 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522419.1 protein_id gnl|my_center|LOCUS_19810 117395 117658 gene locus_tag LOCUS_19820 gene rpsO 117395 117658 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814002.1 protein_id gnl|my_center|LOCUS_19820 117791 119935 gene locus_tag LOCUS_19830 gene pnp 117791 119935 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821234.1 protein_id gnl|my_center|LOCUS_19830 119935 120951 gene locus_tag LOCUS_19840 119935 120951 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813997.1 protein_id gnl|my_center|LOCUS_19840 120960 121745 gene locus_tag LOCUS_19850 gene tpiA 120960 121745 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186004.1 protein_id gnl|my_center|LOCUS_19850 121753 122115 gene locus_tag LOCUS_19860 gene secG 121753 122115 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185627.1 protein_id gnl|my_center|LOCUS_19860 122152 122237 gene locus_tag LOCUS_t00310 122152 122237 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 122325 122684 gene locus_tag LOCUS_19870 122325 122684 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813943.1 protein_id gnl|my_center|LOCUS_19870 122750 123226 gene locus_tag LOCUS_19880 122750 123226 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186402.1 protein_id gnl|my_center|LOCUS_19880 123239 123850 gene locus_tag LOCUS_19890 123239 123850 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186121.1 protein_id gnl|my_center|LOCUS_19890 123853 125106 gene locus_tag LOCUS_19900 123853 125106 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185833.1 protein_id gnl|my_center|LOCUS_19900 125122 125601 gene locus_tag LOCUS_19910 gene nuoE 125122 125601 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813932.1 protein_id gnl|my_center|LOCUS_19910 125598 126893 gene locus_tag LOCUS_19920 gene nuoF 125598 126893 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813930.1 protein_id gnl|my_center|LOCUS_19920 126914 129190 gene locus_tag LOCUS_19930 gene nuoG 126914 129190 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813928.1 protein_id gnl|my_center|LOCUS_19930 129187 130254 gene locus_tag LOCUS_19940 gene nuoH 129187 130254 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813926.1 protein_id gnl|my_center|LOCUS_19940 130268 130759 gene locus_tag LOCUS_19950 gene nuoI 130268 130759 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813924.1 protein_id gnl|my_center|LOCUS_19950 130790 131422 gene locus_tag LOCUS_19960 130790 131422 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185672.1 protein_id gnl|my_center|LOCUS_19960 131439 131744 gene locus_tag LOCUS_19970 gene nuoK 131439 131744 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185739.1 protein_id gnl|my_center|LOCUS_19970 131752 133737 gene locus_tag LOCUS_19980 gene nuoL 131752 133737 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526462.1 protein_id gnl|my_center|LOCUS_19980 133777 135258 gene locus_tag LOCUS_19990 133777 135258 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813918.1 protein_id gnl|my_center|LOCUS_19990 135266 136750 gene locus_tag LOCUS_20000 gene nuoN 135266 136750 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813916.1 protein_id gnl|my_center|LOCUS_20000 136799 137101 gene locus_tag LOCUS_20010 136799 137101 CDS product DUF2818 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813915.1 protein_id gnl|my_center|LOCUS_20010 137183 137611 gene locus_tag LOCUS_20020 137183 137611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 139317 137665 gene locus_tag LOCUS_20030 139317 137665 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193882.1 protein_id gnl|my_center|LOCUS_20030 139522 140232 gene locus_tag LOCUS_20040 139522 140232 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192091.1 protein_id gnl|my_center|LOCUS_20040 140245 140889 gene locus_tag LOCUS_20050 140245 140889 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813726.1 protein_id gnl|my_center|LOCUS_20050 141001 142647 gene locus_tag LOCUS_20060 141001 142647 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813705.1 protein_id gnl|my_center|LOCUS_20060 142673 143530 gene locus_tag LOCUS_20070 gene kdsA 142673 143530 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193658.1 protein_id gnl|my_center|LOCUS_20070 143578 144861 gene locus_tag LOCUS_20080 gene eno 143578 144861 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813700.1 protein_id gnl|my_center|LOCUS_20080 144989 145237 gene locus_tag LOCUS_20090 144989 145237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 146181 145234 gene locus_tag LOCUS_20100 gene hslO 146181 145234 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930902.1 protein_id gnl|my_center|LOCUS_20100 146709 146185 gene locus_tag LOCUS_20110 146709 146185 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524734.1 protein_id gnl|my_center|LOCUS_20110 146789 147598 gene locus_tag LOCUS_20120 146789 147598 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004566336.1 protein_id gnl|my_center|LOCUS_20120 147614 148513 gene locus_tag LOCUS_20130 147614 148513 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816844.1 protein_id gnl|my_center|LOCUS_20130 148525 149181 gene locus_tag LOCUS_20140 148525 149181 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192132.1 protein_id gnl|my_center|LOCUS_20140 149181 149837 gene locus_tag LOCUS_20150 149181 149837 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447056.1 protein_id gnl|my_center|LOCUS_20150 149844 150881 gene locus_tag LOCUS_20160 gene trpS 149844 150881 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546811.1 protein_id gnl|my_center|LOCUS_20160 151021 151470 gene locus_tag LOCUS_20170 151021 151470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 151471 152349 gene locus_tag LOCUS_20180 gene dapA 151471 152349 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191516.1 protein_id gnl|my_center|LOCUS_20180 152374 153531 gene locus_tag LOCUS_20190 gene bamC 152374 153531 CDS product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809956.1 protein_id gnl|my_center|LOCUS_20190 153621 154355 gene locus_tag LOCUS_20200 153621 154355 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193059.1 protein_id gnl|my_center|LOCUS_20200 154643 154419 gene locus_tag LOCUS_20210 154643 154419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 156033 154882 gene locus_tag LOCUS_20220 156033 154882 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535743.1 protein_id gnl|my_center|LOCUS_20220 156134 156682 gene locus_tag LOCUS_20230 156134 156682 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524740.1 protein_id gnl|my_center|LOCUS_20230 157699 156692 gene locus_tag LOCUS_20240 157699 156692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211410235.1 protein_id gnl|my_center|LOCUS_20240 160260 157696 gene locus_tag LOCUS_20250 gene mutS 160260 157696 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193335.1 protein_id gnl|my_center|LOCUS_20250 161107 160340 gene locus_tag LOCUS_20260 161107 160340 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809990.1 protein_id gnl|my_center|LOCUS_20260 161238 161960 gene locus_tag LOCUS_20270 161238 161960 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039343.1 protein_id gnl|my_center|LOCUS_20270 162031 162798 gene locus_tag LOCUS_20280 gene cysE 162031 162798 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193377.1 protein_id gnl|my_center|LOCUS_20280 163630 162803 gene locus_tag LOCUS_20290 163630 162803 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064171.1 protein_id gnl|my_center|LOCUS_20290 164299 163697 gene locus_tag LOCUS_20300 164299 163697 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019248574.1 protein_id gnl|my_center|LOCUS_20300 165579 164311 gene locus_tag LOCUS_20310 165579 164311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 166707 165607 gene locus_tag LOCUS_20320 166707 165607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 166980 168305 gene locus_tag LOCUS_20330 gene cysS 166980 168305 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192752.1 protein_id gnl|my_center|LOCUS_20330 168290 168943 gene locus_tag LOCUS_20340 168290 168943 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820119.1 protein_id gnl|my_center|LOCUS_20340 168953 169915 gene locus_tag LOCUS_20350 168953 169915 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980898.1 protein_id gnl|my_center|LOCUS_20350 169916 170902 gene locus_tag LOCUS_20360 169916 170902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 170895 171833 gene locus_tag LOCUS_20370 170895 171833 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972748.1 protein_id gnl|my_center|LOCUS_20370 171837 173516 gene locus_tag LOCUS_20380 171837 173516 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198453.1 protein_id gnl|my_center|LOCUS_20380 174013 173519 gene locus_tag LOCUS_20390 174013 173519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 173919 174107 gene locus_tag LOCUS_20400 173919 174107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 174142 175911 gene locus_tag LOCUS_20410 gene fadD6 174142 175911 CDS product long-chain-acyl-CoA synthetase FadD6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074247.1 protein_id gnl|my_center|LOCUS_20410 176775 175903 gene locus_tag LOCUS_20420 176775 175903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 177269 176805 gene locus_tag LOCUS_20430 177269 176805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206964.1 protein_id gnl|my_center|LOCUS_20430 178191 177616 gene locus_tag LOCUS_20440 178191 177616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 180518 178329 gene locus_tag LOCUS_20450 180518 178329 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133957058.1 protein_id gnl|my_center|LOCUS_20450 181603 180623 gene locus_tag LOCUS_20460 181603 180623 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053693.1 protein_id gnl|my_center|LOCUS_20460 181861 183462 gene locus_tag LOCUS_20470 181861 183462 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815895.1 protein_id gnl|my_center|LOCUS_20470 183529 183873 gene locus_tag LOCUS_20480 183529 183873 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929420.1 protein_id gnl|my_center|LOCUS_20480 184175 183921 gene locus_tag LOCUS_20490 184175 183921 CDS product acyl-CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191359.1 protein_id gnl|my_center|LOCUS_20490 184862 184194 gene locus_tag LOCUS_20500 184862 184194 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203514.1 protein_id gnl|my_center|LOCUS_20500 186270 185017 gene locus_tag LOCUS_20510 186270 185017 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706126.1 protein_id gnl|my_center|LOCUS_20510 186788 186342 gene locus_tag LOCUS_20520 186788 186342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 187034 189019 gene locus_tag LOCUS_20530 187034 189019 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029300896.1 protein_id gnl|my_center|LOCUS_20530 190026 189016 gene locus_tag LOCUS_20540 190026 189016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 191687 190032 gene locus_tag LOCUS_20550 191687 190032 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102870.1 protein_id gnl|my_center|LOCUS_20550 192218 191703 gene locus_tag LOCUS_20560 192218 191703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 193684 192230 gene locus_tag LOCUS_20570 193684 192230 CDS product coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198974.1 protein_id gnl|my_center|LOCUS_20570 193807 194520 gene locus_tag LOCUS_20580 193807 194520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 194653 196344 gene locus_tag LOCUS_20590 194653 196344 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037028.1 protein_id gnl|my_center|LOCUS_20590 196461 196865 gene locus_tag LOCUS_20600 gene rpsF 196461 196865 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193673.1 protein_id gnl|my_center|LOCUS_20600 196891 197241 gene locus_tag LOCUS_20610 gene priB 196891 197241 CDS product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192181.1 protein_id gnl|my_center|LOCUS_20610 197267 197536 gene locus_tag LOCUS_20620 gene rpsR 197267 197536 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193360.1 protein_id gnl|my_center|LOCUS_20620 197555 198007 gene locus_tag LOCUS_20630 gene rplI 197555 198007 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191711.1 protein_id gnl|my_center|LOCUS_20630 198171 199526 gene locus_tag LOCUS_20640 198171 199526 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813089.1 protein_id gnl|my_center|LOCUS_20640 201829 200174 gene locus_tag LOCUS_20650 201829 200174 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813082.1 protein_id gnl|my_center|LOCUS_20650 202367 201897 gene locus_tag LOCUS_20660 202367 201897 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521302.1 protein_id gnl|my_center|LOCUS_20660 202820 202449 gene locus_tag LOCUS_20670 202820 202449 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192320.1 protein_id gnl|my_center|LOCUS_20670 203194 202817 gene locus_tag LOCUS_20680 203194 202817 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389515.1 protein_id gnl|my_center|LOCUS_20680 203324 204550 gene locus_tag LOCUS_20690 203324 204550 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527177.1 protein_id gnl|my_center|LOCUS_20690 204498 205871 gene locus_tag LOCUS_20700 204498 205871 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813074.1 protein_id gnl|my_center|LOCUS_20700 205873 207288 gene locus_tag LOCUS_20710 gene thrC 205873 207288 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813072.1 protein_id gnl|my_center|LOCUS_20710 207411 208823 gene locus_tag LOCUS_20720 207411 208823 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074304.1 protein_id gnl|my_center|LOCUS_20720 208910 210970 gene locus_tag LOCUS_20730 208910 210970 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706864.1 protein_id gnl|my_center|LOCUS_20730 210972 211472 gene locus_tag LOCUS_20740 gene mobB 210972 211472 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085099.1 protein_id gnl|my_center|LOCUS_20740 211465 212685 gene locus_tag LOCUS_20750 211465 212685 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267455.1 protein_id gnl|my_center|LOCUS_20750 212682 212939 gene locus_tag LOCUS_20760 gene moaD 212682 212939 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097491.1 protein_id gnl|my_center|LOCUS_20760 212941 213408 gene locus_tag LOCUS_20770 gene moaE 212941 213408 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535771.1 protein_id gnl|my_center|LOCUS_20770 213405 213788 gene locus_tag LOCUS_20780 213405 213788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 214285 213818 gene locus_tag LOCUS_20790 214285 213818 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191860.1 protein_id gnl|my_center|LOCUS_20790 214621 216033 gene locus_tag LOCUS_20800 gene glnA 214621 216033 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039961.1 protein_id gnl|my_center|LOCUS_20800 216268 216750 gene locus_tag LOCUS_20810 216268 216750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 216786 217862 gene locus_tag LOCUS_20820 gene glnL 216786 217862 CDS product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135202727.1 protein_id gnl|my_center|LOCUS_20820 217886 219469 gene locus_tag LOCUS_20830 gene ntrC 217886 219469 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192209.1 protein_id gnl|my_center|LOCUS_20830 221608 219539 gene locus_tag LOCUS_20840 221608 219539 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546024.1 protein_id gnl|my_center|LOCUS_20840 222552 221764 gene locus_tag LOCUS_20850 gene xth 222552 221764 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193531.1 protein_id gnl|my_center|LOCUS_20850 224609 222552 gene locus_tag LOCUS_20860 224609 222552 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550186.1 protein_id gnl|my_center|LOCUS_20860 225496 224648 gene locus_tag LOCUS_20870 gene folD 225496 224648 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811948.1 protein_id gnl|my_center|LOCUS_20870 226226 225579 gene locus_tag LOCUS_20880 226226 225579 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811946.1 protein_id gnl|my_center|LOCUS_20880 228565 226232 gene locus_tag LOCUS_20890 228565 226232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 228797 231502 gene locus_tag LOCUS_20900 gene aceE 228797 231502 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039835.1 protein_id gnl|my_center|LOCUS_20900 231517 232857 gene locus_tag LOCUS_20910 gene aceF 231517 232857 CDS product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063727.1 protein_id gnl|my_center|LOCUS_20910 232873 234657 gene locus_tag LOCUS_20920 gene lpdA 232873 234657 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033459591.1 protein_id gnl|my_center|LOCUS_20920 234798 235451 gene locus_tag LOCUS_20930 gene rpiA 234798 235451 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693699.1 protein_id gnl|my_center|LOCUS_20930 235597 236298 gene locus_tag LOCUS_20940 gene phoU 235597 236298 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853444.1 protein_id gnl|my_center|LOCUS_20940 236677 236369 gene locus_tag LOCUS_20950 236677 236369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 237051 236779 gene locus_tag LOCUS_20960 237051 236779 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193961.1 protein_id gnl|my_center|LOCUS_20960 237674 237093 gene locus_tag LOCUS_20970 237674 237093 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941234.1 protein_id gnl|my_center|LOCUS_20970 238472 237678 gene locus_tag LOCUS_20980 gene thyA 238472 237678 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816232.1 protein_id gnl|my_center|LOCUS_20980 240872 239097 gene locus_tag LOCUS_20990 240872 239097 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173455.1 protein_id gnl|my_center|LOCUS_20990 242001 240892 gene locus_tag LOCUS_21000 242001 240892 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404080.1 protein_id gnl|my_center|LOCUS_21000 244556 241998 gene locus_tag LOCUS_21010 244556 241998 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003915882.1 protein_id gnl|my_center|LOCUS_21010 245246 244560 gene locus_tag LOCUS_21020 245246 244560 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888822.1 protein_id gnl|my_center|LOCUS_21020 246076 245291 gene locus_tag LOCUS_21030 gene fabI 246076 245291 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814739.1 protein_id gnl|my_center|LOCUS_21030 247291 246152 gene locus_tag LOCUS_21040 247291 246152 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387894.1 protein_id gnl|my_center|LOCUS_21040 248227 247298 gene locus_tag LOCUS_21050 248227 247298 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196438.1 protein_id gnl|my_center|LOCUS_21050 248617 248348 gene locus_tag LOCUS_21060 248617 248348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 248746 248822 gene locus_tag LOCUS_t00320 248746 248822 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 248946 250853 gene locus_tag LOCUS_21070 gene thrS 248946 250853 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191232.1 protein_id gnl|my_center|LOCUS_21070 250935 251405 gene locus_tag LOCUS_21080 gene infC 250935 251405 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071810680.1 protein_id gnl|my_center|LOCUS_21080 251575 251772 gene locus_tag LOCUS_21090 gene rpmI 251575 251772 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812834.1 protein_id gnl|my_center|LOCUS_21090 251789 252145 gene locus_tag LOCUS_21100 gene rplT 251789 252145 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192938.1 protein_id gnl|my_center|LOCUS_21100 252320 253327 gene locus_tag LOCUS_21110 gene pheS 252320 253327 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191909.1 protein_id gnl|my_center|LOCUS_21110 253359 255791 gene locus_tag LOCUS_21120 gene pheT 253359 255791 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193113.1 protein_id gnl|my_center|LOCUS_21120 255822 256190 gene locus_tag LOCUS_21130 255822 256190 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197408.1 protein_id gnl|my_center|LOCUS_21130 256228 256611 gene locus_tag LOCUS_21140 256228 256611 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161056164.1 protein_id gnl|my_center|LOCUS_21140 256639 256715 gene locus_tag LOCUS_t00330 256639 256715 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 257024 258370 gene locus_tag LOCUS_21150 257024 258370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 261073 258980 gene locus_tag LOCUS_21160 261073 258980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071040.1 protein_id gnl|my_center|LOCUS_21160 261524 261982 gene locus_tag LOCUS_21170 261524 261982 CDS product DUF2778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054994719.1 protein_id gnl|my_center|LOCUS_21170 262826 262254 gene locus_tag LOCUS_21180 262826 262254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 263535 262855 gene locus_tag LOCUS_21190 263535 262855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 263618 264967 gene locus_tag LOCUS_21200 263618 264967 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035375.1 protein_id gnl|my_center|LOCUS_21200 264976 267297 gene locus_tag LOCUS_21210 gene yihQ 264976 267297 CDS product sulfoquinovosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380825.1 protein_id gnl|my_center|LOCUS_21210 267371 268795 gene locus_tag LOCUS_21220 267371 268795 CDS product DUF4118 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462079.1 protein_id gnl|my_center|LOCUS_21220 268792 269493 gene locus_tag LOCUS_21230 gene kdpE 268792 269493 CDS product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025470747.1 protein_id gnl|my_center|LOCUS_21230 269567 271456 gene locus_tag LOCUS_21240 269567 271456 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038140.1 protein_id gnl|my_center|LOCUS_21240 271510 271719 gene locus_tag LOCUS_21250 271510 271719 CDS product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764045.1 protein_id gnl|my_center|LOCUS_21250 271744 272994 gene locus_tag LOCUS_21260 271744 272994 CDS product TIGR03862 family flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202907611.1 protein_id gnl|my_center|LOCUS_21260 273688 272984 gene locus_tag LOCUS_21270 273688 272984 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404953.1 protein_id gnl|my_center|LOCUS_21270 274447 273716 gene locus_tag LOCUS_21280 274447 273716 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406424.1 protein_id gnl|my_center|LOCUS_21280 274591 275430 gene locus_tag LOCUS_21290 274591 275430 