COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence1 source 1..4045538 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..1341 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242674.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 gene dnaA CDS 1529..2665 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242509.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 gene dnaN CDS 2797..3012 product ribosome maturation protein RlbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226810.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 gene rlbA CDS 3028..4140 product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243515.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 gene recF CDS 4163..4408 product extracellular matrix regulator RemB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219266.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 gene remB CDS 4457..6379 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226808.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 gene gyrB CDS 6596..9061 product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244540.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 gene gyrA CDS 9036..9203 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00080 rRNA 9346..10892 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 tRNA 10994..11070 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 tRNA 11082..11157 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 rRNA 11241..14164 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 rRNA 14304..14414 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 CDS complement(14457..15443) product YaaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247147.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS 15525..16991 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226803.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 gene guaB CDS 17144..18475 product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966224.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 gene dacA CDS 18672..19556 product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247145.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 gene pdxS CDS 19578..20168 product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226797.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 gene pdxT CDS 20489..21766 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247131.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 gene serS tRNA 21901..21993 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS complement(22105..22758) product deoxyadenosine/deoxycytidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226792.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 gene dck CDS complement(22755..23378) product deoxyguanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247138.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 gene dgk CDS complement(23477..24760) product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247133.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS complement(24830..25375) product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247139.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS 25461..25946 product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247140.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 gene tadA CDS 26422..28113 product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247135.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 gene dnaX CDS 28137..28460 product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225427.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS 28475..29071 product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225425.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 gene recR CDS 29089..29313 product YaaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242387.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS 29380..29643 product sigma-K factor-processing regulator BofA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225421.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 gene bofA rRNA 29958..31504 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00040 tRNA 31606..31682 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 tRNA 31694..31769 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 rRNA 31853..34776 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00050 rRNA 34916..35026 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00060 CDS 35207..35401 product anti-sigma-G factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243294.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 gene csfB CDS 35534..36148 product 5-bromo-4-chloroindolyl phosphate hydrolysis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242630.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS 36167..37324 product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226779.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS 37406..38848 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243352.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS 38845..39483 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243137.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 gene tmk CDS 39558..39887 product cyclic di-AMP receptor DarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242755.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 gene darA CDS 39900..40340 product YaaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966249.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS 40352..41341 product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244417.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 gene holB CDS 41344..42171 product competence/sporulation regulator complex protein RicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243571.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 gene ricT CDS 42186..42545 product replication initiation-control protein YabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218308.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 gene yabA CDS 42604..43347 product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244526.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS 43334..43633 product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242983.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS 43608..44486 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243457.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 gene rsmI CDS complement(44535..44819) product transition state genes transcriptional regulator AbrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226760.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 gene abrB CDS 45320..47314 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226758.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 gene metG CDS 47393..48160 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226756.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS 48406..49629 product ubiquitin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226754.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS 49774..50334 product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226752.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 gene rnmV CDS 50327..51205 product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226751.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 gene rsmA CDS 51367..52239 product sporulation-specific protease PrtG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243478.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 gene prtG CDS 52450..52710 product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218330.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS 52869..53054 product small, acid-soluble spore protein, alpha/beta type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218333.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS 53193..54071 product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226742.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 gene ispE CDS 54127..54984 product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218342.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 gene purR CDS 54981..55358 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226738.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS 55554..55847 product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966269.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 gene spoVG CDS 56040..57410 product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226732.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 gene glmU CDS 57433..58386 product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218353.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS 58471..59088 product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243443.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS 59195..59761 product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226727.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 gene pth CDS 59821..60051 product anti-sigma-F factor Fin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243417.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 gene fin CDS 60121..63654 product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243453.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 gene mfd CDS 63790..64326 product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218365.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 gene spoVT CDS 64508..66106 product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243709.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS 66096..67565 product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226718.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 gene mazG CDS 67568..67828 product S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226716.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS 67907..68209 product sporulation protein YabP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226714.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 gene yabP CDS 68206..68841 product spore cortex biosynthesis protein YabQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243260.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 gene yabQ CDS 68859..69236 product cell division protein DivIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243211.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 gene divIC CDS 69317..69703 product S1 domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218379.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 tRNA 69872..69948 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA 69957..70032 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS 70229..72712 product stage II sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243026.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 gene spoIIE CDS 72797..73534 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243782.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS 73500..74516 product serine/threonine protein kinase PrkT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966278.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 gene prkT CDS 74620..76038 product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243704.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 gene tilS CDS 76035..76577 product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226700.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 gene hpt CDS 76675..78588 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243881.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 gene ftsH CDS 78781..79557 product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886388.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS 79569..80444 product redox-regulated molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226695.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 gene hslO CDS 80494..81387 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243824.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS 81463..82389 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244491.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 gene cysK CDS 82554..83963 product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242468.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS 83977..84561 product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243797.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 gene pabA CDS 84558..85442 product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244544.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 gene pabC CDS 85424..86281 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242672.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 gene folP CDS 86274..86636 product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242949.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 gene folB CDS 86633..87136 product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242690.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 gene folK CDS 87088..87306 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226678.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS 87320..88321 product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243741.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 gene dusB CDS 88413..89912 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242743.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 gene lysS rRNA 90292..91838 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00070 rRNA 92010..94933 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00080 rRNA 94993..95103 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00090 tRNA 95129..95204 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA 95209..95284 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 tRNA 95322..95397 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 tRNA 95404..95486 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 tRNA 95527..95601 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 tRNA 95616..95701 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 tRNA 95711..95787 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 tRNA 95814..95890 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 tRNA 95898..95973 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 rRNA 96215..97761 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00100 rRNA 97933..100856 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00110 rRNA 100916..101026 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00120 CDS 101275..101739 product transcriptional regulator CtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225724.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 gene ctsR CDS 101753..102310 product protein-arginine kinase activator protein McsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966297.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 gene mcsA CDS 102310..103401 product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235007.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS 103398..105830 product ATP-dependent protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235011.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 gene clpC CDS 106018..107298 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399687.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 gene radA CDS 107302..108384 product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225736.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 gene disA CDS 108498..109598 product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235014.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS 109613..110311 product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235019.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 gene ispD CDS 110304..110780 product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225745.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 gene ispF CDS 110871..112322 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399675.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 gene gltX CDS 112626..113279 product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225749.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 gene cysE CDS 113276..114676 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399682.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 gene cysS CDS 114680..115111 product mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399685.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS 115095..115844 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399684.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 gene rlmB CDS 115851..116363 product ribosome-dependent mRNA decay endonuclease Rae1/YacP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235032.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 gene rae1 CDS 116426..117082 product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966312.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 gene sigH CDS 117358..117537 product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399676.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 gene secE CDS 117717..118250 product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225764.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 gene nusG CDS 118418..118843 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156430.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 gene rplK CDS 118938..119636 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235040.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 gene rplA CDS 119889..120389 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235042.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 gene rplJ CDS 120433..120804 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156436.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 gene rplL CDS 120894..121499 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235045.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS 121747..125328 product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966326.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 gene rpoB CDS 125390..128989 product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399688.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 gene rpoC CDS 129165..129413 product 50S ribosomal protein L7ae-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225778.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS 129527..129943 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225781.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 gene rpsL CDS 129985..130455 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225784.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 gene rpsG CDS 130508..132586 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235056.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 gene fusA CDS 132706..133896 product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235058.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 gene tuf CDS 133997..134953 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235060.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS 135191..135499 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156464.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 gene rpsJ CDS 135539..136168 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399671.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 gene rplC CDS 136196..136819 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399658.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 gene rplD CDS 136819..137106 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156467.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 gene rplW CDS 137138..137971 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225795.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 gene rplB CDS 138029..138307 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156472.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 gene rpsS CDS 138324..138665 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156475.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 gene rplV CDS 138669..139325 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235068.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 gene rpsC CDS 139327..139761 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225801.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 gene rplP CDS 139751..139951 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156482.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 gene rpmC CDS 139974..140237 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225804.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 gene rpsQ CDS 140278..140646 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225805.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 gene rplN CDS 140683..140994 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156486.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 gene rplX CDS 141021..141560 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225809.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 gene rplE CDS 141583..141768 product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156488.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 gene rpsN CDS 141800..142198 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003241998.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 gene rpsH CDS 142213..142767 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399690.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 gene rplF CDS 142800..143162 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225816.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 gene rplR CDS 143181..143687 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003328273.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 gene rpsE CDS 143701..143880 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156497.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 gene rpmD CDS 143911..144351 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225819.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 gene rplO CDS 144353..145648 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399662.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 gene secY CDS 145703..146356 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399686.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS 146353..147099 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225828.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 gene map CDS 147410..147628 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156508.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 gene infA CDS 147798..148163 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235095.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 gene rpsM CDS 148184..148579 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966385.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 gene rpsK CDS 148756..149700 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225835.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS 149778..150140 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225836.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 gene rplQ CDS 150271..151116 product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399689.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS 151092..151961 product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886389.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS 151958..152755 product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399656.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS 152765..153508 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399657.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 gene truA CDS 153670..154107 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003241966.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 gene rplM CDS 154128..154520 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399691.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 gene rpsI CDS complement(154626..154760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS 155004..155771 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399665.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS 155968..156411 product YbaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235118.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS 156471..157184 product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399672.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 gene cwlD CDS 157280..158338 product iron-sulfur carrier protein/transcriptional regulator SalA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235124.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 gene salA CDS complement(158373..158930) product spore germination lipoprotein GerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235126.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 gene gerD CDS 159040..159636 product KinB-signaling pathway activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399693.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 gene kbaA CDS complement(159637..160401) product polysaccharide deacetylase family sporulation protein PdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235130.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 gene pdaB rRNA 160757..162303 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00130 rRNA 162475..165398 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00140 rRNA 165457..165567 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00150 tRNA 165615..165689 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 tRNA 165692..165764 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA 165826..165900 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 tRNA 165933..166009 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA 166036..166112 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 tRNA 166120..166195 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 rRNA 166370..167916 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00160 rRNA 168088..171011 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00170 rRNA 171070..171180 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00180 rRNA 171371..172917 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00190 rRNA 173089..176012 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00200 rRNA 176072..176182 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00210 CDS 176320..176457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS 176417..176827 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS 177099..178535 product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234986.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS 178643..179602 product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886390.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS complement(179619..180368) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234982.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS complement(180365..181375) product iron ABC transporter permease FeuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234980.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 gene feuC CDS complement(181368..182372) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234979.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS complement(182391..183344) product iron ABC transporter substrate-binding protein FeuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234978.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 gene feuA CDS complement(183435..185024) product bacillibactin transport transcriptional regulator Btr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234977.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 gene btr CDS complement(185215..186459) product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234976.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS complement(186473..188401) product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234975.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 gene nagZ CDS complement(188429..189754) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234970.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 gene amiE CDS complement(189810..191177) product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234968.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS complement(191203..192054) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234966.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS complement(192068..192985) product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246253.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 gene murQ CDS complement(193095..193577) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234962.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS complement(193590..194045) product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234960.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 tRNA 194226..194300 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 tRNA 194304..194379 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 tRNA 194384..194457 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 tRNA 194478..194562 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 tRNA 194569..194643 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS 194870..195433 product RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234958.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 gene sigW CDS 195447..196073 product anti-sigma-W factor RsiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234951.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 gene rsiW CDS 196240..197061 product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223651.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 gene cdaA CDS 197054..198508 product CdaA regulatory protein CdaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234947.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 gene cdaR CDS 198527..199873 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234946.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 gene glmM CDS 200305..202107 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234943.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 gene glmS CDS 202882..204399 product NADH dehydrogenase subunit 5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234919.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS 204411..207032 product YbcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234917.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS 207105..207623 product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246329.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS 207704..207994 product DUF6407 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234913.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS 208050..208424 product DUF2294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246482.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS 209113..210090 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234896.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS 210092..210763 product two-component system response regulator YbdJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234895.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 gene ybdJ CDS 210844..211752 product two-component system sensor histidine kinase YbdK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886392.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 gene ybdK CDS complement(211978..212868) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614448.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS 213023..214324 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868155.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 gene thrC CDS 214445..215587 product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238677.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS 216559..216795 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS 216831..217334 product sulfopyruvate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496437.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 gene comD CDS 217346..217906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS 217903..218916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS 218913..219803 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS 219826..220914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS 220950..221348 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS 221390..222529 product serine-pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081619.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS 222522..222779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS 222795..223442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS 223459..224700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS 224799..225035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966423.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS complement(225020..225790) product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234892.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS complement(225914..226768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246309.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS 226904..228088 product DUF4885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246341.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS 228405..229793 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246273.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS 229906..230154 product sigma-G-dependent sporulation-specific acid-soluble spore protein CsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234887.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 gene csgA CDS 230169..230360 product DUF5370 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234886.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS complement(230390..231193) product class D beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246349.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 gene blaOXA CDS 231367..232620 product fatty-acid peroxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246284.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 gene cypC CDS complement(232661..232921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234883.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS 233294..234922 product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456278.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS complement(234948..235838) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246382.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS complement(235937..237271) product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246460.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 gene glpT CDS 237560..237814 product YbeF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234879.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS 237906..238823 product helix-turn-helix domain-containing GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246419.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS 238775..240073 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246425.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS complement(240106..240531) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010331443.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS complement(240593..241504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246251.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS complement(241665..242591) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234873.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS complement(242588..243415) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246321.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS 243646..244800 product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246432.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 gene purT CDS 244942..245880 product extracellular metalloprotease Mpr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246370.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 gene mpr CDS 245843..246241 product YbfJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246434.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS 246414..247298 product enantioselective carboxylesterase CesB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246261.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 gene cesB CDS 247497..248030 product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966430.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 gene pssA CDS 248021..248509 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234861.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS 248502..249311 product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246344.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS 249348..249626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246354.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS 249730..251070 product erythromycin esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246404.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS 251323..252291 product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246287.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS complement(252327..253571) product glutamate-aspartate/proton symporter GltP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234847.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 gene gltP CDS complement(253714..254754) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02340 note possible pseudo, frameshifted CDS complement(254778..255608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02350 note possible pseudo, frameshifted CDS complement(255629..256378) product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246480.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 gene nagB CDS 256597..257304 product transcriptional regulator GamR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234841.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 gene gamR CDS 257339..257614 product DUF1648 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234840.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS 257695..258897 product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246499.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS complement(258933..260279) product S-methylmethionine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966441.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 gene mmuP CDS complement(260466..261413) product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246467.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 gene mmuM CDS complement(261538..262974) product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246395.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS complement(262996..263979) product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234829.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS 264223..265512 product two-component system sensor histidine kinase GlnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886394.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 gene glnK CDS 265523..266467 product glutamine utilization two-component system response regulator GlnL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234824.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 gene glnL CDS 266534..266680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS 266696..267622 product 5-dehydro-4-deoxyglucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246372.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 gene kdgD CDS 267652..269118 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246263.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS 269203..270570 product glucarate transporter GudP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234818.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 gene gudP CDS 270607..271974 product glucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234816.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 gene gudD CDS 272044..272745 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246338.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS 272838..274370 product galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246362.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 gene garD CDS 274647..275567 product macrolide 2'-phosphotransferase MphK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246254.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 gene mphK CDS 276360..277040 product two-component system response regulator YcbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966453.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 gene ycbL CDS 277042..277977 product two-component system sensor histidine kinase YcbM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246497.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 gene ycbM CDS 278072..278995 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246292.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS 279011..279700 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886395.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS complement(279754..280140) product YndM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246313.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS 280255..281490 product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141968.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS 281573..282001 product cell wall hydrolase CwlJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246500.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 gene cwlJ CDS 282107..282838 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246379.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS 283113..284864 product alkaline phosphatase PhoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969242.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 gene phoD CDS 284878..285090 product sec-independent protein translocase protein TatAD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223835.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 gene tatAD CDS 285152..285877 product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246495.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 gene tatC CDS complement(285874..286521) product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246307.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 gene pcp CDS 286601..287713 product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246392.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS complement(287756..289189) product lincomycin efflux MFS transporter Lmr(B) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886396.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 gene lmr(B) CDS complement(289239..289805) product transcriptional regulator LmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246449.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 gene lmrA CDS 290599..291237 product lipase LipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246250.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 gene lipA CDS complement(291275..291658) product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966469.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS 291893..292969 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246276.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS complement(293009..293221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS 293236..293487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS 293623..294555 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246289.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS complement(294595..295659) product DUF4352 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234750.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS 296006..297403 product DUF4901 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246352.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS 297589..298494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS 298574..298906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02780 note possible pseudo, frameshifted CDS 299206..299724 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS 299851..300240 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS complement(300247..300750) product peptidoglycan L-alanyl-D-glutamate endopeptidase CwlK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966473.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 gene cwlK CDS 300871..301992 product response regulator aspartate phosphatase RapJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246478.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 gene rapJ CDS 302102..302878 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246415.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS 302903..304594 product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234736.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS 304777..305745 product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234733.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS 305800..306495 product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234730.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 gene znuC CDS 306453..307295 product zinc ABC transporter permease ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246340.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 gene znuB CDS complement(307333..308274) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246351.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS 308611..309210 product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246350.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS 309232..309813 product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234723.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS 309848..310426 product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003241242.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS 310478..311251 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246458.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS 311335..312948 product YceG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246317.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS 312964..314055 product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234715.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS 314178..315380 product niacin permease NiaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246397.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 gene niaP CDS complement(315654..315884) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886398.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS 316181..317434 product glycine/proline betaine ABC transporter ATP-binding protein OpuAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246301.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 gene opuAA CDS 317436..318284 product glycine/proline betaine ABC transporter permease subunit OpuAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234703.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 gene opuAB CDS 318284..319165 product glycine/proline betaine ABC transporter substrate-binding protein OpuAC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246462.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 gene opuAC CDS complement(319203..320354) product M20 peptidase aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246319.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS 320504..321937 product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966488.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS 322053..322541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246445.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 note possible pseudo, internal stop codon CDS 322794..324773 product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234692.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 gene amyE CDS 324947..325912 product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234685.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS 325944..327569 product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246465.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS complement(327609..329150) product multidrug efflux MFS transporter Bmr3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246377.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 gene bmr3 CDS 329263..329727 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246360.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS 329802..330431 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246469.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 330501..331262 product YqcI/YcgG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246374.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS complement(331264..332610) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246486.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS 332734..333330 product DUF1989 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246345.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS 333463..334281 product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246440.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 gene nadE CDS complement(334555..335148) product tunicamycin resistance ATP-binding TmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246258.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 gene tmrB CDS 335455..336015 product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246473.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS complement(336045..336806) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246488.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS 336923..337897 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246430.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS 337969..338925 product cephalosporin C deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246400.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 gene cah CDS 339009..339791 product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246492.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS 339973..340890 product proline dehydrogenase PutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246421.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 gene putB CDS 340907..342454 product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234655.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 gene pruA CDS 342651..344000 product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886399.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 gene putP CDS 344153..345388 product proline utilization transcriptional regulator PutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234651.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 gene putR CDS complement(345425..346282) product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234649.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS complement(346287..347189) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886400.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS complement(347271..348125) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246384.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS 348288..349298 product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234643.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 gene ffoR CDS complement(349329..350774) product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234641.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 gene cobA CDS complement(350840..351160) product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246252.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 gene nirD CDS complement(351193..353610) product NADPH-nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234637.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 gene nasD CDS complement(353731..355863) product assimilatory nitrate reductase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246484.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 gene nasC CDS complement(355860..358184) product assimilatory nitrate reductase electron transfer subunit NasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246389.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 gene nasB CDS 358365..359570 product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246358.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS 359686..360600 product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246378.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 gene folE2 CDS 360629..360829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS 360913..362085 product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258647.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS 362122..363315 product zinc metallochaperone ZinU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234625.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 gene zinU CDS complement(363364..364044) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234624.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS complement(364054..364917) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966510.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS 365165..365335 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS 365332..365787 product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246356.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS 365870..366202 product YckD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246247.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS 366337..366759 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047763.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS 366747..367088 product DUF3147 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986730.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS 367108..367836 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567993.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS 367909..369342 product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246242.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 gene bglC CDS complement(369379..369777) product DNA-entry nuclease inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246342.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 gene nin CDS complement(369800..370237) product DNA-entry nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246436.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 gene nucA CDS complement(370423..372144) product methyl-accepting chemotaxis protein TlpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246498.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 gene tlpC CDS complement(372260..372817) product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246343.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 gene hxlB CDS complement(372822..373454) product 3-hexulose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246452.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 gene hxlA CDS 373685..374047 product transcriptional activator HxlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246265.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 gene hxlR CDS 374625..385388 product surfactin non-ribosomal peptide synthetase SrfAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886402.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 gene srfAA CDS 385401..396152 product surfactin non-ribosomal peptide synthetase SrfAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886403.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 gene srfAB CDS 396189..400016 product surfactin non-ribosomal peptide synthetase SrfAC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234570.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 gene srfAC CDS 400167..400772 product surfactin biosynthesis thioesterase SrfAD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234568.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 gene srfAD CDS 400871..402097 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246562.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS complement(402723..403661) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246664.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS 403782..405116 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246711.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS complement(405111..405785) product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002182762.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS complement(405890..406537) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246558.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS complement(406659..407402) product cystine ABC transporter ATP-binding protein TcyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246629.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 gene tcyC CDS complement(407416..408120) product cystine ABC transporter permease TcyB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234541.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 gene tcyB CDS complement(408107..408913) product cystine ABC transporter substrate-binding lipoprotein TcyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246699.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 gene tcyA CDS complement(409029..409901) product transcriptional regulator BsdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246552.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 gene bsdA CDS 410027..410605 product non-oxidative hydroxyarylic acid decarboxylases subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966530.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS 410608..412029 product phenolic acid decarboxylase BsdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246683.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 gene bsdC CDS 412046..412273 product phenolic acid decarboxylase subunit BsdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886405.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 gene bsdD CDS 412288..412734 product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969257.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS 412802..413647 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246662.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS complement(413685..415163) product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246610.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS 415443..417197 product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246729.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS complement(417213..417434) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246546.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS 417560..419194 product spore germination protein GerKA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246515.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 gene gerKA CDS 419184..420407 product spore germination protein GerKC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246578.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 gene gerKC CDS 420432..421556 product spore germination protein GerKB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234509.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 gene gerKB CDS complement(421659..422339) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234507.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS complement(422355..423809) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234506.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS 424022..424705 product two-component system response regulator YclJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246532.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 gene yclJ CDS 424692..426113 product two-component system sensor histidine kinase YclK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969263.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 gene yclK CDS 426254..427423 product response regulator aspartate phosphatase RapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246686.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 gene rapC CDS 427407..427529 product phosphatase RapC inhibitor PhrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003224994.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 gene phrC CDS complement(427884..429248) product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966541.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS 429633..430583 product petrobactin ABC transporter permease YclN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234491.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 gene yclN CDS 430576..431523 product petrobactin ABC transporter permease YclO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246705.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 gene yclO CDS 431517..432275 product petrobactin ABC transporter ATP-binding protein YclP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234487.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 gene yclP CDS 432297..433253 product petrobactin ABC transporter substrate-binding protein YclQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246619.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 gene yclQ CDS complement(433300..434724) product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246604.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS complement(434744..435622) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246592.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS complement(435785..436534) product oxygen-insensitive NADPH nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234479.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 gene nfsA CDS complement(436551..436838) product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234477.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS 436979..437293 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234476.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS complement(437295..438734) product transcriptional regulator GabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246571.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 gene gabR CDS 438840..440150 product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234459.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 gene gabT CDS 440219..441607 product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246615.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 gene gabD CDS 441733..442596 product glucose uptake protein GlcU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234455.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 gene glcU CDS 442615..443400 product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246720.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 gene gdh CDS complement(443443..444063) product DUF1775 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246657.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS complement(444077..445705) product copper transporter YcnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246637.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 gene ycnJ CDS complement(445737..446309) product copper uptake transcriptional regulator YcnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246724.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 gene ycnK CDS 446474..446827 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246726.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS 447000..448436 product PTS mannitol transporter subunit IICB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886406.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS 448461..448892 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246714.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS 448894..450015 product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246548.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS 450112..451170 product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234436.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS 451189..451431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS 451442..451867 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234434.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 gene lepB CDS complement(451953..452561) product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246621.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS 452646..453038 product 3-hydroxyacyl-ACP dehydratase FabZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246580.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS complement(453073..453237) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234425.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS 453370..454119 product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234424.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS 454324..455097 product 5-oxoprolinase subunit PpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234423.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 gene pxpA CDS 455112..456326 product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234422.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS 456332..457123 product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886407.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS 457169..457891 product 5-oxoprolinase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234420.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 gene pxpB CDS 457888..458901 product 5-oxoprolinase subunit PxpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234419.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 gene pxpC CDS 458917..459669 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246517.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS 459733..460374 product spore germination lipase LipC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234415.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 gene lipC CDS 460548..460793 product YczI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003240256.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS complement(460799..461086) product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234413.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS 461238..463244 product penicillin-binding protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246590.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 gene pbpC CDS 463345..464247 product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246655.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS 464436..466520 product mannitol operon transcriptional activator MtlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246695.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 gene mtlR CDS 466732..468243 product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246534.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS complement(468261..468857) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966584.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS 469008..469868 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246648.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS 469883..470386 product D-lyxose ketol-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234400.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 gene lyxE CDS 470475..471026 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246691.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS 471104..471526 product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234396.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS 472032..472841 product lipid II flippase Amj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234394.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 gene amj CDS complement(472886..473176) product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246602.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS 473362..473796 product transcriptional regulator LrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246585.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 gene lrpC CDS 473861..476047 product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246684.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS 476250..477338 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246551.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS 477319..478155 product cyclic-di-GMP receptor EpsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246541.