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898616.1 protein_id gnl|my_center|LOCUS_21290 275445 276425 gene locus_tag LOCUS_21300 275445 276425 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479781.1 protein_id gnl|my_center|LOCUS_21300 276828 276430 gene locus_tag LOCUS_21310 gene rnk 276828 276430 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097604.1 protein_id gnl|my_center|LOCUS_21310 277675 277052 gene locus_tag LOCUS_21320 277675 277052 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812191.1 protein_id gnl|my_center|LOCUS_21320 278354 277719 gene locus_tag LOCUS_21330 278354 277719 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090854.1 protein_id gnl|my_center|LOCUS_21330 278459 279310 gene locus_tag LOCUS_21340 278459 279310 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073761.1 protein_id gnl|my_center|LOCUS_21340 279379 280206 gene locus_tag LOCUS_21350 279379 280206 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113889933.1 protein_id gnl|my_center|LOCUS_21350 280987 280214 gene locus_tag LOCUS_21360 280987 280214 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533693.1 protein_id gnl|my_center|LOCUS_21360 282477 281008 gene locus_tag LOCUS_21370 282477 281008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 283156 282497 gene locus_tag LOCUS_21380 283156 282497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 284253 283216 gene locus_tag LOCUS_21390 284253 283216 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070823.1 protein_id gnl|my_center|LOCUS_21390 285578 284259 gene locus_tag LOCUS_21400 285578 284259 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931103.1 protein_id gnl|my_center|LOCUS_21400 285723 286775 gene locus_tag LOCUS_21410 gene cyoA 285723 286775 CDS product ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392423.1 protein_id gnl|my_center|LOCUS_21410 286756 288759 gene locus_tag LOCUS_21420 gene cyoB 286756 288759 CDS product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204250004.1 protein_id gnl|my_center|LOCUS_21420 288752 289399 gene locus_tag LOCUS_21430 gene cyoC 288752 289399 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819722.1 protein_id gnl|my_center|LOCUS_21430 289396 289797 gene locus_tag LOCUS_21440 gene cyoD 289396 289797 CDS product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809276.1 protein_id gnl|my_center|LOCUS_21440 289814 290584 gene locus_tag LOCUS_21450 289814 290584 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531502.1 protein_id gnl|my_center|LOCUS_21450 290627 291964 gene locus_tag LOCUS_21460 290627 291964 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531508.1 protein_id gnl|my_center|LOCUS_21460 291961 292509 gene locus_tag LOCUS_21470 291961 292509 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531509.1 protein_id gnl|my_center|LOCUS_21470 293012 292530 gene locus_tag LOCUS_21480 293012 292530 CDS product DUF1178 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185972.1 protein_id gnl|my_center|LOCUS_21480 293129 293506 gene locus_tag LOCUS_21490 293129 293506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 293626 295002 gene locus_tag LOCUS_21500 gene soxC 293626 295002 CDS product sulfite dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086300.1 protein_id gnl|my_center|LOCUS_21500 295006 296028 gene locus_tag LOCUS_21510 295006 296028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 296058 296531 gene locus_tag LOCUS_21520 gene soxY 296058 296531 CDS product thiosulfate oxidation carrier protein SoxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083833.1 protein_id gnl|my_center|LOCUS_21520 296553 296864 gene locus_tag LOCUS_21530 gene soxZ 296553 296864 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083832.1 protein_id gnl|my_center|LOCUS_21530 296902 297738 gene locus_tag LOCUS_21540 gene soxA 296902 297738 CDS product sulfur oxidation c-type cytochrome SoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228668.1 protein_id gnl|my_center|LOCUS_21540 297756 298397 gene locus_tag LOCUS_21550 gene soxX 297756 298397 CDS product sulfur oxidation c-type cytochrome SoxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228665.1 protein_id gnl|my_center|LOCUS_21550 298467 300194 gene locus_tag LOCUS_21560 gene soxB 298467 300194 CDS product thiosulfohydrolase SoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926971.1 protein_id gnl|my_center|LOCUS_21560 300320 300643 gene locus_tag LOCUS_21570 300320 300643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 301979 300654 gene locus_tag LOCUS_21580 301979 300654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 302311 303339 gene locus_tag LOCUS_21590 302311 303339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207738.1 protein_id gnl|my_center|LOCUS_21590 303420 304460 gene locus_tag LOCUS_21600 303420 304460 CDS product DUF6091 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207691.1 protein_id gnl|my_center|LOCUS_21600 304594 307308 gene locus_tag LOCUS_21610 304594 307308 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207736.1 protein_id gnl|my_center|LOCUS_21610 307439 307365 gene locus_tag LOCUS_t00340 307439 307365 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 307660 308265 gene locus_tag LOCUS_21620 307660 308265 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809919.1 protein_id gnl|my_center|LOCUS_21620 308368 309699 gene locus_tag LOCUS_21630 308368 309699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 309959 310297 gene locus_tag LOCUS_21640 309959 310297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 310735 310304 gene locus_tag LOCUS_21650 310735 310304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 311310 310735 gene locus_tag LOCUS_21660 311310 310735 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809919.1 protein_id gnl|my_center|LOCUS_21660 311599 313560 gene locus_tag LOCUS_21670 gene parE 311599 313560 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185934.1 protein_id gnl|my_center|LOCUS_21670 316725 313573 gene locus_tag LOCUS_21680 316725 313573 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063897.1 protein_id gnl|my_center|LOCUS_21680 317942 316722 gene locus_tag LOCUS_21690 317942 316722 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928130.1 protein_id gnl|my_center|LOCUS_21690 318774 318019 gene locus_tag LOCUS_21700 gene imuA 318774 318019 CDS product translesion DNA synthesis-associated protein ImuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195290.1 protein_id gnl|my_center|LOCUS_21700 319562 318816 gene locus_tag LOCUS_21710 gene lexA 319562 318816 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646078.1 protein_id gnl|my_center|LOCUS_21710 319772 320548 gene locus_tag LOCUS_21720 gene yaaA 319772 320548 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000909771.1 protein_id gnl|my_center|LOCUS_21720 320551 321312 gene locus_tag LOCUS_21730 gene surE 320551 321312 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930526.1 protein_id gnl|my_center|LOCUS_21730 321322 322062 gene locus_tag LOCUS_21740 321322 322062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 322059 322880 gene locus_tag LOCUS_21750 322059 322880 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192107.1 protein_id gnl|my_center|LOCUS_21750 322899 324272 gene locus_tag LOCUS_21760 gene rlmD 322899 324272 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926715.1 protein_id gnl|my_center|LOCUS_21760 325195 324491 gene locus_tag LOCUS_21770 325195 324491 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521332.1 protein_id gnl|my_center|LOCUS_21770 325368 325793 gene locus_tag LOCUS_21780 gene ndk 325368 325793 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193561.1 protein_id gnl|my_center|LOCUS_21780 325860 326999 gene locus_tag LOCUS_21790 gene rlmN 325860 326999 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192451.1 protein_id gnl|my_center|LOCUS_21790 327237 328334 gene locus_tag LOCUS_21800 gene rodZ 327237 328334 CDS product cytoskeleton protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090905.1 protein_id gnl|my_center|LOCUS_21800 328401 329648 gene locus_tag LOCUS_21810 gene ispG 328401 329648 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527159.1 protein_id gnl|my_center|LOCUS_21810 329699 331024 gene locus_tag LOCUS_21820 gene hisS 329699 331024 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063933.1 protein_id gnl|my_center|LOCUS_21820 331021 331665 gene locus_tag LOCUS_21830 331021 331665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 331662 332840 gene locus_tag LOCUS_21840 gene bamB 331662 332840 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810701.1 protein_id gnl|my_center|LOCUS_21840 332849 334174 gene locus_tag LOCUS_21850 gene der 332849 334174 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192452.1 protein_id gnl|my_center|LOCUS_21850 334503 334183 gene locus_tag LOCUS_21860 334503 334183 CDS product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114819.1 protein_id gnl|my_center|LOCUS_21860 334649 335122 gene locus_tag LOCUS_21870 334649 335122 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193328.1 protein_id gnl|my_center|LOCUS_21870 335155 336183 gene locus_tag LOCUS_21880 335155 336183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 336303 337409 gene locus_tag LOCUS_21890 gene aroC 336303 337409 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534774.1 protein_id gnl|my_center|LOCUS_21890 337437 338618 gene locus_tag LOCUS_21900 337437 338618 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207024.1 protein_id gnl|my_center|LOCUS_21900 338709 339542 gene locus_tag LOCUS_21910 338709 339542 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812687.1 protein_id gnl|my_center|LOCUS_21910 339697 341097 gene locus_tag LOCUS_21920 gene leuC 339697 341097 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446523.1 protein_id gnl|my_center|LOCUS_21920 341116 341253 gene locus_tag LOCUS_21930 341116 341253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 341339 341980 gene locus_tag LOCUS_21940 gene leuD 341339 341980 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187882.1 protein_id gnl|my_center|LOCUS_21940 342005 343096 gene locus_tag LOCUS_21950 gene leuB 342005 343096 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187693.1 protein_id gnl|my_center|LOCUS_21950 343144 344268 gene locus_tag LOCUS_21960 gene asd 343144 344268 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188178.1 protein_id gnl|my_center|LOCUS_21960 344333 346519 gene locus_tag LOCUS_21970 344333 346519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 346520 347284 gene locus_tag LOCUS_21980 gene truA 346520 347284 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203245.1 protein_id gnl|my_center|LOCUS_21980 347281 347916 gene locus_tag LOCUS_21990 347281 347916 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064048.1 protein_id gnl|my_center|LOCUS_21990 347940 349193 gene locus_tag LOCUS_22000 gene trpB 347940 349193 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188704.1 protein_id gnl|my_center|LOCUS_22000 349209 350021 gene locus_tag LOCUS_22010 gene trpA 349209 350021 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187543.1 protein_id gnl|my_center|LOCUS_22010 350046 350924 gene locus_tag LOCUS_22020 gene accD 350046 350924 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188147.1 protein_id gnl|my_center|LOCUS_22020 351045 352337 gene locus_tag LOCUS_22030 gene folC 351045 352337 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811819.1 protein_id gnl|my_center|LOCUS_22030 352440 353027 gene locus_tag LOCUS_22040 352440 353027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 353024 353515 gene locus_tag LOCUS_22050 353024 353515 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938481.1 protein_id gnl|my_center|LOCUS_22050 353525 355039 gene locus_tag LOCUS_22060 gene purF 353525 355039 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811814.1 protein_id gnl|my_center|LOCUS_22060 355167 356387 gene locus_tag LOCUS_22070 355167 356387 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191166.1 protein_id gnl|my_center|LOCUS_22070 356499 356589 gene locus_tag LOCUS_t00350 356499 356589 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 357557 356625 gene locus_tag LOCUS_22080 357557 356625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 357750 357917 gene locus_tag LOCUS_22090 357750 357917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 358082 359383 gene locus_tag LOCUS_22100 358082 359383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 360004 359369 gene locus_tag LOCUS_22110 gene rqpR 360004 359369 CDS product response regulator transcription factor RqpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197176.1 protein_id gnl|my_center|LOCUS_22110 360190 360522 gene locus_tag LOCUS_22120 360190 360522 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813572.1 protein_id gnl|my_center|LOCUS_22120 360582 361010 gene locus_tag LOCUS_22130 360582 361010 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256124.1 protein_id gnl|my_center|LOCUS_22130 362166 361024 gene locus_tag LOCUS_22140 gene hmpA 362166 361024 CDS product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113387.1 protein_id gnl|my_center|LOCUS_22140 362388 363956 gene locus_tag LOCUS_22150 gene norR 362388 363956 CDS product nitric oxide reductase transcriptional regulator NorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113388.1 protein_id gnl|my_center|LOCUS_22150 366565 363953 gene locus_tag LOCUS_22160 gene cphA 366565 363953 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930533.1 protein_id gnl|my_center|LOCUS_22160 368793 366601 gene locus_tag LOCUS_22170 gene cphA 368793 366601 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447960.1 protein_id gnl|my_center|LOCUS_22170 368863 371085 gene locus_tag LOCUS_22180 368863 371085 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813559.1 protein_id gnl|my_center|LOCUS_22180 371078 371545 gene locus_tag LOCUS_22190 371078 371545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 372265 371663 gene locus_tag LOCUS_22200 gene flhC 372265 371663 CDS product flagellar transcriptional regulator FlhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198198.1 protein_id gnl|my_center|LOCUS_22200 372600 372283 gene locus_tag LOCUS_22210 gene flhD 372600 372283 CDS product flagellar transcriptional regulator FlhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198199.1 protein_id gnl|my_center|LOCUS_22210 372795 373673 gene locus_tag LOCUS_22220 372795 373673 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091085.1 protein_id gnl|my_center|LOCUS_22220 375084 373657 gene locus_tag LOCUS_22230 375084 373657 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728400.1 protein_id gnl|my_center|LOCUS_22230 375274 375564 gene locus_tag LOCUS_22240 375274 375564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 375691 376164 gene locus_tag LOCUS_22250 375691 376164 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920119.1 protein_id gnl|my_center|LOCUS_22250 376262 376963 gene locus_tag LOCUS_22260 gene pxpB 376262 376963 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097549.1 protein_id gnl|my_center|LOCUS_22260 376956 377930 gene locus_tag LOCUS_22270 376956 377930 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816816.1 protein_id gnl|my_center|LOCUS_22270 377920 378654 gene locus_tag LOCUS_22280 gene pxpA 377920 378654 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687142.1 protein_id gnl|my_center|LOCUS_22280 379098 378655 gene locus_tag LOCUS_22290 379098 378655 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705754.1 protein_id gnl|my_center|LOCUS_22290 379279 381240 gene locus_tag LOCUS_22300 379279 381240 CDS product putative nucleotidyltransferase substrate binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763703.1 protein_id gnl|my_center|LOCUS_22300 381237 381971 gene locus_tag LOCUS_22310 381237 381971 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269182.1 protein_id gnl|my_center|LOCUS_22310 382038 383072 gene locus_tag LOCUS_22320 gene mnmH 382038 383072 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526161.1 protein_id gnl|my_center|LOCUS_22320 383512 383096 gene locus_tag LOCUS_22330 383512 383096 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193685.1 protein_id gnl|my_center|LOCUS_22330 384696 383524 gene locus_tag LOCUS_22340 384696 383524 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114061.1 protein_id gnl|my_center|LOCUS_22340 385227 384733 gene locus_tag LOCUS_22350 385227 384733 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122604.1 protein_id gnl|my_center|LOCUS_22350 387279 385243 gene locus_tag LOCUS_22360 387279 385243 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113937.1 protein_id gnl|my_center|LOCUS_22360 387498 389999 gene locus_tag LOCUS_22370 387498 389999 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039500.1 protein_id gnl|my_center|LOCUS_22370 390040 390564 gene locus_tag LOCUS_22380 390040 390564 CDS product group II truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526443.1 protein_id gnl|my_center|LOCUS_22380 390570 391988 gene locus_tag LOCUS_22390 gene rmuC 390570 391988 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193862.1 protein_id gnl|my_center|LOCUS_22390 391960 393039 gene locus_tag LOCUS_22400 391960 393039 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038644.1 protein_id gnl|my_center|LOCUS_22400 395120 393048 gene locus_tag LOCUS_22410 395120 393048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 396313 395114 gene locus_tag LOCUS_22420 396313 395114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 397811 396453 gene locus_tag LOCUS_22430 397811 396453 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809053.1 protein_id gnl|my_center|LOCUS_22430 399940 397808 gene locus_tag LOCUS_22440 399940 397808 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088216.1 protein_id gnl|my_center|LOCUS_22440 401284 400040 gene locus_tag LOCUS_22450 401284 400040 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039620.1 protein_id gnl|my_center|LOCUS_22450 401893 401300 gene locus_tag LOCUS_22460 gene mobA 401893 401300 CDS product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446521.1 protein_id gnl|my_center|LOCUS_22460 402762 401890 gene locus_tag LOCUS_22470 402762 401890 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074122.1 protein_id gnl|my_center|LOCUS_22470 403901 402783 gene locus_tag LOCUS_22480 gene moaA 403901 402783 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532083.1 protein_id gnl|my_center|LOCUS_22480 404037 404489 gene locus_tag LOCUS_22490 404037 404489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 404494 405156 gene locus_tag LOCUS_22500 404494 405156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 405339 407456 gene locus_tag LOCUS_22510 405339 407456 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172607923.1 protein_id gnl|my_center|LOCUS_22510 407453 408079 gene locus_tag LOCUS_22520 407453 408079 CDS product molecular chaperone TorD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930374.1 protein_id gnl|my_center|LOCUS_22520 408094 408312 gene locus_tag LOCUS_22530 408094 408312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 408328 411267 gene locus_tag LOCUS_22540 408328 411267 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812670.1 protein_id gnl|my_center|LOCUS_22540 411293 411895 gene locus_tag LOCUS_22550 gene fdh3B 411293 411895 CDS product formate dehydrogenase FDH3 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812668.1 protein_id gnl|my_center|LOCUS_22550 411897 412160 gene locus_tag LOCUS_22560 411897 412160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 412173 413249 gene locus_tag LOCUS_22570 412173 413249 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812663.1 protein_id gnl|my_center|LOCUS_22570 416292 413335 gene locus_tag LOCUS_22580 416292 413335 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033459643.1 protein_id gnl|my_center|LOCUS_22580 416714 417721 gene locus_tag LOCUS_22590 gene rluC 416714 417721 CDS product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201356046.1 protein_id gnl|my_center|LOCUS_22590 417718 418377 gene locus_tag LOCUS_22600 417718 418377 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524610.1 protein_id gnl|my_center|LOCUS_22600 418384 418761 gene locus_tag LOCUS_22610 418384 418761 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193415.1 protein_id gnl|my_center|LOCUS_22610 418764 419720 gene locus_tag LOCUS_22620 418764 419720 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191725.1 protein_id gnl|my_center|LOCUS_22620 420417 419722 gene locus_tag LOCUS_22630 420417 419722 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202221.1 protein_id gnl|my_center|LOCUS_22630 421000 420419 gene locus_tag LOCUS_22640 421000 420419 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104746.1 protein_id gnl|my_center|LOCUS_22640 421075 421665 gene locus_tag LOCUS_22650 421075 421665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 421690 421872 gene locus_tag LOCUS_22660 gene rpmF 421690 421872 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214744.1 protein_id gnl|my_center|LOCUS_22660 421938 423020 gene locus_tag LOCUS_22670 gene plsX 421938 423020 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192749.1 protein_id gnl|my_center|LOCUS_22670 423020 423997 gene locus_tag LOCUS_22680 423020 423997 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447294.1 protein_id gnl|my_center|LOCUS_22680 424089 424979 gene locus_tag LOCUS_22690 gene fabD 424089 424979 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813821.1 protein_id gnl|my_center|LOCUS_22690 424994 425746 gene locus_tag LOCUS_22700 gene fabG 424994 425746 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197597.1 protein_id gnl|my_center|LOCUS_22700 425829 426068 gene locus_tag LOCUS_22710 gene acpP 425829 426068 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813816.1 protein_id gnl|my_center|LOCUS_22710 426154 427392 gene locus_tag LOCUS_22720 gene fabF 426154 427392 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193086.1 protein_id gnl|my_center|LOCUS_22720 427789 428391 gene locus_tag LOCUS_22730 gene rpoE 427789 428391 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 protein_id gnl|my_center|LOCUS_22730 428396 429058 gene locus_tag LOCUS_22740 428396 429058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 429073 430053 gene locus_tag LOCUS_22750 429073 430053 CDS product MucB/RseB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764762.1 protein_id gnl|my_center|LOCUS_22750 