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 gene epsK CDS 478145..479875 product DUF2334 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886408.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS 479868..481130 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246697.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS 481136..483232 product cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246598.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS 483719..485542 product potassium transporter KimA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246693.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 gene kimA CDS 485600..486049 product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246544.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 gene mutT CDS 486116..487840 product pyruvate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246569.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS complement(488071..488337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966591.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS complement(488441..489715) product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234364.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS complement(489946..490203) product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246519.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS complement(490281..490733) product DUF2188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246574.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS 490851..491669 product EcsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246628.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS 491796..492167 product glucose starvation-inducible protein GsiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246542.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 gene gsiB CDS 492389..492637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04470 note possible pseudo, internal stop codon, frameshifted CDS 492631..492990 product YdbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246730.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS complement(493027..493848) product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234352.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS complement(493934..494986) product C4-dicarboxylate TRAP transporter substrate-binding protein DctB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234350.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 gene dctB CDS 495056..496663 product two-component system sensor histidine kinase DctS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234348.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 gene dctS CDS 496653..497333 product two-component system response regulator DctR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234347.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 gene dctR CDS 497453..498718 product C4-dicarboxylate transporter DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246626.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 gene dctP CDS 498868..499920 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246523.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS 500173..501411 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814826.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS 501503..502429 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246573.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS 502422..503189 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886409.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS 503284..503619 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225151.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS 503749..504894 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234334.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS complement(504918..505064) product Fur-regulated basic protein FbpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886410.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 gene fbpB CDS complement(505051..505215) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS 505462..506334 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234329.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS complement(506349..506669) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234326.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS 506823..507908 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234325.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS 507983..509356 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246696.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS 509760..511244 product ATP-dependent RNA helicase CshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246685.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 gene cshA CDS 511416..511895 product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234318.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS 511885..513366 product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966602.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS complement(513363..513962) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246687.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS 514057..514422 product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234281.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 gene acpS CDS 514596..515603 product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234282.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS 515718..516887 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234284.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 gene alr CDS 517003..517284 product type II toxin-antitoxin system antitoxin EndoAI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225183.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 gene endB CDS 517289..517639 product type II toxin-antitoxin system endoribonuclease NdoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156187.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 gene ndoA CDS 517757..518581 product RsbT co-antagonist protein RsbRA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966610.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 gene rsbRA CDS 518586..518951 product RsbT antagonist protein RsbS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225190.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 gene rsbS CDS 518955..519356 product serine/threonine-protein kinase RsbT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246640.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 gene rsbT CDS 519368..520375 product phosphoserine phosphatase RsbU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234295.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 gene rsbU CDS 520437..520766 product anti-sigma factor antagonist RsbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234298.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 gene rsbV CDS 520763..521245 product anti-sigma B factor RsbW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234299.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 gene rsbW CDS 521211..521999 product RNA polymerase sigma factor SigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246715.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 gene sigB CDS 521999..522598 product phosphoserine phosphatase RsbX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246608.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 gene rsbX CDS 522705..524864 product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246556.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS 525091..525543 product SprT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246525.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 tRNA 525666..525740 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA 525745..525835 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 tRNA 525865..525936 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 tRNA 525948..526022 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 tRNA 526050..526125 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 tRNA 526137..526219 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 tRNA 526300..526383 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS 526659..526838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS 527268..527402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS 528002..528361 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930407.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 528485..529327 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395635.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS 529991..530971 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817250.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS 531119..531862 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266249.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS 532079..532786 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928484.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS 532764..533480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04920 note possible pseudo, frameshifted CDS 534142..534861 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087558.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS complement(535387..536415) product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171504.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS 537199..537402 product cold shock protein CspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234247.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 gene cspC CDS complement(538150..538626) product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886417.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS complement(539082..539975) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948436.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS 540593..541378 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS complement(541782..542654) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234236.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS 543167..543550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886419.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS 544138..544731 product YdeI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234230.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS complement(544947..545621) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243990.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS complement(546052..546273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS complement(546414..547175) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234254.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS 547433..547843 product transcriptional regulator LrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246601.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 gene lrpA CDS complement(547973..548611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS 548989..550380 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234223.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS 550778..551203 product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234221.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS complement(551263..551835) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234219.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS complement(551920..552177) product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243941.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS 552702..553574 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234217.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS complement(553955..554116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05120 note possible pseudo, internal stop codon, frameshifted CDS 554312..554659 product metal-responsive transcriptional regulator AseR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243257.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 gene aseR CDS 554672..555979 product arsenic transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243030.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS 555995..556414 product thioredoxin-dependent arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398596.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 556607..557407 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886420.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS complement(557561..557701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS complement(557801..558694) product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244236.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS 558828..560276 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244019.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS complement(560389..561012) product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243530.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS 561102..561782 product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244115.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS complement(561847..562290) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242768.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS complement(562379..562549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886421.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS complement(562552..562722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243880.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS 563053..564216 product two-component system sensor histidine kinase YdfH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886422.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 gene ydfH CDS 564209..564850 product two-component system response regulator YdfI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244318.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 gene ydfI CDS 564965..567136 product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243548.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS 567261..567581 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS 567957..568292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS 568484..569806 product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246136.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 gene brnQ CDS 569961..570407 product transcriptional regulator Rok inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232378.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 gene rok CDS complement(570872..571561) product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242513.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS complement(571652..572464) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244218.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS complement(572650..573543) product manganese transporter MneP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244477.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 gene mneP CDS 573998..574618 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244392.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS 574645..575583 product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234172.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS 575723..576112 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234169.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS 576297..576635 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244013.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS complement(576703..578088) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891874.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS 578235..578870 product protease synthase/sporulation negative transcriptional regulator PaiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244329.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 gene paiB CDS 579058..579426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS 579401..580039 product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537542.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS complement(580115..580357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05430 note possible pseudo, internal stop codon, frameshifted CDS complement(580545..580976) product spore coat protein CotP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234154.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 gene cotP CDS complement(580989..581231) product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234151.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS complement(581245..581517) product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243854.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS 581757..582356 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234149.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS 582353..582697 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966666.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS 582851..583324 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234145.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS complement(583335..583706) product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804825.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS 584016..585041 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104350.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS 585135..586139 product transcriptional regulator DegA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245813.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 gene degA CDS 586225..586545 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05530 note possible pseudo, frameshifted CDS 586506..587372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05540 note possible pseudo, internal stop codon, frameshifted CDS 587385..587570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05550 note possible pseudo, internal stop codon CDS 587586..588407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS 588657..589838 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503266.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS 589857..590417 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002054718.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS complement(590464..592092) product ABC-F type ribosomal protection protein VmlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234144.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 gene vmlR CDS complement(592424..593800) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234143.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS complement(593975..594493) product damage-inducible protein DinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234141.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 gene dinB CDS 594660..595118 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242874.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS 595115..597772 product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242658.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS complement(597860..598489) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234135.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS complement(598505..598939) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886424.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS complement(599084..599641) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071745902.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS 599760..600485 product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190726.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS 600482..600805 product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721948.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS 601001..602209 product Bcr/CflA family efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234132.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS complement(602245..602982) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234130.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 603231..603905 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234129.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS 604029..605291 product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234126.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 605450..606634 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234124.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 repeat_region 607173..607819 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggagcgacaggagctaccggggaagc CDS complement(608874..609581) product membrane lipoprotein lipid attachment site-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244238.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS complement(609647..611035) product alkaline phosphatase PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234119.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 gene phoB CDS complement(611510..611995) product YdhH/YoaO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234115.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS complement(612014..612433) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886425.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 note possible pseudo, frameshifted CDS 612574..613551 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234111.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS 613760..614326 product YdhK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242997.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS complement(614498..615664) product purine transporter PbuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234105.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 gene pbuE CDS 615996..616307 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242472.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS 616307..616639 product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243550.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS 616659..617987 product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244271.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 gene celB CDS 618005..619402 product 6-phospho-beta-glucosidase GmuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243625.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 gene gmuD CDS 619551..620264 product transcriptional regulator GmuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234096.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 gene gmuR CDS 620293..621192 product fructokinase GmuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234095.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 gene gmuE CDS 621189..622136 product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242491.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 gene manA CDS 622155..623243 product mannan endo-1,4-beta-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244107.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 gene gmuG CDS complement(623295..624149) product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000500360.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS 624261..624491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05900 tRNA 624482..624558 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 tRNA 624573..624646 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 rRNA 624747..626293 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00220 rRNA 626465..629388 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00230 rRNA 629447..629557 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00240 tRNA 629583..629659 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 tRNA 629721..629797 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 CDS 629978..630955 product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234080.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 gene thiL CDS 630970..631446 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234079.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 gene tsaE CDS 631427..632116 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234078.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 gene tsaB CDS 632126..632581 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243019.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 gene rimI CDS 632574..633614 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244138.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 gene tsaD CDS complement(633842..635770) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244150.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS 635896..636408 product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243499.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 gene moaC CDS 636405..637052 product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234073.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS 637074..637247 product sec-independent protein translocase protein TatAY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234072.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 gene tatAY CDS 637263..638018 product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886426.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 gene tatC CDS complement(638056..638247) product YdiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225680.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS complement(638244..638978) product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234069.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS 639216..639500 product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003155970.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 gene groES CDS 639547..641172 product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243151.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 gene groL CDS 641915..642910 product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577694.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS complement(642999..645488) product glucitol operon transcriptional regulator GutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234045.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 gene gutR CDS 645691..646752 product sorbitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244156.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 gene gutB CDS 646826..648217 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242688.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS 648312..649274 product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968826.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS 649473..650156 product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243015.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS 650222..651247 product TFIIB-type zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966712.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS 651247..652014 product YgcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242723.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS 652044..653015 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244029.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS complement(653063..654076) product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242752.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS 654690..656111 product myo-inositol transporter IolT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234027.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 gene iolT CDS complement(656160..657200) product (R,R)-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234015.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 gene bdhA CDS 657647..658015 product cell wall metabolism protein WalM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234013.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 gene walM CDS 658081..659124 product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243172.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 659240..659572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06190 note possible pseudo, frameshifted CDS 659872..660390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS complement(660793..661002) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234008.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS complement(661085..661900) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244040.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS complement(661914..662903) product DUF4003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243701.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS complement(663002..664543) product outer spore coat copper-dependent laccase CotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243170.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 gene cotA CDS complement(664695..666104) product GABA permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233998.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 gene gabP CDS 666518..667390 product manganese transporter MneS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233995.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 gene mneS CDS 667542..668504 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242543.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS 668504..669700 product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243539.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS 669716..671935 product DUF4129 domain-containing transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242683.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS 672090..673640 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244399.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 gene guaA CDS 674021..675343 product hypoxanthine/guanine permease PbuG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243780.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 gene pbuG CDS 675554..676357 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242783.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS 676516..676683 product Fur-regulated basic protein FbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244066.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS 676898..677452 product DUF5698 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966729.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS 677452..677649 product NETI motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219403.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS 677971..678459 product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244134.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 gene purE CDS 678452..679594 product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966735.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 gene purK CDS 679591..680886 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233955.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 gene purB CDS 680961..681686 product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242871.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS 681679..681933 product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219409.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 gene purS CDS 681930..682613 product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243954.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 gene purQ CDS 682597..684825 product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244429.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 gene purL CDS 684801..686231 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233947.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 gene purF CDS 686332..687372 product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242485.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 gene purM CDS 687369..687956 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244322.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 gene purN CDS 687953..689491 product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244516.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 gene purH CDS 689507..690775 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242993.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 gene purD CDS complement(690815..691237) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242890.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS 691384..692655 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242474.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS complement(692670..692903) product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233931.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS 693033..694775 product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233929.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS 694802..695797 product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233927.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS 695800..696114 product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219429.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(696152..697729) product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233925.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS 697975..698661 product heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233922.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS 698723..700942 product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233919.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 gene pcrA CDS 700966..702972 product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233916.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 gene ligA CDS 702988..704178 product CamS family sex pheromone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242795.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS 704362..705363 product phosphotransferase enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886430.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS complement(705400..706092) product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886431.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS complement(706204..707682) product proline transporter OpuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242814.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 gene opuE CDS 708097..708387 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219442.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 gene gatC CDS 708403..709860 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242878.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 gene gatA CDS 709874..711304 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219444.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 gene gatB CDS complement(711339..712184) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243222.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS 712316..715474 product surfactin resistance protein SrfP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242663.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 gene srfP CDS 715627..716538 product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233894.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS 716595..717974 product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233892.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 gene rlmD CDS 718753..718875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS 718965..720977 product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918506.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS 720974..722275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS 722276..725272 product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368424.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS 725363..726007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS complement(726089..726544) product TIGR01741 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886434.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS complement(726558..727043) product TIGR01741 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886434.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS complement(727048..729057) product LXG family T7SS effector deoxyribonuclease toxin YeeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242909.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 gene yeeF CDS 729161..730258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243884.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS 730402..731544 product response regulator aspartate phosphatase RapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243267.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 gene rapH CDS 731534..731710 product phosphatase RapH inhibitor PhrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242557.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 gene phrH CDS 731870..732589 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242611.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS 732725..733180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS 733282..733866 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243181.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS 733944..734387 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233857.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS 734384..735232 product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243852.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS complement(735291..736274) product gamma-resorcylate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972381.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 gene tsdA CDS 736524..737153 product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023665.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS 737227..737475 product spore coat-associated protein CotJA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219489.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 gene cotJA CDS 737459..737722 product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219491.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 gene cotJB CDS 737737..738306 product spore coat protein CotJC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233850.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 gene cotJC CDS 738431..738973 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244053.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS 739136..739300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06910 note possible pseudo, internal stop codon, frameshifted CDS 739421..740044 product YesL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886435.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS 740212..741774 product two-component system sensor histidine kinase YesM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243833.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 gene yesM CDS 741774..742880 product two-component system response regulator YesN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244566.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 gene yesN CDS 742984..744267 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243860.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS 744288..745193 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233835.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS 745197..746087 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233833.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS 746103..747137 product rhamnogalacturonyl hydrolase YesR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243366.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 gene yesR CDS 747160..749445 product transcriptional regulator YesS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966769.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 gene yesS CDS 749462..750157 product rhamnogalacturonan acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233825.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 gene rhgT CDS 750150..750812 product YesU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233822.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS 750809..751435 product YesL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233820.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS 751574..753418 product rhamnogalacturonan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886436.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 gene rhgW CDS 753486..755303 product rhamnogalacturonan exolyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886437.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 gene rhgX CDS 755466..756119 product rhamnogalacturonan acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244014.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS 756125..758119 product beta-galactosidase YesZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242572.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 gene yesZ CDS 758164..760737 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243379.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS 760827..762368 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244341.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS 762423..763379 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244086.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS 763393..764280 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242715.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS 764289..765632 product alpha-galacturonidase LplD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244472.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 gene lplD CDS 765708..766403 product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233805.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS complement(766440..766763) product heme-degrading oxygenase HmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243958.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 gene hmoA CDS complement(766863..767225) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233803.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS complement(767320..767964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS 768161..769033 product RsbT co-antagonist protein RsbRD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398754.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 gene rsbRD CDS 769190..769357 product YezD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244522.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS 769465..770109 product Bax inhibitor-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244397.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS complement(770228..770731) product transcriptional regulator YetL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233796.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 gene yetL CDS 770890..771999 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243182.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS complement(772034..773104) product DUF3900 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233793.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS 773254..776439 product bifunctional P-450/NADPH--P450 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242884.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 gene cypD CDS 776848..778791 product lipoteichoic acid synthase LtaS1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243930.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 gene ltaS1 CDS 779028..779792 product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244408.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS 779865..780767 product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244102.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS 780785..781702 product putative nucleotide-diphospho-sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243130.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS 781730..782893 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233779.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS 782908..783843 product putative nucleotide-diphospho-sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966783.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS complement(783875..785104) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243467.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS complement(785216..785923) product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244307.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS complement(786015..787400) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242995.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS 787649..789106 product benzaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244104.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 gene yfmT CDS 789126..789980 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233767.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS 790114..792003 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244423.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS 792127..792573 product YfmQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243426.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS 792697..793119 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243655.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS 793184..794374 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233759.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS 794702..794896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS complement(794976..796532) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233752.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS 796707..797837 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233750.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS 797907..798353 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243349.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS complement(798406..799425) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242607.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS complement(799533..800330) product Fe(3+)-citrate ABC transporter ATP-binding protein YfmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233737.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 gene yfmF CDS complement(800343..801344) product Fe(3+)-citrate ABC transporter permease YfmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243506.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 gene yfmE CDS complement(801341..802342) product Fe(3+) dicitrate ABC transporter permease FecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243835.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 gene fecD CDS complement(802415..803362) product Fe(3+)-citrate ABC transporter substrate-binding protein YfmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243996.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 gene yfmC CDS complement(803472..803840) product YfmB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233730.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS 804084..804431 product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233729.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS 804626..805888 product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244025.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS 806016..807449 product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233725.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS 807632..809218 product two-component sensor histidine kinase CitS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242967.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 gene yflR CDS 809232..809912 product two-component response regulator CitT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242754.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 gene citT CDS 809915..810874 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242528.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS 811066..812367 product citrate transporter CitM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242978.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 gene citM CDS 812423..813217 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966790.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS 813337..814428 product nitric oxide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243309.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 gene nosA CDS complement(814419..814694) product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243829.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS 814759..815424 product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243175.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS complement(815472..815603) product YflJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233704.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS complement(815776..815931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244572.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS complement(816041..816355) product DUF3243 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242951.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS complement(816436..817185) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233698.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 gene map CDS 817356..818714 product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243372.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 gene nagE CDS complement(818748..820697) product lipoteichoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233694.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 gene ltaS CDS 820955..821347 product DUF1992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233692.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS 821475..822890 product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243631.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS complement(822887..823963) product endospore germination permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243872.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS complement(823987..824187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233686.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS complement(824203..825357) product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243672.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS complement(825338..826879) product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233683.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS 827075..828487 product PTS system trehalose-specific EIIBC component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233682.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 gene treP CDS 828559..830247 product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244272.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 gene treC CDS 830268..830984 product trehalose operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233679.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 gene treR CDS 831123..831788 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243096.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS complement(831826..836205) product multifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886443.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS 836449..836967 product general stress protein 18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243504.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 gene yfkM CDS complement(837005..838204) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243812.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS complement(838420..838635) product DUF1128 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243712.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS 838839..839309 product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243480.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 gene yfkJ CDS 839327..839647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242981.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS 839671..840498 product YihY family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242564.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS complement(840697..841872) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966795.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS 842039..843094 product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242902.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 gene cax CDS 843168..843959 product YfkD famly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233657.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS complement(843998..844834) product mechanosensitive ion channel protein MscC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886444.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 gene mscC CDS complement(844841..845962) product radical SAM/CxCxxxxC motif protein YfkAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233655.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 gene yfkAB CDS 846108..846293 product SE1561 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223132.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS 846395..847186 product delta-lactam-biosynthetic de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244439.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 gene pdaA CDS complement(847224..848084) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243106.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS complement(848185..849144) product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233650.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 gene corA CDS 849261..850124 product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233646.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS complement(850157..851155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS 851345..852745 product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233644.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 gene rlmD CDS 853090..854094 product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243992.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS 854367..854918 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506639.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS 855086..855538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233638.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS 855568..856257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243897.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS 856486..857487 product acetoin:2,6-dichlorophenolindophenol oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242898.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 gene acoA CDS 857489..858517 product acetoin:2,6-dichlorophenolindophenol oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243124.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 gene acoB CDS 858531..859727 product acetoin dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244059.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 gene acoC CDS 859747..861123 product acetoin dehydrogenase complex dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243007.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 gene acoL CDS 861241..863058 product acetoin dehydrogenase operon transcriptional activator AcoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244100.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 gene acoR CDS 863111..863290 product small acid-soluble spore protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244276.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS complement(863326..863652) product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886445.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS complement(863705..864262) product DUF5381 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886446.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS complement(864286..865053) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243767.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS complement(865065..866288) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243998.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS complement(866294..866608) product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243177.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS 866944..868293 product maltose-6'-phosphate glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244008.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 gene glvA CDS 868358..869122 product MurR/RpiR family transcriptional regulator GlvR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233607.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 gene glvR CDS 869137..870720 product PTS maltose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233606.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 gene malP CDS 870826..872544 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243936.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS 872538..874352 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244082.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS 874506..874910 product DoxX family oxidoreductase CatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244204.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 gene catD CDS 874928..875785 product catechol 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233597.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 gene catE CDS 875889..877106 product two-component system sensor histidine kinase LnrJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966811.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 gene lnrJ CDS 877103..877765 product two-component system response regulator LnrK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242530.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 gene lnrK CDS 877909..878844 product linearmycin resistance ATP-binding protein LnrL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244346.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 gene lnrL CDS 878857..880047 product linearmycin resistance permease LnrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242483.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 gene lnrM CDS 880062..881219 product linearmycin resistance permease LnrN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243650.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 gene lnrN CDS complement(881255..881854) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402586.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS complement(881903..882451) product transcriptional regulator PadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233588.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 gene padR CDS 882725..883357 product esterase EstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243184.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 gene estB CDS 883576..884664 product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242504.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS 884798..885334 product bacillithiol transferase BstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243944.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 gene bstA CDS complement(885331..886887) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243108.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS complement(886999..887481) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244538.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS 887654..890224 product bifunctional lysylphosphatidylglycerol flippase/synthetase MprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242495.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 gene mprF CDS complement(890242..891219) product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242746.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS 891350..892351 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242478.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS 892348..893379 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243057.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS 893493..893867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS 893839..894300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS 894387..894971 product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243940.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS complement(895010..895201) product YfhD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233561.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS complement(895433..896344) product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244332.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS 896433..897224 product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243354.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 gene recX CDS 897233..897553 product YfhH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244592.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS 897691..898884 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243500.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS complement(898918..899070) product small, acid-soluble spore protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223241.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS 899195..899464 product YfhJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243789.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS 899608..900126 product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243363.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS 900212..900544 product SdpC immunity protein SpdL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242803.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 gene spdL CDS 900531..901391 product epoxide hydrolase EphM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243419.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 gene ephM CDS 901616..902605 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244113.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS 902678..905260 product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242872.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS complement(905257..906240) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244136.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS 906457..907566 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243838.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 gene mutY CDS complement(907573..907797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233542.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS 907879..908631 product enoyl-[acyl-carrier-protein] reductase FabL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223262.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 gene fabL CDS 908700..908957 product gamma type acid-soluble spore protein SspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233541.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 gene sspE CDS 909131..909391 product YgaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968853.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS 909535..910065 product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223272.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS 910152..911894 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966836.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(911970..913079) product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233537.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS complement(913250..914539) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233535.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS 914692..915165 product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233532.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 gene bcp CDS 915298..915735 product peroxide-responsive transcriptional repressor PerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223285.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 gene perR CDS complement(915770..916123) product YgzB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243536.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS 916332..917216 product nucleotidyltransferase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243727.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 rRNA 917514..919060 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00250 rRNA 919232..922155 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00260 rRNA 922272..922382 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00270 tRNA 922395..922469 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA 922475..922566 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 tRNA 922601..922672 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 tRNA 922682..922757 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 tRNA 922765..922841 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 tRNA 922906..922982 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 tRNA 922995..923070 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 tRNA 923076..923149 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 tRNA 923171..923255 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 tRNA 923261..923334 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 tRNA 923359..923434 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 tRNA 923443..923517 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 tRNA 923564..923638 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 tRNA 923644..923714 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 tRNA 923722..923810 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 tRNA 924043..924126 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 CDS complement(924176..924952) product sporulation control protein Spo0M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233481.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 gene spo0M CDS 925098..925295 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233478.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS complement(925360..925599) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS 925729..926421 product Type 1 glutamine amidotransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245002.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS 926727..928502 product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233473.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 gene thiC CDS 928634..928813 product transcriptional regulator SenS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245192.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 gene senS CDS complement(928857..930308) product catalase KatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245322.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 gene katA CDS 930590..931486 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886450.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS 931504..932502 product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245431.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS 932499..933329 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886451.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS 933352..934488 product FMNH2-dependent alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245787.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 gene ssuD CDS 934615..935121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245073.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS 935236..935505 product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233455.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 gene rpsN CDS complement(935523..935996) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245008.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS complement(935998..936201) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966860.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 tRNA 936392..936465 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 CDS complement(936556..937179) product B3/4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245517.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS 937262..938422 product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245522.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 gene queG CDS 938508..939419 product amidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886452.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS 939466..939939 product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886453.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 gene trmL CDS 940063..940704 product YhbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886454.