430069 431544 gene locus_tag LOCUS_22760 430069 431544 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192020.1 protein_id gnl|my_center|LOCUS_22760 431660 433462 gene locus_tag LOCUS_22770 gene lepA 431660 433462 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193305.1 protein_id gnl|my_center|LOCUS_22770 433465 434325 gene locus_tag LOCUS_22780 gene lepB 433465 434325 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193513.1 protein_id gnl|my_center|LOCUS_22780 434345 435061 gene locus_tag LOCUS_22790 gene rnc 434345 435061 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853248.1 protein_id gnl|my_center|LOCUS_22790 435063 435959 gene locus_tag LOCUS_22800 gene era 435063 435959 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191678.1 protein_id gnl|my_center|LOCUS_22800 435952 436686 gene locus_tag LOCUS_22810 435952 436686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 436683 437423 gene locus_tag LOCUS_22820 gene pdxJ 436683 437423 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810344.1 protein_id gnl|my_center|LOCUS_22820 437448 437852 gene locus_tag LOCUS_22830 gene acpS 437448 437852 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191194.1 protein_id gnl|my_center|LOCUS_22830 437877 438899 gene locus_tag LOCUS_22840 gene nagZ 437877 438899 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040152.1 protein_id gnl|my_center|LOCUS_22840 439760 438978 gene locus_tag LOCUS_22850 439760 438978 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191958.1 protein_id gnl|my_center|LOCUS_22850 440099 439833 gene locus_tag LOCUS_22860 440099 439833 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040245.1 protein_id gnl|my_center|LOCUS_22860 440737 440102 gene locus_tag LOCUS_22870 440737 440102 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192037.1 protein_id gnl|my_center|LOCUS_22870 441169 440756 gene locus_tag LOCUS_22880 gene msrB 441169 440756 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813871.1 protein_id gnl|my_center|LOCUS_22880 442713 441187 gene locus_tag LOCUS_22890 442713 441187 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812698.1 protein_id gnl|my_center|LOCUS_22890 442809 444446 gene locus_tag LOCUS_22900 442809 444446 CDS product 3-(methylthio)propionyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539668.1 protein_id gnl|my_center|LOCUS_22900 444476 444778 gene locus_tag LOCUS_22910 444476 444778 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192097.1 protein_id gnl|my_center|LOCUS_22910 445599 444790 gene locus_tag LOCUS_22920 445599 444790 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070532.1 protein_id gnl|my_center|LOCUS_22920 445916 445599 gene locus_tag LOCUS_22930 445916 445599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 446812 445913 gene locus_tag LOCUS_22940 446812 445913 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039870.1 protein_id gnl|my_center|LOCUS_22940 447024 447998 gene locus_tag LOCUS_22950 gene mltG 447024 447998 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930596.1 protein_id gnl|my_center|LOCUS_22950 448006 448656 gene locus_tag LOCUS_22960 gene tmk 448006 448656 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811733.1 protein_id gnl|my_center|LOCUS_22960 448653 449648 gene locus_tag LOCUS_22970 gene holB 448653 449648 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930597.1 protein_id gnl|my_center|LOCUS_22970 449685 450068 gene locus_tag LOCUS_22980 449685 450068 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036225.1 protein_id gnl|my_center|LOCUS_22980 450068 450853 gene locus_tag LOCUS_22990 450068 450853 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192025.1 protein_id gnl|my_center|LOCUS_22990 450850 451524 gene locus_tag LOCUS_23000 450850 451524 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191824.1 protein_id gnl|my_center|LOCUS_23000 452838 451555 gene locus_tag LOCUS_23010 452838 451555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 >Feature sequence09 179 910 gene locus_tag LOCUS_23020 179 910 CDS product 16S rRNA pseudouridine(516) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185598.1 protein_id gnl|my_center|LOCUS_23020 1035 1595 gene locus_tag LOCUS_23030 gene efp 1035 1595 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810194.1 protein_id gnl|my_center|LOCUS_23030 1665 2735 gene locus_tag LOCUS_23040 gene earP 1665 2735 CDS product elongation factor P maturation arginine rhamnosyltransferase EarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533947.1 protein_id gnl|my_center|LOCUS_23040 2808 3467 gene locus_tag LOCUS_23050 2808 3467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 4378 3482 gene locus_tag LOCUS_23060 gene xerC 4378 3482 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114345.1 protein_id gnl|my_center|LOCUS_23060 4989 4339 gene locus_tag LOCUS_23070 4989 4339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 5861 4986 gene locus_tag LOCUS_23080 gene dapF 5861 4986 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207416.1 protein_id gnl|my_center|LOCUS_23080 6777 5902 gene locus_tag LOCUS_23090 6777 5902 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038711.1 protein_id gnl|my_center|LOCUS_23090 7640 6774 gene locus_tag LOCUS_23100 7640 6774 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807187.1 protein_id gnl|my_center|LOCUS_23100 7819 8985 gene locus_tag LOCUS_23110 gene metK 7819 8985 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199069.1 protein_id gnl|my_center|LOCUS_23110 9174 10601 gene locus_tag LOCUS_23120 gene ahcY 9174 10601 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942520.1 protein_id gnl|my_center|LOCUS_23120 10620 11420 gene locus_tag LOCUS_23130 10620 11420 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919201.1 protein_id gnl|my_center|LOCUS_23130 11401 12261 gene locus_tag LOCUS_23140 gene metF 11401 12261 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198631.1 protein_id gnl|my_center|LOCUS_23140 12698 12255 gene locus_tag LOCUS_23150 12698 12255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23150 12838 14817 gene locus_tag LOCUS_23160 12838 14817 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525894.1 protein_id gnl|my_center|LOCUS_23160 14837 15811 gene locus_tag LOCUS_23170 14837 15811 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927008.1 protein_id gnl|my_center|LOCUS_23170 15935 17116 gene locus_tag LOCUS_23180 15935 17116 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039570.1 protein_id gnl|my_center|LOCUS_23180 17154 18065 gene locus_tag LOCUS_23190 gene argF 17154 18065 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190177.1 protein_id gnl|my_center|LOCUS_23190 18101 19330 gene locus_tag LOCUS_23200 18101 19330 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092065.1 protein_id gnl|my_center|LOCUS_23200 20411 19386 gene locus_tag LOCUS_23210 gene murB 20411 19386 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692788.1 protein_id gnl|my_center|LOCUS_23210 20463 20948 gene locus_tag LOCUS_23220 20463 20948 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189237.1 protein_id gnl|my_center|LOCUS_23220 20969 21565 gene locus_tag LOCUS_23230 20969 21565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 21588 24302 gene locus_tag LOCUS_23240 gene pepN 21588 24302 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522336.1 protein_id gnl|my_center|LOCUS_23240 24326 25300 gene locus_tag LOCUS_23250 24326 25300 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095990.1 protein_id gnl|my_center|LOCUS_23250 26924 25332 gene locus_tag LOCUS_23260 26924 25332 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814201.1 protein_id gnl|my_center|LOCUS_23260 27084 27554 gene locus_tag LOCUS_23270 gene moaC 27084 27554 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535462.1 protein_id gnl|my_center|LOCUS_23270 28076 27558 gene locus_tag LOCUS_23280 28076 27558 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038213.1 protein_id gnl|my_center|LOCUS_23280 29123 28236 gene locus_tag LOCUS_23290 gene sucD 29123 28236 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550822.1 protein_id gnl|my_center|LOCUS_23290 30343 29177 gene locus_tag LOCUS_23300 gene sucC 30343 29177 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189251.1 protein_id gnl|my_center|LOCUS_23300 31112 30612 gene locus_tag LOCUS_23310 31112 30612 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957973.1 protein_id gnl|my_center|LOCUS_23310 32229 31150 gene locus_tag LOCUS_23320 gene recA 32229 31150 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812760.1 protein_id gnl|my_center|LOCUS_23320 32789 32292 gene locus_tag LOCUS_23330 gene pncC 32789 32292 CDS product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098439.1 protein_id gnl|my_center|LOCUS_23330 33288 32821 gene locus_tag LOCUS_23340 33288 32821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 34400 33324 gene locus_tag LOCUS_23350 gene thiL 34400 33324 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707094.1 protein_id gnl|my_center|LOCUS_23350 34904 34416 gene locus_tag LOCUS_23360 gene nusB 34904 34416 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808599.1 protein_id gnl|my_center|LOCUS_23360 35403 34897 gene locus_tag LOCUS_23370 gene ribH 35403 34897 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186056.1 protein_id gnl|my_center|LOCUS_23370 36524 35400 gene locus_tag LOCUS_23380 gene ribBA 36524 35400 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808597.1 protein_id gnl|my_center|LOCUS_23380 38088 36550 gene locus_tag LOCUS_23390 gene lnt 38088 36550 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040320.1 protein_id gnl|my_center|LOCUS_23390 38996 38088 gene locus_tag LOCUS_23400 38996 38088 CDS product transporter associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189366.1 protein_id gnl|my_center|LOCUS_23400 40426 39059 gene locus_tag LOCUS_23410 gene miaB 40426 39059 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064327.1 protein_id gnl|my_center|LOCUS_23410 40564 41250 gene locus_tag LOCUS_23420 gene coq7 40564 41250 CDS product 2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194286.1 protein_id gnl|my_center|LOCUS_23420 41669 41247 gene locus_tag LOCUS_23430 41669 41247 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549988.1 protein_id gnl|my_center|LOCUS_23430 42205 42633 gene locus_tag LOCUS_23440 gene rplM 42205 42633 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522094.1 protein_id gnl|my_center|LOCUS_23440 42642 43034 gene locus_tag LOCUS_23450 gene rpsI 42642 43034 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814889.1 protein_id gnl|my_center|LOCUS_23450 43145 44188 gene locus_tag LOCUS_23460 gene argC 43145 44188 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820599.1 protein_id gnl|my_center|LOCUS_23460 44207 44923 gene locus_tag LOCUS_23470 44207 44923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 44939 45340 gene locus_tag LOCUS_23480 44939 45340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 45364 45714 gene locus_tag LOCUS_23490 gene erpA 45364 45714 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194247.1 protein_id gnl|my_center|LOCUS_23490 45797 46696 gene locus_tag LOCUS_23500 45797 46696 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065020.1 protein_id gnl|my_center|LOCUS_23500 48262 47306 gene locus_tag LOCUS_23510 gene miaA 48262 47306 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194103.1 protein_id gnl|my_center|LOCUS_23510 50122 48272 gene locus_tag LOCUS_23520 gene mutL 50122 48272 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039151.1 protein_id gnl|my_center|LOCUS_23520 51457 50153 gene locus_tag LOCUS_23530 51457 50153 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247543.1 protein_id gnl|my_center|LOCUS_23530 51988 51503 gene locus_tag LOCUS_23540 gene tsaE 51988 51503 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070930.1 protein_id gnl|my_center|LOCUS_23540 51987 53072 gene locus_tag LOCUS_23550 gene queG 51987 53072 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110324.1 protein_id gnl|my_center|LOCUS_23550 54103 53069 gene locus_tag LOCUS_23560 gene purM 54103 53069 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194386.1 protein_id gnl|my_center|LOCUS_23560 54140 54955 gene locus_tag LOCUS_23570 gene hda 54140 54955 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196484.1 protein_id gnl|my_center|LOCUS_23570 54936 55601 gene locus_tag LOCUS_23580 54936 55601 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269258.1 protein_id gnl|my_center|LOCUS_23580 55598 57055 gene locus_tag LOCUS_23590 gene pcnB 55598 57055 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522151.1 protein_id gnl|my_center|LOCUS_23590 57052 57555 gene locus_tag LOCUS_23600 57052 57555 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814348.1 protein_id gnl|my_center|LOCUS_23600 57631 58272 gene locus_tag LOCUS_23610 57631 58272 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532195.1 protein_id gnl|my_center|LOCUS_23610 58301 59131 gene locus_tag LOCUS_23620 gene panB 58301 59131 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687894.1 protein_id gnl|my_center|LOCUS_23620 59139 59990 gene locus_tag LOCUS_23630 gene panC 59139 59990 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192993.1 protein_id gnl|my_center|LOCUS_23630 59990 60370 gene locus_tag LOCUS_23640 59990 60370 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191357.1 protein_id gnl|my_center|LOCUS_23640 61403 60393 gene locus_tag LOCUS_23650 61403 60393 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809529.1 protein_id gnl|my_center|LOCUS_23650 62586 61411 gene locus_tag LOCUS_23660 62586 61411 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522681.1 protein_id gnl|my_center|LOCUS_23660 63125 62604 gene locus_tag LOCUS_23670 gene purE 63125 62604 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247930.1 protein_id gnl|my_center|LOCUS_23670 64026 63130 gene locus_tag LOCUS_23680 64026 63130 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189256.1 protein_id gnl|my_center|LOCUS_23680 65177 64113 gene locus_tag LOCUS_23690 gene fba 65177 64113 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064288.1 protein_id gnl|my_center|LOCUS_23690 66691 65213 gene locus_tag LOCUS_23700 gene pyk 66691 65213 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188973.1 protein_id gnl|my_center|LOCUS_23700 67872 66691 gene locus_tag LOCUS_23710 67872 66691 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189839.1 protein_id gnl|my_center|LOCUS_23710 67980 68516 gene locus_tag LOCUS_23720 67980 68516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 70464 68470 gene locus_tag LOCUS_23730 70464 68470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 71735 70725 gene locus_tag LOCUS_23740 gene gap 71735 70725 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809444.1 protein_id gnl|my_center|LOCUS_23740 73761 71761 gene locus_tag LOCUS_23750 gene tkt 73761 71761 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522066.1 protein_id gnl|my_center|LOCUS_23750 73899 74675 gene locus_tag LOCUS_23760 73899 74675 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809442.1 protein_id gnl|my_center|LOCUS_23760 74694 76172 gene locus_tag LOCUS_23770 74694 76172 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810134.1 protein_id gnl|my_center|LOCUS_23770 76251 77177 gene locus_tag LOCUS_23780 gene glyQ 76251 77177 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189444.1 protein_id gnl|my_center|LOCUS_23780 77183 79267 gene locus_tag LOCUS_23790 gene glyS 77183 79267 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189008.1 protein_id gnl|my_center|LOCUS_23790 79283 79846 gene locus_tag LOCUS_23800 gene gmhB 79283 79846 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814404.1 protein_id gnl|my_center|LOCUS_23800 79871 80638 gene locus_tag LOCUS_23810 79871 80638 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190040.1 protein_id gnl|my_center|LOCUS_23810 80645 81400 gene locus_tag LOCUS_23820 80645 81400 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189715.1 protein_id gnl|my_center|LOCUS_23820 81397 81789 gene locus_tag LOCUS_23830 gene gloA 81397 81789 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705221.1 protein_id gnl|my_center|LOCUS_23830 82010 83011 gene locus_tag LOCUS_23840 gene dusB 82010 83011 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023995141.1 protein_id gnl|my_center|LOCUS_23840 83008 83262 gene locus_tag LOCUS_23850 83008 83262 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194052.1 protein_id gnl|my_center|LOCUS_23850 83306 84898 gene locus_tag LOCUS_23860 gene purH 83306 84898 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527723.1 protein_id gnl|my_center|LOCUS_23860 84926 85474 gene locus_tag LOCUS_23870 gene ruvC 84926 85474 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196340.1 protein_id gnl|my_center|LOCUS_23870 85537 86127 gene locus_tag LOCUS_23880 gene ruvA 85537 86127 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814226.1 protein_id gnl|my_center|LOCUS_23880 86144 87199 gene locus_tag LOCUS_23890 gene ruvB 86144 87199 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194268.1 protein_id gnl|my_center|LOCUS_23890 89174 87606 gene locus_tag LOCUS_23900 89174 87606 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418921.1 protein_id gnl|my_center|LOCUS_23900 89296 89700 gene locus_tag LOCUS_23910 gene ybgC 89296 89700 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091290.1 protein_id gnl|my_center|LOCUS_23910 89744 90421 gene locus_tag LOCUS_23920 gene tolQ 89744 90421 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186467.1 protein_id gnl|my_center|LOCUS_23920 90471 90899 gene locus_tag LOCUS_23930 gene tolR 90471 90899 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194863.1 protein_id gnl|my_center|LOCUS_23930 90896 91813 gene locus_tag LOCUS_23940 90896 91813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 91828 93165 gene locus_tag LOCUS_23950 gene tolB 91828 93165 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931417.1 protein_id gnl|my_center|LOCUS_23950 93235 93747 gene locus_tag LOCUS_23960 gene pal 93235 93747 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814650.1 protein_id gnl|my_center|LOCUS_23960 93766 94512 gene locus_tag LOCUS_23970 gene ybgF 93766 94512 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814652.1 protein_id gnl|my_center|LOCUS_23970 94598 95713 gene locus_tag LOCUS_23980 94598 95713 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086289.1 protein_id gnl|my_center|LOCUS_23980 95781 95857 gene locus_tag LOCUS_t00360 95781 95857 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 96165 98453 gene locus_tag LOCUS_23990 96165 98453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 98440 99411 gene locus_tag LOCUS_24000 98440 99411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 100976 99408 gene locus_tag LOCUS_24010 100976 99408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 102403 100991 gene locus_tag LOCUS_24020 102403 100991 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267578.1 protein_id gnl|my_center|LOCUS_24020 103101 102400 gene locus_tag LOCUS_24030 gene fabR 103101 102400 CDS product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163800.1 protein_id gnl|my_center|LOCUS_24030 103420 104037 gene locus_tag LOCUS_24040 103420 104037 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328106.1 protein_id gnl|my_center|LOCUS_24040 104507 105940 gene locus_tag LOCUS_24050 104507 105940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 107071 105953 gene locus_tag LOCUS_24060 107071 105953 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931222.1 protein_id gnl|my_center|LOCUS_24060 108484 107075 gene locus_tag LOCUS_24070 108484 107075 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931221.1 protein_id gnl|my_center|LOCUS_24070 108592 109863 gene locus_tag LOCUS_24080 gene tyrS 108592 109863 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814877.1 protein_id gnl|my_center|LOCUS_24080 109860 110588 gene locus_tag LOCUS_24090 109860 110588 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533589.1 protein_id gnl|my_center|LOCUS_24090 110642 111886 gene locus_tag LOCUS_24100 110642 111886 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186490.1 protein_id gnl|my_center|LOCUS_24100 111905 112417 gene locus_tag LOCUS_24110 gene nrdR 111905 112417 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814871.1 protein_id gnl|my_center|LOCUS_24110 112443 113576 gene locus_tag LOCUS_24120 gene ribD 112443 113576 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527563.1 protein_id gnl|my_center|LOCUS_24120 113585 114214 gene locus_tag LOCUS_24130 113585 114214 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185756.1 protein_id gnl|my_center|LOCUS_24130 114957 114205 gene locus_tag LOCUS_24140 114957 114205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 116335 114983 gene locus_tag LOCUS_24150 116335 114983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 117846 116350 gene locus_tag LOCUS_24160 gene mgtE 117846 116350 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412626.1 protein_id gnl|my_center|LOCUS_24160 119127 117868 gene locus_tag LOCUS_24170 119127 117868 CDS product putative Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929970.1 protein_id gnl|my_center|LOCUS_24170 120912 119158 gene locus_tag LOCUS_24180 gene pabB 120912 119158 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722110.1 protein_id gnl|my_center|LOCUS_24180 122212 121010 gene locus_tag LOCUS_24190 122212 121010 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536367.1 protein_id gnl|my_center|LOCUS_24190 124613 122298 gene locus_tag LOCUS_24200 124613 122298 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938729.1 protein_id gnl|my_center|LOCUS_24200 124709 125908 gene locus_tag LOCUS_24210 124709 125908 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194932.1 protein_id gnl|my_center|LOCUS_24210 126762 125905 gene locus_tag LOCUS_24220 126762 125905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 127180 128763 gene locus_tag LOCUS_24230 127180 128763 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536419.1 protein_id gnl|my_center|LOCUS_24230 129151 128741 gene locus_tag LOCUS_24240 129151 128741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 129552 129148 gene locus_tag LOCUS_24250 129552 129148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 129861 129562 gene locus_tag LOCUS_24260 129861 129562 CDS product YqjD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200395.1 protein_id gnl|my_center|LOCUS_24260 131415 129964 gene locus_tag LOCUS_24270 gene dacB 131415 129964 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091272.1 protein_id gnl|my_center|LOCUS_24270 132081 131491 gene locus_tag LOCUS_24280 132081 131491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 132443 134278 gene locus_tag LOCUS_24290 132443 134278 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207765.1 protein_id gnl|my_center|LOCUS_24290 134476 135792 gene locus_tag LOCUS_24300 134476 135792 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037785.1 protein_id gnl|my_center|LOCUS_24300 135804 136355 gene locus_tag LOCUS_24310 135804 136355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 137002 136334 gene locus_tag LOCUS_24320 gene fixJ 137002 136334 CDS product oxygen response regulator transcription factor FixJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193928.1 protein_id gnl|my_center|LOCUS_24320 138980 136989 gene locus_tag LOCUS_24330 138980 136989 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338586.1 protein_id gnl|my_center|LOCUS_24330 139094 140107 gene locus_tag LOCUS_24340 139094 140107 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391425.1 protein_id gnl|my_center|LOCUS_24340 140905 140123 gene locus_tag LOCUS_24350 140905 140123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 141185 141475 gene locus_tag LOCUS_24360 gene groES 141185 141475 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186661.1 protein_id gnl|my_center|LOCUS_24360 141505 143151 gene locus_tag LOCUS_24370 gene groL 141505 143151 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538665.1 protein_id gnl|my_center|LOCUS_24370 143355 143606 gene locus_tag LOCUS_24380 143355 143606 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193070.1 protein_id gnl|my_center|LOCUS_24380 143683 145485 gene locus_tag LOCUS_24390 143683 145485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063980.1 protein_id gnl|my_center|LOCUS_24390 145495 146913 gene locus_tag LOCUS_24400 145495 146913 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930260.1 protein_id gnl|my_center|LOCUS_24400 147487 146855 gene locus_tag LOCUS_24410 gene orn 147487 146855 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535917.1 protein_id gnl|my_center|LOCUS_24410 147578 148834 gene locus_tag LOCUS_24420 147578 148834 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813306.1 protein_id gnl|my_center|LOCUS_24420 148831 149211 gene locus_tag LOCUS_24430 148831 149211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 149204 150196 gene locus_tag LOCUS_24440 gene rsgA 149204 150196 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550124.1 protein_id gnl|my_center|LOCUS_24440 151196 150201 gene locus_tag LOCUS_24450 151196 150201 CDS product CobD/CbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195964.1 protein_id gnl|my_center|LOCUS_24450 151812 151201 gene locus_tag LOCUS_24460 151812 151201 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550123.1 protein_id gnl|my_center|LOCUS_24460 153021 151831 gene locus_tag LOCUS_24470 153021 151831 CDS product UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527722.1 protein_id gnl|my_center|LOCUS_24470 154417 153029 gene locus_tag LOCUS_24480 154417 153029 CDS product aminopeptidase P N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549996.1 protein_id gnl|my_center|LOCUS_24480 155105 154419 gene locus_tag LOCUS_24490 155105 154419 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039134.1 protein_id gnl|my_center|LOCUS_24490 156146 155115 gene locus_tag LOCUS_24500 156146 155115 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931410.1 protein_id gnl|my_center|LOCUS_24500 156245 158542 gene locus_tag LOCUS_24510 156245 158542 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814429.1 protein_id gnl|my_center|LOCUS_24510 158569 159945 gene locus_tag LOCUS_24520 158569 159945 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550859.1 protein_id gnl|my_center|LOCUS_24520 159956 160978 gene locus_tag LOCUS_24530 gene pdxA 159956 160978 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188905.1 protein_id gnl|my_center|LOCUS_24530 160975 161766 gene locus_tag LOCUS_24540 gene rsmA 160975 161766 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931413.1 protein_id gnl|my_center|LOCUS_24540 162611 161763 gene locus_tag LOCUS_24550 gene murI 162611 161763 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404950.1 protein_id gnl|my_center|LOCUS_24550 162724 163461 gene locus_tag LOCUS_24560 162724 163461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 163749 163450 gene locus_tag LOCUS_24570 163749 163450 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704159.1 protein_id gnl|my_center|LOCUS_24570 163828 164346 gene locus_tag LOCUS_24580 163828 164346 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188247.1 protein_id gnl|my_center|LOCUS_24580 164698 164360 gene locus_tag LOCUS_24590 164698 164360 CDS product TIGR01244 family sulfur transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383176.1 protein_id gnl|my_center|LOCUS_24590 165722 164724 gene locus_tag LOCUS_24600 165722 164724 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966235.1 protein_id gnl|my_center|LOCUS_24600 167126 165738 gene locus_tag LOCUS_24610 167126 165738 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887578.1 protein_id gnl|my_center|LOCUS_24610 167227 168462 gene locus_tag LOCUS_24620 167227 168462 CDS product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538642.1 protein_id gnl|my_center|LOCUS_24620 168611 169480 gene locus_tag LOCUS_24630 168611 169480 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929728.1 protein_id gnl|my_center|LOCUS_24630 169572 169868 gene locus_tag LOCUS_24640 169572 169868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 169954 170787 gene locus_tag LOCUS_24650 169954 170787 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105826.1 protein_id gnl|my_center|LOCUS_24650 172067 171114 gene locus_tag LOCUS_24660 172067 171114 CDS product CysB family HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193435.1 protein_id gnl|my_center|LOCUS_24660 172180 172977 gene locus_tag LOCUS_24670 172180 172977 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194827.1 protein_id gnl|my_center|LOCUS_24670 172978 174657 gene locus_tag LOCUS_24680 172978 174657 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098180.1 protein_id gnl|my_center|LOCUS_24680 174659 175198 gene locus_tag LOCUS_24690 174659 175198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 175201 176007 gene locus_tag LOCUS_24700 175201 176007 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192841.1 protein_id gnl|my_center|LOCUS_24700 176048 176971 gene locus_tag LOCUS_24710 gene cysD 176048 176971 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813323.1 protein_id gnl|my_center|LOCUS_24710 176987 178336 gene locus_tag LOCUS_24720 176987 178336 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928137.1 protein_id gnl|my_center|LOCUS_24720 178392 179168 gene locus_tag LOCUS_24730 gene cobA 178392 179168 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192678.1 protein_id gnl|my_center|LOCUS_24730 179248 182889 gene locus_tag LOCUS_24740 179248 182889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 183161 182901 gene locus_tag LOCUS_24750 183161 182901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086960.1 protein_id gnl|my_center|LOCUS_24750 183565 183188 gene locus_tag LOCUS_24760 183565 183188 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193817.1 protein_id gnl|my_center|LOCUS_24760 184767 183562 gene locus_tag LOCUS_24770 gene lptG 184767 183562 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552347.1 protein_id gnl|my_center|LOCUS_24770 185903 184764 gene locus_tag LOCUS_24780 gene lptF 185903 184764 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192178.1 protein_id gnl|my_center|LOCUS_24780 186014 187615 gene locus_tag LOCUS_24790 186014 187615 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191270.1 protein_id gnl|my_center|LOCUS_24790 187602 188048 gene locus_tag LOCUS_24800 187602 188048 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193228.1 protein_id gnl|my_center|LOCUS_24800 188061 188288 gene locus_tag LOCUS_24810 188061 188288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 189914 188289 gene locus_tag LOCUS_24820 189914 188289 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267488.1 protein_id gnl|my_center|LOCUS_24820 190176 193025 gene locus_tag LOCUS_24830 190176 193025 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521705.1 protein_id gnl|my_center|LOCUS_24830 194040 193075 gene locus_tag LOCUS_24840 194040 193075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 194537 194058 gene locus_tag LOCUS_24850 194537 194058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 195177 194611 gene locus_tag LOCUS_24860 195177 194611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 195507 195280 gene locus_tag LOCUS_24870 195507 195280 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193727.1 protein_id gnl|my_center|LOCUS_24870 196047 195535 gene locus_tag LOCUS_24880 196047 195535 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193543.1 protein_id gnl|my_center|LOCUS_24880 198684 196048 gene locus_tag LOCUS_24890 gene alaS 198684 196048 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204967.1 protein_id gnl|my_center|LOCUS_24890 199452 198739 gene locus_tag LOCUS_24900 gene ugpQ 199452 198739 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073586.1 protein_id gnl|my_center|LOCUS_24900 199610 200797 gene locus_tag LOCUS_24910 199610 200797 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268489.1 protein_id gnl|my_center|LOCUS_24910 200798 202075 gene locus_tag LOCUS_24920 200798 202075 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805145.1 protein_id gnl|my_center|LOCUS_24920 202072 203340 gene locus_tag LOCUS_24930 gene doeA 202072 203340 CDS product ectoine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805146.1 protein_id gnl|my_center|LOCUS_24930 203337 204710 gene locus_tag LOCUS_24940 203337 204710 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805147.1 protein_id gnl|my_center|LOCUS_24940 204735 205052 gene locus_tag LOCUS_24950 204735 205052 CDS product EthD family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029217002.1 protein_id gnl|my_center|LOCUS_24950 205504 205049 gene locus_tag LOCUS_24960 205504 205049 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417894.1 protein_id gnl|my_center|LOCUS_24960 205638 206501 gene locus_tag LOCUS_24970 205638 206501 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028000663.1 protein_id gnl|my_center|LOCUS_24970 206517 207458 gene locus_tag LOCUS_24980 206517 207458 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813145.1 protein_id gnl|my_center|LOCUS_24980 207455 208441 gene locus_tag LOCUS_24990 207455 208441 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186471.1 protein_id gnl|my_center|LOCUS_24990 210041 208965 gene locus_tag LOCUS_25000 210041 208965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 210194 212389 gene locus_tag LOCUS_25010 210194 212389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 212386 212772 gene locus_tag LOCUS_25020 212386 212772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 212769 213506 gene locus_tag LOCUS_25030 212769 213506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 213604 215559 gene locus_tag LOCUS_25040 213604 215559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 215931 215563 gene locus_tag LOCUS_25050 215931 215563 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807198.1 protein_id gnl|my_center|LOCUS_25050 216047 216865 gene locus_tag LOCUS_25060 216047 216865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 219150 216877 gene locus_tag LOCUS_25070 219150 216877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 220122 219163 gene locus_tag LOCUS_25080 220122 219163 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393479.1 protein_id gnl|my_center|LOCUS_25080 220820 220305 gene locus_tag LOCUS_25090 220820 220305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 222021 220930 gene locus_tag LOCUS_25100 222021 220930 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118415.1 protein_id gnl|my_center|LOCUS_25100 223227 222052 gene locus_tag LOCUS_25110 223227 222052 CDS product ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204243849.1 protein_id gnl|my_center|LOCUS_25110 223661 223365 gene locus_tag LOCUS_25120 223661 223365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 224009 227323 gene locus_tag LOCUS_25130 224009 227323 CDS product TM0106 family RecB-like putative nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930312.1 protein_id gnl|my_center|LOCUS_25130 227591 229075 gene locus_tag LOCUS_25140 227591 229075 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383503.1 protein_id gnl|my_center|LOCUS_25140 229092 231782 gene locus_tag LOCUS_25150 229092 231782 CDS product Z1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383504.1 protein_id gnl|my_center|LOCUS_25150 232408 232716 gene locus_tag LOCUS_25160 232408 232716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 232720 234777 gene locus_tag LOCUS_25170 232720 234777 CDS product AIPR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008002.1 protein_id gnl|my_center|LOCUS_25170 236510 234957 gene locus_tag LOCUS_25180 236510 234957 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193365322.1 protein_id gnl|my_center|LOCUS_25180 237994 237050 gene locus_tag LOCUS_25190 237994 237050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 238535 238119 gene locus_tag LOCUS_25200 238535 238119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 240298 238652 gene locus_tag LOCUS_25210 240298 238652 CDS product ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551607.1 protein_id gnl|my_center|LOCUS_25210 241291 240326 gene locus_tag LOCUS_25220 241291 240326 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150678942.1 protein_id gnl|my_center|LOCUS_25220 241643 242047 gene locus_tag LOCUS_25230 241643 242047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 242170 242095 gene locus_tag LOCUS_t00370 242170 242095 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 244820 242190 gene locus_tag LOCUS_25240 244820 242190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 246787 244907 gene locus_tag LOCUS_25250 246787 244907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 247341 246895 gene locus_tag LOCUS_25260 247341 246895 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190948.1 protein_id gnl|my_center|LOCUS_25260 247564 247352 gene locus_tag LOCUS_25270 gene rpsU 247564 247352 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190342.1 protein_id gnl|my_center|LOCUS_25270 248959 247730 gene locus_tag LOCUS_25280 248959 247730 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929672.1 protein_id gnl|my_center|LOCUS_25280 249944 248946 gene locus_tag LOCUS_25290 gene ybiB 249944 248946 CDS product DNA-binding protein YbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195270.1 protein_id gnl|my_center|LOCUS_25290 252799 249962 gene locus_tag LOCUS_25300 252799 249962 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936224.1 protein_id gnl|my_center|LOCUS_25300 253185 252814 gene locus_tag LOCUS_25310 gene nirD 253185 252814 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936225.1 protein_id gnl|my_center|LOCUS_25310 255641 253185 gene locus_tag LOCUS_25320 gene nirB 255641 253185 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530942.1 protein_id gnl|my_center|LOCUS_25320 257830 255938 gene locus_tag LOCUS_25330 257830 255938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 257922 259022 gene locus_tag LOCUS_25340 gene tsaD 257922 259022 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811013.1 protein_id gnl|my_center|LOCUS_25340 259640 261130 gene locus_tag LOCUS_25350 259640 261130 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931193.1 protein_id gnl|my_center|LOCUS_25350 261143 262219 gene locus_tag LOCUS_25360 gene glcE 261143 262219 CDS product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194396.1 protein_id gnl|my_center|LOCUS_25360 262229 263479 gene locus_tag LOCUS_25370 gene glcF 262229 263479 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522135.1 protein_id gnl|my_center|LOCUS_25370 263549 263992 gene locus_tag LOCUS_25380 263549 263992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 264586 263993 gene locus_tag LOCUS_25390 264586 263993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 265586 264600 gene locus_tag LOCUS_25400 265586 264600 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537364.1 protein_id gnl|my_center|LOCUS_25400 266209 265586 gene locus_tag LOCUS_25410 266209 265586 CDS product ANTAR domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113581.1 protein_id gnl|my_center|LOCUS_25410 266865 266230 gene locus_tag LOCUS_25420 gene pdxH 266865 266230 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188935.1 protein_id gnl|my_center|LOCUS_25420 266933 267841 gene locus_tag LOCUS_25430 gene xerD 266933 267841 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535956.1 protein_id gnl|my_center|LOCUS_25430 268682 269128 gene locus_tag LOCUS_25440 268682 269128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 269205 272036 gene locus_tag LOCUS_25450 269205 272036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 277718 272067 gene locus_tag LOCUS_25460 gene uvrA 277718 272067 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939035.1 protein_id gnl|my_center|LOCUS_25460 278475 277828 gene locus_tag LOCUS_25470 278475 277828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 278902 278498 gene locus_tag LOCUS_25480 278902 278498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 280140 279076 gene locus_tag LOCUS_25490 gene aroG 280140 279076 CDS product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550019.1 protein_id gnl|my_center|LOCUS_25490 280497 281093 gene locus_tag LOCUS_25500 280497 281093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 282564 281095 gene locus_tag LOCUS_25510 gene tldD 282564 281095 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194084.1 protein_id gnl|my_center|LOCUS_25510 283381 282575 gene locus_tag LOCUS_25520 283381 282575 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522140.1 protein_id gnl|my_center|LOCUS_25520 287429 283383 gene locus_tag LOCUS_25530 287429 283383 CDS product YhdP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009241452.1 protein_id gnl|my_center|LOCUS_25530 287505 290219 gene locus_tag LOCUS_25540 gene glnE 287505 290219 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196324.1 protein_id gnl|my_center|LOCUS_25540 290656 290327 gene locus_tag LOCUS_25550 290656 290327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 >Feature sequence10 1510 251 gene locus_tag LOCUS_25560 1510 251 CDS product EstA family serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208246.1 protein_id gnl|my_center|LOCUS_25560 2443 1607 gene locus_tag LOCUS_25570 2443 1607 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463551.1 protein_id gnl|my_center|LOCUS_25570 2618 3679 gene locus_tag LOCUS_25580 2618 3679 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190236313.1 protein_id gnl|my_center|LOCUS_25580 4556 3666 gene locus_tag LOCUS_25590 4556 3666 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020273.1 protein_id gnl|my_center|LOCUS_25590 4838 6820 gene locus_tag LOCUS_25600 4838 6820 CDS product DUF1302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103441.1 protein_id gnl|my_center|LOCUS_25600 6876 8219 gene locus_tag LOCUS_25610 6876 8219 CDS product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103009.1 protein_id gnl|my_center|LOCUS_25610 8325 9485 gene locus_tag LOCUS_25620 8325 9485 CDS product YCF48-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104718.1 protein_id gnl|my_center|LOCUS_25620 9500 11866 gene locus_tag LOCUS_25630 9500 11866 CDS product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115638.1 protein_id gnl|my_center|LOCUS_25630 11970 12956 gene locus_tag LOCUS_25640 11970 12956 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811668.1 protein_id gnl|my_center|LOCUS_25640 13104 13958 gene locus_tag LOCUS_25650 13104 13958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 14075 14986 gene locus_tag LOCUS_25660 14075 14986 CDS product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073135.1 protein_id gnl|my_center|LOCUS_25660 15055 15678 gene locus_tag LOCUS_25670 15055 15678 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073392.1 protein_id gnl|my_center|LOCUS_25670 16336 15701 gene locus_tag LOCUS_25680 16336 15701 CDS product NrsF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921085.1 protein_id gnl|my_center|LOCUS_25680 16914 16333 gene locus_tag LOCUS_25690 16914 16333 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034199428.1 protein_id gnl|my_center|LOCUS_25690 17046 18167 gene locus_tag LOCUS_25700 17046 18167 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162256.1 protein_id gnl|my_center|LOCUS_25700 18169 19005 gene locus_tag LOCUS_25710 gene fghA 18169 19005 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074448.1 protein_id gnl|my_center|LOCUS_25710 19053 20120 gene locus_tag LOCUS_25720 19053 20120 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155710829.1 protein_id gnl|my_center|LOCUS_25720 20437 20117 gene locus_tag LOCUS_25730 20437 20117 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329333.1 protein_id gnl|my_center|LOCUS_25730 21617 20487 gene locus_tag LOCUS_25740 21617 20487 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315813.1 protein_id gnl|my_center|LOCUS_25740 21741 22667 gene locus_tag LOCUS_25750 21741 22667 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530002.1 protein_id gnl|my_center|LOCUS_25750 23520 22618 gene locus_tag LOCUS_25760 gene rarD 23520 22618 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268385.1 protein_id gnl|my_center|LOCUS_25760 23931 24179 gene locus_tag LOCUS_25770 23931 24179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 24317 25585 gene locus_tag LOCUS_25780 24317 25585 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229955.1 protein_id gnl|my_center|LOCUS_25780 25655 25966 gene locus_tag LOCUS_25790 25655 25966 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929235.1 protein_id gnl|my_center|LOCUS_25790 26391 26008 gene locus_tag LOCUS_tm00010 26391 26008 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 27085 26429 gene locus_tag LOCUS_25800 gene gph 27085 26429 