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS 940695..941408 product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244751.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS 941420..942127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245825.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS 942476..944371 product serine/threonine protein kinase PrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233433.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 gene prkA CDS 944551..945729 product sporulation protein YhbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233432.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 gene yhbH CDS 945890..946354 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233431.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS 946424..947056 product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233430.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS 947097..948695 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233429.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS 948718..949248 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233428.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS 949261..949635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233427.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS 949776..950537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245465.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS 950540..950905 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233424.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS 950907..951605 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233423.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS 951618..952535 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245448.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS 952528..953022 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08940 note possible pseudo, frameshifted CDS complement(953556..953759) product cold shock-like protein CspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003224086.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 gene cspB CDS 954197..955027 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245726.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS complement(955030..956109) product diguanylate cyclase DgcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244833.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 gene dgcK CDS 956280..957671 product L-cystine transporter TcyP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244685.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 gene tcyP CDS complement(957713..958150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245285.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS 958305..958892 product YhcN/YlaJ family sporulation lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245125.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS 959012..959980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245770.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS complement(959912..960565) product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966881.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS 960717..964301 product endonuclease YhcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886455.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 gene yhcR CDS 964298..964894 product sortase SrtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244666.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 gene srtA CDS complement(964925..965833) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244785.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS 966022..966339 product YhcU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233401.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS 966476..966898 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245462.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS 967024..967686 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245030.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS 967702..969243 product bifunctional GNAT family N-acetyltransferase/carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245514.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS 969355..970269 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721396.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS 970429..971766 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886456.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS 971797..972351 product glycerol uptake operon antiterminator GlpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233388.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 gene glpP CDS 972544..973368 product glycerol uptake facilitator protein GlpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233386.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 gene glpF CDS 973387..974877 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233384.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 gene glpK CDS 975022..976686 product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233382.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 gene glpD CDS 976819..978564 product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244986.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 gene pgcA CDS 978716..979858 product two-component system sensor histidine kinase YhcY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245750.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 gene yhcY CDS 979855..980502 product two-component system response regulator YhcZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245647.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 gene yhcZ CDS 980499..981023 product FMN-dependent NADPH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244703.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 gene yhdA CDS complement(981038..981280) product YhdB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233373.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS 981481..981804 product YqzG/YhdC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233371.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS complement(981848..983290) product peptidoglycan endopeptidase LytF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244874.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 gene lytF CDS complement(983443..983883) product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245378.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 gene nsrR CDS complement(983996..985522) product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886457.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS 985688..987094 product stage V sporulation protein SpoVR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233364.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 gene spoVR CDS complement(987124..988500) product alkaline phosphatase PhoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886458.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 gene phoA CDS 989034..990047 product peptidoglycan endopeptidase LytE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244816.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 gene lytE CDS complement(990117..990992) product transcriptional regulator CitR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233357.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 gene citR CDS 991101..992201 product citrate synthase CitA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244745.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 gene citA CDS 992275..993144 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244867.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS 993398..994795 product branched-chain amino acid transporter BcaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245791.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 gene bcaP CDS 994916..996271 product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245615.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS complement(996306..997715) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245209.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS 997825..998253 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966899.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS complement(998288..998578) product anti-sigma-M factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233341.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS complement(998566..999639) product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886459.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS complement(999632..1000123) product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003224177.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 gene sigM CDS 1000320..1001315 product aldo/keto reductase AkrN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245422.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 gene akrN CDS 1001648..1002247 product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233335.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS 1002349..1003476 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844385.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS complement(1003497..1004396) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707196.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS complement(1004555..1005889) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966903.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS complement(1005950..1006495) product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886460.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 gene cueR CDS 1006538..1007719 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245683.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS 1008010..1009395 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245822.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS complement(1009409..1009765) product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245812.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 gene crcB CDS complement(1009762..1010157) product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245042.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS complement(1010144..1010875) product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244958.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS 1011366..1012481 product small-conductance mechanosensitive channel protein MscY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245529.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 gene mscY CDS 1012555..1013298 product sirtuin NAD-dependent deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233309.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 gene srtN CDS complement(1013328..1014176) product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245705.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS 1014463..1015311 product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233305.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 gene dat CDS complement(1015354..1016715) product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233301.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 gene nhaC CDS complement(1016841..1017341) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233299.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS 1017484..1017768 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS 1017792..1019549 product multidrug ABC transporter ATP-binding protein BmrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245157.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 gene bmrC CDS 1019546..1021567 product multidrug resistance ABC transporter ATP-binding protein/permease BmrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233292.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 gene bmrD CDS complement(1021612..1022232) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245013.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS complement(1022703..1022906) product beta type acid-soluble spore protein SspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233287.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 gene sspB CDS complement(1023114..1023323) product YheE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886462.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS complement(1023487..1024848) product spore coat associated protein YheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245015.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 gene yheD CDS complement(1024838..1025929) product spore coat associated protein SpaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245845.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 gene spaC CDS 1026196..1027329 product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245756.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS 1027423..1027776 product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003224239.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS complement(1027820..1029061) product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245738.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS 1029377..1030243 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233277.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS 1030446..1031861 product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245132.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS complement(1031879..1033096) product K(+)/H(+) antiporter subunit KhtU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233272.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 gene khtU CDS complement(1033104..1033601) product K(+)/H(+) antiporter subunit KhtT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233269.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 gene khtT CDS complement(1033664..1033981) product K(+)/H(+) antiporter modulator KhtS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886463.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 gene khtS CDS 1034167..1034934 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245167.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS complement(1034955..1035140) product YhzD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233264.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS 1035267..1036163 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233262.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS 1036156..1037415 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244912.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS 1037523..1038746 product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233258.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS 1038760..1041651 product DNA repair/recombination ATPase SbcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233256.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 gene sbcE CDS 1041725..1042669 product 3'-5' exoribonuclease YhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245698.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 gene yhaM CDS 1042796..1043008 product sporulation protein YhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233252.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 gene yhaL CDS complement(1043048..1043902) product peptidylprolyl isomerase PrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245079.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 gene prsA CDS complement(1044702..1045220) product DUF3267 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245590.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS 1045428..1045769 product YhaI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966921.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS complement(1045766..1046377) product HTH-type transcriptional regulator Hpr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003239501.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS complement(1046555..1046956) product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245875.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS complement(1047307..1047825) product tryptophan transporter TrpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233236.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 gene trpP CDS complement(1047948..1049027) product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233234.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 gene serC CDS complement(1049173..1049610) product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233231.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS 1050098..1050841 product ABC transporter ATP-binding protein EcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233230.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 gene ecsA CDS 1050834..1052060 product ABC transporter permease EcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245169.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 gene ecsB CDS 1052083..1052793 product EcsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233225.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS complement(1052810..1054000) product N-acetyl amino acid acetylase SndC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245681.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 gene sndC CDS complement(1054074..1055462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233218.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS complement(1055544..1055858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966927.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS complement(1055906..1056406) product heme-degrading oxygenase HmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244748.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 gene hmoB CDS 1056528..1058672 product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233213.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS 1058794..1059855 product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966929.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 gene hemE CDS 1059927..1060859 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244736.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 gene hemH CDS 1060874..1062286 product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245394.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 gene hemY CDS 1062432..1063007 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233204.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS 1063078..1065405 product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245424.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS complement(1065449..1066426) product beta-ketoacyl-ACP synthase III FabHB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233200.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 gene fabHB CDS 1066555..1067331 product YhfC family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233198.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS 1067745..1068785 product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966936.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS 1068798..1069205 product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244837.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS complement(1069243..1070532) product glutamate/proton symporter GltT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245579.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 gene gltT CDS 1071094..1071828 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233185.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS 1071841..1072836 product lipoate--protein ligase LplJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244914.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 gene lplJ CDS 1072901..1073545 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245344.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS 1073663..1075204 product long-chain-fatty-acid--CoA ligase LcfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244686.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 gene lcfB CDS complement(1075244..1075639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245187.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS 1075789..1077069 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233175.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS complement(1077107..1078252) product subtilisin AprE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233171.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 gene aprE CDS 1078694..1079143 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233166.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS 1079214..1080206 product acryloyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233163.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS 1080540..1081511 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233159.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS complement(1081543..1082124) product phosphatase PhoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233157.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 gene phoE CDS complement(1082195..1083289) product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233154.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS complement(1083291..1084730) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244910.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS complement(1084736..1085296) product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233151.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS complement(1085431..1086729) product heme-based aerotactic transducer HemAT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245216.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 gene hemAT CDS complement(1086866..1088395) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245031.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS 1088507..1089364 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245662.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS complement(1089392..1089625) product IDEAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233142.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS 1089918..1090496 product competence transcription factor ComK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245329.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 gene comK CDS complement(1090539..1091438) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245421.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS 1091655..1091924 product excalibur calcium-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233136.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS complement(1091967..1093436) product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233134.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS complement(1093433..1093633) product DUF3311 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003224377.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS complement(1093859..1094221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233132.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS 1094377..1094997 product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886465.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS 1094999..1095505 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233128.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 gene lepB CDS 1095688..1097181 product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245274.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS 1097258..1097785 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245853.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS complement(1097812..1098009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS complement(1098361..1099566) product glucose/mannose transporter GlcP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245772.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 gene glcP CDS complement(1099638..1100690) product glucose-6-phosphate 3-dehydrogenase NdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244701.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 gene ntdC CDS complement(1100708..1101553) product kanosamine-6-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244845.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 gene ntdB CDS complement(1101525..1102850) product 3-dehydro-glucose-6-phosphate--glutamate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245503.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 gene ntdA CDS 1102956..1103945 product NTD biosynthesis operon transcriptional regulator NtdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966948.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 gene ntdR CDS complement(1104498..1105652) product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245459.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS complement(1105760..1106962) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245498.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS 1107076..1108803 product SgrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245281.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS complement(1109285..1109722) product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245806.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS 1109689..1109904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS 1109906..1113406 product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244988.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 gene addB CDS 1113393..1117097 product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233100.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 gene addA CDS 1117169..1118344 product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233099.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS 1118341..1121733 product exonuclease subunit SbcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245201.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 gene sbcC CDS 1121747..1122049 product HNH nuclease-like protein HlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245113.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 gene hlpB CDS complement(1122086..1122304) product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233096.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS complement(1122730..1122915) product spore germination protein GerPD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233093.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 gene gerPD CDS complement(1122912..1123529) product spore germination protein GerPC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245548.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS complement(1123552..1123785) product spore germination protein GerPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233090.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 gene gerPB CDS complement(1123799..1124020) product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233088.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS complement(1124438..1124608) product aspartyl-phosphate phosphatase YisI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233086.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 gene yisI CDS complement(1124752..1125675) product CotH kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245291.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS 1125829..1126734 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245441.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS 1126850..1127206 product YisL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244937.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS 1127372..1130056 product cell wall-associated protease WprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244653.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 gene wprA CDS complement(1130088..1130645) product DUF2777 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886469.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS 1130815..1132659 product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233080.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 gene asnB CDS complement(1132868..1133347) product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886470.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS 1133911..1134717 product farnesyl diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245866.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 gene farP CDS complement(1134742..1136109) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233074.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS 1136233..1137096 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966961.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS 1137114..1138127 product transcriptional regulator DegA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245813.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 gene degA CDS 1138335..1139369 product scyllo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244942.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 gene iolX CDS complement(1139427..1139936) product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245457.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS complement(1139986..1140597) product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966965.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS 1140721..1142166 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886472.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS complement(1142173..1142811) product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233060.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS 1143015..1143821 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245141.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS complement(1143848..1144447) product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245829.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 gene cysC CDS complement(1144444..1145613) product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233054.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 gene sat CDS complement(1145726..1146439) product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244757.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS 1146629..1147315 product 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233050.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS 1147312..1148070 product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233048.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS complement(1148115..1148744) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966972.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS complement(1148840..1149955) product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245056.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS complement(1149964..1151232) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245414.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS complement(1151345..1152202) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244917.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(1152208..1152657) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966973.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS complement(1152749..1154587) product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245847.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS complement(1154903..1155394) product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233034.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS 1155542..1156390 product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886474.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS 1156503..1156793 product DUF3784 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233021.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS complement(1156835..1157686) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245785.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS 1157823..1158665 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245017.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS 1158684..1159139 product intracellular proteinase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886475.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS complement(1159170..1159367) product DUF3813 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245613.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS complement(1159624..1160436) product 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YitU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233007.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 gene yitU CDS 1160557..1161324 product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233006.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS 1161388..1161696 product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232998.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS 1161765..1161935 product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990233.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS 1161997..1163427 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232994.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS 1163427..1163966 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886476.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS 1164171..1165208 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245768.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 gene argC CDS 1165228..1166448 product bifunctional ornithine acetyltransferase/N-acetylglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232989.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 gene argJ CDS 1166463..1167239 product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232987.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 gene argB CDS 1167236..1168393 product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232985.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS 1168464..1169525 product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232984.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS 1169518..1172610 product carbamoyl phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232982.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS 1172598..1173542 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232980.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 gene argF CDS 1173643..1173822 product YjzC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245356.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS complement(1173868..1174053) product DUF2929 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245236.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS 1174304..1175038 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245223.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS 1175122..1175679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232974.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS 1175770..1176723 product transcriptional regulator Med inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245494.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 gene med CDS 1176738..1176929 product ComG operon transcriptional repressor ComZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003224559.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 gene comZ CDS complement(1176959..1177180) product spore coat protein YjzB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232972.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 gene yjzB CDS 1177352..1178290 product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232971.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 gene fabH CDS 1178315..1179556 product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244890.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 gene fabF CDS 1179632..1180417 product DUF2268 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232967.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS 1180608..1181594 product oligopeptide ABC transporter ATP-binding protein AppD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232965.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 gene appD CDS 1181591..1182580 product oligopeptide ABC transporter ATP-binding protein AppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232964.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 gene appF CDS 1182668..1184299 product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS 1184375..1185325 product oligopeptide ABC transporter permease AppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245828.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 gene appB CDS 1185342..1186253 product oligopeptide ABC transporter permease AppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232961.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 gene appC CDS 1186459..1187211 product YjbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003239298.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS complement(1187245..1188237) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245134.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 gene trpS CDS 1188981..1190618 product oligopeptide ABC transporter substrate-binding protein OppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232957.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 gene oppA CDS 1190714..1191649 product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245554.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 gene oppB CDS 1191653..1192570 product oligopeptide ABC transporter permease OppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232954.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 gene oppC CDS 1192584..1193651 product oligopeptide ABC transporter ATP-binding protein OppD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886477.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 gene oppD CDS 1193653..1194570 product oligopeptide ABC transporter ATP-binding protein OppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245567.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 gene oppF CDS 1195081..1195890 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS 1196068..1196646 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244921.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS 1196827..1197222 product transcriptional regulator Spx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245483.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 gene spx CDS complement(1197265..1197921) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232944.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS 1198197..1198853 product adaptor protein MecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245194.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 gene mecA CDS 1200211..1202223 product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967010.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 gene pepF CDS complement(1202261..1202428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244944.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS complement(1202742..1203641) product protease adaptor protein SpxH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245184.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 gene spxH CDS complement(1203638..1204036) product group 2 truncated hemoglobin YjbI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232928.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS complement(1204291..1205028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS complement(1205043..1205615) product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232924.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS 1205739..1206104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232922.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS 1206133..1206768 product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245294.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 gene yjbM CDS 1206787..1207587 product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232918.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS 1207602..1208501 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886481.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS complement(1208514..1209248) product bis(5'-nucleosyl)-tetraphosphatase PrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244765.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 gene prpE CDS 1209482..1211326 product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232910.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS 1211578..1212285 product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232909.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 gene tenA CDS 1212263..1212880 product thiazole tautomerase TenI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232908.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 gene tenI CDS 1212864..1213973 product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245044.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 gene thiO CDS 1213970..1214173 product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886482.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 gene thiS CDS 1214176..1214940 product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886483.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 gene thiG CDS 1214937..1215947 product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245868.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 gene thiF CDS 1215966..1216781 product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245050.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 gene thiD CDS 1216918..1217694 product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232896.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 gene fabI CDS 1217801..1218484 product spore coat protein CotO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886484.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 gene cotO CDS complement(1218576..1219025) product spore coat protein CotZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244982.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 gene cotZ CDS complement(1219153..1219641) product spore coat protein CotY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003239243.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 gene cotY CDS complement(1219792..1220298) product spore coat protein CotX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244668.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 gene cotX CDS complement(1220387..1220716) product spore coat protein CotW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245818.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 gene cotW CDS complement(1220757..1221143) product spore coat protein CotV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244871.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 gene cotV CDS 1221299..1221655 product sporulation protein YjcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244844.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 gene yjcA CDS 1221936..1222142 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244769.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS 1222224..1222382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS 1222515..1222769 product sporulation-specific transcription regulator SopVIF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232870.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene spoVIF CDS complement(1222842..1225121) product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245380.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS 1225240..1225494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232866.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS complement(1225568..1225990) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245407.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS complement(1225995..1226510) product YjcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232861.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS complement(1226547..1227269) product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245358.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS 1227607..1228752 product cystathionine gamma-synthase/O-acetylhomoserine thiolyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232857.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 gene metI CDS 1228745..1229917 product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244787.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 gene metC CDS complement(1229946..1230164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11670 note possible pseudo, frameshifted CDS complement(1230191..1230490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11680 note possible pseudo, frameshifted CDS complement(1230560..1231750) product DUF819 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967022.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 tRNA 1231923..1231997 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00560 CDS 1232388..1232825 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS complement(1232871..1233161) product contact-dependent growth inhibition system immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242733.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS complement(1233178..1234551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11720 note possible pseudo, frameshifted CDS complement(1234557..1235039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11730 note possible pseudo, frameshifted CDS 1235277..1236404 product response regulator aspartate phosphatase RapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243267.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 gene rapH CDS 1236848..1237027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS 1237369..1237941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(1238012..1238350) product YolD-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398710.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS 1238965..1239426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11780 note possible pseudo, frameshifted CDS 1239423..1240913 product mannose transport/utilization transcriptional regulator ManR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245617.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 gene manR note possible pseudo, frameshifted CDS 1241062..1243014 product PTS mannose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245781.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 gene manP CDS 1243030..1243977 product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232833.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 gene manA CDS 1244357..1244641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS complement(1244878..1245264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11830 note possible pseudo, frameshifted CDS complement(1245539..1245934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967031.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS 1246136..1246618 product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244878.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 gene ybaK CDS complement(1246663..1246857) product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232825.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS complement(1247947..1248909) product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232818.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 gene cyoE CDS complement(1249060..1249296) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS 1249550..1250950 product peptidoglycan-N-acetylmuramic acid deacetylase PdaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245023.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 gene pdaC CDS complement(1250997..1251470) product YjfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244679.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS complement(1251600..1251767) product YjfB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232812.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS 1251895..1252794 product DUF2268 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244687.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS complement(1252803..1253201) product DUF2809 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967034.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS complement(1253300..1253875) product YjgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245827.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS 1254025..1256982 product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245240.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 gene fdhF CDS 1256975..1257535 product DUF1641 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232799.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS 1257733..1258371 product DUF4352 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244850.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS 1258459..1259076 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886490.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS complement(1259108..1259386) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232791.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS 1259777..1260967 product monooxygenase YjiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232789.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 gene yjiB CDS 1260990..1262168 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232783.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS complement(1262210..1262398) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232781.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS 1262573..1263385 product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245334.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS complement(1263431..1264183) product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232776.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 gene fetB CDS complement(1264183..1264935) product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232774.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS complement(1265054..1266028) product multidrug resistance efflux transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232772.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS 1266160..1266657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232768.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS 1267050..1267472 product DUF1641 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220510.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS 1267512..1268690 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232765.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS 1268872..1270311 product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245001.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 gene uxaC CDS 1270394..1271773 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245721.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS 1271878..1272891 product ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244926.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 gene allD CDS 1272897..1273916 product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245542.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS 1273941..1275020 product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244855.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 gene uxuA CDS 1275017..1275853 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245605.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS 1275901..1277169 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245531.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS 1277257..1278258 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244946.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS 1278336..1279778 product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245710.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS 1279775..1281268 product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245409.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS complement(1281305..1282069) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245643.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS complement(1282296..1282760) product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245144.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS 1282910..1284181 product ATPase YjoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245490.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 gene yjoB CDS 1284332..1285462 product response regulator aspartate phosphatase RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886491.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 gene rapA CDS 1285452..1285586 product phosphatase RapA inhibitor PhrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245487.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 gene phrA CDS complement(1285618..1285872) product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232731.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS 1285996..1286949 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244876.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS complement(1286986..1287363) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245254.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS 1287470..1288072 product poly-gamma-glutamate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244789.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS 1288147..1288983 product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245071.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS complement(1289028..1289624) product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232721.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS complement(1289786..1290127) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232719.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS 1290307..1290486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232712.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS 1290473..1291309 product phage-like element PBSX protein XkdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245799.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS 1291209..1292009 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886492.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS 1292009..1292176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245588.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS 1292261..1292620 product phage-like element PBSX protein XkdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245290.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 gene xkdD CDS 1292607..1292813 product phage-like element PBSX protein XtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244900.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 gene xtrA CDS 1292928..1293437 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245797.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS 1293555..1294349 product phage terminase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244697.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 gene xtmA CDS 1294346..1295647 product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245584.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS 1295648..1297138 product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245427.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS 1297158..1297985 product XkdF-like putative serine protease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245836.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS 1298010..1298945 product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232690.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS 1298967..1299350 product DUF3199 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245011.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS 1299347..1299703 product YqbH/XkdH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967053.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS 1299700..1300185 product HK97 gp10 family phage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245226.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS 1300198..1300638 product phage-like element PBSX protein XkdJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232680.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS 1300642..1300860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232679.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS 1300857..1302257 product phage tail sheath family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245369.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS 1302259..1302702 product phage tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232677.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS 1302793..1303239 product phage-like element PBSX protein XkdN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232676.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS 1303263..1303421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003239113.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS 1303422..1308431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS 1308424..1309083 product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232674.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS 1309096..1310076 product phage-like element PBSX protein XkdQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245730.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS 1310076..1310342 product DUF2577 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244812.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS 1310399..1310824 product DUF2634 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232671.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS 1310817..1311863 product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967060.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS 1311847..1312425 product YmfQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244743.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS 1312422..1312694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232665.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS 1312697..1315138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS 1315156..1315482 product XkdW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232660.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS 1315479..1315643 product XkdX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232658.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS 1315688..1316527 product phage-like element PBSX protein XepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245597.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 gene xepA CDS 1316580..1316849 product hemolysin XhlA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232655.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS 1316862..1317125 product phage holin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232653.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS 1317138..1318031 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245230.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS complement(1318292..1318462) product three component toxin-antitoxin-antitoxin system antitoxin SpoIISB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232646.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 gene spoIISB CDS complement(1318462..1319208) product toxin-antitoxin-antitoxin system toxin SpoIISA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244695.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 gene spoIISA CDS complement(1319318..1320319) product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232642.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS complement(1320332..1320949) product DUF47 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218470.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS complement(1321226..1322542) product serine/threonine exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244819.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 gene steT CDS 1322925..1323875 product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245086.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS 1323976..1324122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS 1324130..1326316 product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245387.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS 1326328..1327299 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232632.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS complement(1327795..1329153) product serine protease HtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967069.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 gene htrA CDS 1329326..1330144 product pyrroline-5-carboxylate reductase ProG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232626.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 gene proG CDS 1330273..1331097 product D-aminopeptidase DppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245814.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 gene dppA CDS 1331113..1332039 product dipeptide ABC transporter permease DppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245446.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 gene dppB CDS 1332045..1333007 product dipeptide ABC transporter permease DppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245702.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 gene dppC CDS 1333012..1334019 product dipeptide ABC transporter ATP-binding subunit DppD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232615.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 gene dppD CDS 1334040..1335671 product dipeptide ABC transporter substrate-binding protein DppE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886494.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 gene dppE CDS 1335777..1336718 product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967072.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS 1336715..1337815 product L-Ala-D/L-Glu epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244980.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 gene ykfB CDS 1337812..1338702 product gamma-D-glutamyl-L-lysine dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245577.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 gene eepC CDS 1338715..1339704 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967074.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS complement(1339744..1340790) product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244689.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 gene pgl CDS complement(1340878..1341738) product dimethylarginine dimethylaminohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245320.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS 1341856..1342416 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244690.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS 1342654..1343853 product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245238.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 gene hmpA CDS complement(1343926..1344156) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967080.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS 1344310..1345041 product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244848.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS 1345134..1345661 product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245783.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS 1345651..1346166 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244793.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS 1346389..1346727 product multidrug efflux SMR transporter subunit YkkC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232583.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 gene ykkC CDS 1346727..1347044 product multidrug efflux SMR transporter subunit YkkD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245695.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 gene ykkD CDS 1347115..1348017 product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245802.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 gene purU CDS 1348378..1349475 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244794.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 gene proB CDS 1349487..1350734 product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245312.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 gene proA CDS 1350863..1351288 product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232574.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS complement(1351321..1351764) product organic hydroperoxide resistance transcriptional regulator OhrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245653.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 gene ohrR CDS 1351906..1352316 product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232570.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS 1352441..1353544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS complement(1353550..1354020) product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245084.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 gene guaD CDS 1354155..1354781 product phosphoserine phosphatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859193.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS complement(1354820..1357108) product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232565.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 gene metE CDS complement(1357523..1358482) product serine protease Isp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232562.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 gene isp CDS 1358705..1359538 product RsbT co-antagonist RsbRB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232560.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 gene rsbRB CDS complement(1359571..1360335) product HMP/thiamine ABC transporter permease ThiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245037.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 gene thiX CDS complement(1360310..1361950) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245821.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS complement(1361937..1362536) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232554.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS complement(1362538..1363140) product HMP/thiamine ABC transporter substrate-binding protein ThiU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244962.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 gene thiU CDS 1363452..1364138 product two-component system response regulator YkoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232551.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 gene ykoG CDS 1364142..1365506 product two-component system sensor histidine kinase YkoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245526.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 gene ykoH CDS 1365503..1366177 product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244905.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS 1366269..1366784 product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232544.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS 1366868..1367005 product transcriptional regulator SplA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218541.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS 1367512..1368867 product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232543.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 gene mgtE CDS complement(1368910..1369242) product MerR family transcriptional regulator TnrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232541.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 gene tnrA CDS 1369436..1369591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232538.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS 1369679..1369861 product stress response protein YkoL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245766.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 gene ykoL CDS 1369998..1370459 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232536.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS complement(1370500..1371594) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245161.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS 1371593..1372237 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245777.