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550108.1 protein_id gnl|my_center|LOCUS_25800 27813 27097 gene locus_tag LOCUS_25810 27813 27097 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113434.1 protein_id gnl|my_center|LOCUS_25810 28577 27921 gene locus_tag LOCUS_25820 28577 27921 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813377.1 protein_id gnl|my_center|LOCUS_25820 29987 28653 gene locus_tag LOCUS_25830 29987 28653 CDS product TRZ/ATZ family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507955.1 protein_id gnl|my_center|LOCUS_25830 30145 32766 gene locus_tag LOCUS_25840 gene gyrA 30145 32766 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926826.1 protein_id gnl|my_center|LOCUS_25840 32794 33912 gene locus_tag LOCUS_25850 gene serC 32794 33912 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189993.1 protein_id gnl|my_center|LOCUS_25850 33912 35003 gene locus_tag LOCUS_25860 gene pheA 33912 35003 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190098.1 protein_id gnl|my_center|LOCUS_25860 35016 36143 gene locus_tag LOCUS_25870 gene hisC 35016 36143 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 protein_id gnl|my_center|LOCUS_25870 36143 37030 gene locus_tag LOCUS_25880 36143 37030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25880 37062 38405 gene locus_tag LOCUS_25890 37062 38405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25890 38416 39084 gene locus_tag LOCUS_25900 gene cmk 38416 39084 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705689.1 protein_id gnl|my_center|LOCUS_25900 39301 40959 gene locus_tag LOCUS_25910 gene rpsA 39301 40959 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189285.1 protein_id gnl|my_center|LOCUS_25910 41016 41312 gene locus_tag LOCUS_25920 41016 41312 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928906.1 protein_id gnl|my_center|LOCUS_25920 41394 41735 gene locus_tag LOCUS_25930 41394 41735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 41725 42945 gene locus_tag LOCUS_25940 gene lapB 41725 42945 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188993.1 protein_id gnl|my_center|LOCUS_25940 42959 43882 gene locus_tag LOCUS_25950 gene hldA 42959 43882 CDS product ADP-heptose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217546.1 protein_id gnl|my_center|LOCUS_25950 43894 44904 gene locus_tag LOCUS_25960 gene rfaD 43894 44904 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190173.1 protein_id gnl|my_center|LOCUS_25960 45509 45156 gene locus_tag LOCUS_25970 45509 45156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 45588 45905 gene locus_tag LOCUS_25980 gene rpsP 45588 45905 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926757.1 protein_id gnl|my_center|LOCUS_25980 46040 46606 gene locus_tag LOCUS_25990 gene rimM 46040 46606 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063944.1 protein_id gnl|my_center|LOCUS_25990 46606 47346 gene locus_tag LOCUS_26000 gene trmD 46606 47346 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552523.1 protein_id gnl|my_center|LOCUS_26000 47467 47847 gene locus_tag LOCUS_26010 gene rplS 47467 47847 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217809.1 protein_id gnl|my_center|LOCUS_26010 50070 47959 gene locus_tag LOCUS_26020 50070 47959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 50475 50092 gene locus_tag LOCUS_26030 50475 50092 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038342.1 protein_id gnl|my_center|LOCUS_26030 50610 52562 gene locus_tag LOCUS_26040 50610 52562 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958448.1 protein_id gnl|my_center|LOCUS_26040 52644 53588 gene locus_tag LOCUS_26050 52644 53588 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811203.1 protein_id gnl|my_center|LOCUS_26050 53592 54455 gene locus_tag LOCUS_26060 gene ubiA 53592 54455 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194359.1 protein_id gnl|my_center|LOCUS_26060 55269 54463 gene locus_tag LOCUS_26070 gene proC 55269 54463 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522133.1 protein_id gnl|my_center|LOCUS_26070 55998 55285 gene locus_tag LOCUS_26080 55998 55285 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461710.1 protein_id gnl|my_center|LOCUS_26080 56038 57072 gene locus_tag LOCUS_26090 56038 57072 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073221.1 protein_id gnl|my_center|LOCUS_26090 57130 57618 gene locus_tag LOCUS_26100 57130 57618 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114194.1 protein_id gnl|my_center|LOCUS_26100 58900 57620 gene locus_tag LOCUS_26110 58900 57620 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224938.1 protein_id gnl|my_center|LOCUS_26110 59377 58919 gene locus_tag LOCUS_26120 59377 58919 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930898.1 protein_id gnl|my_center|LOCUS_26120 60634 59378 gene locus_tag LOCUS_26130 60634 59378 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114089.1 protein_id gnl|my_center|LOCUS_26130 61711 60671 gene locus_tag LOCUS_26140 gene holA 61711 60671 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194041.1 protein_id gnl|my_center|LOCUS_26140 62226 61708 gene locus_tag LOCUS_26150 gene lptE 62226 61708 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100322.1 protein_id gnl|my_center|LOCUS_26150 64900 62255 gene locus_tag LOCUS_26160 gene leuS 64900 62255 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194387.1 protein_id gnl|my_center|LOCUS_26160 65065 67296 gene locus_tag LOCUS_26170 65065 67296 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812546.1 protein_id gnl|my_center|LOCUS_26170 68626 67832 gene locus_tag LOCUS_26180 68626 67832 CDS product BPSS1780 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529044.1 protein_id gnl|my_center|LOCUS_26180 69617 68628 gene locus_tag LOCUS_26190 69617 68628 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190439.1 protein_id gnl|my_center|LOCUS_26190 70412 69675 gene locus_tag LOCUS_26200 70412 69675 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530319.1 protein_id gnl|my_center|LOCUS_26200 70470 73196 gene locus_tag LOCUS_26210 gene polA 70470 73196 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540200.1 protein_id gnl|my_center|LOCUS_26210 73215 74120 gene locus_tag LOCUS_26220 73215 74120 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143390.1 protein_id gnl|my_center|LOCUS_26220 74139 74924 gene locus_tag LOCUS_26230 74139 74924 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930274.1 protein_id gnl|my_center|LOCUS_26230 75799 74930 gene locus_tag LOCUS_26240 75799 74930 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813139.1 protein_id gnl|my_center|LOCUS_26240 76617 75841 gene locus_tag LOCUS_26250 76617 75841 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064216.1 protein_id gnl|my_center|LOCUS_26250 77868 76723 gene locus_tag LOCUS_26260 77868 76723 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190814.1 protein_id gnl|my_center|LOCUS_26260 78043 78303 gene locus_tag LOCUS_26270 78043 78303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 78300 79202 gene locus_tag LOCUS_26280 78300 79202 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691917.1 protein_id gnl|my_center|LOCUS_26280 79199 81118 gene locus_tag LOCUS_26290 gene dxs 79199 81118 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813105.1 protein_id gnl|my_center|LOCUS_26290 81126 81956 gene locus_tag LOCUS_26300 gene folE2 81126 81956 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195713.1 protein_id gnl|my_center|LOCUS_26300 82059 82382 gene locus_tag LOCUS_26310 82059 82382 CDS product DUF3579 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189028.1 protein_id gnl|my_center|LOCUS_26310 82754 82488 gene locus_tag LOCUS_26320 gene rpsT 82754 82488 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212556.1 protein_id gnl|my_center|LOCUS_26320 82832 84391 gene locus_tag LOCUS_26330 gene murJ 82832 84391 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931127.1 protein_id gnl|my_center|LOCUS_26330 85103 84450 gene locus_tag LOCUS_26340 gene adk 85103 84450 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185840.1 protein_id gnl|my_center|LOCUS_26340 86038 85277 gene locus_tag LOCUS_26350 gene kdsB 86038 85277 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185994.1 protein_id gnl|my_center|LOCUS_26350 86221 86045 gene locus_tag LOCUS_26360 86221 86045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 87275 86202 gene locus_tag LOCUS_26370 gene lpxK 87275 86202 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555967.1 protein_id gnl|my_center|LOCUS_26370 87700 87272 gene locus_tag LOCUS_26380 87700 87272 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091161.1 protein_id gnl|my_center|LOCUS_26380 88326 87712 gene locus_tag LOCUS_26390 88326 87712 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812889.1 protein_id gnl|my_center|LOCUS_26390 88626 89993 gene locus_tag LOCUS_26400 gene xseA 88626 89993 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197496.1 protein_id gnl|my_center|LOCUS_26400 90071 90652 gene locus_tag LOCUS_26410 gene sodB 90071 90652 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064087.1 protein_id gnl|my_center|LOCUS_26410 91219 90728 gene locus_tag LOCUS_26420 91219 90728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 91381 92628 gene locus_tag LOCUS_26430 gene icd 91381 92628 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189552.1 protein_id gnl|my_center|LOCUS_26430 92930 92709 gene locus_tag LOCUS_26440 92930 92709 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196460.1 protein_id gnl|my_center|LOCUS_26440 93294 93602 gene locus_tag LOCUS_26450 gene clpS 93294 93602 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194131.1 protein_id gnl|my_center|LOCUS_26450 93599 95923 gene locus_tag LOCUS_26460 gene clpA 93599 95923 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196461.1 protein_id gnl|my_center|LOCUS_26460 97055 96012 gene locus_tag LOCUS_26470 97055 96012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 97688 97236 gene locus_tag LOCUS_26480 gene dut 97688 97236 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812576.1 protein_id gnl|my_center|LOCUS_26480 98949 97702 gene locus_tag LOCUS_26490 gene coaBC 98949 97702 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928305.1 protein_id gnl|my_center|LOCUS_26490 99471 98962 gene locus_tag LOCUS_26500 gene lspA 99471 98962 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186086.1 protein_id gnl|my_center|LOCUS_26500 102304 99509 gene locus_tag LOCUS_26510 gene ileS 102304 99509 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812558.1 protein_id gnl|my_center|LOCUS_26510 103267 102311 gene locus_tag LOCUS_26520 103267 102311 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535897.1 protein_id gnl|my_center|LOCUS_26520 103426 104013 gene locus_tag LOCUS_26530 gene purN 103426 104013 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812554.1 protein_id gnl|my_center|LOCUS_26530 104031 105377 gene locus_tag LOCUS_26540 104031 105377 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186079.1 protein_id gnl|my_center|LOCUS_26540 105510 106703 gene locus_tag LOCUS_26550 105510 106703 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186237.1 protein_id gnl|my_center|LOCUS_26550 107241 107074 gene locus_tag LOCUS_26560 gene rpmG 107241 107074 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185395.1 protein_id gnl|my_center|LOCUS_26560 107488 107255 gene locus_tag LOCUS_26570 gene rpmB 107488 107255 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810297.1 protein_id gnl|my_center|LOCUS_26570 108308 107625 gene locus_tag LOCUS_26580 gene radC 108308 107625 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769555.1 protein_id gnl|my_center|LOCUS_26580 108887 108351 gene locus_tag LOCUS_26590 gene gloA 108887 108351 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101793.1 protein_id gnl|my_center|LOCUS_26590 109058 109522 gene locus_tag LOCUS_26600 109058 109522 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186190.1 protein_id gnl|my_center|LOCUS_26600 109530 110459 gene locus_tag LOCUS_26610 gene ispH 109530 110459 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930264.1 protein_id gnl|my_center|LOCUS_26610 111784 110489 gene locus_tag LOCUS_26620 111784 110489 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932228.1 protein_id gnl|my_center|LOCUS_26620 111939 112934 gene locus_tag LOCUS_26630 111939 112934 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973898.1 protein_id gnl|my_center|LOCUS_26630 112940 113617 gene locus_tag LOCUS_26640 112940 113617 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262281.1 protein_id gnl|my_center|LOCUS_26640 113745 115184 gene locus_tag LOCUS_26650 113745 115184 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207046.1 protein_id gnl|my_center|LOCUS_26650 115240 116520 gene locus_tag LOCUS_26660 115240 116520 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266536.1 protein_id gnl|my_center|LOCUS_26660 116525 117415 gene locus_tag LOCUS_26670 116525 117415 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230939.1 protein_id gnl|my_center|LOCUS_26670 118378 117716 gene locus_tag LOCUS_26680 118378 117716 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230938.1 protein_id gnl|my_center|LOCUS_26680 119540 118506 gene locus_tag LOCUS_26690 119540 118506 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056364.1 protein_id gnl|my_center|LOCUS_26690 119716 121629 gene locus_tag LOCUS_26700 119716 121629 CDS product propionate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813753.1 protein_id gnl|my_center|LOCUS_26700 121751 122521 gene locus_tag LOCUS_26710 121751 122521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 124052 122532 gene locus_tag LOCUS_26720 124052 122532 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121241671.1 protein_id gnl|my_center|LOCUS_26720 124626 124087 gene locus_tag LOCUS_26730 124626 124087 CDS product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930554.1 protein_id gnl|my_center|LOCUS_26730 124829 126811 gene locus_tag LOCUS_26740 gene acs 124829 126811 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188376.1 protein_id gnl|my_center|LOCUS_26740 126898 128952 gene locus_tag LOCUS_26750 126898 128952 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525415.1 protein_id gnl|my_center|LOCUS_26750 129013 129103 gene locus_tag LOCUS_t00380 129013 129103 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 129379 130353 gene locus_tag LOCUS_26760 129379 130353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 130350 130853 gene locus_tag LOCUS_26770 130350 130853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 131916 130879 gene locus_tag LOCUS_26780 131916 130879 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174847485.1 protein_id gnl|my_center|LOCUS_26780 132130 131918 gene locus_tag LOCUS_26790 132130 131918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 132187 132771 gene locus_tag LOCUS_26800 132187 132771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 134633 132792 gene locus_tag LOCUS_26810 134633 132792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 134716 134886 gene locus_tag LOCUS_26820 134716 134886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 135165 134905 gene locus_tag LOCUS_26830 135165 134905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 135890 135162 gene locus_tag LOCUS_26840 135890 135162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 136436 135915 gene locus_tag LOCUS_26850 136436 135915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 136710 136414 gene locus_tag LOCUS_26860 136710 136414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 136991 136710 gene locus_tag LOCUS_26870 136991 136710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 137226 136981 gene locus_tag LOCUS_26880 137226 136981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 137650 137432 gene locus_tag LOCUS_26890 137650 137432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 137835 138281 gene locus_tag LOCUS_26900 137835 138281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 138894 138415 gene locus_tag LOCUS_26910 138894 138415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 139681 138947 gene locus_tag LOCUS_26920 139681 138947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 140418 139690 gene locus_tag LOCUS_26930 140418 139690 CDS product LexA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687969.1 protein_id gnl|my_center|LOCUS_26930 140514 140771 gene locus_tag LOCUS_26940 140514 140771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 140764 141075 gene locus_tag LOCUS_26950 140764 141075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 141068 141331 gene locus_tag LOCUS_26960 141068 141331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 141723 141460 gene locus_tag LOCUS_26970 141723 141460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 141859 142131 gene locus_tag LOCUS_26980 141859 142131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 142159 142695 gene locus_tag LOCUS_26990 142159 142695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 142699 142950 gene locus_tag LOCUS_27000 142699 142950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 142947 144026 gene locus_tag LOCUS_27010 142947 144026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 144383 144799 gene locus_tag LOCUS_27020 144383 144799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 145354 145857 gene locus_tag LOCUS_27030 145354 145857 CDS product phage terminase small subunit P27 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900701.1 protein_id gnl|my_center|LOCUS_27030 146024 147529 gene locus_tag LOCUS_27040 146024 147529 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165443313.1 protein_id gnl|my_center|LOCUS_27040 147563 147787 gene locus_tag LOCUS_27050 147563 147787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 147784 147954 gene locus_tag LOCUS_27060 147784 147954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 147954 149177 gene locus_tag LOCUS_27070 147954 149177 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975496.1 protein_id gnl|my_center|LOCUS_27070 149227 149910 gene locus_tag LOCUS_27080 149227 149910 CDS product HK97 family phage prohead protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193633.1 protein_id gnl|my_center|LOCUS_27080 149921 151321 gene locus_tag LOCUS_27090 149921 151321 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971286.1 protein_id gnl|my_center|LOCUS_27090 151375 151587 gene locus_tag LOCUS_27100 151375 151587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 151592 152206 gene locus_tag LOCUS_27110 151592 152206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 152206 152553 gene locus_tag LOCUS_27120 152206 152553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 152543 153055 gene locus_tag LOCUS_27130 152543 153055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 153052 153453 gene locus_tag LOCUS_27140 153052 153453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 153542 154018 gene locus_tag LOCUS_27150 153542 154018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 154127 154585 gene locus_tag LOCUS_27160 154127 154585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 155007 159818 gene locus_tag LOCUS_27170 155007 159818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 159815 161326 gene locus_tag LOCUS_27180 159815 161326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 161481 162185 gene locus_tag LOCUS_27190 161481 162185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 162185 164068 gene locus_tag LOCUS_27200 162185 164068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 164130 164432 gene locus_tag LOCUS_27210 164130 164432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 164469 164672 gene locus_tag LOCUS_27220 164469 164672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 164669 165181 gene locus_tag LOCUS_27230 164669 165181 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816484.1 protein_id gnl|my_center|LOCUS_27230 165178 165648 gene locus_tag LOCUS_27240 165178 165648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 166909 167136 gene locus_tag LOCUS_27250 166909 167136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 168174 167860 gene locus_tag LOCUS_27260 168174 167860 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071008.1 protein_id gnl|my_center|LOCUS_27260 168509 168171 gene locus_tag LOCUS_27270 168509 168171 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843587.1 protein_id gnl|my_center|LOCUS_27270 168708 169316 gene locus_tag LOCUS_27280 168708 169316 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242591.1 protein_id gnl|my_center|LOCUS_27280 169695 169342 gene locus_tag LOCUS_27290 169695 169342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 169819 170064 gene locus_tag LOCUS_27300 169819 170064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 170149 171483 gene locus_tag LOCUS_27310 170149 171483 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038811.1 protein_id gnl|my_center|LOCUS_27310 171930 171487 gene locus_tag LOCUS_27320 171930 171487 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522995.1 protein_id gnl|my_center|LOCUS_27320 173987 172017 gene locus_tag LOCUS_27330 173987 172017 CDS product alkyl sulfatase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989908.1 protein_id gnl|my_center|LOCUS_27330 175465 174068 gene locus_tag LOCUS_27340 175465 174068 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262172.1 protein_id gnl|my_center|LOCUS_27340 175502 176137 gene locus_tag LOCUS_27350 175502 176137 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118644.1 protein_id gnl|my_center|LOCUS_27350 176334 176134 gene locus_tag LOCUS_27360 gene golB 176334 176134 CDS product gold resistance metallochaperone GolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159469.1 protein_id gnl|my_center|LOCUS_27360 176459 178690 gene locus_tag LOCUS_27370 gene copA1 176459 178690 CDS product copper-translocating P-type ATPase CopA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093042.1 protein_id gnl|my_center|LOCUS_27370 178693 179112 gene locus_tag LOCUS_27380 gene cueR 178693 179112 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613681.1 protein_id gnl|my_center|LOCUS_27380 179744 179145 gene locus_tag LOCUS_27390 179744 179145 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640067.1 protein_id gnl|my_center|LOCUS_27390 182898 179728 gene locus_tag LOCUS_27400 gene acrB 182898 179728 CDS product efflux RND transporter permease AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132507.1 