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS complement(1372265..1373077) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245342.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS 1373275..1374969 product DUF6044 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245165.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS 1374982..1375995 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245533.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS complement(1376138..1377973) product DNA ligase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886495.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS complement(1377977..1378861) product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886496.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS complement(1378950..1381352) product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967094.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS 1381561..1382196 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967095.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS 1382456..1383250 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967096.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS 1383514..1384269 product RNA polymerase sigma factor SigI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245855.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 gene sigI CDS 1384266..1384436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13350 note possible pseudo, frameshifted CDS 1384469..1385446 product anti-sigma-I factor RsgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244727.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 gene rsgI note possible pseudo, frameshifted CDS complement(1385457..1385651) product acid-soluble spore protein SspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218568.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 gene sspD CDS complement(1385783..1386484) product transcriptional regulator HtpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245220.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 gene htpK CDS 1386654..1387550 product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245353.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 gene htpX CDS 1387725..1389074 product Ktr system potassium transporter KtrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244672.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 gene ktrD CDS 1389230..1389385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232510.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS 1389388..1389558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245411.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS complement(1389600..1390622) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245573.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS 1390875..1393091 product sporulation two-component system sensor histidine kinase KinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232504.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 gene kinE CDS 1393088..1393585 product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232502.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 gene ogt CDS 1393675..1393800 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS complement(1393834..1394895) product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232498.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 gene mtnA CDS complement(1394903..1396096) product S-methyl-5-thioribose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244973.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 gene mtnK CDS complement(1396440..1397141) product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232495.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS 1397314..1398507 product methionine-glutamine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244774.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 gene mtnE CDS 1398734..1399945 product 2,3-diketo-5-methylthiopentyl-1-phosphate enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245108.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 gene mtnW CDS 1399942..1400649 product 2-hydroxy-3-keto-5-methylthiopentenyl-1-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245748.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 gene mtnX CDS 1400607..1401236 product methylthioribulose 1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244782.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS 1401251..1401787 product acireductone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244952.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 gene mtnD CDS complement(1401831..1402151) product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232481.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS 1402354..1402611 product aspartyl-phosphate phosphatase Spo0E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218598.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 gene spo0E CDS 1402697..1403128 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245685.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS complement(1403156..1404658) product sporulation kinase KinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886497.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 gene kinD CDS 1404869..1405306 product MarR family transcriptional regulator MhqR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232475.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 gene mhqR CDS complement(1405345..1406130) product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232473.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 gene motB CDS complement(1406102..1406914) product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244739.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 gene motA CDS complement(1407304..1409403) product ATP-dependent protease ATP-binding subunit ClpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967104.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 gene clpE CDS 1409770..1410813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244712.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS 1411128..1411787 product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245417.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 gene queC CDS 1411789..1412229 product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245665.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 gene queD CDS 1412222..1412953 product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232460.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 gene queE CDS 1412971..1413468 product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218613.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 gene queF CDS complement(1413736..1413867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS 1414100..1414342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS 1414383..1414673 product YkvR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245399.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS complement(1414794..1414979) product YkvS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232446.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS 1415144..1415338 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218622.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS 1415637..1416266 product cell wall hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232442.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS 1416384..1417721 product sporulation protein YkvU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245552.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 gene ykvU CDS 1417775..1418269 product sporulation thiol-disulfide oxidoreductase StoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245444.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 gene stoA CDS 1418254..1418412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS 1418504..1420417 product metal-transporting ATPase PfeT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245873.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 gene pfeT CDS 1420823..1421917 product di/tri-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244662.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 gene papB CDS complement(1421968..1422093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS 1422198..1423163 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244772.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS 1423247..1424092 product ptsGHI operon transcription antiterminator GlcT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967114.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 gene glcT CDS 1424322..1426421 product PTS glucose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244661.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 gene ptsG CDS 1426520..1426786 product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154654.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS 1426786..1428498 product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218638.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 gene ptsP CDS 1428590..1428829 product splAB operon transcriptional regulator SplA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218644.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 gene splA CDS 1428907..1429935 product spore photoproduct lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245173.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 gene splB CDS complement(1429949..1430629) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245627.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS 1430766..1432733 product methyl-accepting chemotaxis protein McpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245443.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 gene mcpC CDS 1432877..1433743 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245029.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS complement(1433784..1434575) product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244693.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS 1434913..1437033 product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245075.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS 1437198..1439018 product sporulation kinase KinA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245779.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 gene kinA CDS complement(1439028..1440209) product aminotransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232415.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(1440411..1440572) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245246.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS 1440779..1441690 product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967126.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 gene cheV CDS complement(1441732..1442196) product YkyB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232406.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS complement(1442322..1443614) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245267.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS complement(1443690..1444193) product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886500.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS complement(1444242..1445102) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232400.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS 1445244..1446008 product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232398.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 gene fadH CDS 1446072..1447295 product EAL-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232391.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS 1447914..1448153 product DUF1797 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218671.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS 1448262..1448780 product ribonuclease H-like YkuK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232389.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS 1448920..1449111 product AbrB antirepressor AbbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886502.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 gene abbA CDS 1449250..1449693 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218674.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS 1449840..1450721 product transcriptional regulator CcpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232387.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 gene ccpC CDS 1450832..1451308 product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232386.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS 1451298..1452191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232385.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS 1452207..1452662 product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245242.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS 1452768..1453478 product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218680.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 gene dapD CDS 1453548..1454672 product N-acetyldiaminopimelate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232383.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS 1454734..1454979 product YkuS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232382.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS complement(1455015..1455818) product small-conductance mechanosensitive channel protein MscT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244994.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 gene mscT CDS 1455875..1456081 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS 1456063..1456605 product biofilm-specific peroxidase AhpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245371.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 gene ahpA CDS 1456675..1457133 product thiol-disulfide oxidoreductase YkuV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245810.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 gene ykuV CDS 1457581..1458168 product transcriptional regulator Rok inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232378.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 gene rok CDS complement(1458208..1459173) product spore protein Cse15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245018.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 gene cse15 CDS 1459393..1459908 product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232376.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS 1459959..1460978 product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232375.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS 1460996..1462288 product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232372.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS 1462249..1462770 product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232370.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 gene mobB CDS 1462770..1463243 product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232367.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS 1463236..1463469 product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232366.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 gene moaD CDS 1463695..1465452 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967136.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS 1465463..1467277 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232362.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS 1467392..1468087 product toxin SDP protection protein YknW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232360.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 gene yknW CDS 1468092..1469225 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244902.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS 1469226..1469918 product ABC transporter ATP-binding protein YknY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232356.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 gene yknY CDS 1469915..1471108 product sporulation-delaying-protein transporter subunit SkiZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232354.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 gene skiZ CDS 1471388..1472143 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245688.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS 1472140..1473051 product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244923.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 gene pfkB CDS 1473066..1474973 product PTS fructose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232350.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS complement(1475034..1475552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS complement(1475852..1476184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14350 note possible pseudo, frameshifted CDS 1476407..1476988 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232348.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 gene lepB CDS complement(1477024..1477293) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232345.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS 1477475..1479094 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232344.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS 1479156..1480067 product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245639.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS complement(1480098..1481330) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232341.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS complement(1481440..1481574) product protein YkpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238865.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS complement(1481676..1482695) product cell shape-determining protein MreBH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245743.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 gene mreBH CDS 1482964..1483242 product transcriptional regulator AbhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244728.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 gene abhA CDS 1483435..1484721 product two-component sensor histidine kinase KinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232333.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 gene kinC CDS 1484738..1485565 product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245146.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS 1485637..1486302 product Ktr system potassium transporter KtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222311.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 gene ktrC CDS 1486460..1488193 product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245362.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 gene ade CDS complement(1488229..1489905) product ribonuclease J1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245660.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 gene rnjA CDS complement(1489902..1490111) product RNA polymerase subunit omega 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222303.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 gene rnpZA CDS 1490494..1491267 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245153.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS complement(1491302..1491856) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245474.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 gene def CDS complement(1491966..1492118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS 1492330..1493001 product YkyA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967146.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS 1493424..1494539 product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222294.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 gene pdhA CDS 1494543..1495520 product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232313.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 gene pdhB CDS 1495636..1496964 product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232311.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 gene pdhC CDS 1496969..1498381 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232309.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 gene lpdA CDS complement(1498427..1498801) product peptidoglycan-associated lipoprotein Slp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245672.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 gene slp CDS 1499453..1499785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14590 note possible pseudo, frameshifted CDS 1500085..1500615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS complement(1500665..1502137) product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244780.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 gene speA CDS 1502322..1502588 product UPF0223 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245382.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS complement(1502621..1503259) product YktB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232300.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS 1503499..1503687 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967148.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS 1503825..1504622 product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232297.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 gene suhB CDS 1504648..1505076 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232296.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS complement(1505153..1506067) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245561.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS complement(1506499..1508064) product neutral metalloprotease NprE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245026.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 gene nprE CDS 1508352..1510289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886503.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS 1510279..1510548 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232287.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS 1510548..1511069 product RNA polymerase sigma factor YlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245485.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 gene ylaC CDS 1511066..1511359 product anti-SigP sigma factor SigQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232283.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 gene sigQ CDS complement(1511399..1512010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232282.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS complement(1512284..1512472) product YlaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245500.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS 1512585..1514423 product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232278.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 gene typA CDS 1514479..1514796 product YlaH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232274.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS complement(1514855..1515061) product YlaI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232271.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS complement(1515147..1515776) product YhcN/YlaJ family sporulation lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232269.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS 1515932..1517260 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245272.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS complement(1517263..1517748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245279.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS 1517851..1518780 product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245206.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 gene glsA CDS 1518878..1519159 product YlaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245286.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS 1519359..1520570 product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967159.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 gene ftsW CDS 1520645..1524091 product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244778.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 gene pyc CDS complement(1524532..1525452) product heme A synthase CtaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245869.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 gene ctaA CDS 1525807..1526724 product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232250.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 gene cyoE CDS 1526965..1528035 product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232248.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 gene coxB CDS 1528068..1529936 product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232245.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 gene ctaD CDS 1529936..1530559 product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232244.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 gene ctaE CDS 1530562..1530894 product cytochrome c oxidase subunit IVB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232242.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 gene ctaF CDS 1530921..1531814 product cytochrome c oxidase assembly factor CtaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244967.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 gene ctaG CDS complement(1531846..1532205) product YugN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232238.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS 1532348..1532794 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221362.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS 1532879..1533919 product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245434.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS 1534178..1534576 product YlbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232233.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS 1534591..1534830 product YlbE-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232231.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS 1534950..1535399 product regulatory iron-sulfur-containing complex subunit RicF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221370.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 gene ricF CDS 1535532..1535726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS 1536046..1536600 product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232227.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 gene rsmD CDS 1536605..1537090 product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245283.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 gene coaD CDS complement(1537101..1538327) product dipicolinic acid transporter SpoVV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245492.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 gene spoVV CDS 1538508..1539290 product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232221.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS 1539292..1540317 product protease DdcP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245451.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 gene ddcP CDS complement(1540334..1541581) product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244707.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS 1541791..1542309 product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232214.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS 1542331..1542510 product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154457.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 gene rpmF CDS 1542656..1543237 product sporulation specific transcriptional regulator GerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232210.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 gene gerR CDS complement(1543294..1543776) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244940.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS 1543936..1544832 product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232206.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS 1544903..1546522 product bacillithiol biosynthesis cysteine-adding enzyme BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245571.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 gene bshC CDS 1546633..1547079 product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221402.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 gene mraZ CDS 1547149..1548084 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245724.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 gene rsmH CDS 1548123..1548476 product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232200.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 gene ftsL CDS 1548569..1550623 product penicillin-binding protein 2B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968930.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 gene pbpB CDS 1550757..1552697 product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245048.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS 1552874..1554358 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245326.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS 1554470..1555444 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232192.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 gene mraY CDS 1555445..1556800 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232189.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 gene murD CDS 1556861..1557961 product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244810.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 gene spoVE CDS 1558081..1559172 product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232184.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 gene murG CDS 1559204..1560115 product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232182.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 gene murB CDS 1560246..1561037 product cell division protein DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232178.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 gene divIB CDS 1561034..1561729 product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245024.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS 1561752..1562459 product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967184.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS 1562477..1562842 product small basic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238683.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS 1563017..1564339 product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967186.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 gene ftsA CDS 1564375..1565523 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232167.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 gene ftsZ CDS 1565823..1570124 product bacillopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245629.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS 1570292..1571245 product sigma-E processing peptidase SpoIIGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232163.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 gene spoIIGA CDS 1571308..1572027 product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221446.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 gene sigE CDS 1572167..1572949 product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967190.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 gene sigG CDS 1573103..1573897 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232156.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS 1574100..1575380 product N-formyl-4-amino-5-aminomethyl-2-methylpyrimidine deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244730.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 gene ylmB CDS 1575463..1575708 product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232153.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS 1575870..1576706 product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967191.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 gene pgeF CDS 1576713..1577405 product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245324.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS 1577437..1577856 product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244791.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 gene sepF CDS 1577863..1578135 product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221463.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS 1578196..1578969 product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232140.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS 1579063..1579557 product septum site-determining protein DivIVA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221468.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 gene divIVA CDS 1579899..1582664 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245512.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 gene ileS CDS 1582810..1583184 product sporulation-related RNA polymerase-binding protein YlyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245479.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 gene ylyA CDS 1583287..1583751 product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245047.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 gene lspA CDS 1583753..1584664 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245307.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS 1584846..1585391 product bifunctional pyrimidine operon transcriptional regulator/uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232127.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 gene pyrR CDS 1585566..1586873 product uracil permease PyrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221479.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 gene pyrP CDS 1587018..1587932 product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245123.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS 1587916..1589202 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245035.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS 1589199..1590293 product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232115.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS 1590278..1593493 product carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232113.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 gene carB CDS 1593490..1594260 product dihydroorotate oxidase B electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232111.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 gene pyrK CDS 1594260..1595195 product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245610.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS 1595164..1595883 product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232107.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 gene pyrF CDS 1595880..1596512 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232105.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 gene pyrE CDS 1596924..1597625 product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232103.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS 1597637..1598701 product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232101.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 gene cysP CDS 1598750..1599898 product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245745.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 gene sat CDS 1599911..1600504 product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232097.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 gene cysC CDS 1600603..1601376 product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232095.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 gene cobA CDS 1601379..1602164 product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232093.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 gene sirB CDS 1602145..1602633 product precorrin-2 dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232091.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 gene sirC CDS complement(1602671..1604389) product tRNA modification protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886504.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 gene rqcH CDS 1604505..1607177 product calcium-translocating P-type ATPase, SERCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232087.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS 1607260..1608135 product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967215.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS 1608212..1608481 product extracellular matrix/biofilm regulator RemA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154355.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 gene remA CDS 1608465..1609103 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232083.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 gene gmk CDS 1609107..1609310 product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221520.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 gene rpoZ CDS 1609392..1610612 product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967219.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 gene coaBC CDS 1610609..1613026 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 gene priA CDS 1613053..1613535 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232077.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 gene def CDS 1613540..1614493 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232070.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 gene fmt CDS 1614480..1615823 product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232068.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 gene rsmB CDS 1615826..1616917 product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232066.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 gene rlmN CDS 1616924..1617688 product protein-serine/threonine phosphatase PrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232064.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 gene prpC CDS 1617682..1619628 product serine/threonine protein kinase PrkC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232062.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 gene prkC CDS 1619643..1620539 product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232060.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 gene rsgA CDS 1620544..1621197 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232058.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 gene rpe CDS 1621267..1621911 product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245470.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS 1621913..1622062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS complement(1622135..1622323) product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221548.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 gene rpmB CDS 1622602..1622964 product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232054.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS 1622980..1624641 product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245033.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS 1624780..1625442 product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232050.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 gene sdaAB CDS 1625466..1626368 product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232049.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 gene sdaAA CDS 1626346..1628394 product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244692.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 gene recG CDS 1628503..1629069 product transcription factor FapR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232044.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 gene fapR CDS 1629083..1630084 product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232041.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 gene plsX CDS 1630103..1631056 product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245314.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 gene fabD CDS 1631049..1631789 product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232035.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 gene fabG CDS 1631873..1632106 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154310.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 gene acpP CDS 1632246..1632995 product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232030.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 gene rncS CDS 1633097..1636657 product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232028.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 gene smc CDS 1636677..1637666 product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232026.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 gene ftsY CDS 1637801..1638082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15940 note possible pseudo, internal stop codon, frameshifted CDS 1638382..1638900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS complement(1638964..1639449) product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245834.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS 1639628..1639960 product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238590.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS 1639974..1641314 product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232020.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 gene ffh CDS 1641420..1641692 product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220815.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 gene rpsP CDS 1641692..1641937 product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232017.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS 1642059..1642445 product YlqD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232015.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS 1642450..1642974 product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232013.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 gene rimM CDS 1642971..1643702 product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967234.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 gene trmD CDS 1643842..1644189 product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220825.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 gene rplS CDS 1644334..1645182 product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967235.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 gene ylqF CDS 1645253..1646020 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245658.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 gene rnhB CDS 1646049..1647779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245096.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS 1647776..1648057 product FlhB-like flagellar biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232001.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS 1648231..1649388 product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244732.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 gene sucC CDS 1649417..1650319 product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238566.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 gene sucD CDS 1650380..1651273 product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245871.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 gene dprA CDS 1651460..1653535 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245599.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 gene topA CDS 1653611..1654918 product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244725.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 gene trmFO CDS 1654986..1655900 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231988.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 gene xerC CDS 1655913..1656458 product ATP-dependent protease subunit ClpQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238555.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 gene clpQ CDS 1656475..1657635 product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245556.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 gene hslU note possible pseudo, frameshifted CDS 1657610..1657867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16170 note possible pseudo, frameshifted CDS 1657907..1658686 product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220850.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 gene codY CDS 1659067..1659456 product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245656.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 gene flgB CDS 1659456..1659908 product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245521.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 gene flgC CDS 1659914..1660240 product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238544.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 gene fliE CDS 1660286..1661896 product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886506.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 gene fliF CDS 1661909..1662925 product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231981.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 gene fliG CDS 1662918..1663670 product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967242.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 gene fliH CDS 1663667..1664983 product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244825.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 gene fliI CDS 1664986..1665429 product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231977.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 gene fliJ CDS 1665441..1666055 product MotE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231975.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS 1666067..1667530 product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231973.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS 1667527..1667949 product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231970.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 gene flgD CDS 1667971..1668765 product flagellar basal body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231968.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 gene flgG CDS 1668805..1669020 product swarming motility protein SwrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231966.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 gene swrD CDS 1669017..1669442 product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231964.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 gene fliL CDS 1669476..1670474 product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220879.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 gene fliM CDS 1670464..1671603 product flagellar motor switch phosphatase FliY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231962.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 gene fliY CDS 1671629..1671991 product chemotaxis protein CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244957.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 gene cheY CDS 1672006..1672665 product flagella biosynthesis regulatory protein FliZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231958.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 gene fliZ CDS 1672658..1673323 product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245692.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 gene fliP CDS 1673338..1673607 product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220888.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 gene fliQ CDS 1673810..1674394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS 1674394..1675476 product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231949.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 gene flhB CDS 1675509..1677542 product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231947.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 gene flhA CDS 1677542..1678642 product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231945.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 gene flhF CDS 1678639..1679529 product flagellum location/number ATPase FlhG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886507.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 gene flhG CDS 1679531..1680601 product protein-glutamate O-methylesterase CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245823.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 gene cheB CDS 1680598..1682622 product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245734.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 gene cheA CDS 1682644..1683114 product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231938.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 gene cheW CDS 1683133..1683762 product CheY-P phosphatase CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231935.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 gene cheC CDS 1683759..1684259 product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244852.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 gene cheD CDS 1684282..1685046 product RNA polymerase sigma-28 factor SigD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220911.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 gene sigD CDS 1685075..1685578 product swarming motility protein SwrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967248.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 gene swrB CDS 1685722..1686462 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220918.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 gene rpsB CDS 1686564..1687445 product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231929.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 gene tsf CDS 1687591..1688313 product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220923.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 gene pyrH CDS 1688315..1688872 product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231927.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 gene frr CDS 1689003..1689785 product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231925.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS 1689798..1690598 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231924.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 gene cdsA CDS 1690651..1691811 product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245155.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 gene dxr CDS 1691824..1693086 product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886508.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 gene rseP CDS 1693119..1694813 product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231918.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 gene proS CDS 1694871..1699235 product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245843.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS 1699565..1700035 product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231915.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 gene rimP CDS 1700070..1701188 product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231912.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 gene nusA CDS 1701202..1701477 product glucose-induced regulator RulR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967250.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 gene rulR CDS 1701479..1701781 product YlxQ family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220946.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS 1701801..1703948 product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231906.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 gene infB CDS 1704240..1704593 product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967251.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 gene rbfA CDS 1704676..1705605 product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244678.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 gene truB CDS 1705624..1706574 product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245551.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 gene ribF CDS 1706731..1707000 product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220957.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 gene rpsO CDS 1707173..1709290 product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231897.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 gene pnp CDS 1709408..1710367 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244721.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS 1710407..1711636 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245717.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS 1711715..1711972 product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231890.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS 1712165..1713058 product dipicolinic acid synthetase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231888.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 gene dpaA CDS 1713061..1713663 product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244650.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 gene dpaB CDS 1713789..1714829 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244674.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 gene asd CDS 1714921..1716135 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245524.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 gene dapG CDS 1716166..1717038 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245816.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 gene dapA CDS 1717217..1718884 product ribonuclease J2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231875.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 gene rnjB CDS 1719001..1719738 product translocation-enhancing protein TepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245712.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 gene tepA CDS 1719735..1719947 product TepA modulator TepJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231871.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 gene tepJ CDS 1720077..1722440 product DNA translocase SpoIIIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245350.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 gene spoIIIE CDS 1722584..1723309 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245732.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS 1723420..1724658 product bacillibactin exporter BcbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886509.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 gene bcbE CDS 1724910..1726190 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886510.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS 1726187..1727473 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244823.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS 1727526..1728254 product EF-P-5 aminopentanone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244676.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 gene efpI CDS 1728335..1728592 product DUF3243 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245199.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS 1728722..1729513 product DUF3388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000574107.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS 1729532..1730446 product cell shape determination protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886511.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 gene rodZ CDS 1730497..1731078 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244753.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 gene pgsA CDS 1731096..1732346 product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231847.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS 1732519..1733565 product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245789.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 gene recA CDS 1733735..1734910 product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245877.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS 1735186..1736748 product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221010.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 gene rny CDS 1736818..1737612 product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245138.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 gene ymdB CDS 1737811..1738071 product stage V sporulation protein SpoVS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154135.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 gene spoVS CDS 1738337..1739380 product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244880.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 gene tdh CDS 1739394..1740572 product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231837.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS 1740717..1742246 product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244831.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 gene miaB CDS 1742248..1742679 product regulatory iron-sulfur-containing complex subunit RicA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231834.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 gene ricA CDS 1742939..1743484 product outer spore coat protein CotE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231833.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 gene cotE CDS 1743617..1746193 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244841.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 gene mutS CDS 1746210..1748096 product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245099.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 gene mutL CDS 1748531..1749286 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS complement(1749303..1749758) product regulatory YrvL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231830.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS complement(1749904..1750461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245720.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS 1750582..1751199 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231827.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS 1751388..1752065 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231824.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS 1752443..1753309 product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231821.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 gene fabD CDS 1753464..1753613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS 1753814..1754788 product acyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231814.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS 1754785..1757067 product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231811.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 gene fabD CDS 1757154..1757402 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231809.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS 1757380..1758627 product polyketide biosynthesis malonyl-ACP decarboxylase PksF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245287.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 gene pksF CDS 1758628..1759890 product polyketide biosynthesis 3-hydroxy-3-methylglutaryl-ACP synthase PksG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231805.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 gene pksG CDS 1759887..1760657 product enoyl-CoA hydratase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886512.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS 1760697..1761446 product polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231800.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS 1761492..1776632 product polyketide synthase PksJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245563.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 gene pksJ CDS 1776634..1790304 product polyketide synthase PksL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886513.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 gene pksL CDS 1790320..1803102 product polyketide synthase PksM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245093.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 gene pksM CDS 1803092..1819636 product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886514.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS 1819651..1827282 product beta-ketoacyl synthase N-terminal-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245624.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS complement(1827325..1828542) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244857.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS complement(1828779..1829135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245436.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS complement(1829214..1830038) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244800.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS complement(1830141..1831469) product serine protease AprX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967303.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 gene aprX CDS 1831685..1831918 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS 1832198..1832905 product poly-gamma-glutamate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245758.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS 1832980..1833432 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245175.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS complement(1833444..1833797) product multidrug efflux SMR transporter subunit EbrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245163.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 gene ebrB CDS complement(1833811..1834128) product multidrug efflux SMR transporter subunit EbrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967307.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 gene ebrA CDS complement(1834271..1834519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS 1834618..1835022 product YmaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231769.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS 1835122..1836066 product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245569.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 gene miaA CDS 1836106..1836327 product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221097.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 gene hfq CDS 1836523..1836795 product YmzC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245879.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS 1836877..1837107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245262.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS 1837351..1837743 product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231758.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 gene nrdI CDS 1837703..1839805 product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245700.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 gene nrdE CDS 1839823..1840812 product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231754.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 gene nrdF CDS 1840861..1841481 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245105.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS complement(1841545..1842312) product sporulation-specific N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244862.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 gene cwlC CDS 1842874..1843077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS 1843111..1844076 product stage V sporulation protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231746.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 gene spoVK CDS 1844105..1845472 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245432.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 gene hflX CDS 1845490..1846755 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245218.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS 1846865..1847272 product transcriptional repressor GlnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238341.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 gene glnR CDS 1847331..1848665 product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231737.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 gene glnA CDS 1849106..1849945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS 1850263..1850424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17510 note possible pseudo, internal stop codon, frameshifted CDS 1850472..1850624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17520 note possible pseudo, internal stop codon, frameshifted CDS 1850965..1851450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS 1852428..1853819 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245259.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS 1853862..1855463 product xylan 1,4-beta-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245202.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 gene xynB CDS complement(1855632..1856786) product xylose repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244935.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS 1857045..1858382 product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245235.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 gene xylA CDS 1858554..1860053 product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245233.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 gene xylB CDS 1860401..1861099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS complement(1861533..1861976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17600 note possible pseudo, internal stop codon, frameshifted CDS 1862712..1864013 product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886516.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS complement(1864135..1865319) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244881.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 gene alr CDS 1865799..1866260 product DUF2691 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245293.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS 1866291..1866725 product dUTP diphosphatase DutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245820.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 gene dutA CDS complement(1866850..1867023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS complement(1867336..1867557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS 1867733..1867891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS 1867946..1868110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS 1868062..1868238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS 1868377..1869216 product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244896.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS complement(1869426..1870145) product YrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023592782.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS complement(1870918..1871118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS 1871721..1872122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967329.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS complement(1872183..1872617) product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231627.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS 1872772..1873032 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS 1873054..1873242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231626.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS 1873406..1874602 product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017008.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS 1874599..1874910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS 1875076..1875882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231618.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS 1875887..1876507 product DUF4166 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244960.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS 1876501..1878132 product YndJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231612.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS 1878238..1878549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231610.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS 1878780..1879538 product gamma-polyglutamate hydrolase PghL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245793.