protein_id gnl|my_center|LOCUS_27400 184083 182923 gene locus_tag LOCUS_27410 184083 182923 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943335.1 protein_id gnl|my_center|LOCUS_27410 184270 185574 gene locus_tag LOCUS_27420 184270 185574 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808608.1 protein_id gnl|my_center|LOCUS_27420 186313 185582 gene locus_tag LOCUS_27430 186313 185582 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188660.1 protein_id gnl|my_center|LOCUS_27430 186576 186310 gene locus_tag LOCUS_27440 186576 186310 CDS product SemiSWEET transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089200.1 protein_id gnl|my_center|LOCUS_27440 187529 186576 gene locus_tag LOCUS_27450 187529 186576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 187909 187526 gene locus_tag LOCUS_27460 187909 187526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 188043 188606 gene locus_tag LOCUS_27470 188043 188606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 188908 189378 gene locus_tag LOCUS_27480 188908 189378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 189371 190999 gene locus_tag LOCUS_27490 189371 190999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 191894 191004 gene locus_tag LOCUS_27500 191894 191004 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263863.1 protein_id gnl|my_center|LOCUS_27500 192048 195170 gene locus_tag LOCUS_27510 192048 195170 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083133.1 protein_id gnl|my_center|LOCUS_27510 195174 196310 gene locus_tag LOCUS_27520 195174 196310 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083132.1 protein_id gnl|my_center|LOCUS_27520 198232 196307 gene locus_tag LOCUS_27530 198232 196307 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103382.1 protein_id gnl|my_center|LOCUS_27530 198840 198286 gene locus_tag LOCUS_27540 198840 198286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 199031 199333 gene locus_tag LOCUS_27550 199031 199333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 199346 201064 gene locus_tag LOCUS_27560 199346 201064 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114194.1 protein_id gnl|my_center|LOCUS_27560 201057 201368 gene locus_tag LOCUS_27570 201057 201368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 202623 201379 gene locus_tag LOCUS_27580 202623 201379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 205161 202723 gene locus_tag LOCUS_27590 205161 202723 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141976.1 protein_id gnl|my_center|LOCUS_27590 206203 205232 gene locus_tag LOCUS_27600 206203 205232 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205506.1 protein_id gnl|my_center|LOCUS_27600 206697 206200 gene locus_tag LOCUS_27610 206697 206200 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089775.1 protein_id gnl|my_center|LOCUS_27610 206975 206703 gene locus_tag LOCUS_27620 206975 206703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 208506 206977 gene locus_tag LOCUS_27630 208506 206977 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035506.1 protein_id gnl|my_center|LOCUS_27630 208793 208503 gene locus_tag LOCUS_27640 208793 208503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 209608 208928 gene locus_tag LOCUS_27650 209608 208928 CDS product Fe2+-dependent dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037901.1 protein_id gnl|my_center|LOCUS_27650 211824 209626 gene locus_tag LOCUS_27660 gene piuA 211824 209626 CDS product TonB-dependent siderophore receptor PiuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112850.1 protein_id gnl|my_center|LOCUS_27660 213555 211984 gene locus_tag LOCUS_27670 gene ahpF 213555 211984 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206518.1 protein_id gnl|my_center|LOCUS_27670 214222 213659 gene locus_tag LOCUS_27680 gene ahpC 214222 213659 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071237.1 protein_id gnl|my_center|LOCUS_27680 214774 216093 gene locus_tag LOCUS_27690 214774 216093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 216184 218556 gene locus_tag LOCUS_27700 216184 218556 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268707.1 protein_id gnl|my_center|LOCUS_27700 219152 218553 gene locus_tag LOCUS_27710 219152 218553 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480138.1 protein_id gnl|my_center|LOCUS_27710 219279 221723 gene locus_tag LOCUS_27720 219279 221723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 221737 223329 gene locus_tag LOCUS_27730 221737 223329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 223626 223342 gene locus_tag LOCUS_27740 223626 223342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 223810 224712 gene locus_tag LOCUS_27750 223810 224712 CDS product DedA family protein/thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036907.1 protein_id gnl|my_center|LOCUS_27750 224848 225714 gene locus_tag LOCUS_27760 224848 225714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 225733 226614 gene locus_tag LOCUS_27770 225733 226614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 226611 227348 gene locus_tag LOCUS_27780 gene phnC 226611 227348 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939222.1 protein_id gnl|my_center|LOCUS_27780 227352 228263 gene locus_tag LOCUS_27790 227352 228263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461155.1 protein_id gnl|my_center|LOCUS_27790 229863 228271 gene locus_tag LOCUS_27800 229863 228271 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035546.1 protein_id gnl|my_center|LOCUS_27800 230720 229884 gene locus_tag LOCUS_27810 230720 229884 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389102.1 protein_id gnl|my_center|LOCUS_27810 232070 230748 gene locus_tag LOCUS_27820 232070 230748 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258192.1 protein_id gnl|my_center|LOCUS_27820 232573 232070 gene locus_tag LOCUS_27830 232573 232070 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257143.1 protein_id gnl|my_center|LOCUS_27830 233681 232590 gene locus_tag LOCUS_27840 gene dctP 233681 232590 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 protein_id gnl|my_center|LOCUS_27840 234492 234046 gene locus_tag LOCUS_27850 gene chrS 234492 234046 CDS product chromate efflux transcriptional regulator ChrS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242900.1 protein_id gnl|my_center|LOCUS_27850 235416 234556 gene locus_tag LOCUS_27860 235416 234556 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263859.1 protein_id gnl|my_center|LOCUS_27860 236906 235428 gene locus_tag LOCUS_27870 236906 235428 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263860.1 protein_id gnl|my_center|LOCUS_27870 237164 238723 gene locus_tag LOCUS_27880 237164 238723 CDS product bifunctional GNAT family N-acetyltransferase/carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464264.1 protein_id gnl|my_center|LOCUS_27880 240151 238709 gene locus_tag LOCUS_27890 240151 238709 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198485.1 protein_id gnl|my_center|LOCUS_27890 241311 240154 gene locus_tag LOCUS_27900 241311 240154 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170105.1 protein_id gnl|my_center|LOCUS_27900 241467 242069 gene locus_tag LOCUS_27910 241467 242069 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268298.1 protein_id gnl|my_center|LOCUS_27910 243228 242074 gene locus_tag LOCUS_27920 243228 242074 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727867.1 protein_id gnl|my_center|LOCUS_27920 244372 243242 gene locus_tag LOCUS_27930 244372 243242 CDS product ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007771538.1 protein_id gnl|my_center|LOCUS_27930 245635 244466 gene locus_tag LOCUS_27940 245635 244466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 246063 245647 gene locus_tag LOCUS_27950 246063 245647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 246241 246888 gene locus_tag LOCUS_27960 246241 246888 CDS product DUF1956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792895.1 protein_id gnl|my_center|LOCUS_27960 246885 247997 gene locus_tag LOCUS_27970 246885 247997 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328247.1 protein_id gnl|my_center|LOCUS_27970 247994 251104 gene locus_tag LOCUS_27980 247994 251104 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328246.1 protein_id gnl|my_center|LOCUS_27980 251101 251880 gene locus_tag LOCUS_27990 251101 251880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 252227 252000 gene locus_tag LOCUS_28000 252227 252000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 252118 253293 gene locus_tag LOCUS_28010 252118 253293 CDS product SGNH hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027110.1 protein_id gnl|my_center|LOCUS_28010 254612 253290 gene locus_tag LOCUS_28020 254612 253290 CDS product NADH:flavin oxidoreductase/NADH oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262931.1 protein_id gnl|my_center|LOCUS_28020 255272 254616 gene locus_tag LOCUS_28030 255272 254616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 255901 255269 gene locus_tag LOCUS_28040 255901 255269 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027327.1 protein_id gnl|my_center|LOCUS_28040 255988 257043 gene locus_tag LOCUS_28050 255988 257043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029784.1 protein_id gnl|my_center|LOCUS_28050 257355 257044 gene locus_tag LOCUS_28060 257355 257044 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077234.1 protein_id gnl|my_center|LOCUS_28060 257627 258871 gene locus_tag LOCUS_28070 257627 258871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 258887 260437 gene locus_tag LOCUS_28080 258887 260437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 260538 261626 gene locus_tag LOCUS_28090 260538 261626 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113167.1 protein_id gnl|my_center|LOCUS_28090 261745 263424 gene locus_tag LOCUS_28100 261745 263424 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966127.1 protein_id gnl|my_center|LOCUS_28100 263432 263869 gene locus_tag LOCUS_28110 263432 263869 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226776.1 protein_id gnl|my_center|LOCUS_28110 265054 263909 gene locus_tag LOCUS_28120 265054 263909 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727945.1 protein_id gnl|my_center|LOCUS_28120 265192 266226 gene locus_tag LOCUS_28130 265192 266226 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444337.1 protein_id gnl|my_center|LOCUS_28130 266319 268334 gene locus_tag LOCUS_28140 266319 268334 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113937.1 protein_id gnl|my_center|LOCUS_28140 268347 269363 gene locus_tag LOCUS_28150 268347 269363 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101519.1 protein_id gnl|my_center|LOCUS_28150 269451 270422 gene locus_tag LOCUS_28160 269451 270422 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901538.1 protein_id gnl|my_center|LOCUS_28160 270434 271576 gene locus_tag LOCUS_28170 270434 271576 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103930.1 protein_id gnl|my_center|LOCUS_28170 271599 272480 gene locus_tag LOCUS_28180 271599 272480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 272477 273772 gene locus_tag LOCUS_28190 272477 273772 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103021108.1 protein_id gnl|my_center|LOCUS_28190 273769 275460 gene locus_tag LOCUS_28200 273769 275460 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114249.1 protein_id gnl|my_center|LOCUS_28200 276369 275509 gene locus_tag LOCUS_28210 276369 275509 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114805.1 protein_id gnl|my_center|LOCUS_28210 276662 277576 gene locus_tag LOCUS_28220 276662 277576 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202681.1 protein_id gnl|my_center|LOCUS_28220 278883 278701 gene locus_tag LOCUS_28230 278883 278701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 279239 279523 gene locus_tag LOCUS_28240 279239 279523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 279633 281027 gene locus_tag LOCUS_28250 279633 281027 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707322.1 protein_id gnl|my_center|LOCUS_28250 281100 281723 gene locus_tag LOCUS_28260 281100 281723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 281811 282284 gene locus_tag LOCUS_28270 281811 282284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 282357 283310 gene locus_tag LOCUS_28280 282357 283310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 284112 283753 gene locus_tag LOCUS_28290 284112 283753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 283996 284535 gene locus_tag LOCUS_28300 283996 284535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 284634 285476 gene locus_tag LOCUS_28310 284634 285476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 285555 286601 gene locus_tag LOCUS_28320 285555 286601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 286676 287335 gene locus_tag LOCUS_28330 286676 287335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 287506 287664 gene locus_tag LOCUS_28340 287506 287664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 >Feature sequence11 900 466 gene locus_tag LOCUS_28350 900 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 2130 997 gene locus_tag LOCUS_28360 2130 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 2682 2272 gene locus_tag LOCUS_28370 2682 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 2845 3240 gene locus_tag LOCUS_28380 2845 3240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 4096 3311 gene locus_tag LOCUS_28390 4096 3311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 5286 4306 gene locus_tag LOCUS_28400 5286 4306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 6405 5419 gene locus_tag LOCUS_28410 6405 5419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 7755 8030 gene locus_tag LOCUS_28420 7755 8030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 8060 9076 gene locus_tag LOCUS_28430 8060 9076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 9416 9895 gene locus_tag LOCUS_28440 9416 9895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 9964 11088 gene locus_tag LOCUS_28450 9964 11088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 11850 11236 gene locus_tag LOCUS_28460 11850 11236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 12293 11934 gene locus_tag LOCUS_28470 12293 11934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 15105 13099 gene locus_tag LOCUS_28480 15105 13099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 15607 15119 gene locus_tag LOCUS_28490 15607 15119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 16862 15594 gene locus_tag LOCUS_28500 16862 15594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 18578 16872 gene locus_tag LOCUS_28510 18578 16872 CDS product PilN family type IVB pilus formation outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205650.1 protein_id gnl|my_center|LOCUS_28510 19780 18593 gene locus_tag LOCUS_28520 19780 18593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 21934 21143 gene locus_tag LOCUS_28530 gene virB9 21934 21143 CDS product P-type conjugative transfer protein VirB9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946980.1 protein_id gnl|my_center|LOCUS_28530 22713 21931 gene locus_tag LOCUS_28540 22713 21931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 24391 22811 gene locus_tag LOCUS_28550 24391 22811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 25097 24861 gene locus_tag LOCUS_28560 25097 24861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 25464 25790 gene locus_tag LOCUS_28570 25464 25790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 27044 26271 gene locus_tag LOCUS_28580 27044 26271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 29442 27037 gene locus_tag LOCUS_28590 gene trbE 29442 27037 CDS product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090993.1 protein_id gnl|my_center|LOCUS_28590 29840 29523 gene locus_tag LOCUS_28600 29840 29523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 30190 29840 gene locus_tag LOCUS_28610 30190 29840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 30683 30165 gene locus_tag LOCUS_28620 30683 30165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 33812 31965 gene locus_tag LOCUS_28630 gene traD 33812 31965 CDS product conjugative transfer system coupling protein TraD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205050578.1 protein_id gnl|my_center|LOCUS_28630 34932 33826 gene locus_tag LOCUS_28640 34932 33826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 35848 36480 gene locus_tag LOCUS_28650 35848 36480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 37565 36516 gene locus_tag LOCUS_28660 37565 36516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 38295 37786 gene locus_tag LOCUS_28670 38295 37786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 40193 38550 gene locus_tag LOCUS_28680 40193 38550 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942806.1 protein_id gnl|my_center|LOCUS_28680 41583 40396 gene locus_tag LOCUS_28690 41583 40396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 44664 41827 gene locus_tag LOCUS_28700 44664 41827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 45638 45066 gene locus_tag LOCUS_28710 45638 45066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 46217 45894 gene locus_tag LOCUS_28720 46217 45894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 46822 46232 gene locus_tag LOCUS_28730 gene ssb 46822 46232 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107825.1 protein_id gnl|my_center|LOCUS_28730 47529 46819 gene locus_tag LOCUS_28740 47529 46819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 48260 47589 gene locus_tag LOCUS_28750 48260 47589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 49254 48253 gene locus_tag LOCUS_28760 49254 48253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 49873 49283 gene locus_tag LOCUS_28770 49873 49283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 50133 49870 gene locus_tag LOCUS_28780 50133 49870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 50230 50382 gene locus_tag LOCUS_28790 50230 50382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 50682 51539 gene locus_tag LOCUS_28800 50682 51539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 51547 53346 gene locus_tag LOCUS_28810 gene pcrA 51547 53346 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644128.1 protein_id gnl|my_center|LOCUS_28810 53343 54185 gene locus_tag LOCUS_28820 53343 54185 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266634.1 protein_id gnl|my_center|LOCUS_28820 56104 54152 gene locus_tag LOCUS_28830 gene recG 56104 54152 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881342.1 protein_id gnl|my_center|LOCUS_28830 58226 57267 gene locus_tag LOCUS_28840 58226 57267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 58413 58751 gene locus_tag LOCUS_28850 58413 58751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 58758 58961 gene locus_tag LOCUS_28860 58758 58961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 59751 59041 gene locus_tag LOCUS_28870 59751 59041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 60486 59815 gene locus_tag LOCUS_28880 60486 59815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 60631 60795 gene locus_tag LOCUS_28890 60631 60795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 63001 61031 gene locus_tag LOCUS_28900 63001 61031 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257705.1 protein_id gnl|my_center|LOCUS_28900 64045 63056 gene locus_tag LOCUS_28910 64045 63056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 64194 65228 gene locus_tag LOCUS_28920 64194 65228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 65784 65254 gene locus_tag LOCUS_28930 65784 65254 CDS product DUF882 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705140.1 protein_id gnl|my_center|LOCUS_28930 67598 65781 gene locus_tag LOCUS_28940 67598 65781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 68293 67598 gene locus_tag LOCUS_28950 68293 67598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 68874 69170 gene locus_tag LOCUS_28960 68874 69170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 69891 70631 gene locus_tag LOCUS_28970 gene parA 69891 70631 CDS product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202825640.1 protein_id gnl|my_center|LOCUS_28970 70636 71202 gene locus_tag LOCUS_28980 70636 71202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 72888 71269 gene locus_tag LOCUS_28990 72888 71269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 74637 73627 gene locus_tag LOCUS_29000 74637 73627 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012569583.1 protein_id gnl|my_center|LOCUS_29000 74769 74936 gene locus_tag LOCUS_29010 74769 74936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 75252 75992 gene locus_tag LOCUS_29020 75252 75992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 76092 76499 gene locus_tag LOCUS_29030 76092 76499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 76521 76826 gene locus_tag LOCUS_29040 76521 76826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 76857 77105 gene locus_tag LOCUS_29050 76857 77105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 77458 77147 gene locus_tag LOCUS_29060 77458 77147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 77919 77488 gene locus_tag LOCUS_29070 77919 77488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 78194 77976 gene locus_tag LOCUS_29080 78194 77976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 78358 78191 gene locus_tag LOCUS_29090 78358 78191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 78938 78348 gene locus_tag LOCUS_29100 78938 78348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 79160 78948 gene locus_tag LOCUS_29110 79160 78948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 79707 79210 gene locus_tag LOCUS_29120 79707 79210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 80587 79838 gene locus_tag LOCUS_29130 80587 79838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 80904 80659 gene locus_tag LOCUS_29140 80904 80659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 81693 82478 gene locus_tag LOCUS_29150 81693 82478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 82475 82864 gene locus_tag LOCUS_29160 82475 82864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 82873 83934 gene locus_tag LOCUS_29170 82873 83934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 84517 83960 gene locus_tag LOCUS_29180 84517 83960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 85266 84628 gene locus_tag LOCUS_29190 85266 84628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 85827 85300 gene locus_tag LOCUS_29200 85827 85300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 87057 88373 gene locus_tag LOCUS_29210 87057 88373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 89174 88389 gene locus_tag LOCUS_29220 89174 88389 CDS product PRTRC system ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108426.1 protein_id gnl|my_center|LOCUS_29220 89861 89184 gene locus_tag LOCUS_29230 89861 89184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 90634 89864 gene locus_tag LOCUS_29240 90634 89864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 91725 90655 gene locus_tag LOCUS_29250 91725 90655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 91838 91635 gene locus_tag LOCUS_29260 91838 91635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 92050 91844 gene locus_tag LOCUS_29270 92050 91844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 92535 92080 gene locus_tag LOCUS_29280 92535 92080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 94513 92708 gene locus_tag LOCUS_29290 94513 92708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 94778 96895 gene locus_tag LOCUS_29300 gene dinG 94778 96895 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689889.1 protein_id gnl|my_center|LOCUS_29300 97029 97487 gene locus_tag LOCUS_29310 97029 97487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 97529 98086 gene locus_tag LOCUS_29320 gene ssb 97529 98086 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806953.1 protein_id gnl|my_center|LOCUS_29320 100422 98089 gene locus_tag LOCUS_29330 100422 98089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 100698 100429 gene locus_tag LOCUS_29340 100698 100429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 100849 101307 gene locus_tag LOCUS_29350 100849 101307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 101499 101308 gene locus_tag LOCUS_29360 101499 101308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 103015 101975 gene locus_tag LOCUS_29370 103015 101975 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769709.1 protein_id gnl|my_center|LOCUS_29370 103810 103043 gene locus_tag LOCUS_29380 103810 103043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 104189 103944 gene locus_tag LOCUS_29390 104189 103944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 104379 105275 gene locus_tag LOCUS_29400 104379 105275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 106550 105297 gene locus_tag LOCUS_29410 106550 105297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 107046 107477 gene locus_tag LOCUS_29420 107046 107477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 107658 107858 gene locus_tag LOCUS_29430 107658 107858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 107956 108315 gene locus_tag LOCUS_29440 107956 108315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 108961 108350 gene locus_tag LOCUS_29450 108961 108350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 109431 110564 gene locus_tag LOCUS_29460 109431 110564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 110650 110919 gene locus_tag LOCUS_29470 110650 110919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 111386 111054 gene locus_tag LOCUS_29480 111386 111054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 112124 111480 gene locus_tag LOCUS_29490 112124 111480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 114054 112321 gene locus_tag LOCUS_29500 114054 112321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 114882 114196 gene locus_tag LOCUS_29510 114882 114196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 115321 114941 gene locus_tag LOCUS_29520 115321 114941 CDS product DUF1643 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263212.1 protein_id gnl|my_center|LOCUS_29520 115853 115425 gene locus_tag LOCUS_29530 115853 115425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 116595 116056 gene locus_tag LOCUS_29540 116595 116056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 117306 116614 gene locus_tag LOCUS_29550 117306 116614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 117831 117502 gene locus_tag LOCUS_29560 117831 117502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 119582 117828 gene locus_tag LOCUS_29570 119582 117828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 120098 120679 gene locus_tag LOCUS_29580 120098 120679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 120684 121460 gene locus_tag LOCUS_29590 120684 121460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 123475 121487 gene locus_tag LOCUS_29600 123475 121487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 124406 125248 gene locus_tag LOCUS_29610 124406 125248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 125505 126170 gene locus_tag LOCUS_29620 125505 126170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 126207 127370 gene locus_tag LOCUS_29630 126207 127370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 127373 128071 gene locus_tag LOCUS_29640 127373 128071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 128098 129557 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggtgaatgaccctagccgttgttagggtgtg 129832 131748 gene locus_tag LOCUS_29650 129832 131748 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476616.1 protein_id gnl|my_center|LOCUS_29650 131735 132802 gene locus_tag LOCUS_29660 131735 132802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 132799 134142 gene locus_tag LOCUS_29670 132799 134142 CDS product ISL3-like element ISPpu12 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004574636.1 protein_id gnl|my_center|LOCUS_29670 134617 134285 gene locus_tag LOCUS_29680 134617 134285 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560819.1 protein_id gnl|my_center|LOCUS_29680 134961 134614 gene locus_tag LOCUS_29690 134961 134614 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227701.1 protein_id gnl|my_center|LOCUS_29690 135304 135101 gene locus_tag LOCUS_29700 135304 135101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 >Feature sequence12 1365 499 gene locus_tag LOCUS_29710 1365 499 CDS product flagellin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767010.1 protein_id gnl|my_center|LOCUS_29710 2594 1731 gene locus_tag LOCUS_29720 2594 1731 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943665.1 protein_id gnl|my_center|LOCUS_29720 3008 3445 gene locus_tag LOCUS_29730 3008 3445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 3527 4090 gene locus_tag LOCUS_29740 gene flhC 3527 4090 CDS product flagellar transcriptional regulator FlhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198198.1 protein_id gnl|my_center|LOCUS_29740 4400 5263 gene locus_tag LOCUS_29750 gene motA 4400 5263 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198197.1 protein_id gnl|my_center|LOCUS_29750 5279 6247 gene locus_tag LOCUS_29760 gene motB 5279 6247 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811924.1 protein_id gnl|my_center|LOCUS_29760 6279 7208 gene locus_tag LOCUS_29770 6279 7208 CDS product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073135.1 protein_id gnl|my_center|LOCUS_29770 7218 7607 gene locus_tag LOCUS_29780 gene cheY 7218 7607 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500431.1 protein_id gnl|my_center|LOCUS_29780 7641 8414 gene locus_tag LOCUS_29790 gene cheZ 7641 8414 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817162.1 protein_id gnl|my_center|LOCUS_29790 8451 10289 gene locus_tag LOCUS_29800 gene cheAY2 8451 10289 CDS product chemotaxis histidine kinase/response regulator CheAY2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342347.1 protein_id gnl|my_center|LOCUS_29800 10431 12176 gene locus_tag LOCUS_29810 10431 12176 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267534.1 protein_id gnl|my_center|LOCUS_29810 12673 12221 gene locus_tag LOCUS_29820 12673 12221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 12684 13814 gene locus_tag LOCUS_29830 gene flhB 12684 13814 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938913.1 protein_id gnl|my_center|LOCUS_29830 14520 16640 gene locus_tag LOCUS_29840 gene flhA 14520 16640 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198639.1 protein_id gnl|my_center|LOCUS_29840 16637 17974 gene locus_tag LOCUS_29850 16637 17974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 17998 18756 gene locus_tag LOCUS_29860 17998 18756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 18782 19498 gene locus_tag LOCUS_29870 18782 19498 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198636.1 protein_id gnl|my_center|LOCUS_29870 19505 21403 gene locus_tag LOCUS_29880 19505 21403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 21417 21857 gene locus_tag LOCUS_29890 21417 21857 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316403.1 protein_id gnl|my_center|LOCUS_29890 22347 21832 gene locus_tag LOCUS_29900 22347 21832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 22654 22364 gene locus_tag LOCUS_29910 22654 22364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 23473 22769 gene locus_tag LOCUS_29920 23473 22769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 23665 24117 gene locus_tag LOCUS_29930 gene flgB 23665 24117 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097139.1 protein_id gnl|my_center|LOCUS_29930 24134 24556 gene locus_tag LOCUS_29940 gene flgC 24134 24556 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554316.1 protein_id gnl|my_center|LOCUS_29940 24570 25241 gene locus_tag LOCUS_29950 gene flgD 24570 25241 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211112.1 protein_id gnl|my_center|LOCUS_29950 25268 26581 gene locus_tag LOCUS_29960 gene flgE 25268 26581 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073130.1 protein_id gnl|my_center|LOCUS_29960 26607 27344 gene locus_tag LOCUS_29970 26607 27344 CDS product flagellar basal body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009113335.1 protein_id gnl|my_center|LOCUS_29970 27358 28140 gene locus_tag LOCUS_29980 gene flgG 27358 28140 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050114401.1 protein_id gnl|my_center|LOCUS_29980 28189 28878 gene locus_tag LOCUS_29990 28189 28878 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447174.1 protein_id gnl|my_center|LOCUS_29990 28892 30037 gene locus_tag LOCUS_30000 gene flgI 28892 30037 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589326.1 protein_id gnl|my_center|LOCUS_30000 30038 30451 gene locus_tag LOCUS_30010 30038 30451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 30482 32215 gene locus_tag LOCUS_30020 gene flgK 30482 32215 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704937.1 protein_id gnl|my_center|LOCUS_30020 32236 33213 gene locus_tag LOCUS_30030 gene flgL 32236 33213 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212764.1 protein_id gnl|my_center|LOCUS_30030 34407 33778 gene locus_tag LOCUS_30040 gene rqpR 34407 33778 CDS product response regulator transcription factor RqpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197176.1 protein_id gnl|my_center|LOCUS_30040 35908 34400 gene locus_tag LOCUS_30050 35908 34400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 36119 37111 gene locus_tag LOCUS_30060 36119 37111 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525698.1 protein_id gnl|my_center|LOCUS_30060 37108 37707 gene locus_tag LOCUS_30070 gene cheD 37108 37707 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072188.1 protein_id gnl|my_center|LOCUS_30070 37719 38858 gene locus_tag LOCUS_30080 37719 38858 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200023.1 protein_id gnl|my_center|LOCUS_30080 40578 38860 gene locus_tag LOCUS_30090 40578 38860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 40681 41238 gene locus_tag LOCUS_30100 gene greB 40681 41238 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812405.1 protein_id gnl|my_center|LOCUS_30100 44078 41838 gene locus_tag LOCUS_30110 44078 41838 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194871.1 protein_id gnl|my_center|LOCUS_30110 44380 44126 gene locus_tag LOCUS_30120 gene minE 44380 44126 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814252.1 protein_id gnl|my_center|LOCUS_30120 45197 44385 gene locus_tag LOCUS_30130 gene minD 45197 44385 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814250.1 protein_id gnl|my_center|LOCUS_30130 46005 45208 gene locus_tag LOCUS_30140 gene minC 46005 45208 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072527.1 protein_id gnl|my_center|LOCUS_30140 46312 46106 gene locus_tag LOCUS_30150 gene rpoZ 46312 46106 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185855.1 protein_id gnl|my_center|LOCUS_30150 46969 46322 gene locus_tag LOCUS_30160 gene gmk 46969 46322 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185877.1 protein_id gnl|my_center|LOCUS_30160 48987 48058 gene locus_tag LOCUS_30170 48987 48058 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185526.1 protein_id gnl|my_center|LOCUS_30170 49044 50267 gene locus_tag LOCUS_30180 gene dinB 49044 50267 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937382.1 protein_id gnl|my_center|LOCUS_30180 50306 51037 gene locus_tag LOCUS_30190 gene rph 50306 51037 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186400.1 protein_id gnl|my_center|LOCUS_30190 51059 51688 gene locus_tag LOCUS_30200 gene rdgB 51059 51688 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186211.1 protein_id gnl|my_center|LOCUS_30200 51689 53008 gene locus_tag LOCUS_30210 gene hemW 51689 53008 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229174.1 protein_id gnl|my_center|LOCUS_30210 53548 53024 gene locus_tag LOCUS_30220 53548 53024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 53672 56260 gene locus_tag LOCUS_30230 gene clpB 53672 56260 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521310.1 protein_id gnl|my_center|LOCUS_30230 57544 56666 gene locus_tag LOCUS_30240 57544 56666 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207613.1 protein_id gnl|my_center|LOCUS_30240 57667 58674 gene locus_tag LOCUS_30250 57667 58674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 58757 59248 gene locus_tag LOCUS_30260 gene rraA 58757 59248 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191744.1 protein_id gnl|my_center|LOCUS_30260 59543 59346 gene locus_tag LOCUS_30270 59543 59346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 59542 60858 gene locus_tag LOCUS_30280 gene aceA 59542 60858 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706620.1 protein_id gnl|my_center|LOCUS_30280 62757 61069 gene locus_tag LOCUS_30290 62757 61069 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528518.1 protein_id gnl|my_center|LOCUS_30290 64490 62862 gene locus_tag LOCUS_30300 64490 62862 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267488.1 protein_id gnl|my_center|LOCUS_30300 67882 64601 gene locus_tag LOCUS_30310 67882 64601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 68966 68064 gene locus_tag LOCUS_30320 68966 68064 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266649.1 protein_id gnl|my_center|LOCUS_30320 69070 69738 gene locus_tag LOCUS_30330 69070 69738 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204015.1 protein_id gnl|my_center|LOCUS_30330 69843 71672 gene locus_tag LOCUS_30340 69843 71672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 71942 71733 gene locus_tag LOCUS_30350 71942 71733 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005331438.1 protein_id gnl|my_center|LOCUS_30350 72197 72997 gene locus_tag LOCUS_30360 72197 72997 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809629.1 protein_id gnl|my_center|LOCUS_30360 74517 73018 gene locus_tag LOCUS_30370 gene ppx 74517 73018 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192703.1 protein_id gnl|my_center|LOCUS_30370 74662 76803 gene locus_tag LOCUS_30380 gene ppk1 74662 76803 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521820.1 protein_id gnl|my_center|LOCUS_30380 79099 76805 gene locus_tag LOCUS_30390 79099 76805 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521683.1 protein_id gnl|my_center|LOCUS_30390 79990 79130 gene locus_tag LOCUS_30400 79990 79130 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011832186.1 protein_id gnl|my_center|LOCUS_30400 80060 80842 gene locus_tag LOCUS_30410 gene bdhA 80060 80842 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113501.1 protein_id gnl|my_center|LOCUS_30410 82194 81391 gene locus_tag LOCUS_30420 82194 81391 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817266.1 protein_id gnl|my_center|LOCUS_30420 83150 82191 gene locus_tag LOCUS_30430 83150 82191 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378609.1 protein_id gnl|my_center|LOCUS_30430 84578 83163 gene locus_tag LOCUS_30440 84578 83163 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003371557.1 protein_id gnl|my_center|LOCUS_30440 87112 84677 gene locus_tag LOCUS_30450 87112 84677 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039712.1 protein_id gnl|my_center|LOCUS_30450 87988 87203 gene locus_tag LOCUS_30460 87988 87203 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527360.1 protein_id gnl|my_center|LOCUS_30460 87965 88561 gene locus_tag LOCUS_30470 87965 88561 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072737.1 protein_id gnl|my_center|LOCUS_30470 89260 88571 gene locus_tag LOCUS_30480 gene lolD 89260 88571 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158007.1 protein_id gnl|my_center|LOCUS_30480 90530 89253 gene locus_tag LOCUS_30490 90530 89253 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930193.1 protein_id gnl|my_center|LOCUS_30490 90604 91770 gene locus_tag LOCUS_30500 90604 91770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 91770 93509 gene locus_tag LOCUS_30510 gene recJ 91770 93509 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191649.1 protein_id gnl|my_center|LOCUS_30510 93815 93516 gene locus_tag LOCUS_30520 93815 93516 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532246.1 protein_id gnl|my_center|LOCUS_30520 94115 93825 gene locus_tag LOCUS_30530 94115 93825 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180943360.1 protein_id gnl|my_center|LOCUS_30530 94342 95400 gene locus_tag LOCUS_30540 gene prfB 94342 95400 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926448.1 protein_id gnl|my_center|LOCUS_30540 95404 96936 gene locus_tag LOCUS_30550 gene lysS 95404 96936 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205152.1 protein_id gnl|my_center|LOCUS_30550 97275 97703 gene locus_tag LOCUS_30560 97275 97703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 98928 98011 gene locus_tag LOCUS_30570 98928 98011 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112287.1 protein_id gnl|my_center|LOCUS_30570 101506 98933 gene locus_tag LOCUS_30580 101506 98933 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187774.1 protein_id gnl|my_center|LOCUS_30580 104822 101538 gene locus_tag LOCUS_30590 104822 101538 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205417.1 protein_id gnl|my_center|LOCUS_30590 104882 105427 gene locus_tag LOCUS_30600 104882 105427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 105480 106331 gene locus_tag LOCUS_30610 gene yghU 105480 106331 CDS product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769036.1 protein_id gnl|my_center|LOCUS_30610 106352 106783 gene locus_tag LOCUS_30620 106352 106783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 106799 107602 gene locus_tag LOCUS_30630 gene blaOXA 106799 107602 CDS product OXA-48 family carbapenem-hydrolyzing class D beta-lactamase OXA-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071128.1 protein_id gnl|my_center|LOCUS_30630 107665 109206 gene locus_tag LOCUS_30640 107665 109206 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214443067.1 protein_id gnl|my_center|LOCUS_30640 109401 109207 gene locus_tag LOCUS_30650 gene iscX 109401 109207 CDS product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004698764.1 protein_id gnl|my_center|LOCUS_30650 109756 109418 gene locus_tag LOCUS_30660 gene fdx 109756 109418 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009387062.1 protein_id gnl|my_center|LOCUS_30660 111672 109789 gene locus_tag LOCUS_30670 gene hscA 111672 109789 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938156.1 protein_id gnl|my_center|LOCUS_30670 112217 111672 gene locus_tag LOCUS_30680 gene hscB 112217 111672 CDS product Fe-S protein assembly co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202016.1 protein_id gnl|my_center|LOCUS_30680 112540 112217 gene locus_tag LOCUS_30690 gene iscA 112540 112217 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191333.1 protein_id gnl|my_center|LOCUS_30690 112955 112575 gene locus_tag LOCUS_30700 gene iscU 112955 112575 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192918.1 protein_id gnl|my_center|LOCUS_30700 114194 112983 gene locus_tag LOCUS_30710 114194 112983 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524724.1 protein_id gnl|my_center|LOCUS_30710 114704 114222 gene locus_tag LOCUS_30720 gene iscR 114704 114222 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195928.1 protein_id gnl|my_center|LOCUS_30720 115371 114880 gene locus_tag LOCUS_30730 115371 114880 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812465.1 protein_id gnl|my_center|LOCUS_30730 117481 115418 gene locus_tag LOCUS_30740 gene uvrB 117481 115418 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812466.1 protein_id gnl|my_center|LOCUS_30740 117718 118905 gene locus_tag LOCUS_30750 117718 118905 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118408.1 protein_id gnl|my_center|LOCUS_30750 119038 119113 gene locus_tag LOCUS_t00390 119038 119113 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 119943 121940 gene locus_tag LOCUS_30760 119943 121940 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932588.1 protein_id gnl|my_center|LOCUS_30760 121924 124680 gene locus_tag LOCUS_30770 121924 124680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 125126 125428 gene locus_tag LOCUS_30780 125126 125428 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082849.1 protein_id gnl|my_center|LOCUS_30780 125425 126255 gene locus_tag LOCUS_30790 125425 126255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30790 126447 129434 gene locus_tag LOCUS_30800 126447 129434 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544913.1 protein_id gnl|my_center|LOCUS_30800 130875 129937 gene locus_tag LOCUS_30810 130875 129937 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407991.1 protein_id gnl|my_center|LOCUS_30810 131086 