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 gene pghL CDS complement(1879561..1880013) product YndM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231606.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 note possible pseudo, internal stop codon, frameshifted CDS 1880211..1880633 product FosM family fosfomycin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231604.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 gene fosM CDS 1880709..1881137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS complement(1881527..1882144) product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238209.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 gene lexA CDS 1882300..1882611 product cell division suppressor protein YneA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231598.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 gene yneA CDS 1882630..1883283 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231596.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS 1883347..1883580 product DUF896 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231595.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS 1883749..1885752 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245397.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 gene tkt CDS 1885907..1886353 product sporulation inhibitor of replication protein SirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231591.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 gene sirA CDS 1886439..1886657 product YneF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221221.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS complement(1886731..1886922) product aspartyl-phosphate phosphatase YnzD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886518.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 gene ynzD CDS 1887124..1887831 product cytochrome c-type biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231585.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 gene ccdA CDS 1887920..1888279 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245707.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS 1888370..1888852 product CcdC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231582.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS complement(1888883..1889311) product DynA interaction protein YneK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231580.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 gene yneK CDS complement(1889543..1889917) product outer spore coat protein CotM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886520.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 gene cotM CDS complement(1890016..1890162) product small acid-soluble spore protein P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221237.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS complement(1890194..1890358) product acid-soluble spore protein SspO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244839.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 gene sspO CDS 1890566..1893295 product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245728.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 gene acnA CDS 1893368..1893880 product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244797.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS 1893960..1894085 product FbpB family small basic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244964.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS 1894150..1894296 product acid-soluble spore protein SspN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231569.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 gene sspN CDS 1894333..1894584 product small acid-soluble spore protein Tlp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231568.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 gene tlp CDS 1894668..1895084 product YbgC/FadM family acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231566.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS 1895100..1895399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231564.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS complement(1895430..1895717) product HesB/YadR/YfhF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231562.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS complement(1895797..1896378) product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231560.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 gene plsY CDS 1896547..1896954 product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245606.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS 1897350..1899317 product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231552.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 gene parE CDS 1899320..1901740 product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231550.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 gene parC CDS complement(1901788..1901913) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS complement(1901939..1902292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014113949.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS 1902788..1904131 product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231542.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS 1904434..1905933 product endo-1,4-beta-glucanase EglS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231540.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 gene eglS CDS 1906008..1906271 product YnfE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231535.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS 1906545..1906973 product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231531.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS 1906997..1907887 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245127.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 gene galU CDS 1907967..1908554 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231529.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS complement(1908602..1908730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS complement(1908693..1908890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS complement(1909199..1909495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS complement(1909685..1910434) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS complement(1910552..1910872) product YolD-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398710.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS 1911032..1911235 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18270 note possible pseudo, frameshifted CDS 1911208..1911372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18280 note possible pseudo, frameshifted CDS complement(1911421..1912620) product oligoribonuclease NrnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245472.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 gene nrnB CDS complement(1912790..1914319) product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231527.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS complement(1914336..1915118) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231526.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS complement(1915136..1916038) product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231525.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 gene ldeG CDS complement(1916053..1916274) product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245519.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS complement(1916289..1917623) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231523.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS complement(1917633..1919282) product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244755.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS complement(1919325..1920467) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245114.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS complement(1920974..1922506) product glycoside hydrolase family 10 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231519.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS complement(1922661..1923053) product DUF1360 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231518.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS complement(1923223..1931055) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS complement(1931153..1947250) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS complement(1947307..1959222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS complement(1959243..1960445) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245314.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 gene fabD CDS complement(1961416..1962891) product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399303.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 gene dacB CDS complement(1962924..1963901) product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399304.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 gene galM CDS complement(1964034..1965425) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399508.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS 1965712..1966257 product DL-endopeptidase inhibitor IseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399558.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 gene iseA CDS 1966710..1967273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS 1967365..1967559 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS 1967725..1967862 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS 1967930..1968487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS complement(1968554..1969531) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244876.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS complement(1969589..1969852) product phage holin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232653.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS complement(1969865..1970077) product BhlA/UviB family holin-like peptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246119.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS complement(1970133..1970306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS complement(1970306..1970677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS complement(1970690..1972480) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS complement(1972493..1972663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS complement(1972660..1972968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS complement(1972984..1974879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS complement(1974916..1976622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS complement(1976634..1977473) product phage tail family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009911828.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS complement(1977473..1981351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS complement(1981364..1981543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS complement(1981546..1981890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS complement(1981939..1982553) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS complement(1982557..1982934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS complement(1982931..1983314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS complement(1983307..1983678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS complement(1983611..1983958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS complement(1983974..1984465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS complement(1984493..1984810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS complement(1984822..1986015) product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905933.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS complement(1986052..1986678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS complement(1986668..1987915) product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466243.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS complement(1987921..1988139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS complement(1988152..1989861) product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127897.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS complement(1989861..1990394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS complement(1990466..1990807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS complement(1991257..1992012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS complement(1992075..1992413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS complement(1992607..1993359) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS complement(1993592..1994134) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012145.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS complement(1994134..1994583) product ArpU family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166128.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS complement(1994823..1995518) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS complement(1995533..1996039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS complement(1996092..1996988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS complement(1997001..1997249) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS complement(1997246..1997473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS complement(1997470..1997787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS complement(1997830..1998027) product phage-like element PBSX protein XtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244900.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 gene xtrA CDS complement(1998105..1998260) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS complement(1998273..1998413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS complement(1998382..1998552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS complement(1998521..1999069) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS complement(1999066..1999224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS complement(1999221..1999370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS complement(1999385..2000272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS complement(2000199..2001071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS complement(2001064..2001282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS complement(2001297..2001626) product DUF771 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286573.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS complement(2001761..2001964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS 2002130..2002528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS complement(2002818..2002946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS complement(2002965..2004065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS 2004320..2005429 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286587.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 tRNA complement(2005588..2005660) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00570 CDS complement(2005713..2006258) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231473.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS complement(2006574..2006804) product excisionase family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231472.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS 2006989..2008752 product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231470.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 gene ggt CDS complement(2008915..2009094) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS 2009127..2009336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19100 note possible pseudo, frameshifted CDS 2009333..2009842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19110 note possible pseudo, frameshifted CDS complement(2009895..2011376) product glutamate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231462.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 gene gltD CDS complement(2011393..2015955) product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967365.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 gene gltB CDS 2016101..2017003 product glutamate biosynthesis transcriptional regulator GltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399246.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 gene gltC CDS complement(2017057..2018172) product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231456.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 gene proB CDS complement(2018169..2018984) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886524.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 gene proC CDS complement(2019208..2019576) product replication termination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220337.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 gene rtp CDS 2019881..2021098 product monooxygenase YjiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232789.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 gene yjiB CDS complement(2021130..2021846) product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399223.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS 2022005..2022310 product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967371.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS 2022380..2023138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231443.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS 2023195..2023728 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231441.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS complement(2023916..2024908) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966673.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS complement(2024902..2025648) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966674.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS complement(2025658..2026374) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966675.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS complement(2027022..2028266) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231439.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS complement(2028361..2029824) product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399436.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS complement(2029842..2030843) product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967372.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS 2031202..2033244 product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399552.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS 2033353..2033646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231432.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS complement(2033738..2033953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS 2034728..2034850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS 2034907..2035200 product YozQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231427.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS complement(2035341..2036945) product HAMP domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231425.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS 2037342..2038793 product 4-hydroxyphenylacetate 3-monooxygenase, oxygenase component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231423.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 gene hpaB CDS complement(2038858..2039556) product expansin ExlX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231419.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 gene exlX CDS complement(2039819..2040496) product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399503.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS 2040668..2041705 product polysaccharide lyase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967389.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS complement(2042024..2042653) product acetoin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002469273.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 note possible pseudo, internal stop codon, frameshifted CDS complement(2042839..2043153) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19400 note possible pseudo, frameshifted CDS complement(2043413..2044129) product NPP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975777.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS 2044386..2045072 product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399422.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS complement(2045261..2045452) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS complement(2045449..2045751) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399414.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS complement(2045987..2046343) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS 2046685..2046807 product phosphatase RapK inhibitor PhrK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399440.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 gene phrK CDS 2047042..2047404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967392.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS complement(2047493..2047687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399432.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS complement(2047832..2048326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231402.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS complement(2048375..2049286) product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231400.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS 2049658..2050140 product DUF2975 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399412.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS 2050151..2050375 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231396.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS 2050499..2051296 product DUF817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399435.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS complement(2051382..2052269) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399248.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS 2052370..2053248 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399570.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS complement(2053603..2053767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245467.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS complement(2053852..2054316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS complement(2054401..2054547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS complement(2056144..2056776) product type 1 glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231388.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS 2057124..2058038 product class A beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231385.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 gene bla CDS complement(2058083..2058289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19610 note possible pseudo, frameshifted CDS complement(2058791..2059411) product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906226.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS 2059946..2060449 product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399152.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS complement(2060839..2061351) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245754.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS 2061640..2061840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19650 note possible pseudo, frameshifted CDS complement(2062090..2062290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS complement(2062451..2062615) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19670 note possible pseudo, frameshifted CDS 2062999..2064372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS 2064369..2065475 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807837.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS 2065462..2066169 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078432.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 CDS 2066316..2066834 product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651510.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 CDS complement(2066916..2074292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS 2074620..2074886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS 2075082..2075255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS 2075458..2075808 product DUF2200 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970036.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS complement(2076602..2077192) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518846.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS complement(2077164..2078012) product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435498.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS complement(2078194..2078427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19780 note possible pseudo, frameshifted CDS 2079704..2080210 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19790 note possible pseudo, internal stop codon, frameshifted CDS 2080198..2080692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19800 note possible pseudo, frameshifted CDS 2080682..2080954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS 2081212..2081943 product beta-glucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244531.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 gene bglS CDS complement(2082587..2083072) product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246042.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS 2083276..2084712 product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399325.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS complement(2084968..2085300) product chaperone CsaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399582.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 gene csaA CDS complement(2085365..2086084) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886529.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS complement(2086105..2086605) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231298.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 note possible pseudo, frameshifted CDS complement(2086802..2087377) product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399277.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS complement(2087388..2087738) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19890 note possible pseudo, frameshifted CDS complement(2087711..2088088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19900 note possible pseudo, frameshifted CDS complement(2088137..2088619) product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231292.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS complement(2088673..2089620) product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231290.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS 2089809..2090354 product mother cell-specific sporulation protein Csk22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399253.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 gene csk22 CDS complement(2090380..2090700) product Zn(II)-responsive metalloregulatory transcriptional repressor CzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231284.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 gene czrA CDS 2090894..2091571 product lysozyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231283.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS complement(2091663..2092199) product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231280.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS complement(2092337..2093119) product VLRF1 family aeRF1-type release factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399450.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS 2093289..2093786 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399390.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS 2093850..2094827 product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399250.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS 2094994..2096052 product fatty acid desaturase DesE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399588.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 gene desE CDS 2096176..2097288 product two-component sensor histidine kinase DesK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231271.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 gene desK CDS 2097307..2097906 product two-component system response regulator DesR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399356.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 gene desR CDS complement(2097941..2099449) product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087134.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS complement(2099714..2100577) product 3D domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231267.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS complement(2100824..2102599) product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399229.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 gene recQ CDS complement(2103157..2103783) product FMN-dependent NADH-azoreductase AzoJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231260.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 gene azoJ CDS complement(2103934..2104425) product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231259.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS complement(2104607..2104951) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220141.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS complement(2105160..2105363) product DUF6501 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231245.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS 2105594..2107081 product aldehyde dehydrogenase DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399332.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 gene dhaS CDS 2107181..2109079 product sporulenol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399534.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 gene sqhC CDS 2109069..2109914 product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399227.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS complement(2109947..2111284) product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399312.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS 2111515..2112480 product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399225.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS complement(2112530..2113783) product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399364.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 gene odhB CDS complement(2113799..2116633) product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399330.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 gene sucA CDS complement(2116861..2118777) product nitric oxide reductase activation protein NorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399326.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS complement(2118788..2119678) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886530.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS complement(2119766..2120356) product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399243.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS complement(2120450..2121685) product D-gamma-glutamyl-meso-diaminopimelic acid endopeptidase CwlS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399265.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 gene cwlS CDS complement(2122065..2123282) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399256.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS complement(2123517..2124131) product cyclic di-AMP synthase CdaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886531.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 gene cdaS CDS 2124407..2125765 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231218.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS 2125781..2126629 product RsbT co-antagonist RsbRC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231216.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 gene rsbRC CDS complement(2126655..2127320) product bacillithiol biosynthesis deacetylase BshB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231215.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 gene bshB2 CDS complement(2127339..2127689) product YojF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231213.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS complement(2127686..2127964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231211.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS complement(2128040..2128936) product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231209.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 gene rarD CDS 2129035..2129496 product spore germination protein GerT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231207.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 gene gerT CDS complement(2129530..2129766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS 2130190..2130579 product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231200.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS complement(2130997..2131335) product transcriptional regulator YodB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399427.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 gene yodB CDS 2131465..2132073 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231196.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS complement(2132117..2132719) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231194.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS complement(2132735..2133556) product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231191.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS 2133830..2134030 product DUF3311 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231189.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS 2134030..2135520 product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399269.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS complement(2135555..2136955) product carboxy-terminal processing protease CtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231186.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 gene ctpA CDS 2137108..2137809 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399589.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS 2137897..2138148 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231182.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS complement(2138231..2139052) product LD-carboxypeptidase LdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399387.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 gene ldcB CDS complement(2139135..2139836) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231176.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 gene deoD CDS 2140039..2140164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231174.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS complement(2140203..2140517) product shape determination protein YodL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399431.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 gene yodL CDS complement(2140578..2141189) product phosphatidylglycerophosphatase PgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399336.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 gene pgpB CDS complement(2141270..2141446) product YozD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231166.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS 2141568..2141711 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231164.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS complement(2141708..2142388) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231162.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS complement(2142544..2142768) product YozE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231160.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS complement(2142855..2143133) product YokU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399539.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS complement(2143130..2144545) product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399420.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 gene ablA CDS complement(2144575..2145402) product putative beta-lysine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399564.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 gene ablB CDS complement(2145380..2146684) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886532.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS complement(2146699..2147352) product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399417.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS complement(2147337..2148026) product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230839.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS complement(2148033..2149367) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230836.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS complement(2149690..2150469) product spore maturation N-acetyltransferase CgeE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230830.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 gene cgeE CDS complement(2150498..2151778) product spore maturation glycosyltransferase CgeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230828.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 gene cgeD CDS complement(2151843..2152148) product spore maturation protein CgeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230826.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 gene cgeC CDS 2152354..2152740 product spore crust protein CgeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230824.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 gene cgeA CDS 2152747..2153700 product spore maturation protein CgeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399421.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 gene cgeB CDS complement(2153754..2154902) product phytase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230820.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS 2155268..2156293 product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289359.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS complement(2156337..2156771) product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230813.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 gene msrB CDS complement(2156772..2157305) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230812.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 gene msrA CDS 2157437..2157862 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398634.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS complement(2157914..2159251) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398532.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS complement(2159325..2159519) product protein YpmT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230808.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 gene ypmT CDS complement(2159532..2160095) product YpmS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230807.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS complement(2160105..2160872) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245956.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS complement(2160950..2161531) product cytochrome c oxidase assembly accessory protein ScuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245947.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 gene scuA CDS complement(2161684..2161935) product DUF2535 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399020.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS complement(2162022..2163290) product threonine ammonia-lyase IlvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230803.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 gene ilvA CDS 2163539..2164534 product sigma-54-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399025.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS 2164555..2165196 product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398522.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS complement(2165229..2165849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398497.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS complement(2165850..2166356) product dihydrofolate reductase DfrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230799.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 gene dfrA CDS complement(2166353..2167147) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398587.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS complement(2167231..2167764) product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230797.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS complement(2167782..2168396) product YpjP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967559.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS complement(2168656..2169441) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230795.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS complement(2169483..2169917) product bacilliredoxin BrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230794.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 gene brxA CDS complement(2170022..2171698) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967560.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 gene ilvD CDS complement(2171989..2173122) product conserved virulence factor C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398677.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS complement(2173182..2173799) product Mn(2+)-dependent (deoxy)ribonucleoside pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230787.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 gene hdhQ CDS complement(2173812..2174294) product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230784.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS 2174650..2175555 product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398721.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 gene metA CDS 2175813..2176934 product diglucosyl diacylglycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246153.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS 2177178..2177378 product cold-shock protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230776.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 gene cspD CDS complement(2177430..2177612) product transcriptional regulator DegR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230774.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 gene degR CDS 2177767..2178036 product DUF2564 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398863.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS complement(2178065..2178247) product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399003.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS complement(2178240..2178920) product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230769.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS 2179003..2179692 product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230767.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS 2179692..2180147 product reverse transcriptase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230765.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS 2180131..2180259 product small, acid-soluble spore protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218255.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 gene sspL CDS complement(2180267..2181157) product 5'-3' exonuclease ExnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230763.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 gene exnP CDS complement(2181258..2181401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230761.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS complement(2181479..2181736) product YpbS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230757.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS complement(2181801..2185382) product dynamin GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230755.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 gene dynA CDS complement(2185717..2186223) product alkylpyrone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398552.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 gene bpsB CDS complement(2186227..2187324) product type III polyketide synthase BpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230750.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 gene bpsA CDS complement(2187397..2188713) product xanthine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230748.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 gene pbuX CDS complement(2188710..2189294) product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230744.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 gene xpt CDS complement(2189629..2191134) product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398513.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 gene ypwA CDS complement(2191247..2192239) product 2-keto-3-deoxygluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230734.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 gene kdgT CDS complement(2192283..2192873) product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230732.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 gene eda CDS complement(2192875..2193849) product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230727.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 gene kdgK CDS complement(2193887..2194906) product pectin utilization transcriptional regulator KdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230725.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 gene kdgR CDS 2195129..2195956 product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230722.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 gene kduI CDS 2195958..2196722 product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230720.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 gene kduD CDS complement(2196765..2198690) product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230718.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS complement(2198794..2198985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246090.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS complement(2199353..2200510) product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967571.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS complement(2201056..2201352) product cell division regulator GpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225629.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 gene gpsB CDS complement(2201428..2201973) product DUF1273 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398656.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS complement(2202599..2203849) product metal-dependent exonucleaseMrfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398813.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 gene mrfB CDS complement(2203863..2206112) product ATP-dependent helicase MrfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246149.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 gene mrfA CDS complement(2206215..2206721) product glucose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967573.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS 2206859..2207278 product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398640.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS complement(2207299..2207667) product YppG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398696.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS 2207856..2208044 product YppF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230690.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS complement(2208084..2208455) product YppE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246080.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS complement(2208501..2208746) product YppD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398488.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS complement(2209074..2210036) product DUF2515 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398707.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS 2210077..2210697 product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399067.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 gene recU CDS 2210719..2213472 product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398589.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS complement(2213546..2214040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967579.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS complement(2214037..2214696) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967580.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 gene nth CDS complement(2214715..2215413) product DNA replication protein DnaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398499.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 gene dnaD CDS complement(2215508..2216800) product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398777.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 gene asnS CDS complement(2216942..2218123) product aspartate transaminase AspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398489.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 gene aspB CDS complement(2218146..2218631) product cell wall elongation/penicillin-binding protein regulator TseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230665.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 gene tseB CDS complement(2218640..2218810) product YpmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225588.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS complement(2218952..2221816) product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398920.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 gene dinG CDS complement(2221873..2222256) product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225586.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 gene panD CDS complement(2222258..2223118) product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230656.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 gene panC CDS complement(2223120..2223953) product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230652.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 gene panB CDS complement(2224198..2225175) product bifunctional biotin--[acetyl-CoA-carboxylase] synthetase/biotin operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230650.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS complement(2225160..2226353) product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230647.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS complement(2226358..2227491) product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230645.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 gene bshA CDS complement(2227488..2228198) product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230642.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 gene bshB1 CDS complement(2228191..2228604) product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230640.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 gene mgsA CDS complement(2228620..2229423) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246190.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 gene dapB CDS complement(2229435..2229770) product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398996.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS 2229910..2230782 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230635.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS complement(2230819..2231613) product sporulation protein YpjB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230633.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 gene ypjB CDS complement(2231682..2232239) product DUF1405 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886552.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS complement(2232386..2233153) product menaquinol-cytochrome c reductase cytochrome b/c subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225562.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS complement(2233188..2233862) product menaquinol-cytochrome c reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225560.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 gene qcrB CDS complement(2233864..2234367) product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230627.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS complement(2234513..2234956) product YpiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246201.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS complement(2235011..2235550) product ReoY family proteolytic degradation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399171.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS complement(2235622..2236893) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230620.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS complement(2237242..2238528) product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246068.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 gene aroA CDS complement(2238540..2239655) product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230615.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS complement(2239704..2240786) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399129.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 gene hisC CDS complement(2240798..2241601) product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230608.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 gene trpA CDS complement(2241594..2242796) product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230605.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 gene trpB CDS complement(2242777..2243424) product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398742.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS complement(2243429..2244181) product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886553.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 gene trpC CDS complement(2244174..2245190) product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245959.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 gene trpD CDS complement(2245162..2246709) product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246124.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 gene trpE CDS complement(2246925..2247305) product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967606.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 gene aroH CDS complement(2247305..2248393) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230592.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 gene aroB CDS complement(2248393..2249565) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398727.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 gene aroC CDS complement(2249640..2250410) product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230589.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 gene cheR CDS complement(2250650..2251096) product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886554.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 gene ndk CDS complement(2251215..2252261) product heptaprenyl diphosphate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886555.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 gene hepT CDS complement(2252203..2252904) product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230580.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 gene menG CDS complement(2252911..2253666) product heptaprenyl diphosphate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398550.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 gene hepS CDS complement(2253830..2254057) product trp RNA-binding attenuation protein MtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230576.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 gene mtrB CDS complement(2254079..2254651) product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225516.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 gene folE CDS complement(2254839..2255117) product non-specific DNA-binding protein Hbs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003153447.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 gene hbs CDS complement(2255492..2256970) product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230572.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 gene spoIVA CDS complement(2257159..2257887) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230571.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS complement(2257909..2258112) product DUF2768 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399143.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS complement(2258451..2259488) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230566.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 gene gpsA CDS complement(2259506..2260816) product ribosome-associated GTPase EngA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230565.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 gene engA CDS complement(2260971..2261165) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230563.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS complement(2261162..2262055) product YIEGIA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230562.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS complement(2262052..2262651) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230560.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS 2262729..2262860 product YpzI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513900.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS complement(2262903..2263952) product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399098.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 gene fni CDS complement(2263965..2265113) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230556.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 gene rpsA CDS complement(2265348..2266022) product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230555.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 gene cmk CDS complement(2266101..2266277) product YpfB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230553.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS complement(2266323..2266976) product cyclic di-GMP receptor DgrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230551.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 gene dgrA CDS complement(2267070..2268422) product germination protein YpeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230547.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 gene ypeB CDS complement(2268458..2269369) product spore cortex-lytic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398523.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 gene sleB CDS complement(2269522..2270178) product glutamic-type intramembrane protease PrsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230542.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 gene prsW CDS complement(2270296..2271270) product YpdA family putative bacillithiol disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399008.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS complement(2271380..2272654) product NAD-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886557.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 gene gudB CDS complement(2272811..2273395) product genetic competence negative regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230533.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS complement(2273555..2274334) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230532.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS complement(2274418..2274861) product YpbF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230531.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS complement(2274924..2275676) product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398603.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS complement(2275627..2276214) product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886558.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS complement(2276256..2277746) product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230528.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS complement(2277739..2278797) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398594.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS 2279064..2279312 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225461.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS complement(2279351..2279920) product riboflavin transporter FmnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399159.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 gene fmnP CDS complement(2279947..2280210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS 2280414..2281991 product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398713.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 gene serA CDS complement(2282035..2282802) product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230523.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 gene aroD CDS complement(2282915..2284018) product anti-sigma-X factor RsiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967642.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 gene rsiX CDS complement(2283954..2284538) product RNA polymerase sigma factor SigX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230521.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 gene sigX CDS complement(2284742..2286511) product sensor histidine kinase ResE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230520.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 gene resE CDS complement(2286508..2287230) product DNA-binding response regulator ResD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246107.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 gene resD CDS complement(2287312..2288487) product cytochrome c biogenesis protein ResC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398799.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 gene resC CDS complement(2288507..2290135) product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230515.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 gene resB CDS complement(2290132..2290671) product thiol-disulfide oxidoreductase ResA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230513.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 gene resA CDS complement(2290766..2291500) product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398815.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 gene rluB CDS complement(2291592..2292128) product spore maturation protein SpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230509.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 gene spmB CDS complement(2292133..2292723) product spore maturation protein SpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398980.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 gene spmA CDS complement(2292711..2293859) product D-alanyl-D-alanine carboxypeptidase DacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230505.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 gene dacB CDS complement(2293984..2294523) product YpuI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399065.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 CDS complement(2294578..2295171) product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223904.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 gene scpB CDS complement(2295161..2295946) product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246108.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 gene scpA CDS 2296193..2296717 product DUF309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230498.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS complement(2296731..2297105) product GNAT family N-acetyltransferase RibT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223910.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 gene ribT CDS complement(2297218..2297682) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223915.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 gene ribH CDS complement(2297715..2298911) product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398484.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS complement(2298926..2299573) product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398505.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 gene ribE CDS complement(2299584..2300669) product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398763.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 gene ribD CDS complement(2301065..2301409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398735.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS complement(2301646..2302200) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246166.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 gene lepB CDS complement(2302711..2302917) product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223929.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS complement(2303451..2303882) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223931.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS 2303928..2304116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22300 CDS 2304139..2305011 product DUF1002 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967658.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS complement(2305041..2306360) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398851.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 gene lysA CDS complement(2306363..2306563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS complement(2306467..2307948) product spore germination protein SpoVAF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230471.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 gene spoVAF CDS complement(2307893..2308510) product stage V sporulation protein SpoVABEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230469.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 gene spoVAEA CDS complement(2308518..2308868) product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230467.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 gene spoVAE CDS complement(2308870..2309886) product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230465.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 gene spoVAD CDS complement(2309899..2310351) product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223947.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 gene spoVAC CDS complement(2310364..2310789) product stage V sporulation protein SpoVAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230463.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 gene spoVAB CDS complement(2310779..2311402) product stage V sporulation protein SpoVAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246053.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 gene spoVAA CDS complement(2311526..2312293) product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230458.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 gene sigF CDS complement(2312305..2312745) product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230452.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 gene spoIIAB CDS complement(2312742..2313095) product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398633.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 gene spoIIAA CDS complement(2313191..2314360) product D-alanyl-D-alanine carboxypeptidase DacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398637.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 gene dacF CDS complement(2314520..2315335) product purine nucleoside phosphorylase I, inosine and guanosine-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230447.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS complement(2315348..2316532) product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230444.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 gene deoB CDS complement(2316695..2317585) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398985.