132030 gene locus_tag LOCUS_30820 131086 132030 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070761.1 protein_id gnl|my_center|LOCUS_30820 132307 132086 gene locus_tag LOCUS_30830 132307 132086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 >Feature sequence13 786 1319 gene locus_tag LOCUS_30840 786 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 2565 1321 gene locus_tag LOCUS_30850 2565 1321 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814551.1 protein_id gnl|my_center|LOCUS_30850 2608 3699 gene locus_tag LOCUS_30860 2608 3699 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528524.1 protein_id gnl|my_center|LOCUS_30860 4497 3694 gene locus_tag LOCUS_30870 4497 3694 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205980.1 protein_id gnl|my_center|LOCUS_30870 4550 5896 gene locus_tag LOCUS_30880 4550 5896 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257427.1 protein_id gnl|my_center|LOCUS_30880 5926 7080 gene locus_tag LOCUS_30890 gene pyrC 5926 7080 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814588.1 protein_id gnl|my_center|LOCUS_30890 7056 7985 gene locus_tag LOCUS_30900 7056 7985 CDS product DUF3025 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527732.1 protein_id gnl|my_center|LOCUS_30900 8568 8969 gene locus_tag LOCUS_30910 gene mraZ 8568 8969 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194130.1 protein_id gnl|my_center|LOCUS_30910 8972 9943 gene locus_tag LOCUS_30920 gene rsmH 8972 9943 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194427.1 protein_id gnl|my_center|LOCUS_30920 9931 10212 gene locus_tag LOCUS_30930 9931 10212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 10205 11965 gene locus_tag LOCUS_30940 10205 11965 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446492.1 protein_id gnl|my_center|LOCUS_30940 11962 13458 gene locus_tag LOCUS_30950 11962 13458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 13451 14845 gene locus_tag LOCUS_30960 gene murF 13451 14845 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194098.1 protein_id gnl|my_center|LOCUS_30960 14793 15989 gene locus_tag LOCUS_30970 gene mraY 14793 15989 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247664.1 protein_id gnl|my_center|LOCUS_30970 16006 17481 gene locus_tag LOCUS_30980 gene murD 16006 17481 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203798.1 protein_id gnl|my_center|LOCUS_30980 17475 18731 gene locus_tag LOCUS_30990 gene ftsW 17475 18731 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194175.1 protein_id gnl|my_center|LOCUS_30990 18728 19801 gene locus_tag LOCUS_31000 gene murG 18728 19801 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194182.1 protein_id gnl|my_center|LOCUS_31000 19798 21198 gene locus_tag LOCUS_31010 gene murC 19798 21198 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522018.1 protein_id gnl|my_center|LOCUS_31010 21195 22166 gene locus_tag LOCUS_31020 21195 22166 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814571.1 protein_id gnl|my_center|LOCUS_31020 22167 22946 gene locus_tag LOCUS_31030 22167 22946 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522020.1 protein_id gnl|my_center|LOCUS_31030 22957 24204 gene locus_tag LOCUS_31040 gene ftsA 22957 24204 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194020.1 protein_id gnl|my_center|LOCUS_31040 24269 25438 gene locus_tag LOCUS_31050 gene ftsZ 24269 25438 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814568.1 protein_id gnl|my_center|LOCUS_31050 25622 26125 gene locus_tag LOCUS_31060 25622 26125 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040329.1 protein_id gnl|my_center|LOCUS_31060 26272 27192 gene locus_tag LOCUS_31070 gene lpxC 26272 27192 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522022.1 protein_id gnl|my_center|LOCUS_31070 27707 27258 gene locus_tag LOCUS_31080 27707 27258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 27778 28755 gene locus_tag LOCUS_31090 27778 28755 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814565.1 protein_id gnl|my_center|LOCUS_31090 28856 31615 gene locus_tag LOCUS_31100 gene secA 28856 31615 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064961.1 protein_id gnl|my_center|LOCUS_31100 31664 32893 gene locus_tag LOCUS_31110 gene argJ 31664 32893 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931662.1 protein_id gnl|my_center|LOCUS_31110 32906 33772 gene locus_tag LOCUS_31120 32906 33772 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040567.1 protein_id gnl|my_center|LOCUS_31120 33817 34740 gene locus_tag LOCUS_31130 33817 34740 CDS product Nudix family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815027.1 protein_id gnl|my_center|LOCUS_31130 35560 34751 gene locus_tag LOCUS_31140 gene zapD 35560 34751 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195118.1 protein_id gnl|my_center|LOCUS_31140 36259 35633 gene locus_tag LOCUS_31150 gene coaE 36259 35633 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194322.1 protein_id gnl|my_center|LOCUS_31150 37106 36267 gene locus_tag LOCUS_31160 37106 36267 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707571.1 protein_id gnl|my_center|LOCUS_31160 38341 37103 gene locus_tag LOCUS_31170 gene pilG 38341 37103 CDS product type 4 pilus assembly protein PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216405.1 protein_id gnl|my_center|LOCUS_31170 40059 38362 gene locus_tag LOCUS_31180 gene pilB 40059 38362 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070776.1 protein_id gnl|my_center|LOCUS_31180 41159 40167 gene locus_tag LOCUS_31190 41159 40167 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204136.1 protein_id gnl|my_center|LOCUS_31190 41374 41685 gene locus_tag LOCUS_31200 gene rplU 41374 41685 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807462.1 protein_id gnl|my_center|LOCUS_31200 41702 41962 gene locus_tag LOCUS_31210 gene rpmA 41702 41962 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194025.1 protein_id gnl|my_center|LOCUS_31210 42083 43198 gene locus_tag LOCUS_31220 gene obgE 42083 43198 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194312.1 protein_id gnl|my_center|LOCUS_31220 43204 44325 gene locus_tag LOCUS_31230 gene proB 43204 44325 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194262.1 protein_id gnl|my_center|LOCUS_31230 44357 45214 gene locus_tag LOCUS_31240 44357 45214 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102328.1 protein_id gnl|my_center|LOCUS_31240 45298 45858 gene locus_tag LOCUS_31250 45298 45858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 46185 46487 gene locus_tag LOCUS_31260 46185 46487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 47079 46519 gene locus_tag LOCUS_31270 47079 46519 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814635.1 protein_id gnl|my_center|LOCUS_31270 47220 48980 gene locus_tag LOCUS_31280 47220 48980 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194217.1 protein_id gnl|my_center|LOCUS_31280 49018 49635 gene locus_tag LOCUS_31290 49018 49635 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219051.1 protein_id gnl|my_center|LOCUS_31290 51565 50168 gene locus_tag LOCUS_31300 gene ffh 51565 50168 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194338.1 protein_id gnl|my_center|LOCUS_31300 51613 52452 gene locus_tag LOCUS_31310 gene ccsA 51613 52452 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538773.1 protein_id gnl|my_center|LOCUS_31310 52452 52709 gene locus_tag LOCUS_31320 52452 52709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 52727 53290 gene locus_tag LOCUS_31330 gene ampD 52727 53290 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038846.1 protein_id gnl|my_center|LOCUS_31330 53517 56441 gene locus_tag LOCUS_31340 53517 56441 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814928.1 protein_id gnl|my_center|LOCUS_31340 56556 57761 gene locus_tag LOCUS_31350 56556 57761 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814929.1 protein_id gnl|my_center|LOCUS_31350 57931 58413 gene locus_tag LOCUS_31360 57931 58413 CDS product type VI secretion system tube protein Hcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086373.1 protein_id gnl|my_center|LOCUS_31360 59008 58394 gene locus_tag LOCUS_31370 59008 58394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 60308 59265 gene locus_tag LOCUS_31380 60308 59265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 60471 63608 gene locus_tag LOCUS_31390 60471 63608 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189742338.1 protein_id gnl|my_center|LOCUS_31390 64818 63709 gene locus_tag LOCUS_31400 64818 63709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 65606 64815 gene locus_tag LOCUS_31410 65606 64815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 68150 65772 gene locus_tag LOCUS_31420 68150 65772 CDS product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858944.1 protein_id gnl|my_center|LOCUS_31420 68340 68642 gene locus_tag LOCUS_31430 68340 68642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 70297 68639 gene locus_tag LOCUS_31440 70297 68639 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764923.1 protein_id gnl|my_center|LOCUS_31440 70943 70356 gene locus_tag LOCUS_31450 70943 70356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 71775 70882 gene locus_tag LOCUS_31460 71775 70882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 72281 71841 gene locus_tag LOCUS_31470 72281 71841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 72840 72265 gene locus_tag LOCUS_31480 72840 72265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 73392 72937 gene locus_tag LOCUS_31490 73392 72937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 73515 74288 gene locus_tag LOCUS_31500 73515 74288 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147137887.1 protein_id gnl|my_center|LOCUS_31500 74285 74614 gene locus_tag LOCUS_31510 74285 74614 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706244.1 protein_id gnl|my_center|LOCUS_31510 74637 75476 gene locus_tag LOCUS_31520 74637 75476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 76700 75477 gene locus_tag LOCUS_31530 76700 75477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 77653 76754 gene locus_tag LOCUS_31540 77653 76754 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106518184.1 protein_id gnl|my_center|LOCUS_31540 77833 79335 gene locus_tag LOCUS_31550 77833 79335 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899906.1 protein_id gnl|my_center|LOCUS_31550 79586 79338 gene locus_tag LOCUS_31560 79586 79338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 79936 79628 gene locus_tag LOCUS_31570 79936 79628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 79986 80555 gene locus_tag LOCUS_31580 79986 80555 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194943.1 protein_id gnl|my_center|LOCUS_31580 81105 80626 gene locus_tag LOCUS_31590 81105 80626 CDS product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194406.1 protein_id gnl|my_center|LOCUS_31590 82082 81126 gene locus_tag LOCUS_31600 82082 81126 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522039.1 protein_id gnl|my_center|LOCUS_31600 82908 82120 gene locus_tag LOCUS_31610 82908 82120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 83839 82946 gene locus_tag LOCUS_31620 gene prmA 83839 82946 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814950.1 protein_id gnl|my_center|LOCUS_31620 85185 83836 gene locus_tag LOCUS_31630 gene accC 85185 83836 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814951.1 protein_id gnl|my_center|LOCUS_31630 85669 85202 gene locus_tag LOCUS_31640 gene accB 85669 85202 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194067.1 protein_id gnl|my_center|LOCUS_31640 86346 85849 gene locus_tag LOCUS_31650 86346 85849 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194069.1 protein_id gnl|my_center|LOCUS_31650 86945 86343 gene locus_tag LOCUS_31660 86945 86343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 87008 88399 gene locus_tag LOCUS_31670 gene mpl 87008 88399 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527766.1 protein_id gnl|my_center|LOCUS_31670 88396 89040 gene locus_tag LOCUS_31680 88396 89040 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814956.1 protein_id gnl|my_center|LOCUS_31680 89148 89600 gene locus_tag LOCUS_31690 89148 89600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 89609 91624 gene locus_tag LOCUS_31700 89609 91624 CDS product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014486102.1 protein_id gnl|my_center|LOCUS_31700 91621 92454 gene locus_tag LOCUS_31710 91621 92454 CDS product TonB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931246.1 protein_id gnl|my_center|LOCUS_31710 92469 93368 gene locus_tag LOCUS_31720 gene aroE 92469 93368 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194401.1 protein_id gnl|my_center|LOCUS_31720 93365 94114 gene locus_tag LOCUS_31730 gene mtgA 93365 94114 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814960.1 protein_id gnl|my_center|LOCUS_31730 94681 97911 gene locus_tag LOCUS_31740 94681 97911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 >Feature sequence14 1 126 gene locus_tag LOCUS_31750 1 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 368 1234 gene locus_tag LOCUS_31760 368 1234 CDS product flagellin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268449.1 protein_id gnl|my_center|LOCUS_31760 1509 1754 gene locus_tag LOCUS_31770 1509 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 1777 3426 gene locus_tag LOCUS_31780 gene fliD 1777 3426 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211150.1 protein_id gnl|my_center|LOCUS_31780 3525 3917 gene locus_tag LOCUS_31790 gene fliS 3525 3917 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211149.1 protein_id gnl|my_center|LOCUS_31790 3944 4291 gene locus_tag LOCUS_31800 3944 4291 CDS product flagellar protein FliT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197170.1 protein_id gnl|my_center|LOCUS_31800 4322 5578 gene locus_tag LOCUS_31810 4322 5578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 5568 5855 gene locus_tag LOCUS_31820 5568 5855 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811829.1 protein_id gnl|my_center|LOCUS_31820 5852 6607 gene locus_tag LOCUS_31830 5852 6607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 8161 6623 gene locus_tag LOCUS_31840 8161 6623 CDS product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853666.1 protein_id gnl|my_center|LOCUS_31840 8567 8244 gene locus_tag LOCUS_31850 8567 8244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 8792 10507 gene locus_tag LOCUS_31860 gene fliF 8792 10507 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523066.1 protein_id gnl|my_center|LOCUS_31860 10544 11545 gene locus_tag LOCUS_31870 gene fliG 10544 11545 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197167.1 protein_id gnl|my_center|LOCUS_31870 11532 12269 gene locus_tag LOCUS_31880 gene fliH 11532 12269 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930338.1 protein_id gnl|my_center|LOCUS_31880 12270 13676 gene locus_tag LOCUS_31890 gene fliI 12270 13676 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197164.1 protein_id gnl|my_center|LOCUS_31890 13692 14141 gene locus_tag LOCUS_31900 gene fliJ 13692 14141 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811846.1 protein_id gnl|my_center|LOCUS_31900 14138 15634 gene locus_tag LOCUS_31910 14138 15634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 15761 16279 gene locus_tag LOCUS_31920 15761 16279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 16296 17342 gene locus_tag LOCUS_31930 gene fliM 16296 17342 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196784.1 protein_id gnl|my_center|LOCUS_31930 17365 17814 gene locus_tag LOCUS_31940 17365 17814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 17837 18346 gene locus_tag LOCUS_31950 17837 18346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 18343 19113 gene locus_tag LOCUS_31960 gene fliP 18343 19113 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160406.1 protein_id gnl|my_center|LOCUS_31960 19149 19418 gene locus_tag LOCUS_31970 gene fliQ 19149 19418 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160414.1 protein_id gnl|my_center|LOCUS_31970 19421 20185 gene locus_tag LOCUS_31980 gene fliR 19421 20185 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201278.1 protein_id gnl|my_center|LOCUS_31980 20638 20186 gene locus_tag LOCUS_31990 20638 20186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 22674 20623 gene locus_tag LOCUS_32000 22674 20623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 24226 22817 gene locus_tag LOCUS_32010 24226 22817 CDS product sodium/proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867156.1 protein_id gnl|my_center|LOCUS_32010 25142 24228 gene locus_tag LOCUS_32020 gene thpD 25142 24228 CDS product ectoine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063968.1 protein_id gnl|my_center|LOCUS_32020 25553 25164 gene locus_tag LOCUS_32030 25553 25164 CDS product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423821.1 protein_id gnl|my_center|LOCUS_32030 26884 25550 gene locus_tag LOCUS_32040 gene ectB 26884 25550 CDS product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263924.1 protein_id gnl|my_center|LOCUS_32040 27408 26881 gene locus_tag LOCUS_32050 gene ectA 27408 26881 CDS product diaminobutyrate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640101.1 protein_id gnl|my_center|LOCUS_32050 27703 28185 gene locus_tag LOCUS_32060 27703 28185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 28280 28507 gene locus_tag LOCUS_32070 28280 28507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 29567 28518 gene locus_tag LOCUS_32080 29567 28518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 30177 29656 gene locus_tag LOCUS_32090 30177 29656 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381223.1 protein_id gnl|my_center|LOCUS_32090 32390 30192 gene locus_tag LOCUS_32100 32390 30192 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704962.1 protein_id gnl|my_center|LOCUS_32100 34519 32411 gene locus_tag LOCUS_32110 34519 32411 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704965.1 protein_id gnl|my_center|LOCUS_32110 34867 34523 gene locus_tag LOCUS_32120 34867 34523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 35252 34887 gene locus_tag LOCUS_32130 35252 34887 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704967.1 protein_id gnl|my_center|LOCUS_32130 36470 35274 gene locus_tag LOCUS_32140 36470 35274 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704968.1 protein_id gnl|my_center|LOCUS_32140 36642 36454 gene locus_tag LOCUS_32150 36642 36454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 37160 36867 gene locus_tag LOCUS_32160 37160 36867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 38168 37182 gene locus_tag LOCUS_32170 38168 37182 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091085.1 protein_id gnl|my_center|LOCUS_32170 38999 38316 gene locus_tag LOCUS_32180 38999 38316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 40332 39034 gene locus_tag LOCUS_32190 40332 39034 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113046.1 protein_id gnl|my_center|LOCUS_32190 41012 40329 gene locus_tag LOCUS_32200 41012 40329 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269051.1 protein_id gnl|my_center|LOCUS_32200 41602 41009 gene locus_tag LOCUS_32210 41602 41009 CDS product DUF2796 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261131.1 protein_id gnl|my_center|LOCUS_32210 42496 41681 gene locus_tag LOCUS_32220 42496 41681 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004467023.1 protein_id gnl|my_center|LOCUS_32220 45579 42502 gene locus_tag LOCUS_32230 45579 42502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 45735 46082 gene locus_tag LOCUS_32240 45735 46082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 46093 47367 gene locus_tag LOCUS_32250 46093 47367 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069810832.1 protein_id gnl|my_center|LOCUS_32250 47582 48352 gene locus_tag LOCUS_32260 47582 48352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 48740 48366 gene locus_tag LOCUS_32270 48740 48366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 49860 48940 gene locus_tag LOCUS_32280 49860 48940 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192762.1 protein_id gnl|my_center|LOCUS_32280 50327 49857 gene locus_tag LOCUS_32290 50327 49857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 50481 50693 gene locus_tag LOCUS_32300 50481 50693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 50697 51476 gene locus_tag LOCUS_32310 50697 51476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 51591 54026 gene locus_tag LOCUS_32320 51591 54026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 54037 55788 gene locus_tag LOCUS_32330 54037 55788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 55956 56180 gene locus_tag LOCUS_32340 55956 56180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 56374 57792 gene locus_tag LOCUS_32350 56374 57792 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539365.1 protein_id gnl|my_center|LOCUS_32350 57863 58987 gene locus_tag LOCUS_32360 57863 58987 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268679.1 protein_id gnl|my_center|LOCUS_32360 60270 59497 gene locus_tag LOCUS_32370 60270 59497 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206620.1 protein_id gnl|my_center|LOCUS_32370 60408 60839 gene locus_tag LOCUS_32380 gene aroQ 60408 60839 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194379.1 protein_id gnl|my_center|LOCUS_32380 60951 62363 gene locus_tag LOCUS_32390 60951 62363 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615477.1 protein_id gnl|my_center|LOCUS_32390 62360 63559 gene locus_tag LOCUS_32400 62360 63559 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 protein_id gnl|my_center|LOCUS_32400 63556 66696 gene locus_tag LOCUS_32410 63556 66696 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123110.1 protein_id gnl|my_center|LOCUS_32410 66693 67583 gene locus_tag LOCUS_32420 66693 67583 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791454.1 protein_id gnl|my_center|LOCUS_32420 68411 67587 gene locus_tag LOCUS_32430 68411 67587 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970367.1 protein_id gnl|my_center|LOCUS_32430 69187 68426 gene locus_tag LOCUS_32440 69187 68426 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970366.1 protein_id gnl|my_center|LOCUS_32440 69893 69180 gene locus_tag LOCUS_32450 69893 69180 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162304053.1 protein_id gnl|my_center|LOCUS_32450