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 gene xerD CDS complement(2317593..2317820) product YqzK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230440.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS complement(2317945..2318394) product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223972.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 gene fur CDS complement(2318507..2319151) product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398593.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 gene spoIIM CDS complement(2319253..2319468) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246030.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS complement(2319570..2320889) product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398731.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS complement(2320907..2322313) product malate-H+/Na+-lactate antiporter MleN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230432.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 gene mleN CDS complement(2322456..2323883) product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230430.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 gene aspA CDS complement(2323929..2324918) product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399032.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 gene ansA CDS 2325100..2325450 product HTH-type transcriptional regulator AnsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399024.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 gene ansR CDS complement(2325459..2325635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS 2325705..2326037 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22580 note possible pseudo, frameshifted CDS 2326337..2326855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS complement(2326764..2327912) product TIGR00375 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246128.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS complement(2327909..2328466) product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398600.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 gene nudF CDS 2328540..2328662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS 2328726..2329646 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398525.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 CDS complement(2329678..2329902) product YqkE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886561.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS 2330066..2330983 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398519.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 CDS complement(2331022..2332161) product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392361.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 gene ftsW CDS complement(2332164..2333321) product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392081.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 gene rodA CDS complement(2333337..2333981) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123715.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS complement(2334449..2334688) product YqkC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230411.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS complement(2334702..2335025) product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226552.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS complement(2335022..2336053) product bifunctional GNAT family N-acetyltransferase/GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398771.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS complement(2336050..2336388) product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245961.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS complement(2336401..2336871) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398668.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS complement(2337061..2337399) product YolD-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398477.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS complement(2337396..2338631) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886562.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS 2338801..2339007 product YqzH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398642.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS complement(2339033..2339314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS 2339524..2340756 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398495.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS 2340808..2340993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS complement(2340962..2341348) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398989.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS complement(2341353..2342198) product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245966.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 gene coaA CDS complement(2342384..2343730) product D-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399082.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 gene dsdA CDS complement(2343808..2344587) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398795.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 CDS complement(2344593..2345552) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398688.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 CDS 2345955..2346791 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398788.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 gene proC CDS complement(2346841..2348475) product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398867.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS 2348649..2349665 product NADPH dehydrogenase NamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230377.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 gene namA CDS 2349775..2350536 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230373.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS complement(2350599..2351264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22890 note possible pseudo, frameshifted CDS complement(2351448..2351780) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017149794.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS complement(2351882..2352031) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001265708.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 gene rpmG CDS complement(2352111..2353034) product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398681.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 gene rnz CDS 2353260..2354729 product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246151.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 gene zwf CDS complement(2354861..2356270) product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230365.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 gene gndA CDS complement(2356381..2357625) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398755.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 CDS 2357689..2357985 product membrane protein insertion/folding monitor MifM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886563.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 gene mifM CDS 2358016..2358843 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230359.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS 2359008..2359736 product DUF2071 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399111.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS complement(2359785..2360900) product tripeptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230352.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS complement(2360918..2362447) product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886564.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS complement(2362434..2362856) product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399095.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 gene mce CDS complement(2363059..2363589) product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398604.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS complement(2363641..2364609) product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246146.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS complement(2364682..2365404) product arginine ABC transporter ATP-binding protein ArtR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398740.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 gene artR CDS complement(2365397..2366056) product arginine ABC transporter permease ArtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230340.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 gene artQ CDS complement(2366135..2366902) product arginine ABC transporter substrate-binding protein ArtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398706.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 gene artP CDS complement(2367170..2367607) product bacilliredoxin BrxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226477.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 gene brxB CDS 2367766..2368650 product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230330.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS 2368732..2369901 product multidrug efflux MFS transporter Bmr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230328.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 gene bmr CDS 2369974..2370810 product multidrug efflux transcriptional regulator BmrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230325.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 gene bmrR CDS complement(2370871..2372148) product branched-chain alpha-keto dehydrogenase complex dihydrolipoyllysine-residue (2-methylpropanoyl)transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230323.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 gene bfmBB CDS complement(2372170..2373153) product 3-methyl-2-oxobutanoate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398638.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 gene bfmBAB CDS complement(2373167..2374159) product 3-methyl-2-oxobutanoate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398565.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 gene bfmBAA CDS complement(2374181..2375605) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230317.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 gene lpdA CDS complement(2375627..2376712) product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230311.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 gene buk CDS complement(2376737..2377831) product branched-chain amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230309.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 gene bcd CDS complement(2377843..2378742) product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398694.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 gene yqiS CDS complement(2378868..2380943) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398669.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS 2381096..2381332 product DUF2627 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230304.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS complement(2381375..2382280) product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398772.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 gene prpB CDS complement(2382300..2383718) product bifunctional 2-methylcitrate dehydratase/aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398686.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS complement(2383740..2384858) product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230298.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 gene mmgD CDS complement(2384891..2386030) product Acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245999.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS complement(2386057..2386920) product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230294.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS complement(2386944..2388125) product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230291.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS complement(2388253..2388984) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230288.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS complement(2389064..2389678) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886565.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS complement(2389704..2390000) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230284.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS 2390534..2391652 product NADH-dependent flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398691.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS complement(2392193..2392996) product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226427.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 gene spo0A CDS complement(2393273..2394553) product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398697.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 gene spoIVB CDS complement(2394727..2396457) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230267.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 gene recN CDS complement(2396493..2396942) product arginine repressor ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230265.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 gene argR CDS complement(2397039..2397884) product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230264.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 CDS complement(2397881..2399782) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245985.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 gene dxs CDS complement(2399963..2400853) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230262.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS complement(2400843..2401097) product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226409.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 CDS complement(2401094..2402440) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246103.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 gene xseA CDS complement(2402579..2403430) product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230259.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 gene folD CDS complement(2403442..2403837) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230256.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 gene nusB CDS complement(2404102..2404509) product fatty acid biosynthesis protein YqhY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230254.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 gene yqhY CDS complement(2404530..2405882) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230253.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 gene accC CDS complement(2405894..2406376) product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230252.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 gene accB CDS complement(2406533..2407189) product stage III sporulation ratchet engulfment protein SpoIIIAH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230250.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 gene spoIIIAH CDS complement(2407190..2407879) product stage III sporulation protein AG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230248.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 gene spoIIIAG CDS complement(2407872..2408492) product stage III sporulation protein AF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230233.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 gene spoIIIAF CDS complement(2408506..2409705) product stage III sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230230.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 gene spoIIIAE CDS complement(2409724..2410125) product stage III sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230228.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 gene spoIIIAD CDS complement(2410132..2410338) product stage III sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003153142.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 gene spoIIIAC CDS complement(2410361..2410876) product stage III sporulation protein SpoIIIAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230227.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 gene spoIIIAB CDS complement(2410870..2411793) product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230226.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 gene spoIIIAA CDS complement(2411869..2412150) product YqhV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398639.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS complement(2412300..2412857) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226377.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 gene efp CDS complement(2412882..2413943) product aminopeptidase PapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230224.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 gene papA CDS complement(2413946..2414386) product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230223.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 gene aroQ CDS complement(2414474..2415007) product YqhR family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230222.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 CDS 2415236..2416192 product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967716.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS 2416232..2416627 product SA1362 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226367.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS complement(2416624..2417499) product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230220.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS complement(2417624..2418052) product transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003236923.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 gene mntR CDS complement(2418152..2418988) product octanoyltransferase LipM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398586.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 gene lipM CDS 2419179..2419559 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398485.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS complement(2419597..2421063) product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230209.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 gene gcvPB CDS complement(2421056..2422402) product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230207.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 gene gcvPA CDS complement(2422432..2423520) product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398598.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 gene gcvT CDS 2423963..2425636 product SNF2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398544.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 CDS 2425657..2426451 product YqhG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230200.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS 2426637..2426810 product anti-repressor SinI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230187.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS 2426844..2427179 product transcriptional regulator SinR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226345.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 gene sinR CDS complement(2427273..2428058) product biofilm matrix protein TasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398632.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 gene tasA CDS complement(2428122..2428706) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246088.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS complement(2428678..2429439) product amyloid fiber anchoring/assembly protein TapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399106.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 gene tapA CDS 2429711..2430034 product YqzG/YhdC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246051.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 CDS complement(2430076..2430255) product YqzE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230176.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 CDS complement(2430327..2430701) product ComG operon protein ComGG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230170.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 gene comGG CDS complement(2430702..2430989) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23760 CDS complement(2431111..2431458) product ComG operon protein 5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230165.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 gene comGE CDS complement(2431442..2431873) product comG operon protein ComGD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398628.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 gene comGD CDS complement(2431863..2432159) product comG operon protein ComGC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230162.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 gene comGC CDS complement(2432173..2433210) product comG operon protein ComGB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246116.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 gene comGB CDS complement(2433197..2434267) product competence protein ComGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399124.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 gene comGA CDS complement(2434480..2434896) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245462.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS complement(2434953..2435906) product magnesium transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399136.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 gene corA CDS 2436077..2437378 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967730.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS complement(2437430..2438269) product RsbT co-antagonist protein RsbRD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398754.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 gene rsbRD tRNA 2438358..2438428 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00580 CDS complement(2438495..2438872) product transcriptional regulator MgsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230147.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 gene mgsR CDS 2439105..2439350 product DUF2626 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226300.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS complement(2439390..2440025) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967732.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS 2440183..2440356 product DUF2759 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230141.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS complement(2440388..2440702) product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230139.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS complement(2440705..2441760) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230137.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS complement(2441832..2442956) product M14 family metallocarboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886566.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS complement(2443042..2444955) product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399146.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS complement(2445071..2446123) product glucose kinase GlcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230132.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 gene glcK CDS complement(2446054..2446263) product YqgQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399107.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 CDS complement(2446379..2447899) product rhomboid protease YqgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230128.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 gene yqgP CDS complement(2447988..2448161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230126.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS complement(2448228..2448791) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230122.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS complement(2448877..2449026) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003153056.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 gene rpmG CDS complement(2449110..2450189) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967743.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS complement(2450186..2450665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967744.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 CDS 2450836..2451189 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245993.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS 2451186..2451650 product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230109.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 CDS complement(2451682..2452464) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399074.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 gene pstB CDS complement(2452475..2453284) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967747.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 gene pstB CDS complement(2453306..2454190) product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230103.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 gene pstA CDS complement(2454190..2455119) product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398935.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 gene pstC CDS complement(2455188..2456090) product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398774.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 CDS complement(2456245..2458395) product penicillin-binding protein 2A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398702.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 gene pbpA CDS complement(2458510..2459802) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230095.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 CDS complement(2459909..2460517) product superoxide dismutase SodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398583.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 gene sodA CDS complement(2460696..2461178) product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398518.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 CDS 2461289..2462050 product DUF1189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230089.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS 2462145..2462444 product LysM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230087.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 CDS 2462572..2463699 product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886567.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 gene ispG CDS complement(2463725..2464108) product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886568.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 CDS 2464248..2464829 product nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246215.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS complement(2464875..2465312) product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398578.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 gene zur CDS complement(2465449..2466330) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230077.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS 2466446..2466700 product DUF2624 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230076.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS complement(2466727..2467620) product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967756.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 CDS complement(2467630..2468946) product DEAD-box ATP-dependent RNA helicase CshB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399101.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 gene cshB CDS 2469115..2469837 product YqfQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246095.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 CDS 2469960..2470904 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246170.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS complement(2470927..2472048) product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399125.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS complement(2472041..2472691) product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166854628.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 gene trmK CDS complement(2472946..2473308) product cytochrome c-550 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230068.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 gene cccA CDS complement(2473635..2474750) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226225.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 gene rpoD CDS complement(2474950..2476770) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230066.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 gene dnaG CDS complement(2476804..2477298) product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230065.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 CDS complement(2477550..2478362) product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230064.1 transl_table 11 codon_start 1 locus_tag LOCUS_24310 CDS complement(2478388..2479029) product transcriptional regulator CcpN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003237058.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 gene ccpN CDS complement(2479160..2481199) product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230059.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 gene glyS CDS complement(2481192..2482163) product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226213.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 gene glyQ CDS complement(2482376..2483143) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230055.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 gene recO CDS complement(2483180..2483323) product YqzL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230053.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 CDS complement(2483468..2484373) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230051.1 transl_table 11 codon_start 1 locus_tag LOCUS_24370 gene era CDS complement(2484354..2484764) product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230049.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 CDS complement(2484885..2485256) product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398824.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 CDS complement(2485237..2485710) product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230039.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 gene ybeY CDS complement(2485711..2487777) product cyclic-di-AMP phosphodiesterase PgpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886570.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 gene pgpH CDS complement(2487791..2487925) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24420 CDS complement(2487925..2488884) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230035.1 transl_table 11 codon_start 1 locus_tag LOCUS_24430 CDS complement(2488881..2490077) product sporulation protein YqfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230033.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 gene yqfD CDS complement(2490096..2490377) product sporulation protein YqfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226191.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 gene yqfC CDS complement(2490434..2490850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230029.1 transl_table 11 codon_start 1 locus_tag LOCUS_24460 CDS complement(2490875..2491870) product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230026.1 transl_table 11 codon_start 1 locus_tag LOCUS_24470 gene floA CDS complement(2491892..2493205) product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230024.1 transl_table 11 codon_start 1 locus_tag LOCUS_24480 CDS complement(2493336..2493782) product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230022.1 transl_table 11 codon_start 1 locus_tag LOCUS_24490 CDS complement(2493797..2493970) product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003152957.1 transl_table 11 codon_start 1 locus_tag LOCUS_24500 gene rpsU CDS 2494143..2495066 product Na/Pi symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230019.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 CDS complement(2495103..2496458) product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230017.1 transl_table 11 codon_start 1 locus_tag LOCUS_24520 gene mtaB CDS complement(2496458..2497228) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230015.1 transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS complement(2497251..2498186) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398884.1 transl_table 11 codon_start 1 locus_tag LOCUS_24540 gene prmA CDS complement(2498211..2499338) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230010.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 gene dnaJ CDS complement(2499536..2501371) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398786.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 gene dnaK CDS complement(2501395..2501958) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230005.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 gene grpE CDS complement(2502030..2503061) product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246126.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 gene hrcA CDS complement(2503142..2504281) product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398764.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 gene hemW CDS complement(2504337..2506172) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229999.1 transl_table 11 codon_start 1 locus_tag LOCUS_24600 gene lepA CDS complement(2506306..2506644) product YqxA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399162.1 transl_table 11 codon_start 1 locus_tag LOCUS_24610 CDS complement(2506661..2507866) product spore autolysin SpoIIP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229993.1 transl_table 11 codon_start 1 locus_tag LOCUS_24620 gene spoIIP CDS complement(2507929..2509035) product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229991.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 gene gpr CDS 2509112..2509252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24640 CDS 2509239..2509505 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229989.1 transl_table 11 codon_start 1 locus_tag LOCUS_24650 gene rpsT CDS complement(2509520..2510563) product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229987.1 transl_table 11 codon_start 1 locus_tag LOCUS_24660 gene holA CDS 2510793..2510927 product YqzM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229983.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS complement(2510968..2511792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24680 CDS complement(2513302..2513871) product ComE operon protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229978.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 CDS complement(2513938..2514555) product competence protein ComEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398514.1 transl_table 11 codon_start 1 locus_tag LOCUS_24700 gene comEA CDS 2514639..2515460 product late competence protein ComER inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398597.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 gene comER CDS complement(2515526..2516269) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229973.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS complement(2516266..2516622) product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229971.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 gene rsfS CDS complement(2516640..2517200) product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399059.1 transl_table 11 codon_start 1 locus_tag LOCUS_24740 gene yqeK CDS complement(2517190..2517759) product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398676.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 CDS complement(2517771..2518061) product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226133.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 gene yhbY CDS complement(2518055..2518897) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229967.1 transl_table 11 codon_start 1 locus_tag LOCUS_24770 gene aroE CDS complement(2518916..2520016) product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229966.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 gene yqeH CDS complement(2520020..2520538) product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226126.1 transl_table 11 codon_start 1 locus_tag LOCUS_24790 CDS complement(2521342..2522073) product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229964.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 CDS complement(2522324..2523076) product N-acetylmuramoyl-L-alanine amidase CwlH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229963.1 transl_table 11 codon_start 1 locus_tag LOCUS_24810 gene cwlH CDS 2523271..2523897 product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229962.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS complement(2523916..2524809) product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229961.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 gene gnd CDS 2525114..2525836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886572.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 CDS complement(2525869..2526279) product sporulation-specific Dnase NucB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967785.1 transl_table 11 codon_start 1 locus_tag LOCUS_24850 gene nucB CDS 2526475..2527203 product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051382.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 gene sigK CDS complement(2527345..2527593) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24870 CDS complement(2527811..2529199) product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228523.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 gene fumC CDS 2529354..2530244 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242958.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 CDS complement(2530607..2530882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24900 CDS 2531338..2531787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24910 CDS complement(2531922..2532092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886576.1 transl_table 11 codon_start 1 locus_tag LOCUS_24920 CDS complement(2532450..2533409) product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705465.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 CDS complement(2533517..2533942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24940 CDS complement(2534562..2535296) product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246762.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 CDS 2535522..2535881 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391916.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 CDS 2536274..2537014 product nitroreductase NfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075306.1 transl_table 11 codon_start 1 locus_tag LOCUS_24970 gene nfsA CDS complement(2537246..2538157) product AraC family transcriptional regulator CmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118743.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 gene cmrA CDS 2538286..2538534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24990 CDS 2538521..2539309 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862685.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 CDS 2540052..2540510 product spermine/spermidine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229879.1 transl_table 11 codon_start 1 locus_tag LOCUS_25010 gene bltD CDS complement(2540682..2541536) product multidrug efflux transcriptional regulator BltR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229881.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 gene bltR CDS 2541664..2542866 product multidrug efflux MFS transporter Blt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229880.1 transl_table 11 codon_start 1 locus_tag LOCUS_25030 gene blt CDS 2543009..2543470 product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966430.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 gene pssA note possible pseudo, frameshifted CDS 2543461..2543736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25050 note possible pseudo, frameshifted CDS 2543736..2543945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25060 note possible pseudo, frameshifted CDS 2544119..2544847 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811089.1 transl_table 11 codon_start 1 locus_tag LOCUS_25070 CDS complement(2544959..2545105) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS complement(2545414..2545635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25090 CDS complement(2545705..2547042) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206175.1 transl_table 11 codon_start 1 locus_tag LOCUS_25100 CDS complement(2547256..2548014) product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084957.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS complement(2548040..2548990) product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903779.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 CDS complement(2548987..2549841) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904393.1 transl_table 11 codon_start 1 locus_tag LOCUS_25130 CDS complement(2550476..2550949) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206857.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS complement(2550963..2551391) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096713.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 CDS complement(2551472..2551786) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234907.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 CDS complement(2552687..2552905) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25170 CDS complement(2553632..2553964) product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906360.1 transl_table 11 codon_start 1 locus_tag LOCUS_25180 CDS complement(2554351..2556099) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964060.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 CDS complement(2556478..2557233) product metal-binding protein ZinT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229858.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 CDS complement(2557541..2557897) product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398671.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS complement(2557949..2558308) product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399021.1 transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS 2558712..2558957 product spore coat protein F-like protein YraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229845.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS 2558975..2559343 product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967868.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS 2559362..2560498 product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229843.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 CDS 2560517..2560714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229842.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 CDS 2560730..2561029 product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246006.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 CDS complement(2561161..2561439) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25280 CDS complement(2561474..2562454) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930477.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 CDS 2562621..2563523 product AraC family transcriptional regulator CmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118743.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 gene cmrA CDS complement(2563677..2564084) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930407.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 CDS complement(2564185..2564589) product aldehyde stress transcriptional regulator AdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398725.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 gene adhR CDS 2564777..2565448 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202637.1 transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS 2565634..2566683 product formaldehyde dehydrogenase AdhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229837.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 gene adhA CDS 2566832..2567341 product cysteine protease YraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229836.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 gene yraA CDS complement(2567382..2569418) product levanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398804.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 gene sacC CDS complement(2569578..2570405) product PTS fructose transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229834.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 gene levG CDS complement(2570427..2571230) product PTS fructose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229833.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 gene levF CDS complement(2571247..2571735) product PTS fructose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399158.1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 gene levE CDS complement(2571735..2572175) product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246144.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 gene levD CDS complement(2572365..2575172) product transcriptional regulator LevR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229830.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 gene levR CDS complement(2575567..2576193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25420 CDS complement(2576312..2576839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25430 CDS 2577060..2578448 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886581.1 transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS complement(2578609..2579241) product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229828.1 transl_table 11 codon_start 1 locus_tag LOCUS_25450 CDS 2579393..2580220 product TrmB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398526.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 CDS 2580412..2580912 product RNA polymerase sigma factor SigV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398891.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 gene sigV CDS 2580912..2581769 product anti-sigma-V factor RsiV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398482.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 gene rsiV CDS 2581882..2583801 product peptidoglycan O-acetyltransferase OatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398729.1 transl_table 11 codon_start 1 locus_tag LOCUS_25490 gene oatA CDS 2583923..2584219 product YrhK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398584.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 CDS complement(2584463..2587627) product bifunctional cytochrome P450/NADPH--P450 reductase CypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246174.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 gene cypB CDS complement(2587645..2588229) product transcriptional regulator FatR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967878.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 gene fatR CDS complement(2588450..2588989) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398716.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 CDS complement(2589492..2589641) product YrzI family small protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399102.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS complement(2589791..2589964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25550 CDS complement(2590032..2590832) product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229815.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 CDS complement(2591096..2591464) product DUF2294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398508.1 transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS 2591778..2594720 product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886582.1 transl_table 11 codon_start 1 locus_tag LOCUS_25580 gene fdhF CDS 2594739..2595221 product DUF1641 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246168.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 CDS complement(2595258..2595488) product YrhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003237358.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 CDS complement(2595571..2596710) product bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229810.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 CDS complement(2596712..2597635) product O-acetylserine dependent cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229809.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 CDS complement(2597699..2598394) product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967881.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 gene mtnN CDS complement(2598417..2599058) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229807.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 CDS 2599250..2599453 product YrzA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967883.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS complement(2599490..2600188) product YrrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246156.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 CDS complement(2600253..2602007) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398903.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 CDS complement(2602061..2602534) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399078.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 gene greA CDS complement(2602785..2603420) product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225916.1 transl_table 11 codon_start 1 locus_tag LOCUS_25690 gene udk CDS complement(2603426..2604694) product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229802.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 CDS complement(2604713..2605642) product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399094.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS complement(2605648..2606301) product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229800.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 CDS complement(2606453..2607535) product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229799.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 gene mltG CDS complement(2607671..2607952) product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246199.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 CDS complement(2607970..2608386) product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229795.1 transl_table 11 codon_start 1 locus_tag LOCUS_25750 gene ruvX CDS complement(2608394..2608660) product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225903.1 transl_table 11 codon_start 1 locus_tag LOCUS_25760 CDS complement(2608745..2611381) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246158.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 gene alaS CDS complement(2611715..2612776) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967889.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 CDS complement(2613027..2613218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225893.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 CDS complement(2613230..2613388) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25800 CDS complement(2613811..2616207) product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398511.1 transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS complement(2616233..2616883) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886584.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 CDS complement(2616939..2618054) product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398509.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 gene mnmA CDS complement(2618082..2619224) product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246057.1 transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS complement(2619243..2619659) product cysteine metabolism transcriptional regulator CymR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225879.1 transl_table 11 codon_start 1 locus_tag LOCUS_25850 gene cymR CDS 2619861..2621126 product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398500.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 CDS complement(2621190..2621708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25870 CDS complement(2622008..2622340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25880 note possible pseudo, frameshifted CDS complement(2622460..2623224) product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967893.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 CDS complement(2623561..2625339) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229758.1 transl_table 11 codon_start 1 locus_tag LOCUS_25900 gene aspS CDS complement(2625353..2626627) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229755.1 transl_table 11 codon_start 1 locus_tag LOCUS_25910 gene hisS CDS complement(2626803..2627012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25920 CDS complement(2627009..2627179) product YrzK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399157.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS 2627312..2628865 product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399040.1 transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS complement(2628890..2629330) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071581519.1 transl_table 11 codon_start 1 locus_tag LOCUS_25950 gene dtd CDS complement(2629343..2631547) product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229747.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 gene relA CDS complement(2631716..2632228) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229745.1 transl_table 11 codon_start 1 locus_tag LOCUS_25970 CDS complement(2632234..2634594) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246110.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 gene recJ CDS complement(2634661..2634993) product DUF1049 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229740.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 CDS complement(2635070..2635567) product cation:proton antiporter regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229739.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS complement(2635725..2637938) product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245970.1 transl_table 11 codon_start 1 locus_tag LOCUS_26010 gene secDF CDS complement(2637977..2638273) product post-transcriptional regulator ComN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398498.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 gene comN CDS 2638390..2639946 product stage V sporulation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398529.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 gene spoVB CDS complement(2639950..2640606) product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398801.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 CDS 2640804..2641193 product TIGR04086 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229729.1 transl_table 11 codon_start 1 locus_tag LOCUS_26050 CDS complement(2641250..2641516) product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398708.1 transl_table 11 codon_start 1 locus_tag LOCUS_26060 gene yajC CDS complement(2641557..2642702) product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229725.1 transl_table 11 codon_start 1 locus_tag LOCUS_26070 gene tgt CDS complement(2642729..2643757) product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229723.1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 gene queA CDS complement(2643787..2643987) product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222669.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 CDS complement(2643980..2644984) product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229718.1 transl_table 11 codon_start 1 locus_tag LOCUS_26100 gene ruvB CDS complement(2644995..2645600) product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229717.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 gene ruvA CDS complement(2645739..2646251) product sporulation cell-cell signaling protein BofC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229715.1 transl_table 11 codon_start 1 locus_tag LOCUS_26120 gene bofC CDS complement(2646299..2647606) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246197.1 transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS complement(2647619..2648713) product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398990.1 transl_table 11 codon_start 1 locus_tag LOCUS_26140 gene iolG CDS 2648950..2649597 product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246159.1 transl_table 11 codon_start 1 locus_tag LOCUS_26150 CDS complement(2649643..2649765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26160 CDS 2650039..2651493 product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398698.1 transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS complement(2651534..2652256) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398802.1 transl_table 11 codon_start 1 locus_tag LOCUS_26180 CDS complement(2652358..2652957) product spore germination protein SgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245996.1 transl_table 11 codon_start 1 locus_tag LOCUS_26190 gene sgpA CDS complement(2653106..2654266) product spore coat assembly protein SafA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229695.1 transl_table 11 codon_start 1 locus_tag LOCUS_26200 gene safA CDS complement(2654382..2655488) product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229691.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 gene nadA CDS complement(2655475..2656344) product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229689.1 transl_table 11 codon_start 1 locus_tag LOCUS_26220 gene nadC CDS complement(2656298..2657893) product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229687.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 gene nadB CDS 2657982..2659184 product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398844.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 gene nifS CDS 2659144..2659686 product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398582.1 transl_table 11 codon_start 1 locus_tag LOCUS_26250 CDS complement(2659709..2660563) product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398512.1 transl_table 11 codon_start 1 locus_tag LOCUS_26260 gene pheA CDS complement(2660580..2661023) product transcriptional regulator ThrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222630.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 gene thrR CDS complement(2661081..2662367) product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246161.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 gene obgE CDS complement(2662401..2662979) product sporulation initiation phosphotransferase Sop0B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399131.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 gene spo0B CDS complement(2663299..2663583) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222623.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 gene rpmA CDS complement(2663596..2663937) product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229669.1 transl_table 11 codon_start 1 locus_tag LOCUS_26310 CDS complement(2663940..2664248) product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229668.1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 gene rplU CDS complement(2664395..2665261) product stage IV sporulation intramembrane metalloprotease SpoIVFB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398649.1 transl_table 11 codon_start 1 locus_tag LOCUS_26330 gene spoIVFB CDS complement(2665254..2666045) product stage IV sporulation protein SpoIVFA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398684.1 transl_table 11 codon_start 1 locus_tag LOCUS_26340 gene spoIVFA CDS complement(2666194..2667000) product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398624.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 gene minD CDS complement(2667002..2667691) product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398901.1 transl_table 11 codon_start 1 locus_tag LOCUS_26360 gene minC CDS complement(2667735..2668253) product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398811.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 gene mreD CDS complement(2668250..2669122) product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967915.1 transl_table 11 codon_start 1 locus_tag LOCUS_26380 gene mreC CDS complement(2669153..2670166) product cell shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229650.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 gene mreB CDS complement(2670258..2670953) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246034.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 gene radC CDS complement(2670990..2671559) product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398496.1 transl_table 11 codon_start 1 locus_tag LOCUS_26410 CDS complement(2671711..2672709) product stage II sporulation protein SpoIIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398782.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 gene spoIIB CDS complement(2672843..2673379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26430 CDS complement(2673726..2675018) product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229640.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 CDS complement(2675079..2677721) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398606.1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 gene valS CDS 2678171..2678362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222590.1 transl_table 11 codon_start 1 locus_tag LOCUS_26460 CDS complement(2678381..2679406) product spore coat protein CotN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399056.1 transl_table 11 codon_start 1 locus_tag LOCUS_26470 gene cotN CDS complement(2679439..2681649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26480 CDS complement(2681783..2683075) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398699.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 gene hemL CDS complement(2683105..2684079) product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229631.1 transl_table 11 codon_start 1 locus_tag LOCUS_26500 gene hemB CDS complement(2684076..2684864) product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229629.1 transl_table 11 codon_start 1 locus_tag LOCUS_26510 gene hemD CDS complement(2684854..2685795) product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886587.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 gene hemC CDS complement(2685832..2686551) product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222575.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 CDS complement(2686670..2688037) product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399038.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 gene hemA CDS 2688267..2688764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229624.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 CDS complement(2688788..2689375) product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229621.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 gene yihA CDS complement(2689372..2691696) product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229618.1 transl_table 11 codon_start 1 locus_tag LOCUS_26570 gene lon CDS complement(2691877..2693535) product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398923.1 transl_table 11 codon_start 1 locus_tag LOCUS_26580 gene lonB CDS complement(2693689..2694951) product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229613.1 transl_table 11 codon_start 1 locus_tag LOCUS_26590 gene clpX CDS complement(2695223..2696497) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229611.1 transl_table 11 codon_start 1 locus_tag LOCUS_26600 gene tig CDS complement(2696725..2697729) product DNA damage checkpoint antagonist DdcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229609.1 transl_table 11 codon_start 1 locus_tag LOCUS_26610 gene ddcA CDS complement(2697846..2698445) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229606.1 transl_table 11 codon_start 1 locus_tag LOCUS_26620 gene leuD CDS complement(2698458..2699876) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229604.1 transl_table 11 codon_start 1 locus_tag LOCUS_26630 gene leuC CDS complement(2699927..2701024) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399139.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 gene leuB CDS complement(2701045..2702601) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967929.1 transl_table 11 codon_start 1 locus_tag LOCUS_26650 CDS complement(2702588..2703616) product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222549.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 gene ilvC CDS complement(2703640..2704158) product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399096.1 transl_table 11 codon_start 1 locus_tag LOCUS_26670 gene ilvN CDS complement(2704155..2705879) product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398643.1 transl_table 11 codon_start 1 locus_tag LOCUS_26680 gene ilvB CDS 2706696..2707019 product inner spore coat protein CotQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398743.1 transl_table 11 codon_start 1 locus_tag LOCUS_26690 gene cotQ CDS 2707219..2707674 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399128.1 transl_table 11 codon_start 1 locus_tag LOCUS_26700 CDS complement(2707815..2709125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26710 CDS 2709347..2710171 product YsnF/AvaK domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229586.1 transl_table 11 codon_start 1 locus_tag LOCUS_26720 tRNA complement(2710235..2710310) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00590 CDS complement(2710439..2710948) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229585.1 transl_table 11 codon_start 1 locus_tag LOCUS_26730 CDS complement(2710964..2711551) product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886588.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 CDS complement(2711573..2712310) product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246039.1 transl_table 11 codon_start 1 locus_tag LOCUS_26750 CDS complement(2712421..2713521) product spore germination protein GerM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229578.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 gene gerM CDS complement(2713637..2714452) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886589.1 transl_table 11 codon_start 1 locus_tag LOCUS_26770 gene racE CDS complement(2714463..2714918) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229573.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 CDS complement(2715148..2715372) product spore germination transcription factor GerE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003184172.1 transl_table 11 codon_start 1 locus_tag LOCUS_26790 gene gerE CDS complement(2715488..2715931) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398491.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 CDS complement(2715991..2716752) product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229569.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 gene sdhB CDS complement(2716749..2718515) product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229567.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 gene sdhA CDS complement(2718549..2719157) product succinate dehydrogenase cytochrome B558 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222512.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 gene sdhC CDS 2719449..2719895 product YslB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222508.1 transl_table 11 codon_start 1 locus_tag LOCUS_26840 CDS complement(2719939..2721168) product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229564.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 CDS complement(2721538..2723310) product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246045.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 gene uvrC CDS complement(2723446..2723760) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222500.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 gene trxA CDS complement(2724088..2725575) product alpha-L-arabinofuranosidase AbfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398654.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 gene abfB CDS 2725654..2725806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26890 CDS complement(2725789..2726766) product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398999.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 gene etfA CDS complement(2726802..2727575) product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398765.1 transl_table 11 codon_start 1 locus_tag LOCUS_26910 gene etfB CDS complement(2727590..2728366) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229549.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 CDS complement(2728381..2728965) product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229547.1 transl_table 11 codon_start 1 locus_tag LOCUS_26930 gene fadR CDS complement(2729083..2730765) product long-chain-fatty-acid--CoA ligase LcfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399166.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 gene lcfA CDS complement(2730953..2731357) product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003237674.1 transl_table 11 codon_start 1 locus_tag LOCUS_26950 CDS complement(2731372..2733729) product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229541.1 transl_table 11 codon_start 1 locus_tag LOCUS_26960 CDS complement(2733750..2735462) product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229538.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 gene polX CDS complement(2735534..2736067) product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229537.1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 CDS complement(2736074..2736331) product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229534.1 transl_table 11 codon_start 1 locus_tag LOCUS_26990 gene zapA CDS 2736464..2737405 product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245949.1 transl_table 11 codon_start 1 locus_tag LOCUS_27000 gene rnhC CDS complement(2737441..2739855) product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398979.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 gene pheT CDS complement(2739871..2740905) product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398818.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 gene pheS CDS complement(2741258..2742004) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246182.1 transl_table 11 codon_start 1 locus_tag LOCUS_27030 CDS 2742123..2742338 product small acid-soluble spore protein SspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229525.1 transl_table 11 codon_start 1 locus_tag LOCUS_27040 gene sspI CDS 2742867..2743727 product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244958.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 CDS 2744250..2745662 product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398865.1 transl_table 11 codon_start 1 locus_tag LOCUS_27060 gene glcD CDS 2745659..2746993 product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229519.1 transl_table 11 codon_start 1 locus_tag LOCUS_27070 CDS complement(2747030..2747410) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049863.1 transl_table 11 codon_start 1 locus_tag LOCUS_27080 CDS complement(2747444..2749240) product carbon starvation protein CstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229512.1 transl_table 11 codon_start 1 locus_tag LOCUS_27090 gene cstA CDS complement(2749352..2750242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS complement(2750239..2750793) product DUF1700 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032393.1 transl_table 11 codon_start 1 locus_tag LOCUS_27110 CDS complement(2750790..2751116) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117500.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 CDS complement(2751270..2752772) product alpha-L-arabinofuranosidase AbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398747.1 transl_table 11 codon_start 1 locus_tag LOCUS_27130 gene abfA CDS complement(2752791..2753636) product arabinose ABC transporter permease AraQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229508.1 transl_table 11 codon_start 1 locus_tag LOCUS_27140 gene araQ CDS complement(2753637..2754578) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229507.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 CDS complement(2754614..2755915) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399072.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 CDS complement(2755946..2757130) product sn-glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229504.1 transl_table 11 codon_start 1 locus_tag LOCUS_27170 gene egsA CDS complement(2757127..2757936) product sugar-phosphatase AraL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886590.1 transl_table 11 codon_start 1 locus_tag LOCUS_27180 gene araL CDS complement(2757923..2758612) product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229501.1 transl_table 11 codon_start 1 locus_tag LOCUS_27190 gene araD CDS complement(2758626..2760311) product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229500.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 gene araB CDS complement(2760327..2761817) product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229499.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 gene araA CDS complement(2762001..2762975) product arabinan endo-1,5-alpha-L-arabinosidase AbnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229496.1 transl_table 11 codon_start 1 locus_tag LOCUS_27220 gene abnA CDS complement(2763170..2764255) product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229495.1 transl_table 11 codon_start 1 locus_tag LOCUS_27230 CDS 2764439..2764831 product sigma W pathway protein YsdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229493.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 gene ysdB CDS complement(2764848..2765117) product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229490.1 transl_table 11 codon_start 1 locus_tag LOCUS_27250 CDS complement(2765173..2765532) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222420.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 gene rplT CDS complement(2765564..2765764) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222418.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 gene rpmI CDS complement(2765777..2766280) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886591.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 gene infC CDS complement(2766617..2766820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27290 CDS 2766935..2767594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229484.1 transl_table 11 codon_start 1 locus_tag LOCUS_27300 CDS complement(2767626..2768321) product antiholin-like protein LrgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229482.1 transl_table 11 codon_start 1 locus_tag LOCUS_27310 gene lrgB CDS complement(2768342..2768782) product antiholin-like murein hydrolase modulator LrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399155.1 transl_table 11 codon_start 1 locus_tag LOCUS_27320 gene lrgA CDS complement(2768916..2769641) product two-component system response regulator LytT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229479.1 transl_table 11 codon_start 1 locus_tag LOCUS_27330 gene lytT CDS complement(2769619..2771400) product two-component system sensor histidine kinase LytS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229477.1 transl_table 11 codon_start 1 locus_tag LOCUS_27340 gene lytS CDS 2771567..2772349 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398978.1 transl_table 11 codon_start 1 locus_tag LOCUS_27350 CDS complement(2772390..2774321) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229473.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 gene thrS CDS complement(2774721..2775566) product putative sporulation protein YtxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229471.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 gene ytxC CDS complement(2775645..2776286) product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229468.1 transl_table 11 codon_start 1 locus_tag LOCUS_27380 CDS complement(2776320..2777255) product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229466.1 transl_table 11 codon_start 1 locus_tag LOCUS_27390 gene dnaI CDS complement(2777283..2778704) product replication initiation membrane attachment protein DnaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229464.1 transl_table 11 codon_start 1 locus_tag LOCUS_27400 gene dnaB CDS complement(2778819..2779277) product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223586.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 gene nrdR CDS complement(2779551..2779931) product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223584.1 transl_table 11 codon_start 1 locus_tag LOCUS_27420 gene speD CDS complement(2780170..2781192) product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229459.1 transl_table 11 codon_start 1 locus_tag LOCUS_27430 CDS complement(2781397..2781777) product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229458.1 transl_table 11 codon_start 1 locus_tag LOCUS_27440 CDS 2781961..2783151 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229456.1 transl_table 11 codon_start 1 locus_tag LOCUS_27450 CDS 2783175..2784017 product aldo/keto reductase YtbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229455.1 transl_table 11 codon_start 1 locus_tag LOCUS_27460 gene ytbE CDS complement(2784054..2784647) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398928.1 transl_table 11 codon_start 1 locus_tag LOCUS_27470 gene coaE CDS complement(2784663..2785295) product sporulation membrane protein YtaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229449.1 transl_table 11 codon_start 1 locus_tag LOCUS_27480 gene ytaF CDS complement(2785462..2786292) product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246122.1 transl_table 11 codon_start 1 locus_tag LOCUS_27490 gene mutM CDS complement(2786315..2788957) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398870.1 transl_table 11 codon_start 1 locus_tag LOCUS_27500 gene polA CDS complement(2789199..2790938) product sensory box histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398493.1 transl_table 11 codon_start 1 locus_tag LOCUS_27510 gene phoR CDS complement(2790931..2791653) product two-component system response regulator PhoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229442.1 transl_table 11 codon_start 1 locus_tag LOCUS_27520 gene phoP CDS complement(2791865..2792803) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229437.1 transl_table 11 codon_start 1 locus_tag LOCUS_27530 gene mdh CDS complement(2792847..2794118) product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229433.1 transl_table 11 codon_start 1 locus_tag LOCUS_27540 gene icd CDS complement(2794283..2795401) product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398810.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 gene citZ CDS complement(2795734..2796198) product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398695.1 transl_table 11 codon_start 1 locus_tag LOCUS_27560 CDS 2796295..2797410 product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399115.1 transl_table 11 codon_start 1 locus_tag LOCUS_27570 gene ytvI CDS complement(2797443..2797826) product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246085.1 transl_table 11 codon_start 1 locus_tag LOCUS_27580 gene fxsA CDS complement(2797921..2799678) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398560.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 gene pyk CDS complement(2799720..2800679) product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229420.1 transl_table 11 codon_start 1 locus_tag LOCUS_27600 gene pfkA CDS complement(2800863..2801840) product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229417.1 transl_table 11 codon_start 1 locus_tag LOCUS_27610 gene accA CDS complement(2801825..2802697) product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223544.1 transl_table 11 codon_start 1 locus_tag LOCUS_27620 gene accD CDS complement(2803031..2804263) product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229415.1 transl_table 11 codon_start 1 locus_tag LOCUS_27630 gene maeB CDS complement(2804400..2807747) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229412.1 transl_table 11 codon_start 1 locus_tag LOCUS_27640 gene dnaE CDS 2807908..2808228 product sporulation membrane protein YtrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229410.1 transl_table 11 codon_start 1 locus_tag LOCUS_27650 gene ytrH CDS 2808225..2808728 product sporulation membrane protein YtrI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229408.1 transl_table 11 codon_start 1 locus_tag LOCUS_27660 gene ytrI CDS 2808830..2809021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229407.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 CDS complement(2809039..2809980) product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398971.1 transl_table 11 codon_start 1 locus_tag LOCUS_27680 gene nrnA CDS 2810111..2810413 product YtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229401.1 transl_table 11 codon_start 1 locus_tag LOCUS_27690 CDS complement(2810433..2811752) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398641.1 transl_table 11 codon_start 1 locus_tag LOCUS_27700 CDS complement(2811873..2812556) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245964.1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 CDS complement(2812619..2813386) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398521.1 transl_table 11 codon_start 1 locus_tag LOCUS_27720 CDS complement(2813512..2813643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399018.1 transl_table 11 codon_start 1 locus_tag LOCUS_27730 CDS complement(2813708..2815093) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246018.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 gene argH CDS complement(2815090..2816301) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229357.1 transl_table 11 codon_start 1 locus_tag LOCUS_27750 CDS complement(2816472..2816984) product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398479.1 transl_table 11 codon_start 1 locus_tag LOCUS_27760 CDS complement(2817070..2818257) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223511.1 transl_table 11 codon_start 1 locus_tag LOCUS_27770 CDS complement(2818604..2819590) product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229346.1 transl_table 11 codon_start 1 locus_tag LOCUS_27780 CDS complement(2819650..2820153) product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223506.1 transl_table 11 codon_start 1 locus_tag LOCUS_27790 gene tpx CDS complement(2820262..2820717) product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398631.1 transl_table 11 codon_start 1 locus_tag LOCUS_27800 gene ytfJ CDS complement(2820731..2821411) product DUF2953 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399127.1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 CDS complement(2821486..2821980) product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229340.1 transl_table 11 codon_start 1 locus_tag LOCUS_27820 CDS complement(2821993..2823000) product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229337.1 transl_table 11 codon_start 1 locus_tag LOCUS_27830 gene sppA CDS 2823187..2823990 product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399091.1 transl_table 11 codon_start 1 locus_tag LOCUS_27840 CDS complement(2824024..2825613) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229333.1 transl_table 11 codon_start 1 locus_tag LOCUS_27850 CDS complement(2825633..2827222) product acyl--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229331.1 transl_table 11 codon_start 1 locus_tag LOCUS_27860 CDS complement(2827402..2827611) product alpha type acid-soluble spore protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223491.1 transl_table 11 codon_start 1 locus_tag LOCUS_27870 gene sspA CDS complement(2827703..2828908) product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229326.1 transl_table 11 codon_start 1 locus_tag LOCUS_27880 gene thiI CDS complement(2828912..2830057) product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398687.1 transl_table 11 codon_start 1 locus_tag LOCUS_27890 CDS 2830259..2831599 product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229322.1 transl_table 11 codon_start 1 locus_tag LOCUS_27900 gene brnQ CDS complement(2831698..2833401) product septation ring formation regulator EzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229320.1 transl_table 11 codon_start 1 locus_tag LOCUS_27910 gene ezrA CDS 2833598..2834407 product histidinol-phosphatase HisJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229318.1 transl_table 11 codon_start 1 locus_tag LOCUS_27920 gene hisJ CDS complement(2834400..2835023) product transcriptional regulator RefZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229313.1 transl_table 11 codon_start 1 locus_tag LOCUS_27930 gene refZ CDS 2835150..2835641 product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229311.1 transl_table 11 codon_start 1 locus_tag LOCUS_27940 CDS complement(2835679..2837418) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229309.1 transl_table 11 codon_start 1 locus_tag LOCUS_27950 CDS 2837713..2838315 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229304.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 gene rpsD CDS complement(2838337..2838465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27970 CDS complement(2838596..2839864) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229300.1 transl_table 11 codon_start 1 locus_tag LOCUS_27980 gene tyrS CDS complement(2840206..2841924) product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399030.1 transl_table 11 codon_start 1 locus_tag LOCUS_27990 gene acsA CDS 2842084..2842716 product acetoin utilization protein acetyltransferase AcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229296.1 transl_table 11 codon_start 1 locus_tag LOCUS_28000 gene acuA CDS 2842743..2843387 product acetoin utilization AcuB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229294.1 transl_table 11 codon_start 1 locus_tag LOCUS_28010 CDS 2843384..2844550 product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398517.1 transl_table 11 codon_start 1 locus_tag LOCUS_28020 CDS complement(2844579..2845289) product flagellar motor protein MotS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229290.1 transl_table 11 codon_start 1 locus_tag LOCUS_28030 gene motS CDS complement(2845279..2846097) product flagellar motor protein MotP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398692.1 transl_table 11 codon_start 1 locus_tag LOCUS_28040 gene motP CDS complement(2846161..2847165) product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229285.1 transl_table 11 codon_start 1 locus_tag LOCUS_28050 gene ccpA CDS complement(2847441..2848517) product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223454.1 transl_table 11 codon_start 1 locus_tag LOCUS_28060 CDS complement(2848753..2849079) product bacillithiol system redox-active protein YtxJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229280.1 transl_table 11 codon_start 1 locus_tag LOCUS_28070 gene ytxJ CDS complement(2849103..2849558) product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398549.1 transl_table 11 codon_start 1 locus_tag LOCUS_28080 CDS complement(2849589..2850011) product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229276.1 transl_table 11 codon_start 1 locus_tag LOCUS_28090 CDS complement(2850173..2851471) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229274.1 transl_table 11 codon_start 1 locus_tag LOCUS_28100 gene murC CDS complement(2851720..2854596) product DNA translocase SftA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229272.1 transl_table 11 codon_start 1 locus_tag LOCUS_28110 gene sftA CDS complement(2854757..2855362) product DUF4479 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229269.1 transl_table 11 codon_start 1 locus_tag LOCUS_28120 CDS complement(2855378..2856187) product DUF1444 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967991.1 transl_table 11 codon_start 1 locus_tag LOCUS_28130 CDS complement(2856202..2856525) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229265.1 transl_table 11 codon_start 1 locus_tag LOCUS_28140 CDS 2856759..2857205 product YtoQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229263.1 transl_table 11 codon_start 1 locus_tag LOCUS_28150 CDS complement(2857262..2858335) product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229261.1 transl_table 11 codon_start 1 locus_tag LOCUS_28160 CDS 2858494..2858811 product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229259.1 transl_table 11 codon_start 1 locus_tag LOCUS_28170 CDS complement(2858865..2860565) product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229258.1 transl_table 11 codon_start 1 locus_tag LOCUS_28180 CDS complement(2860648..2861493) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246020.1 transl_table 11 codon_start 1 locus_tag LOCUS_28190 CDS complement(2861560..2862201) product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398646.1 transl_table 11 codon_start 1 locus_tag LOCUS_28200 gene trmB CDS 2862406..2862684 product YtzH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003237926.1 transl_table 11 codon_start 1 locus_tag LOCUS_28210 CDS complement(2862685..2863494) product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886595.1 transl_table 11 codon_start 1 locus_tag LOCUS_28220 CDS complement(2863661..2865817) product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229246.1 transl_table 11 codon_start 1 locus_tag LOCUS_28230 gene pulA CDS complement(2865842..2866771) product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229243.1 transl_table 11 codon_start 1 locus_tag LOCUS_28240 CDS complement(2866820..2867734) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229241.1 transl_table 11 codon_start 1 locus_tag LOCUS_28250 CDS complement(2867760..2868311) product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229239.1 transl_table 11 codon_start 1 locus_tag LOCUS_28260 gene thpR CDS 2868461..2869396 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229237.1 transl_table 11 codon_start 1 locus_tag LOCUS_28270 gene cysK CDS complement(2869429..2870820) product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399126.1 transl_table 11 codon_start 1 locus_tag LOCUS_28280 gene pepV CDS 2870917..2872215 product hypoxanthine/guanine permease PbuO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229234.1 transl_table 11 codon_start 1 locus_tag LOCUS_28290 gene pbuO CDS complement(2872254..2873411) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229232.1 transl_table 11 codon_start 1 locus_tag LOCUS_28300 CDS complement(2873408..2874118) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229230.1 transl_table 11 codon_start 1 locus_tag LOCUS_28310 CDS 2874317..2874502 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28320 CDS 2874408..2874629 product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003152337.1 transl_table 11 codon_start 1 locus_tag LOCUS_28330 CDS complement(2874750..2875469) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229226.1 transl_table 11 codon_start 1 locus_tag LOCUS_28340 CDS complement(2875538..2877172) product lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229224.1 transl_table 11 codon_start 1 locus_tag LOCUS_28350 gene murJ CDS 2877423..2878637 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229222.1 transl_table 11 codon_start 1 locus_tag LOCUS_28360 CDS 2878827..2880362 product glycine betaine transporter OpuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229220.1 transl_table 11 codon_start 1 locus_tag LOCUS_28370 gene opuD CDS complement(2880400..2880582) product sporulation protein Cse60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223398.1 transl_table 11 codon_start 1 locus_tag LOCUS_28380 CDS complement(2880650..2881318) product YesL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229218.1 transl_table 11 codon_start 1 locus_tag LOCUS_28390 CDS complement(2881340..2882626) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968003.1 transl_table 11 codon_start 1 locus_tag LOCUS_28400 CDS complement(2882638..2883060) product rhamnogalaturonan transport/degradation protein RmgS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886596.1 transl_table 11 codon_start 1 locus_tag LOCUS_28410 gene rmgS CDS complement(2883138..2884250) product unsaturated rhamnogalacturonyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014906487.1 transl_table 11 codon_start 1 locus_tag LOCUS_28420 gene rmgQ CDS complement(2884267..2885232) product polygalacturonan/rhamnogalacturonan ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229209.1 transl_table 11 codon_start 1 locus_tag LOCUS_28430 gene rmgP CDS 2885448..2887763 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968004.1 transl_table 11 codon_start 1 locus_tag LOCUS_28440 CDS complement(2887804..2889306) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398776.1 transl_table 11 codon_start 1 locus_tag LOCUS_28450 CDS complement(2889330..2890211) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 transl_table 11 codon_start 1 locus_tag LOCUS_28460 CDS complement(2890399..2891160) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245974.1 transl_table 11 codon_start 1 locus_tag LOCUS_28470 CDS complement(2891238..2892425) product biotin biosynthesis cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398783.1 transl_table 11 codon_start 1 locus_tag LOCUS_28480 gene bioI CDS complement(2892492..2893499) product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398967.1 transl_table 11 codon_start 1 locus_tag LOCUS_28490 gene bioB CDS complement(2893502..2894197) product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398591.1 transl_table 11 codon_start 1 locus_tag LOCUS_28500 gene bioD CDS complement(2894194..2895363) product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968008.1 transl_table 11 codon_start 1 locus_tag LOCUS_28510 gene bioF CDS complement(2895353..2896699) product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398913.1 transl_table 11 codon_start 1 locus_tag LOCUS_28520 gene bioA CDS complement(2896689..2897465) product 6-carboxyhexanoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968009.1 transl_table 11 codon_start 1 locus_tag LOCUS_28530 gene bioW CDS complement(2897665..2897970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28540 CDS complement(2898255..2899154) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398709.1 transl_table 11 codon_start 1 locus_tag LOCUS_28550 CDS 2899372..2900406 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398480.1 transl_table 11 codon_start 1 locus_tag LOCUS_28560 CDS 2900440..2901717 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398680.1 transl_table 11 codon_start 1 locus_tag LOCUS_28570 CDS 2901714..2902625 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968010.1 transl_table 11 codon_start 1 locus_tag LOCUS_28580 CDS 2902622..2903452 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398630.1 transl_table 11 codon_start 1 locus_tag LOCUS_28590 CDS 2903472..2904770 product alpha-galactosidase MelA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246000.1 transl_table 11 codon_start 1 locus_tag LOCUS_28600 gene melA CDS complement(2904793..2905104) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398993.1 transl_table 11 codon_start 1 locus_tag LOCUS_28610 CDS complement(2905219..2907633) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246072.1 transl_table 11 codon_start 1 locus_tag LOCUS_28620 gene leuS CDS complement(2908061..2908396) product DUF4257 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246114.1 transl_table 11 codon_start 1 locus_tag LOCUS_28630 CDS 2908790..2909575 product blue-light photoreceptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399022.1 transl_table 11 codon_start 1 locus_tag LOCUS_28640 CDS complement(2909607..2910800) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398741.1 transl_table 11 codon_start 1 locus_tag LOCUS_28650 CDS 2910990..2911736 product LMBR1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229141.1 transl_table 11 codon_start 1 locus_tag LOCUS_28660 CDS complement(2911773..2913713) product bacitracin ABC transporter permease BceB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229139.1 transl_table 11 codon_start 1 locus_tag LOCUS_28670 gene bceB CDS complement(2913703..2914464) product bacitracin ABC transporter ATP-binding protein BceA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229137.1 transl_table 11 codon_start 1 locus_tag LOCUS_28680 gene bceA CDS complement(2914566..2915570) product two-component sensor histidine kinase BceS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398652.1 transl_table 11 codon_start 1 locus_tag LOCUS_28690 gene bceS CDS complement(2915563..2916258) product two-component response regulator BceR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399109.1 transl_table 11 codon_start 1 locus_tag LOCUS_28700 gene bceR CDS complement(2916356..2917666) product ABC transporter permease YtrF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398682.1 transl_table 11 codon_start 1 locus_tag LOCUS_28710 gene ytrF CDS complement(2917656..2918351) product ABC transporter ATP-binding protein YtrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229129.1 transl_table 11 codon_start 1 locus_tag LOCUS_28720 gene ytrE CDS complement(2918366..2919343) product ABC transporter permease YtrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398887.1 transl_table 11 codon_start 1 locus_tag LOCUS_28730 gene ytrD CDS complement(2919373..2920359) product ABC transporter permease YtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246175.1 transl_table 11 codon_start 1 locus_tag LOCUS_28740 gene ytrC CDS complement(2920353..2921231) product ABC transporter ATP-binding protein YtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398506.1 transl_table 11 codon_start 1 locus_tag LOCUS_28750 gene ytrB CDS complement(2921224..2921616) product GntR family transcriptional regulator YtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229121.1 transl_table 11 codon_start 1 locus_tag LOCUS_28760 gene ytrA CDS complement(2921943..2922215) product YtzC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229117.1 transl_table 11 codon_start 1 locus_tag LOCUS_28770 CDS 2922377..2923348 product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968016.1 transl_table 11 codon_start 1 locus_tag LOCUS_28780 CDS 2923345..2923929 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398483.1 transl_table 11 codon_start 1 locus_tag LOCUS_28790 CDS complement(2923919..2925025) product tetraprenyl-beta-curcumene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399076.1 transl_table 11 codon_start 1 locus_tag LOCUS_28800 gene tbcS CDS complement(2925046..2925825) product phospholipase YtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398545.1 transl_table 11 codon_start 1 locus_tag LOCUS_28810 gene ytpA CDS 2925874..2926389 product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399093.1 transl_table 11 codon_start 1 locus_tag LOCUS_28820 CDS complement(2926649..2928040) product alanine permease AlaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229105.1 transl_table 11 codon_start 1 locus_tag LOCUS_28830 gene alaP CDS complement(2928180..2930078) product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398625.1 transl_table 11 codon_start 1 locus_tag LOCUS_28840 gene asnB CDS complement(2930227..2931429) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229102.1 transl_table 11 codon_start 1 locus_tag LOCUS_28850 gene metK CDS 2931934..2933517 product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229100.1 transl_table 11 codon_start 1 locus_tag LOCUS_28860 gene pckA CDS complement(2933556..2933798) product DUF2584 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398611.1 transl_table 11 codon_start 1 locus_tag LOCUS_28870 CDS complement(2933850..2934623) product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246204.1 transl_table 11 codon_start 1 locus_tag LOCUS_28880 CDS 2934773..2935777 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245977.1 transl_table 11 codon_start 1 locus_tag LOCUS_28890 CDS 2935790..2936572 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229092.1 transl_table 11 codon_start 1 locus_tag LOCUS_28900 CDS 2936547..2937359 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229090.1 transl_table 11 codon_start 1 locus_tag LOCUS_28910 CDS complement(2937416..2937934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28920 CDS complement(2938234..2938566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28930 note possible pseudo, frameshifted CDS complement(2938677..2939153) product nucleoside triphosphatase YtkD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229087.1 transl_table 11 codon_start 1 locus_tag LOCUS_28940 gene ytkD CDS complement(2939365..2939769) product holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229085.1 transl_table 11 codon_start 1 locus_tag LOCUS_28950 CDS complement(2939935..2940372) product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229083.1 transl_table 11 codon_start 1 locus_tag LOCUS_28960 CDS 2940504..2940644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28970 CDS complement(2940638..2941078) product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398648.1 transl_table 11 codon_start 1 locus_tag LOCUS_28980 CDS complement(2941198..2941671) product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219361.1 transl_table 11 codon_start 1 locus_tag LOCUS_28990 CDS 2941799..2942026 product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229076.1 transl_table 11 codon_start 1 locus_tag LOCUS_29000 gene yidD CDS complement(2942023..2942586) product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229074.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 CDS complement(2942705..2942953) product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219346.1 transl_table 11 codon_start 1 locus_tag LOCUS_29020 CDS 2943159..2944490 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399130.1 transl_table 11 codon_start 1 locus_tag LOCUS_29030 CDS 2944533..2945573 product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229071.1 transl_table 11 codon_start 1 locus_tag LOCUS_29040 CDS 2945627..2945785 product DUF1540 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229069.1 transl_table 11 codon_start 1 locus_tag LOCUS_29050 CDS complement(2945804..2946691) product manganese ABC transporter permease MntD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229067.1 transl_table 11 codon_start 1 locus_tag LOCUS_29060 gene mntD CDS complement(2946681..2947988) product manganese ABC transporter permease MntC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229064.1 transl_table 11 codon_start 1 locus_tag LOCUS_29070 gene mntC CDS complement(2947994..2948746) product manganese ABC transporter ATP-binding protein MntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398644.1 transl_table 11 codon_start 1 locus_tag LOCUS_29080 gene mntB CDS complement(2948765..2949685) product manganese ABC transporter substrate-binding protein/adhesin MntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229060.1 transl_table 11 codon_start 1 locus_tag LOCUS_29090 gene mntA CDS complement(2949966..2951081) product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398737.1 transl_table 11 codon_start 1 locus_tag LOCUS_29100 gene menC CDS complement(2951078..2952538) product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229056.1 transl_table 11 codon_start 1 locus_tag LOCUS_29110 CDS complement(2952629..2953447) product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229054.1 transl_table 11 codon_start 1 locus_tag LOCUS_29120 gene menB CDS complement(2953461..2954309) product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398592.1 transl_table 11 codon_start 1 locus_tag LOCUS_29130 gene menH CDS complement(2954297..2956039) product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229050.1 transl_table 11 codon_start 1 locus_tag LOCUS_29140 gene menD CDS complement(2956036..2957496) product isochorismate synthase MenF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398674.1 transl_table 11 codon_start 1 locus_tag LOCUS_29150 CDS 2957743..2958462 product yteA family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229046.1 transl_table 11 codon_start 1 locus_tag LOCUS_29160 CDS complement(2958486..2959289) product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229044.1 transl_table 11 codon_start 1 locus_tag LOCUS_29170 CDS 2959461..2960747 product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398478.1 transl_table 11 codon_start 1 locus_tag LOCUS_29180 CDS 2960744..2961694 product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229036.1 transl_table 11 codon_start 1 locus_tag LOCUS_29190 CDS 2961697..2962920 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229035.1 transl_table 11 codon_start 1 locus_tag LOCUS_29200 CDS complement(2962997..2963419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399071.1 transl_table 11 codon_start 1 locus_tag LOCUS_29210 CDS complement(2963421..2964476) product spore coat protein CotS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229031.1 transl_table 11 codon_start 1 locus_tag LOCUS_29220 gene cotS CDS complement(2964491..2965624) product spore coat protein CotSA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229028.1 transl_table 11 codon_start 1 locus_tag LOCUS_29230 gene cotSA CDS 2965826..2966887 product spore coat kinase CotI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886600.1 transl_table 11 codon_start 1 locus_tag LOCUS_29240 gene cotI CDS 2966979..2967446 product TspO/MBR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229024.1 transl_table 11 codon_start 1 locus_tag LOCUS_29250 CDS complement(2967475..2969871) product glycogen phosphorylase GlgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399110.1 transl_table 11 codon_start 1 locus_tag LOCUS_29260 gene glgP CDS complement(2969858..2971312) product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246015.1 transl_table 11 codon_start 1 locus_tag LOCUS_29270 gene glgA CDS complement(2971309..2972340) product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398841.1 transl_table 11 codon_start 1 locus_tag LOCUS_29280 gene glgD CDS complement(2972363..2973505) product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968049.1 transl_table 11 codon_start 1 locus_tag LOCUS_29290 CDS complement(2973502..2975385) product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398803.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 gene glgB tRNA complement(2975619..2975690) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00600 tRNA complement(2975721..2975811) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00610 tRNA complement(2975815..2975889) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00620 tRNA complement(2975900..2975976) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00630 tRNA complement(2975992..2976065) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00640 tRNA complement(2976075..2976150) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00650 tRNA complement(2976172..2976247) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00660 tRNA complement(2976260..2976336) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00670 tRNA complement(2976401..2976477) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00680 tRNA complement(2976495..2976587) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00690 tRNA complement(2976594..2976670) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00700 tRNA complement(2976673..2976749) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00710 tRNA complement(2976769..2976842) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00720 tRNA complement(2976848..2976924) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00730 tRNA complement(2976940..2977016) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00740 tRNA complement(2977026..2977111) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00750 tRNA complement(2977126..2977200) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00760 tRNA complement(2977206..2977292) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00770 tRNA complement(2977303..2977378) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00780 tRNA complement(2977416..2977491) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00790 tRNA complement(2977524..2977599) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00800 rRNA complement(2977625..2977735) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00280 rRNA complement(2977875..2980798) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00290 rRNA complement(2980970..2982516) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00300 CDS 2983193..2983771 product energy-coupled thiamine transporter ThiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228966.1 transl_table 11 codon_start 1 locus_tag LOCUS_29310 gene thiT CDS complement(2983813..2984334) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228963.1 transl_table 11 codon_start 1 locus_tag LOCUS_29320 CDS complement(2984359..2985888) product flotillin lipid rafts scaffold protein FloT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228960.1 transl_table 11 codon_start 1 locus_tag LOCUS_29330 gene floT CDS complement(2985909..2986433) product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243808.1 transl_table 11 codon_start 1 locus_tag LOCUS_29340 CDS 2986603..2987091 product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242867.1 transl_table 11 codon_start 1 locus_tag LOCUS_29350 CDS complement(2987097..2987678) product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243361.1 transl_table 11 codon_start 1 locus_tag LOCUS_29360 CDS complement(2987766..2988974) product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243227.1 transl_table 11 codon_start 1 locus_tag LOCUS_29370 gene gbsB CDS complement(2988990..2990462) product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243430.1 transl_table 11 codon_start 1 locus_tag LOCUS_29380 gene betB CDS 2990657..2991199 product transcriptional regulator GbsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244320.1 transl_table 11 codon_start 1 locus_tag LOCUS_29390 gene gbsR CDS 2991406..2991951 product biofilm-surface layer protein BslA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243556.1 transl_table 11 codon_start 1 locus_tag LOCUS_29400 gene bslA CDS 2992319..2992987 product potassium uptake protein KtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243377.1 transl_table 11 codon_start 1 locus_tag LOCUS_29410 gene ktrA CDS 2992994..2994331 product Ktr system potassium transporter KtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243582.1 transl_table 11 codon_start 1 locus_tag LOCUS_29420 gene ktrB CDS complement(2994367..2994630) product YiaA/YiaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222348.1 transl_table 11 codon_start 1 locus_tag LOCUS_29430 CDS complement(2994740..2995588) product exo-glucosaminidase LytG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228938.1 transl_table 11 codon_start 1 locus_tag LOCUS_29440 gene lytG CDS complement(2995748..2997283) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243120.1 transl_table 11 codon_start 1 locus_tag LOCUS_29450 CDS 2997744..2998229 product cysteine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243534.1 transl_table 11 codon_start 1 locus_tag LOCUS_29460 gene cdoA tRNA complement(2998337..2998409) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00810 CDS complement(2998514..2999344) product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243397.1 transl_table 11 codon_start 1 locus_tag LOCUS_29470 CDS complement(2999436..3000602) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244365.1 transl_table 11 codon_start 1 locus_tag LOCUS_29480 CDS 3000783..3001769 product scyllo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228926.1 transl_table 11 codon_start 1 locus_tag LOCUS_29490 gene iolU CDS complement(3001811..3003085) product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244294.1 transl_table 11 codon_start 1 locus_tag LOCUS_29500 gene rhaA CDS complement(3003110..3003424) product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243762.1 transl_table 11 codon_start 1 locus_tag LOCUS_29510 gene rhaM CDS complement(3003439..3004899) product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243094.1 transl_table 11 codon_start 1 locus_tag LOCUS_29520 gene rhaB CDS complement(3004904..3005680) product rhamnose catabolism operon transcriptional regulator RhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968057.1 transl_table 11 codon_start 1 locus_tag LOCUS_29530 gene rhaR CDS complement(3005740..3007809) product bifunctional aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244479.1 transl_table 11 codon_start 1 locus_tag LOCUS_29540 CDS complement(3007946..3009934) product methyl-accepting chemotaxis protein TlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243983.1 transl_table 11 codon_start 1 locus_tag LOCUS_29550 gene tlpB CDS complement(3010047..3012032) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244077.1 transl_table 11 codon_start 1 locus_tag LOCUS_29560 gene mcpA CDS complement(3012161..3014146) product methyl-accepting chemotaxis protein TlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243846.1 transl_table 11 codon_start 1 locus_tag LOCUS_29570 gene tlpA CDS complement(3014325..3016313) product methyl-accepting chemotaxis protein McpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243461.1 transl_table 11 codon_start 1 locus_tag LOCUS_29580 gene mcpB CDS 3016470..3017207 product protein-glutamine gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243977.1 transl_table 11 codon_start 1 locus_tag LOCUS_29590 CDS complement(3017220..3017477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244393.1 transl_table 11 codon_start 1 locus_tag LOCUS_29600 CDS complement(3017499..3018530) product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229861.1 transl_table 11 codon_start 1 locus_tag LOCUS_29610 CDS complement(3018544..3018942) product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243483.1 transl_table 11 codon_start 1 locus_tag LOCUS_29620 CDS complement(3019061..3020725) product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243842.1 transl_table 11 codon_start 1 locus_tag LOCUS_29630 CDS 3020932..3021264 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29640 note possible pseudo, frameshifted CDS 3021564..3022082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29650 CDS complement(3022139..3023431) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968059.1 transl_table 11 codon_start 1 locus_tag LOCUS_29660 CDS complement(3023475..3024152) product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228889.1 transl_table 11 codon_start 1 locus_tag LOCUS_29670 CDS complement(3024197..3024460) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243434.1 transl_table 11 codon_start 1 locus_tag LOCUS_29680 CDS 3024508..3024840 product biofilm formation protein MstX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228886.1 transl_table 11 codon_start 1 locus_tag LOCUS_29690 gene mstX CDS 3024837..3025823 product potassium channel protein KbfO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242502.1 transl_table 11 codon_start 1 locus_tag LOCUS_29700 gene kbfO CDS complement(3025820..3026224) product YugN-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228878.1 transl_table 11 codon_start 1 locus_tag LOCUS_29710 CDS complement(3026285..3026650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886601.1 transl_table 11 codon_start 1 locus_tag LOCUS_29720 CDS complement(3026715..3028067) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243401.1 transl_table 11 codon_start 1 locus_tag LOCUS_29730 CDS complement(3028179..3029351) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228872.1 transl_table 11 codon_start 1 locus_tag LOCUS_29740 CDS complement(3029454..3030617) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228869.1 transl_table 11 codon_start 1 locus_tag LOCUS_29750 CDS 3030848..3031084 product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220771.1 transl_table 11 codon_start 1 locus_tag LOCUS_29760 CDS complement(3031129..3031521) product S1 domain-containing post-transcriptional regulator GSP13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228864.1 transl_table 11 codon_start 1 locus_tag LOCUS_29770 gene yugI CDS complement(3031723..3032883) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968069.1 transl_table 11 codon_start 1 locus_tag LOCUS_29780 CDS complement(3032884..3033384) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968070.1 transl_table 11 codon_start 1 locus_tag LOCUS_29790 CDS 3033534..3034355 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228858.1 transl_table 11 codon_start 1 locus_tag LOCUS_29800 CDS complement(3034382..3034642) product YugE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242594.1 transl_table 11 codon_start 1 locus_tag LOCUS_29810 CDS 3034729..3035892 product cystathionine beta-lyase PatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228854.1 transl_table 11 codon_start 1 locus_tag LOCUS_29820 gene patB CDS 3036018..3037304 product sporulation sensor histidine kinase KinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228853.1 transl_table 11 codon_start 1 locus_tag LOCUS_29830 gene kinB CDS 3037350..3037736 product kinase-associated lipoprotein KapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228851.1 transl_table 11 codon_start 1 locus_tag LOCUS_29840 gene kapB CDS complement(3037763..3038380) product 3'-5' exonuclease KapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228846.1 transl_table 11 codon_start 1 locus_tag LOCUS_29850 gene kapD CDS complement(3038456..3038659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29860 CDS 3038712..3039770 product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228842.1 transl_table 11 codon_start 1 locus_tag LOCUS_29870 CDS 3039863..3041737 product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886602.1 transl_table 11 codon_start 1 locus_tag LOCUS_29880 CDS 3041758..3042171 product thiol-disulfide oxidoreductase DCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228839.1 transl_table 11 codon_start 1 locus_tag LOCUS_29890 CDS complement(3042189..3042746) product YufK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228837.1 transl_table 11 codon_start 1 locus_tag LOCUS_29900 CDS 3042924..3044525 product two-component system sensor histidine kinase MaeL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228835.1 transl_table 11 codon_start 1 locus_tag LOCUS_29910 gene maeL CDS 3044518..3045225 product two-component system response regulator MaeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968074.1 transl_table 11 codon_start 1 locus_tag LOCUS_29920 gene maeM CDS 3045655..3047001 product sodium/malate symporter MaeN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244241.1 transl_table 11 codon_start 1 locus_tag LOCUS_29930 gene maeN CDS complement(3047038..3047253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228823.1 transl_table 11 codon_start 1 locus_tag LOCUS_29940 CDS 3047483..3049888 product Na+/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228821.1 transl_table 11 codon_start 1 locus_tag LOCUS_29950 CDS 3049881..3050312 product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228819.1 transl_table 11 codon_start 1 locus_tag LOCUS_29960 CDS 3050312..3050653 product Na(+)/H(+) antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220730.1 transl_table 11 codon_start 1 locus_tag LOCUS_29970 CDS 3050646..3052127 product Na+/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244432.1 transl_table 11 codon_start 1 locus_tag LOCUS_29980 CDS 3052133..3052609 product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244015.1 transl_table 11 codon_start 1 locus_tag LOCUS_29990 CDS 3052609..3052893 product Na(+)/H(+) antiporter subunit F1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228814.1 transl_table 11 codon_start 1 locus_tag LOCUS_30000 CDS 3052877..3053251 product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244302.1 transl_table 11 codon_start 1 locus_tag LOCUS_30010 gene mnhG CDS complement(3053290..3053670) product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228810.1 transl_table 11 codon_start 1 locus_tag LOCUS_30020 CDS complement(3053686..3054330) product two-component system response regulator ComA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220716.1 transl_table 11 codon_start 1 locus_tag LOCUS_30030 gene comA CDS complement(3054411..3056315) product two-component system sensor histidine kinase ComP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242894.1 transl_table 11 codon_start 1 locus_tag LOCUS_30040 gene comP CDS complement(3056743..3056907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30050 CDS complement(3056920..3057780) product ComX modifying isoprenyl transferase ComQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243039.1 transl_table 11 codon_start 1 locus_tag LOCUS_30060 gene comQ CDS complement(3057966..3058106) product degradation enzyme regulation protein DegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220708.1 transl_table 11 codon_start 1 locus_tag LOCUS_30070 gene degQ CDS 3058569..3058937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243784.1 transl_table 11 codon_start 1 locus_tag LOCUS_30080 CDS complement(3058913..3060142) product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243525.1 transl_table 11 codon_start 1 locus_tag LOCUS_30090 gene pdeH CDS complement(3060277..3061749) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228788.1 transl_table 11 codon_start 1 locus_tag LOCUS_30100 CDS complement(3061765..3062316) product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243099.1 transl_table 11 codon_start 1 locus_tag LOCUS_30110 CDS complement(3062413..3062811) product YueI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242987.1 transl_table 11 codon_start 1 locus_tag LOCUS_30120 CDS complement(3062883..3063131) product YueH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228783.1 transl_table 11 codon_start 1 locus_tag LOCUS_30130 CDS complement(3063204..3063425) product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242933.1 transl_table 11 codon_start 1 locus_tag LOCUS_30140 CDS complement(3063485..3064594) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243652.1 transl_table 11 codon_start 1 locus_tag LOCUS_30150 CDS 3064709..3065098 product DUF2283 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243066.1 transl_table 11 codon_start 1 locus_tag LOCUS_30160 CDS complement(3065139..3065375) product YuzF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220677.1 transl_table 11 codon_start 1 locus_tag LOCUS_30170 CDS complement(3065561..3066091) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244444.1 transl_table 11 codon_start 1 locus_tag LOCUS_30180 CDS complement(3066288..3067019) product (S)-benzoin forming benzil reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244421.1 transl_table 11 codon_start 1 locus_tag LOCUS_30190 CDS complement(3067086..3067541) product type VII secretion protein EssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886603.1 transl_table 11 codon_start 1 locus_tag LOCUS_30200 gene essA CDS complement(3067573..3070806) product type VII secretion protein EsaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244105.1 transl_table 11 codon_start 1 locus_tag LOCUS_30210 gene esaA CDS complement(3070803..3075290) product type VII secretion protein EssC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243866.1 transl_table 11 codon_start 1 locus_tag LOCUS_30220 gene essC CDS complement(3075351..3076682) product type VII secretion protein EssB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243575.1 transl_table 11 codon_start 1 locus_tag LOCUS_30230 gene essB CDS complement(3076697..3076936) product ESX secretion system protein YukD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228763.1 transl_table 11 codon_start 1 locus_tag LOCUS_30240 gene yukD CDS complement(3077007..3077300) product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220661.1 transl_table 11 codon_start 1 locus_tag LOCUS_30250 CDS 3077875..3079098 product sporulation transcriptional activator AdeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886604.1 transl_table 11 codon_start 1 locus_tag LOCUS_30260 gene adeR CDS 3079200..3080336 product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243280.1 transl_table 11 codon_start 1 locus_tag LOCUS_30270 gene ald CDS 3080449..3081126 product YukJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242737.1 transl_table 11 codon_start 1 locus_tag LOCUS_30280 CDS complement(3081169..3081378) product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243183.1 transl_table 11 codon_start 1 locus_tag LOCUS_30290 CDS complement(3081393..3088532) product non-ribosomal peptide synthetase DhbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968094.1 transl_table 11 codon_start 1 locus_tag LOCUS_30300 gene dhbF CDS complement(3088552..3089487) product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228749.1 transl_table 11 codon_start 1 locus_tag LOCUS_30310 CDS complement(3089520..3091139) product (2,3-dihydroxybenzoyl)adenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243083.1 transl_table 11 codon_start 1 locus_tag LOCUS_30320 CDS complement(3091168..3092367) product isochorismate synthase DhbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243699.1 transl_table 11 codon_start 1 locus_tag LOCUS_30330 gene dhbC CDS complement(3092393..3093178) product 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244476.1 transl_table 11 codon_start 1 locus_tag LOCUS_30340 CDS complement(3093380..3094258) product ferri-bacillibactin esterase BesA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228740.1 transl_table 11 codon_start 1 locus_tag LOCUS_30350 gene besA CDS complement(3094460..3095056) product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228739.1 transl_table 11 codon_start 1 locus_tag LOCUS_30360 CDS 3095159..3095761 product BioY family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228737.1 transl_table 11 codon_start 1 locus_tag LOCUS_30370 CDS complement(3095829..3097157) product Na+/H+ antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228736.1 transl_table 11 codon_start 1 locus_tag LOCUS_30380 CDS complement(3097302..3098804) product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228733.1 transl_table 11 codon_start 1 locus_tag LOCUS_30390 CDS 3098962..3099438 product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244337.1 transl_table 11 codon_start 1 locus_tag LOCUS_30400 CDS complement(3099467..3100123) product stationary phase survival protein SpsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969090.1 transl_table 11 codon_start 1 locus_tag LOCUS_30410 gene spsC CDS complement(3100227..3100547) product YuiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243877.1 transl_table 11 codon_start 1 locus_tag LOCUS_30420 CDS complement(3100916..3102136) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886605.1 transl_table 11 codon_start 1 locus_tag LOCUS_30430 CDS 3102468..3103466 product ferredoxin--NADP reductase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220618.1 transl_table 11 codon_start 1 locus_tag LOCUS_30440 gene yumC CDS complement(3103506..3103646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228723.1 transl_table 11 codon_start 1 locus_tag LOCUS_30450 CDS 3103924..3104904 product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244278.1 transl_table 11 codon_start 1 locus_tag LOCUS_30460 gene guaC CDS complement(3104978..3105199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30470 CDS complement(3105216..3105743) product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870301.1 transl_table 11 codon_start 1 locus_tag LOCUS_30480 CDS complement(3105740..3106444) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434049.1 transl_table 11 codon_start 1 locus_tag LOCUS_30490 CDS 3106702..3106863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30500 CDS complement(3108175..3108510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30510 CDS complement(3108575..3109147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30520 CDS complement(3110221..3110367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30530 note possible pseudo, internal stop codon, frameshifted CDS complement(3110581..3111099) product spermidine/spermine N(1)-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244000.1 transl_table 11 codon_start 1 locus_tag LOCUS_30540 gene paiA CDS complement(3111176..3111349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30550 CDS complement(3111651..3112013) product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244166.1 transl_table 11 codon_start 1 locus_tag LOCUS_30560 CDS complement(3112092..3112946) product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243745.1 transl_table 11 codon_start 1 locus_tag LOCUS_30570 gene dapF CDS complement(3113069..3114283) product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243750.1 transl_table 11 codon_start 1 locus_tag LOCUS_30580 CDS complement(3114422..3114658) product YuzB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222913.1 transl_table 11 codon_start 1 locus_tag LOCUS_30590 CDS 3114921..3115988 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242518.1 transl_table 11 codon_start 1 locus_tag LOCUS_30600 CDS complement(3116175..3116501) product YuzD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242597.1 transl_table 11 codon_start 1 locus_tag LOCUS_30610 CDS 3116698..3116934 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30620 CDS complement(3116976..3118949) product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243690.1 transl_table 11 codon_start 1 locus_tag LOCUS_30630 CDS complement(3119058..3119987) product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228699.1 transl_table 11 codon_start 1 locus_tag LOCUS_30640 gene thrB CDS complement(3119984..3121051) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228697.1 transl_table 11 codon_start 1 locus_tag LOCUS_30650 gene thrC CDS complement(3121042..3122343) product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228694.1 transl_table 11 codon_start 1 locus_tag LOCUS_30660 CDS complement(3122511..3123536) product spore coat-associated protein CotNH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242649.1 transl_table 11 codon_start 1 locus_tag LOCUS_30670 gene cotNH CDS 3123692..3124192 product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243814.1 transl_table 11 codon_start 1 locus_tag LOCUS_30680 CDS complement(3124218..3124988) product 5' nucleotidase NucF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243196.1 transl_table 11 codon_start 1 locus_tag LOCUS_30690 gene nucF CDS complement(3125017..3125451) product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228684.1 transl_table 11 codon_start 1 locus_tag LOCUS_30700 CDS complement(3125475..3125750) product YutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228682.1 transl_table 11 codon_start 1 locus_tag LOCUS_30710 CDS 3125864..3126499 product YhcN/YlaJ family sporulation lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243821.1 transl_table 11 codon_start 1 locus_tag LOCUS_30720 CDS complement(3126515..3127411) product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222888.1 transl_table 11 codon_start 1 locus_tag LOCUS_30730 gene lipA CDS 3127646..3128626 product L-Ala--D-Glu endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243462.1 transl_table 11 codon_start 1 locus_tag LOCUS_30740 gene lytH CDS complement(3128654..3129421) product sporulation protein YunB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968113.1 transl_table 11 codon_start 1 locus_tag LOCUS_30750 gene yunB CDS complement(3129493..3129798) product YunC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242587.1 transl_table 11 codon_start 1 locus_tag LOCUS_30760 CDS complement(3129864..3131252) product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242525.1 transl_table 11 codon_start 1 locus_tag LOCUS_30770 CDS complement(3131272..3132093) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228670.1 transl_table 11 codon_start 1 locus_tag LOCUS_30780 CDS complement(3132111..3132965) product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243895.1 transl_table 11 codon_start 1 locus_tag LOCUS_30790 CDS complement(3132997..3133344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242865.1 transl_table 11 codon_start 1 locus_tag LOCUS_30800 CDS complement(3133441..3134784) product allantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243112.1 transl_table 11 codon_start 1 locus_tag LOCUS_30810 CDS 3134959..3136554 product purine catabolism transcriptional regulator PucR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244351.1 transl_table 11 codon_start 1 locus_tag LOCUS_30820 gene pucR CDS 3136698..3138050 product uric acid permease PucJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243942.1 transl_table 11 codon_start 1 locus_tag LOCUS_30830 gene pucJ CDS 3138056..3139348 product uric acid permease PucK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244570.1 transl_table 11 codon_start 1 locus_tag LOCUS_30840 gene pucK CDS 3139361..3140845 product urate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242600.1 transl_table 11 codon_start 1 locus_tag LOCUS_30850 gene pucL CDS 3140845..3141189 product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244132.1 transl_table 11 codon_start 1 locus_tag LOCUS_30860 gene uraH CDS 3141428..3141982 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30870 CDS complement(3142724..3143260) product xanthine dehydrogenase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243276.1 transl_table 11 codon_start 1 locus_tag LOCUS_30880 gene pucE CDS complement(3143251..3145488) product xanthine dehydrogenase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243174.1 transl_table 11 codon_start 1 locus_tag LOCUS_30890 gene pucD CDS complement(3145489..3146322) product xanthine dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228646.1 transl_table 11 codon_start 1 locus_tag LOCUS_30900 gene pucC CDS complement(3146319..3146936) product xanthine dehydrogenase accessory protein PucB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228645.1 transl_table 11 codon_start 1 locus_tag LOCUS_30910 gene pucB CDS complement(3146933..3147925) product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243519.1 transl_table 11 codon_start 1 locus_tag LOCUS_30920 CDS 3148028..3148225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30930 CDS complement(3148155..3149411) product (S)-ureidoglycine--glyoxylate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244520.1 transl_table 11 codon_start 1 locus_tag LOCUS_30940 gene pucG CDS complement(3149422..3150660) product allantoate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228640.1 transl_table 11 codon_start 1 locus_tag LOCUS_30950 gene allC CDS 3150858..3151340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30960 note possible pseudo, internal stop codon CDS 3151389..3151919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30970 note possible pseudo, internal stop codon CDS 3152001..3152867 product endonuclease I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968119.1 transl_table 11 codon_start 1 locus_tag LOCUS_30980 CDS complement(3152900..3154003) product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228630.1 transl_table 11 codon_start 1 locus_tag LOCUS_30990 gene ugpC CDS 3154184..3154912 product transcriptional regulator FrlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228628.1 transl_table 11 codon_start 1 locus_tag LOCUS_31000 gene frlR CDS complement(3154937..3155791) product fructosamine kinase FrlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228626.1 transl_table 11 codon_start 1 locus_tag LOCUS_31010 gene frlD CDS complement(3155805..3156707) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228625.1 transl_table 11 codon_start 1 locus_tag LOCUS_31020 CDS complement(3156711..3157589) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243523.1 transl_table 11 codon_start 1 locus_tag LOCUS_31030 CDS complement(3157647..3158915) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243455.1 transl_table 11 codon_start 1 locus_tag LOCUS_31040 CDS complement(3158996..3159982) product fructosamine deglycase FrlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243688.1 transl_table 11 codon_start 1 locus_tag LOCUS_31050 gene frlB CDS complement(3160197..3160430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31060 CDS complement(3160667..3161791) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228615.1 transl_table 11 codon_start 1 locus_tag LOCUS_31070 CDS 3161950..3162099 product acid-soluble spore protein SspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228613.1 transl_table 11 codon_start 1 locus_tag LOCUS_31080 gene sspG CDS 3162099..3162371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243521.1 transl_table 11 codon_start 1 locus_tag LOCUS_31090 CDS complement(3162525..3162908) product methylglyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243237.1 transl_table 11 codon_start 1 locus_tag LOCUS_31100 gene glxB CDS complement(3163017..3163295) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968126.1 transl_table 11 codon_start 1 locus_tag LOCUS_31110 CDS complement(3163719..3165116) product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228608.1 transl_table 11 codon_start 1 locus_tag LOCUS_31120 gene sufB CDS complement(3165137..3165580) product iron-sulfur cluster assembly scaffold protein SufU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222809.1 transl_table 11 codon_start 1 locus_tag LOCUS_31130 gene sufU CDS complement(3165570..3166790) product cysteine desulfurase SufS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228604.1 transl_table 11 codon_start 1 locus_tag LOCUS_31140 gene sufS CDS complement(3166790..3168103) product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228602.1 transl_table 11 codon_start 1 locus_tag LOCUS_31150 gene sufD CDS complement(3168121..3168906) product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151872.1 transl_table 11 codon_start 1 locus_tag LOCUS_31160 gene sufC CDS complement(3169099..3169236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228600.1 transl_table 11 codon_start 1 locus_tag LOCUS_31170 CDS complement(3169429..3169791) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228596.1 transl_table 11 codon_start 1 locus_tag LOCUS_31180 CDS complement(3169892..3170716) product methionine ABC transporter substrate-binding lipoprotein MetQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228595.1 transl_table 11 codon_start 1 locus_tag LOCUS_31190 gene metQ CDS complement(3170730..3171398) product methionine ABC transporter permease MetP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228593.1 transl_table 11 codon_start 1 locus_tag LOCUS_31200 gene metP CDS complement(3171391..3172416) product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242531.1 transl_table 11 codon_start 1 locus_tag LOCUS_31210 gene metN CDS complement(3172743..3173087) product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228587.1 transl_table 11 codon_start 1 locus_tag LOCUS_31220 CDS complement(3173195..3173515) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228585.1 transl_table 11 codon_start 1 locus_tag LOCUS_31230 CDS complement(3173517..3173879) product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968134.1 transl_table 11 codon_start 1 locus_tag LOCUS_31240 CDS complement(3173957..3174193) product YusG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228581.1 transl_table 11 codon_start 1 locus_tag LOCUS_31250 CDS complement(3174249..3174632) product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222781.1 transl_table 11 codon_start 1 locus_tag LOCUS_31260 gene gcvH CDS complement(3174699..3175055) product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222779.1 transl_table 11 codon_start 1 locus_tag LOCUS_31270 CDS complement(3175164..3176948) product acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244094.1 transl_table 11 codon_start 1 locus_tag LOCUS_31280 gene fadE CDS complement(3176963..3178138) product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228574.1 transl_table 11 codon_start 1 locus_tag LOCUS_31290 CDS complement(3178149..3180518) product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243831.1 transl_table 11 codon_start 1 locus_tag LOCUS_31300 CDS 3180693..3180839 product YuzL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228571.1 transl_table 11 codon_start 1 locus_tag LOCUS_31310 CDS complement(3180864..3181772) product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228569.1 transl_table 11 codon_start 1 locus_tag LOCUS_31320 CDS 3181867..3182112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228567.1 transl_table 11 codon_start 1 locus_tag LOCUS_31330 CDS 3182125..3182457 product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228564.1 transl_table 11 codon_start 1 locus_tag LOCUS_31340 CDS 3182616..3183086 product MarR family transcriptional regulator MdtR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242592.1 transl_table 11 codon_start 1 locus_tag LOCUS_31350 gene mdtR CDS 3183088..3184704 product multidrug efflux MFS transporter MdtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228559.1 transl_table 11 codon_start 1 locus_tag LOCUS_31360 gene mdtP CDS complement(3184741..3185124) product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968136.1 transl_table 11 codon_start 1 locus_tag LOCUS_31370 CDS complement(3185143..3185883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31380 CDS 3186019..3186906 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228551.1 transl_table 11 codon_start 1 locus_tag LOCUS_31390 CDS complement(3186927..3187214) product YusU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228549.1 transl_table 11 codon_start 1 locus_tag LOCUS_31400 CDS complement(3187241..3188062) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886609.1 transl_table 11 codon_start 1 locus_tag LOCUS_31410 CDS complement(3188286..3188723) product YusW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228545.1 transl_table 11 codon_start 1 locus_tag LOCUS_31420 CDS complement(3188872..3190680) product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990142.1 transl_table 11 codon_start 1 locus_tag LOCUS_31430 CDS 3190814..3191668 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228540.1 transl_table 11 codon_start 1 locus_tag LOCUS_31440 CDS 3191745..3192206 product metalloregulation DNA-binding stress protein MgrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228537.1 transl_table 11 codon_start 1 locus_tag LOCUS_31450 gene mrgA CDS complement(3192248..3193624) product serine protease Do-like protein HtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228534.1 transl_table 11 codon_start 1 locus_tag LOCUS_31460 gene htrB CDS 3193902..3194579 product secretion stress-responsive two-component system response regulator CssR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228529.1 transl_table 11 codon_start 1 locus_tag LOCUS_31470 gene cssR CDS 3194576..3195931 product secretion stress-responsive two-component system sensor histidine kinase CssS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228527.1 transl_table 11 codon_start 1 locus_tag LOCUS_31480 gene cssS CDS complement(3195960..3196124) product anti-adapter protein SpxO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221681.1 transl_table 11 codon_start 1 locus_tag LOCUS_31490 gene spxO CDS 3196293..3197168 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243192.1 transl_table 11 codon_start 1 locus_tag LOCUS_31500 CDS complement(3197208..3198596) product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228523.1 transl_table 11 codon_start 1 locus_tag LOCUS_31510 gene fumC CDS complement(3198663..3198848) product YvzF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244599.1 transl_table 11 codon_start 1 locus_tag LOCUS_31520 CDS 3198965..3200413 product spore germination receptor protein GerAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886610.1 transl_table 11 codon_start 1 locus_tag LOCUS_31530 gene gerAA CDS 3200382..3201479 product spore germination receptor protein GerAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968145.1 transl_table 11 codon_start 1 locus_tag LOCUS_31540 gene gerAB CDS 3201476..3202597 product spore germination receptor protein GerAC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968146.1 transl_table 11 codon_start 1 locus_tag LOCUS_31550 gene gerAC CDS complement(3202605..3203240) product two-component system response regulator LiaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243201.1 transl_table 11 codon_start 1 locus_tag LOCUS_31560 gene liaR CDS complement(3203218..3204300) product two-component system sensor histidine kinase LiaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244464.1 transl_table 11 codon_start 1 locus_tag LOCUS_31570 gene liaS CDS complement(3204297..3205022) product LiaRS two-component regulatory system accessory protein LiaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242605.1 transl_table 11 codon_start 1 locus_tag LOCUS_31580 gene liaF CDS complement(3205056..3205928) product DUF4097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244420.1 transl_table 11 codon_start 1 locus_tag LOCUS_31590 CDS complement(3206029..3206709) product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243047.1 transl_table 11 codon_start 1 locus_tag LOCUS_31600 CDS complement(3206736..3207116) product cell envelope stress-induced membrane anchor protein LiaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243447.1 transl_table 11 codon_start 1 locus_tag LOCUS_31610 gene liaI CDS complement(3207278..3208546) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244338.1 transl_table 11 codon_start 1 locus_tag LOCUS_31620 CDS complement(3208722..3209303) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228501.1 transl_table 11 codon_start 1 locus_tag LOCUS_31630 CDS complement(3209325..3210659) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886611.1 transl_table 11 codon_start 1 locus_tag LOCUS_31640 CDS complement(3210656..3211717) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968147.1 transl_table 11 codon_start 1 locus_tag LOCUS_31650 CDS complement(3211680..3212633) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243040.1 transl_table 11 codon_start 1 locus_tag LOCUS_31660 CDS 3213033..3213824 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242985.1 transl_table 11 codon_start 1 locus_tag LOCUS_31670 CDS complement(3213862..3214740) product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228493.1 transl_table 11 codon_start 1 locus_tag LOCUS_31680 CDS complement(3214809..3216551) product two-component system sensor histidine kinase YvrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243980.1 transl_table 11 codon_start 1 locus_tag LOCUS_31690 gene yvrG CDS complement(3216548..3217261) product two-component system response regulator YvrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243545.1 transl_table 11 codon_start 1 locus_tag LOCUS_31700 gene yvrH CDS complement(3217415..3217651) product sigma-O factor regulator RsoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228484.1 transl_table 11 codon_start 1 locus_tag LOCUS_31710 gene rsoA CDS complement(3217648..3218184) product RNA polymerase sigma factor SigO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243707.1 transl_table 11 codon_start 1 locus_tag LOCUS_31720 gene sigO CDS 3218388..3218543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31730 CDS 3218663..3219820 product oxalate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243476.1 transl_table 11 codon_start 1 locus_tag LOCUS_31740 gene oxdC CDS complement(3220325..3221554) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244568.1 transl_table 11 codon_start 1 locus_tag LOCUS_31750 CDS complement(3221547..3222236) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242701.1 transl_table 11 codon_start 1 locus_tag LOCUS_31760 CDS complement(3222220..3223413) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243035.1 transl_table 11 codon_start 1 locus_tag LOCUS_31770 CDS complement(3223585..3224394) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243882.1 transl_table 11 codon_start 1 locus_tag LOCUS_31780 CDS complement(3224410..3225420) product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244298.1 transl_table 11 codon_start 1 locus_tag LOCUS_31790 CDS complement(3225420..3226466) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886613.1 transl_table 11 codon_start 1 locus_tag LOCUS_31800 CDS 3226671..3227618 product iron-hydroxamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243220.1 transl_table 11 codon_start 1 locus_tag LOCUS_31810 CDS complement(3227983..3229392) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244227.1 transl_table 11 codon_start 1 locus_tag LOCUS_31820 CDS complement(3229792..3229932) product small acid-soluble spore protein SspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221612.1 transl_table 11 codon_start 1 locus_tag LOCUS_31830 gene sspJ CDS 3230101..3230583 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228444.1 transl_table 11 codon_start 1 locus_tag LOCUS_31840 CDS 3230683..3232536 product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243932.1 transl_table 11 codon_start 1 locus_tag LOCUS_31850 CDS complement(3232563..3233492) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243439.1 transl_table 11 codon_start 1 locus_tag LOCUS_31860 CDS 3233599..3234381 product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243706.1 transl_table 11 codon_start 1 locus_tag LOCUS_31870 gene modA CDS 3234413..3235045 product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014906541.1 transl_table 11 codon_start 1 locus_tag LOCUS_31880 gene modB CDS complement(3235075..3235905) product glyoxal/methylglyoxal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243374.1 transl_table 11 codon_start 1 locus_tag LOCUS_31890 gene pgoN CDS 3236128..3236613 product stress response protein YvgO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243913.1 transl_table 11 codon_start 1 locus_tag LOCUS_31900 gene yvgO CDS complement(3236658..3238670) product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243269.1 transl_table 11 codon_start 1 locus_tag LOCUS_31910 CDS complement(3238925..3240640) product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243849.1 transl_table 11 codon_start 1 locus_tag LOCUS_31920 gene cysI CDS complement(3240666..3242483) product assimilatory sulfite reductase (NADPH) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243259.1 transl_table 11 codon_start 1 locus_tag LOCUS_31930 CDS complement(3242654..3244978) product DNA helicase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244180.1 transl_table 11 codon_start 1 locus_tag LOCUS_31940 gene helD CDS complement(3245171..3245779) product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219999.1 transl_table 11 codon_start 1 locus_tag LOCUS_31950 CDS complement(3245965..3246381) product disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228417.1 transl_table 11 codon_start 1 locus_tag LOCUS_31960 CDS complement(3246386..3247054) product disulfide bond formation protein BdbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228414.1 transl_table 11 codon_start 1 locus_tag LOCUS_31970 gene bdbD CDS complement(3247175..3249283) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014906546.1 transl_table 11 codon_start 1 locus_tag LOCUS_31980 CDS complement(3249443..3251854) product copper-exporting P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242925.1 transl_table 11 codon_start 1 locus_tag LOCUS_31990 gene copA CDS complement(3251938..3252147) product copper chaperone CopZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244260.1 transl_table 11 codon_start 1 locus_tag LOCUS_32000 gene copZ CDS complement(3252222..3252527) product copper-sensing transcriptional repressor CsoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228404.1 transl_table 11 codon_start 1 locus_tag LOCUS_32010 gene csoR CDS 3252653..3253729 product scyllo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968169.1 transl_table 11 codon_start 1 locus_tag LOCUS_32020 gene iolW CDS complement(3253767..3254402) product FMN-dependent NADH-azoreductase AzoRB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243587.1 transl_table 11 codon_start 1 locus_tag LOCUS_32030 gene azoRB CDS complement(3254562..3256460) product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243180.1 transl_table 11 codon_start 1 locus_tag LOCUS_32040 CDS complement(3256566..3257222) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002040907.1 transl_table 11 codon_start 1 locus_tag LOCUS_32050 CDS complement(3257230..3258177) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378082.1 transl_table 11 codon_start 1 locus_tag LOCUS_32060 CDS complement(3258298..3259092) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228388.1 transl_table 11 codon_start 1 locus_tag LOCUS_32070 CDS 3259544..3259960 product NAD(+)--rifampin ADP-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811445.1 transl_table 11 codon_start 1 locus_tag LOCUS_32080 gene arr CDS 3260650..3260850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32090 tmRNA complement(3261423..3261782) product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(3261958..3262428) product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220025.1 transl_table 11 codon_start 1 locus_tag LOCUS_32100 gene smpB CDS complement(3262573..3264912) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228386.1 transl_table 11 codon_start 1 locus_tag LOCUS_32110 gene rnr CDS complement(3264931..3265671) product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242610.1 transl_table 11 codon_start 1 locus_tag LOCUS_32120 CDS complement(3265803..3266033) product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220028.1 transl_table 11 codon_start 1 locus_tag LOCUS_32130 gene secG CDS 3266184..3266954 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228381.1 transl_table 11 codon_start 1 locus_tag LOCUS_32140 CDS complement(3266995..3267228) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968172.1 transl_table 11 codon_start 1 locus_tag LOCUS_32150 CDS 3267380..3267787 product transcriptional repressor RghR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220034.1 transl_table 11 codon_start 1 locus_tag LOCUS_32160 gene rghR CDS 3267816..3268235 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228377.1 transl_table 11 codon_start 1 locus_tag LOCUS_32170 CDS 3268326..3268652 product catDE operon transcriptional regulator CatR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242888.1 transl_table 11 codon_start 1 locus_tag LOCUS_32180 gene catR CDS complement(3268862..3270241) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949126.1 transl_table 11 codon_start 1 locus_tag LOCUS_32190 CDS complement(3270232..3270894) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405372.1 transl_table 11 codon_start 1 locus_tag LOCUS_32200 CDS complement(3270912..3271682) product lantibiotic immunity ABC transporter MutG family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405369.1 transl_table 11 codon_start 1 locus_tag LOCUS_32210 CDS complement(3271684..3272439) product lantibiotic immunity ABC transporter MutE/EpiE family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949125.1 transl_table 11 codon_start 1 locus_tag LOCUS_32220 CDS complement(3272436..3273152) product lantibiotic protection ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261887.1 transl_table 11 codon_start 1 locus_tag LOCUS_32230 CDS complement(3273166..3273663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32240 CDS complement(3274249..3274419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32250 CDS complement(3274494..3275819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32260 CDS complement(3275792..3277636) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888006.1 transl_table 11 codon_start 1 locus_tag LOCUS_32270 CDS complement(3277627..3280719) product lantibiotic dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031312.1 transl_table 11 codon_start 1 locus_tag LOCUS_32280 CDS complement(3280938..3281609) product choline ABC transporter permease OpuBD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228374.1 transl_table 11 codon_start 1 locus_tag LOCUS_32290 gene opuBD CDS complement(3281626..3282546) product choline ABC transporter substrate-binding lipoprotein OpuBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228372.1 transl_table 11 codon_start 1 locus_tag LOCUS_32300 gene opuBC CDS complement(3282558..3283211) product choline ABC transporter permease OpuBB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228370.1 transl_table 11 codon_start 1 locus_tag LOCUS_32310 gene opuBB CDS complement(3283226..3284371) product choline ABC transporter ATP-binding protein OpuBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242811.1 transl_table 11 codon_start 1 locus_tag LOCUS_32320 gene opuBA CDS 3284656..3285189 product GbsR/MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243347.1 transl_table 11 codon_start 1 locus_tag LOCUS_32330 CDS complement(3285249..3285767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32340 CDS complement(3286067..3286399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32350 note possible pseudo, frameshifted CDS complement(3286514..3287188) product glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244403.1 transl_table 11 codon_start 1 locus_tag LOCUS_32360 gene opuCD CDS complement(3287206..3288123) product osmoprotectant ABC transporter substrate-binding lipoprotein OpuCC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228350.1 transl_table 11 codon_start 1 locus_tag LOCUS_32370 gene opuCC CDS complement(3288137..3288790) product glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228349.1 transl_table 11 codon_start 1 locus_tag LOCUS_32380 gene opuCB CDS complement(3288813..3289952) product osmoprotectant ABC transporter ATP-binding protein OpuCA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243370.1 transl_table 11 codon_start 1 locus_tag LOCUS_32390 gene opuCA CDS 3290216..3290773 product opuC operon transcriptional regulator OpcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244093.1 transl_table 11 codon_start 1 locus_tag LOCUS_32400 gene opcR CDS 3290786..3291115 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32410 CDS 3291300..3291998 product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228340.1 transl_table 11 codon_start 1 locus_tag LOCUS_32420 CDS complement(3292036..3293841) product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228338.1 transl_table 11 codon_start 1 locus_tag LOCUS_32430 CDS 3293973..3294434 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228335.1 transl_table 11 codon_start 1 locus_tag LOCUS_32440 CDS complement(3294477..3295769) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228333.1 transl_table 11 codon_start 1 locus_tag LOCUS_32450 gene eno CDS complement(3295798..3297333) product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228330.1 transl_table 11 codon_start 1 locus_tag LOCUS_32460 gene gpmI CDS complement(3297326..3298087) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243394.1 transl_table 11 codon_start 1 locus_tag LOCUS_32470 gene tpiA CDS complement(3298118..3299302) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243051.1 transl_table 11 codon_start 1 locus_tag LOCUS_32480 CDS complement(3299611..3300618) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219957.1 transl_table 11 codon_start 1 locus_tag LOCUS_32490 gene gap CDS complement(3300665..3301687) product gapA transcriptional regulator CggR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968188.1 transl_table 11 codon_start 1 locus_tag LOCUS_32500 gene cggR CDS complement(3301988..3303382) product arabinose-proton symporter AraE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243899.1 transl_table 11 codon_start 1 locus_tag LOCUS_32510 gene araE CDS 3303586..3304674 product arabinose utilization transcriptional regulator AraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243070.1 transl_table 11 codon_start 1 locus_tag LOCUS_32520 gene araR CDS complement(3304723..3305733) product MsnO8 family LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228318.1 transl_table 11 codon_start 1 locus_tag LOCUS_32530 CDS complement(3306224..3307567) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228313.1 transl_table 11 codon_start 1 locus_tag LOCUS_32540 CDS complement(3307968..3309002) product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228311.1 transl_table 11 codon_start 1 locus_tag LOCUS_32550 CDS complement(3309109..3309831) product lactate utilization protein LutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228309.1 transl_table 11 codon_start 1 locus_tag LOCUS_32560 gene lutC CDS complement(3309831..3311270) product lactate utilization iron-sulfur protein LutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228307.1 transl_table 11 codon_start 1 locus_tag LOCUS_32570 gene lutB CDS complement(3311297..3312013) product lactate utilization iron-sulfur protein LutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244353.1 transl_table 11 codon_start 1 locus_tag LOCUS_32580 gene lutA CDS complement(3312188..3312805) product DUF2812 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948669.1 transl_table 11 codon_start 1 locus_tag LOCUS_32590 CDS complement(3312802..3313131) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078066.1 transl_table 11 codon_start 1 locus_tag LOCUS_32600 CDS complement(3313251..3313853) product two-component system response regulator YvfU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228302.1 transl_table 11 codon_start 1 locus_tag LOCUS_32610 gene yvfU CDS complement(3313870..3314985) product two-component system sensor histidine kinase YvfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228300.1 transl_table 11 codon_start 1 locus_tag LOCUS_32620 gene yvfT CDS complement(3314989..3315726) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228297.1 transl_table 11 codon_start 1 locus_tag LOCUS_32630 CDS complement(3315727..3316632) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228295.1 transl_table 11 codon_start 1 locus_tag LOCUS_32640 CDS 3316917..3317726 product sigma factor SigB/phosphatase RsbP regulator RsbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228292.1 transl_table 11 codon_start 1 locus_tag LOCUS_32650 gene rsbQ CDS 3317749..3318972 product phosphoserine phosphatase RsbP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228290.1 transl_table 11 codon_start 1 locus_tag LOCUS_32660 gene rsbP CDS complement(3319013..3319909) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32670 note possible pseudo, frameshifted CDS complement(3320044..3320304) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32680 note possible pseudo, frameshifted CDS complement(3320385..3322445) product beta-galactosidase GanA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243532.1 transl_table 11 codon_start 1 locus_tag LOCUS_32690 gene ganA CDS complement(3322466..3323317) product arabinogalactan oligomer ABC transporter permease GanQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228283.1 transl_table 11 codon_start 1 locus_tag LOCUS_32700 gene ganQ CDS complement(3323321..3324598) product arabinogalactan oligomer ABC transporter permease GanP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243623.1 transl_table 11 codon_start 1 locus_tag LOCUS_32710 gene ganP CDS complement(3324617..3325882) product arabinogalactan oligomer ABC transporter substrate-binding protein GanS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228280.1 transl_table 11 codon_start 1 locus_tag LOCUS_32720 gene ganS CDS complement(3326024..3327016) product galactan degradation operon transcriptional regulator GanR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244199.1 transl_table 11 codon_start 1 locus_tag LOCUS_32730 gene ganR CDS complement(3327198..3327920) product L-lactate utilization/bacilysin biosynthesis transcriptional regulator LutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968191.1 transl_table 11 codon_start 1 locus_tag LOCUS_32740 gene lutR CDS 3328148..3329839 product L-lactate permease LutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228275.1 transl_table 11 codon_start 1 locus_tag LOCUS_32750 gene lutP CDS complement(3329866..3331176) product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242595.1 transl_table 11 codon_start 1 locus_tag LOCUS_32760 gene rpoN CDS 3331255..3331473 product protein YvfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219905.1 transl_table 11 codon_start 1 locus_tag LOCUS_32770 gene yvfG CDS complement(3331484..3332449) product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228270.1 transl_table 11 codon_start 1 locus_tag LOCUS_32780 CDS complement(3332428..3333594) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968194.1 transl_table 11 codon_start 1 locus_tag LOCUS_32790 CDS complement(3333611..3334249) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228268.1 transl_table 11 codon_start 1 locus_tag LOCUS_32800 CDS complement(3334246..3334854) product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243002.1 transl_table 11 codon_start 1 locus_tag LOCUS_32810 CDS complement(3334851..3336299) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886617.1 transl_table 11 codon_start 1 locus_tag LOCUS_32820 CDS complement(3336365..3337399) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228264.1 transl_table 11 codon_start 1 locus_tag LOCUS_32830 CDS complement(3337396..3338472) product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228262.1 transl_table 11 codon_start 1 locus_tag LOCUS_32840 CDS complement(3338477..3339511) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243644.1 transl_table 11 codon_start 1 locus_tag LOCUS_32850 CDS complement(3339536..3340639) product biofilm exopolysaccharide biosynthesis protein EpsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228259.1 transl_table 11 codon_start 1 locus_tag LOCUS_32860 gene epsG CDS complement(3340643..3341791) product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228257.1 transl_table 11 codon_start 1 locus_tag LOCUS_32870 CDS complement(3341784..3342620) product glycosyltransferase EpsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244557.1 transl_table 11 codon_start 1 locus_tag LOCUS_32880 gene epsE CDS complement(3342617..3343762) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242735.1 transl_table 11 codon_start 1 locus_tag LOCUS_32890 CDS complement(3343774..3345594) product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244548.1 transl_table 11 codon_start 1 locus_tag LOCUS_32900 CDS complement(3345830..3346513) product protein tyrosine kinase EpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228249.1 transl_table 11 codon_start 1 locus_tag LOCUS_32910 gene epsB CDS complement(3346519..3347223) product YveK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228247.1 transl_table 11 codon_start 1 locus_tag LOCUS_32920 CDS 3347469..3347927 product transcriptional regulator SlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242589.1 transl_table 11 codon_start 1 locus_tag LOCUS_32930 gene slrR CDS 3348002..3349471 product para-nitrobenzyl esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243926.1 transl_table 11 codon_start 1 locus_tag LOCUS_32940 gene pnbA CDS 3349474..3349665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32950 CDS complement(3349692..3350177) product phenolic acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243190.1 transl_table 11 codon_start 1 locus_tag LOCUS_32960 gene padC CDS complement(3350199..3350654) product DUF3237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084993485.1 transl_table 11 codon_start 1 locus_tag LOCUS_32970 CDS complement(3350781..3351464) product broad specificity amino-acid racemase RacX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244427.1 transl_table 11 codon_start 1 locus_tag LOCUS_32980 gene racX CDS complement(3351480..3352835) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243737.1 transl_table 11 codon_start 1 locus_tag LOCUS_32990 CDS 3353591..3355012 product levansucrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001022105.1 transl_table 11 codon_start 1 locus_tag LOCUS_33000 gene sacB CDS 3355089..3356639 product 2,6-beta-fructan 6-levanbiohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243729.1 transl_table 11 codon_start 1 locus_tag LOCUS_33010 gene levB CDS 3356747..3358309 product aspartate/proton symporter AspP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228228.1 transl_table 11 codon_start 1 locus_tag LOCUS_33020 gene aspP CDS 3358404..3358988 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244443.1 transl_table 11 codon_start 1 locus_tag LOCUS_33030 CDS 3359069..3359404 product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242480.1 transl_table 11 codon_start 1 locus_tag LOCUS_33040 CDS 3359404..3359718 product QacE family quaternary ammonium compound efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228222.1 transl_table 11 codon_start 1 locus_tag LOCUS_33050 CDS complement(3359760..3360272) product DUF3231 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243249.1 transl_table 11 codon_start 1 locus_tag LOCUS_33060 tRNA complement(3360423..3360503) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00820 CDS 3360773..3361369 product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228214.1 transl_table 11 codon_start 1 locus_tag LOCUS_33070 gene clpP CDS complement(3361404..3361979) product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228180.1 transl_table 11 codon_start 1 locus_tag LOCUS_33080 CDS 3362097..3362417 product MazG-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242570.1 transl_table 11 codon_start 1 locus_tag LOCUS_33090 CDS complement(3362444..3364045) product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244488.1 transl_table 11 codon_start 1 locus_tag LOCUS_33100 CDS complement(3364064..3364648) product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886620.1 transl_table 11 codon_start 1 locus_tag LOCUS_33110 CDS 3365054..3366028 product bifunctional glyoxylate/hydroxypyruvate reductase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886621.1 transl_table 11 codon_start 1 locus_tag LOCUS_33120 CDS complement(3366064..3367998) product lantibiotic ABC transporter permease PsdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243432.1 transl_table 11 codon_start 1 locus_tag LOCUS_33130 gene psdB CDS complement(3367973..3368752) product lantibiotic ABC transporter ATP-binding protein PsdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228167.1 transl_table 11 codon_start 1 locus_tag LOCUS_33140 gene psdA CDS complement(3368835..3369905) product two-component sensor histidine kinase PsdS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242699.1 transl_table 11 codon_start 1 locus_tag LOCUS_33150 gene psdS CDS complement(3369899..3370612) product two-component system response regulator PsdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244535.1 transl_table 11 codon_start 1 locus_tag LOCUS_33160 gene psdR CDS 3370759..3370968 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243327.1 transl_table 11 codon_start 1 locus_tag LOCUS_33170 CDS complement(3371004..3371759) product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968228.1 transl_table 11 codon_start 1 locus_tag LOCUS_33180 CDS complement(3371768..3372025) product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219835.1 transl_table 11 codon_start 1 locus_tag LOCUS_33190 CDS complement(3372049..3372999) product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243775.1 transl_table 11 codon_start 1 locus_tag LOCUS_33200 gene whiA CDS complement(3373021..3373974) product gluconeogenesis morphogenetic factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244450.1 transl_table 11 codon_start 1 locus_tag LOCUS_33210 gene mgfK CDS complement(3373976..3374863) product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243903.1 transl_table 11 codon_start 1 locus_tag LOCUS_33220 gene rapZ CDS complement(3374888..3375334) product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886622.1 transl_table 11 codon_start 1 locus_tag LOCUS_33230 CDS complement(3375685..3376635) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243021.1 transl_table 11 codon_start 1 locus_tag LOCUS_33240 gene trxB CDS complement(3376854..3378263) product peptidoglycan DL-endopeptidase CwlO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968231.1 transl_table 11 codon_start 1 locus_tag LOCUS_33250 gene cwlO CDS complement(3378644..3380098) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242799.1 transl_table 11 codon_start 1 locus_tag LOCUS_33260 CDS complement(3380223..3381992) product multidrug resistance ABC transporter ATP-binding protein/permease BmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243345.1 transl_table 11 codon_start 1 locus_tag LOCUS_33270 gene bmrA CDS complement(3382157..3382516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228131.1 transl_table 11 codon_start 1 locus_tag LOCUS_33280 CDS complement(3382531..3384417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242583.1 transl_table 11 codon_start 1 locus_tag LOCUS_33290 CDS complement(3384407..3385060) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244157.1 transl_table 11 codon_start 1 locus_tag LOCUS_33300 CDS complement(3385373..3385996) product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243045.1 transl_table 11 codon_start 1 locus_tag LOCUS_33310 gene hisIE CDS complement(3385993..3386751) product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244585.1 transl_table 11 codon_start 1 locus_tag LOCUS_33320 gene hisF CDS complement(3386748..3387485) product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242559.1 transl_table 11 codon_start 1 locus_tag LOCUS_33330 gene hisA CDS complement(3387482..3388120) product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244267.1 transl_table 11 codon_start 1 locus_tag LOCUS_33340 gene hisH CDS complement(3388121..3388705) product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243389.1 transl_table 11 codon_start 1 locus_tag LOCUS_33350 gene hisB CDS complement(3388702..3389985) product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243286.1 transl_table 11 codon_start 1 locus_tag LOCUS_33360 gene hisD CDS complement(3389982..3390623) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968235.1 transl_table 11 codon_start 1 locus_tag LOCUS_33370 gene hisG CDS complement(3390616..3391791) product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244441.1 transl_table 11 codon_start 1 locus_tag LOCUS_33380 CDS 3392041..3392784 product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243552.1 transl_table 11 codon_start 1 locus_tag LOCUS_33390 CDS 3393039..3393704 product pectate/pectin lyase PelC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242578.1 transl_table 11 codon_start 1 locus_tag LOCUS_33400 gene pelC CDS complement(3393727..3394245) product heptaprenylglyceryl phosphate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244270.1 transl_table 11 codon_start 1 locus_tag LOCUS_33410 gene hprF CDS complement(3394249..3394899) product pyrophosphatase PpaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242685.1 transl_table 11 codon_start 1 locus_tag LOCUS_33420 gene ppaX CDS complement(3394896..3395834) product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243723.1 transl_table 11 codon_start 1 locus_tag LOCUS_33430 CDS complement(3395858..3396667) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242661.1 transl_table 11 codon_start 1 locus_tag LOCUS_33440 gene lgt CDS complement(3396681..3397613) product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228097.1 transl_table 11 codon_start 1 locus_tag LOCUS_33450 gene hprK CDS 3397795..3398985 product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243413.1 transl_table 11 codon_start 1 locus_tag LOCUS_33460 gene nagA CDS 3398982..3399710 product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228092.1 transl_table 11 codon_start 1 locus_tag LOCUS_33470 gene nagB CDS 3399728..3400459 product transcriptional regulator NagR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228089.1 transl_table 11 codon_start 1 locus_tag LOCUS_33480 gene nagR CDS complement(3400478..3404347) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228085.1 transl_table 11 codon_start 1 locus_tag LOCUS_33490 CDS 3404512..3404985 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228083.1 transl_table 11 codon_start 1 locus_tag LOCUS_33500 CDS complement(3405026..3406243) product pulcherriminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244436.1 transl_table 11 codon_start 1 locus_tag LOCUS_33510 gene cypX CDS complement(3406258..3407004) product cyclo(L-leucyl-L-leucyl) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242712.1 transl_table 11 codon_start 1 locus_tag LOCUS_33520 gene pchC CDS 3407444..3407953 product pulcherriminic acid biosynthesis transcriptional regulator PchR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228073.1 transl_table 11 codon_start 1 locus_tag LOCUS_33530 gene pchR CDS 3407975..3409186 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228068.1 transl_table 11 codon_start 1 locus_tag LOCUS_33540 CDS complement(3409216..3409575) product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228066.1 transl_table 11 codon_start 1 locus_tag LOCUS_33550 CDS complement(3409577..3409774) product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228065.1 transl_table 11 codon_start 1 locus_tag LOCUS_33560 CDS complement(3409779..3410876) product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228061.1 transl_table 11 codon_start 1 locus_tag LOCUS_33570 CDS complement(3410901..3411227) product protein YvlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244375.1 transl_table 11 codon_start 1 locus_tag LOCUS_33580 gene yvlA CDS 3411446..3411676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228059.1 transl_table 11 codon_start 1 locus_tag LOCUS_33590 CDS complement(3411720..3414593) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228057.1 transl_table 11 codon_start 1 locus_tag LOCUS_33600 gene uvrA CDS complement(3414601..3416586) product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243787.1 transl_table 11 codon_start 1 locus_tag LOCUS_33610 gene uvrB CDS complement(3416771..3417001) product CsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228053.1 transl_table 11 codon_start 1 locus_tag LOCUS_33620 CDS 3417971..3420466 product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243243.1 transl_table 11 codon_start 1 locus_tag LOCUS_33630 CDS 3420543..3421106 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244088.1 transl_table 11 codon_start 1 locus_tag LOCUS_33640 CDS 3421141..3422475 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242625.1 transl_table 11 codon_start 1 locus_tag LOCUS_33650 CDS complement(3422523..3423719) product cell division topological determinant MinJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242631.1 transl_table 11 codon_start 1 locus_tag LOCUS_33660 gene minJ CDS complement(3423798..3424133) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33670 CDS complement(3424534..3425976) product carboxy-terminal processing protease CtpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228041.1 transl_table 11 codon_start 1 locus_tag LOCUS_33680 gene ctpB CDS complement(3426313..3427203) product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968247.1 transl_table 11 codon_start 1 locus_tag LOCUS_33690 gene ftsX CDS complement(3427196..3427882) product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228039.1 transl_table 11 codon_start 1 locus_tag LOCUS_33700 gene ftsE CDS complement(3428117..3428467) product cytochrome c-551 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242725.1 transl_table 11 codon_start 1 locus_tag LOCUS_33710 gene cccB CDS complement(3428504..3429349) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242677.1 transl_table 11 codon_start 1 locus_tag LOCUS_33720 CDS complement(3429517..3430500) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886623.1 transl_table 11 codon_start 1 locus_tag LOCUS_33730 gene prfB CDS complement(3430688..3433213) product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228033.1 transl_table 11 codon_start 1 locus_tag LOCUS_33740 gene secA CDS complement(3433382..3433951) product ribosome hibernation promotion factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228031.1 transl_table 11 codon_start 1 locus_tag LOCUS_33750 gene hpf CDS complement(3433972..3434190) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33760 CDS complement(3434529..3434870) product flagella biosynthesis regulatory protein FliT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242603.1 transl_table 11 codon_start 1 locus_tag LOCUS_33770 gene fliT CDS complement(3434867..3435268) product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243747.1 transl_table 11 codon_start 1 locus_tag LOCUS_33780 gene fliS CDS complement(3435290..3436786) product flagellar hook-associated protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242960.1 transl_table 11 codon_start 1 locus_tag LOCUS_33790 CDS complement(3436804..3437133) product flagellar protein FlaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968250.1 transl_table 11 codon_start 1 locus_tag LOCUS_33800 gene flaG CDS complement(3437363..3438190) product flagellin Hag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166847803.1 transl_table 11 codon_start 1 locus_tag LOCUS_33810 gene hag CDS complement(3438335..3438559) product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219727.1 transl_table 11 codon_start 1 locus_tag LOCUS_33820 gene csrA CDS complement(3438553..3438984) product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228007.1 transl_table 11 codon_start 1 locus_tag LOCUS_33830 gene fliW CDS complement(3439005..3439580) product DUF6470 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243053.1 transl_table 11 codon_start 1 locus_tag LOCUS_33840 CDS complement(3439627..3440523) product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228004.1 transl_table 11 codon_start 1 locus_tag LOCUS_33850 gene flgL CDS complement(3440533..3442056) product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228001.1 transl_table 11 codon_start 1 locus_tag LOCUS_33860 gene flgK CDS complement(3442075..3442557) product flagellar protein FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227999.1 transl_table 11 codon_start 1 locus_tag LOCUS_33870 gene flgN CDS complement(3442573..3442839) product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227997.1 transl_table 11 codon_start 1 locus_tag LOCUS_33880 gene flgM CDS complement(3442920..3443339) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227995.1 transl_table 11 codon_start 1 locus_tag LOCUS_33890 CDS complement(3443412..3443891) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33900 CDS complement(3444098..3444394) product late competence protein ComFB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227989.1 transl_table 11 codon_start 1 locus_tag LOCUS_33910 gene comFB CDS complement(3444463..3445848) product ATP-dependent helicase ComFA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243962.1 transl_table 11 codon_start 1 locus_tag LOCUS_33920 gene comFA CDS complement(3445953..3446798) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244125.1 transl_table 11 codon_start 1 locus_tag LOCUS_33930 CDS complement(3446896..3447585) product two-component system response regulator DegU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219701.1 transl_table 11 codon_start 1 locus_tag LOCUS_33940 gene degU CDS complement(3447668..3448825) product two-component sensor histidine kinase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227983.1 transl_table 11 codon_start 1 locus_tag LOCUS_33950 gene degS CDS 3449041..3449694 product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227979.1 transl_table 11 codon_start 1 locus_tag LOCUS_33960 CDS 3449694..3450818 product polyisoprenyl-teichoic acid--peptidoglycan teichoic acid transferase TagV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244117.1 transl_table 11 codon_start 1 locus_tag LOCUS_33970 gene tagV CDS complement(3450892..3451968) product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227975.1 transl_table 11 codon_start 1 locus_tag LOCUS_33980 CDS complement(3452113..3453312) product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243252.1 transl_table 11 codon_start 1 locus_tag LOCUS_33990 CDS complement(3453335..3454093) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242619.1 transl_table 11 codon_start 1 locus_tag LOCUS_34000 CDS complement(3454117..3454797) product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243110.1 transl_table 11 codon_start 1 locus_tag LOCUS_34010 CDS complement(3454826..3456292) product teichuronic acid biosynthesis protein TuaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886625.1 transl_table 11 codon_start 1 locus_tag LOCUS_34020 gene tuaE CDS complement(3456376..3457770) product UDP-glucose 6-dehydrogenase TuaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242596.1 transl_table 11 codon_start 1 locus_tag LOCUS_34030 gene tuaD CDS complement(3457823..3458992) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242807.1 transl_table 11 codon_start 1 locus_tag LOCUS_34040 CDS complement(3458989..3460443) product MOP flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244371.1 transl_table 11 codon_start 1 locus_tag LOCUS_34050 CDS complement(3460496..3461155) product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891044.1 transl_table 11 codon_start 1 locus_tag LOCUS_34060 CDS complement(3461390..3463294) product poly(ribitol-phosphate) beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000975351.1 transl_table 11 codon_start 1 locus_tag LOCUS_34070 gene tarS CDS complement(3463513..3465000) product N-acetylmuramoyl-L-alanine amidase LytC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242758.1 transl_table 11 codon_start 1 locus_tag LOCUS_34080 gene lytC CDS complement(3465088..3467241) product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243620.1 transl_table 11 codon_start 1 locus_tag LOCUS_34090 CDS complement(3467269..3467592) product membrane-bound protein LytA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242772.1 transl_table 11 codon_start 1 locus_tag LOCUS_34100 gene lytA CDS 3467805..3468725 product transcription antiterminator LytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227949.1 transl_table 11 codon_start 1 locus_tag LOCUS_34110 gene lytR CDS complement(3468766..3469908) product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243178.1 transl_table 11 codon_start 1 locus_tag LOCUS_34120 gene wecB CDS complement(3469931..3471835) product poly(ribitol-phosphate) beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000975351.1 transl_table 11 codon_start 1 locus_tag LOCUS_34130 gene tarS CDS complement(3471910..3473430) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025727141.1 transl_table 11 codon_start 1 locus_tag LOCUS_34140 CDS complement(3473465..3474832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34150 CDS 3475168..3476052 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227944.1 transl_table 11 codon_start 1 locus_tag LOCUS_34160 gene galU CDS complement(3476091..3477674) product teichoic acids export ABC transporter ATP-binding subunit TagH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227930.1 transl_table 11 codon_start 1 locus_tag LOCUS_34170 gene tagH CDS complement(3477694..3478521) product teichoic acids export ABC transporter permease subunit TagG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227928.1 transl_table 11 codon_start 1 locus_tag LOCUS_34180 gene tagG CDS complement(3478738..3480765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34190 CDS complement(3480790..3481566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34200 CDS complement(3481563..3484247) product poly(glucosyl N-acetylgalactosamine 1-phosphate) glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227939.1 transl_table 11 codon_start 1 locus_tag LOCUS_34210 gene ggaB CDS complement(3484288..3485634) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968267.1 transl_table 11 codon_start 1 locus_tag LOCUS_34220 CDS complement(3485665..3486849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34230 CDS complement(3486953..3487342) product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227921.1 transl_table 11 codon_start 1 locus_tag LOCUS_34240 gene tagD CDS 3487851..3488624 product N-acetylglucosaminyldiphosphoundecaprenol N-acetyl-beta-D- mannosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227919.1 transl_table 11 codon_start 1 locus_tag LOCUS_34250 gene tagA CDS 3488720..3489871 product teichoic acid glycerol-phosphate primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968271.1 transl_table 11 codon_start 1 locus_tag LOCUS_34260 gene tagB CDS 3489960..3490673 product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721503.1 transl_table 11 codon_start 1 locus_tag LOCUS_34270 CDS 3490670..3491695 product ribitol-5-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610204.1 transl_table 11 codon_start 1 locus_tag LOCUS_34280 CDS 3491699..3492868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34290 CDS 3492875..3494746 product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645039.1 transl_table 11 codon_start 1 locus_tag LOCUS_34300 CDS complement(3494785..3497427) product beta-N-acetylglucosaminidase LytD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243594.1 transl_table 11 codon_start 1 locus_tag LOCUS_34310 gene lytD CDS complement(3497555..3498505) product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244253.1 transl_table 11 codon_start 1 locus_tag LOCUS_34320 gene manA CDS 3498772..3500223 product spore germination protein GerBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243291.1 transl_table 11 codon_start 1 locus_tag LOCUS_34330 gene gerBA CDS 3500229..3501335 product spore germination protein GerBB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244581.1 transl_table 11 codon_start 1 locus_tag LOCUS_34340 gene gerBB CDS 3501332..3502465 product spore germination protein GerBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242990.1 transl_table 11 codon_start 1 locus_tag LOCUS_34350 gene gerBC CDS complement(3502502..3503875) product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243731.1 transl_table 11 codon_start 1 locus_tag LOCUS_34360 CDS 3504213..3505181 product polyisoprenyl-teichoic acid--peptidoglycan teichoic acid transferase TagT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243404.1 transl_table 11 codon_start 1 locus_tag LOCUS_34370 gene tagT CDS 3505339..3506199 product 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YwtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244395.1 transl_table 11 codon_start 1 locus_tag LOCUS_34380 gene ywtE CDS complement(3506234..3507475) product gamma-DL-glutamyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242751.1 transl_table 11 codon_start 1 locus_tag LOCUS_34390 gene pgdS CDS complement(3507616..3507783) product extrachromosomal elements maintenance protein EdmS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227896.1 transl_table 11 codon_start 1 locus_tag LOCUS_34400 gene edmS CDS complement(3507798..3508940) product capsular polyglutamate synthetase PgsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243306.1 transl_table 11 codon_start 1 locus_tag LOCUS_34410 gene pgsA CDS complement(3508959..3509408) product poly-gamma-glutamate biosynthesis protein PgsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227889.1 transl_table 11 codon_start 1 locus_tag LOCUS_34420 gene pgsC CDS complement(3509423..3510604) product poly-gamma-glutamate synthase PgsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227883.1 transl_table 11 codon_start 1 locus_tag LOCUS_34430 gene pgsB CDS 3511386..3512375 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968279.1 transl_table 11 codon_start 1 locus_tag LOCUS_34440 CDS 3512368..3513249 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968280.1 transl_table 11 codon_start 1 locus_tag LOCUS_34450 gene rbsK CDS 3513246..3513641 product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244175.1 transl_table 11 codon_start 1 locus_tag LOCUS_34460 gene rbsD CDS 3513657..3515138 product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244379.1 transl_table 11 codon_start 1 locus_tag LOCUS_34470 gene rbsA CDS 3515140..3516108 product ribose ABC transporter permease RbsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968282.1 transl_table 11 codon_start 1 locus_tag LOCUS_34480 gene rbsC CDS 3516122..3517039 product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242760.1 transl_table 11 codon_start 1 locus_tag LOCUS_34490 gene rbsB CDS 3517149..3517685 product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243596.1 transl_table 11 codon_start 1 locus_tag LOCUS_34500 CDS 3517840..3518136 product DUF3892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243460.1 transl_table 11 codon_start 1 locus_tag LOCUS_34510 CDS complement(3518177..3518704) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242788.1 transl_table 11 codon_start 1 locus_tag LOCUS_34520 CDS complement(3518803..3519570) product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244457.1 transl_table 11 codon_start 1 locus_tag LOCUS_34530 gene budA CDS complement(3519632..3521344) product acetolactate synthase AlsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244057.1 transl_table 11 codon_start 1 locus_tag LOCUS_34540 gene alsS CDS 3521504..3522391 product als operon DNA-binding transcriptional repressor AlsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227859.1 transl_table 11 codon_start 1 locus_tag LOCUS_34550 gene alsR CDS complement(3522430..3523521) product spore coat protein CotH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227854.1 transl_table 11 codon_start 1 locus_tag LOCUS_34560 gene cotH CDS 3524430..3525047 product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227852.1 transl_table 11 codon_start 1 locus_tag LOCUS_34570 CDS 3525210..3525545 product DUF4181 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227850.1 transl_table 11 codon_start 1 locus_tag LOCUS_34580 CDS complement(3525550..3527127) product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227847.1 transl_table 11 codon_start 1 locus_tag LOCUS_34590 gene ggt CDS 3527342..3527818 product chromate efflux transcriptional regulator ChrS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242900.1 transl_table 11 codon_start 1 locus_tag LOCUS_34600 gene chrS CDS 3527832..3528425 product chromate efflux transporter subunit ChrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227843.1 transl_table 11 codon_start 1 locus_tag LOCUS_34610 gene chrB CDS 3528422..3528958 product chromate resistance efflux protein ChrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227840.1 transl_table 11 codon_start 1 locus_tag LOCUS_34620 gene chrA CDS complement(3528985..3529206) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243378.1 transl_table 11 codon_start 1 locus_tag LOCUS_34630 CDS complement(3529203..3529748) product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242945.1 transl_table 11 codon_start 1 locus_tag LOCUS_34640 CDS 3529871..3530752 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243262.1 transl_table 11 codon_start 1 locus_tag LOCUS_34650 CDS complement(3530813..3533098) product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107211.1 transl_table 11 codon_start 1 locus_tag LOCUS_34660 CDS 3533256..3534122 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109238.1 transl_table 11 codon_start 1 locus_tag LOCUS_34670 CDS complement(3534154..3534870) product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243213.1 transl_table 11 codon_start 1 locus_tag LOCUS_34680 CDS complement(3534927..3535418) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963657.1 transl_table 11 codon_start 1 locus_tag LOCUS_34690 CDS complement(3535631..3536284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34700 CDS complement(3536361..3536912) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34710 CDS complement(3537495..3538046) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34720 CDS complement(3538051..3539952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34730 CDS complement(3539971..3540231) product YwqI/YxiC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221757.1 transl_table 11 codon_start 1 locus_tag LOCUS_34740 CDS complement(3540241..3540663) product DUF5082 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242741.1 transl_table 11 codon_start 1 locus_tag LOCUS_34750 CDS complement(3540730..3540993) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34760 CDS complement(3541035..3542357) product UDP-glucose 6-dehydrogenase UglF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243223.1 transl_table 11 codon_start 1 locus_tag LOCUS_34770 gene uglF CDS complement(3542553..3543317) product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227815.1 transl_table 11 codon_start 1 locus_tag LOCUS_34780 CDS complement(3543367..3544053) product tyrosine-protein kinase PtkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244182.1 transl_table 11 codon_start 1 locus_tag LOCUS_34790 gene ptkA CDS complement(3544073..3544819) product protein-tyrosine kinase activator TkmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227811.1 transl_table 11 codon_start 1 locus_tag LOCUS_34800 gene tkmA CDS complement(3545054..3545197) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242876.1 transl_table 11 codon_start 1 locus_tag LOCUS_34810 CDS 3545401..3547011 product SWIM zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227806.1 transl_table 11 codon_start 1 locus_tag LOCUS_34820 CDS 3546998..3549766 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227803.1 transl_table 11 codon_start 1 locus_tag LOCUS_34830 CDS complement(3549895..3550752) product phosphatase YwpJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242946.1 transl_table 11 codon_start 1 locus_tag LOCUS_34840 gene ywpJ CDS complement(3550758..3551534) product transcriptional regulator GlcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244075.1 transl_table 11 codon_start 1 locus_tag LOCUS_34850 gene glcR CDS complement(3551759..3552100) product single-stranded DNA-binding protein SsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227798.1 transl_table 11 codon_start 1 locus_tag LOCUS_34860 gene ssbB CDS complement(3552177..3552560) product DynA interaction protein YwpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227796.1 transl_table 11 codon_start 1 locus_tag LOCUS_34870 gene ywpG CDS 3552725..3553147 product YwpF-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227794.1 transl_table 11 codon_start 1 locus_tag LOCUS_34880 CDS complement(3553280..3553918) product class A sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722751.1 transl_table 11 codon_start 1 locus_tag LOCUS_34890 CDS complement(3554015..3559957) product SpaA isopeptide-forming pilin-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905155.1 transl_table 11 codon_start 1 locus_tag LOCUS_34900 CDS complement(3560278..3561354) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136609070.1 transl_table 11 codon_start 1 locus_tag LOCUS_34910 CDS 3561528..3564608 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459091.1 transl_table 11 codon_start 1 locus_tag LOCUS_34920 CDS complement(3564648..3565040) product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242893.1 transl_table 11 codon_start 1 locus_tag LOCUS_34930 gene mscL CDS complement(3565116..3565541) product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221796.1 transl_table 11 codon_start 1 locus_tag LOCUS_34940 gene fabZ CDS 3565733..3566797 product aspartate phosphatase RapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227782.1 transl_table 11 codon_start 1 locus_tag LOCUS_34950 gene rapD CDS complement(3566818..3567627) product flagellar hook-basal body complex protein FlhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244381.1 transl_table 11 codon_start 1 locus_tag LOCUS_34960 gene flhP CDS complement(3567661..3568512) product flagellar hook-basal body complex protein FlhO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244097.1 transl_table 11 codon_start 1 locus_tag LOCUS_34970 gene flhO CDS complement(3568635..3569636) product cell shape-determining protein Mbl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227776.1 transl_table 11 codon_start 1 locus_tag LOCUS_34980 gene mbl CDS complement(3569815..3570096) product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221804.1 transl_table 11 codon_start 1 locus_tag LOCUS_34990 gene spoIIID CDS 3570445..3570858 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227771.1 transl_table 11 codon_start 1 locus_tag LOCUS_35000 CDS 3570880..3572070 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227769.1 transl_table 11 codon_start 1 locus_tag LOCUS_35010 CDS complement(3572166..3573572) product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243080.1 transl_table 11 codon_start 1 locus_tag LOCUS_35020 CDS complement(3573679..3575145) product allantoin permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243156.1 transl_table 11 codon_start 1 locus_tag LOCUS_35030 gene pucI CDS complement(3575326..3576630) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243939.1 transl_table 11 codon_start 1 locus_tag LOCUS_35040 CDS complement(3576684..3577250) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227761.1 transl_table 11 codon_start 1 locus_tag LOCUS_35050 CDS complement(3577438..3577899) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244424.1 transl_table 11 codon_start 1 locus_tag LOCUS_35060 CDS 3578170..3579384 product ammonium transporter AmtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227757.1 transl_table 11 codon_start 1 locus_tag LOCUS_35070 gene amtB CDS 3579396..3579746 product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221829.1 transl_table 11 codon_start 1 locus_tag LOCUS_35080 CDS 3579924..3580505 product undecaprenyl-diphosphate phosphatase BcrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243362.1 transl_table 11 codon_start 1 locus_tag LOCUS_35090 gene bcrC CDS complement(3580531..3580968) product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227753.1 transl_table 11 codon_start 1 locus_tag LOCUS_35100 CDS complement(3581079..3581951) product stage II sporulation protein spoIIQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227751.1 transl_table 11 codon_start 1 locus_tag LOCUS_35110 gene spoIIQ CDS 3582086..3582583 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886629.1 transl_table 11 codon_start 1 locus_tag LOCUS_35120 CDS 3582580..3583089 product DUF5362 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227749.1 transl_table 11 codon_start 1 locus_tag LOCUS_35130 CDS 3583320..3585110 product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627530.1 transl_table 11 codon_start 1 locus_tag LOCUS_35140 CDS complement(3585217..3585651) product DUF5392 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244359.1 transl_table 11 codon_start 1 locus_tag LOCUS_35150 CDS 3585895..3587343 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243311.1 transl_table 11 codon_start 1 locus_tag LOCUS_35160 gene cls CDS complement(3587365..3588138) product transcriptional activator Mta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242936.1 transl_table 11 codon_start 1 locus_tag LOCUS_35170 gene mta CDS 3588284..3588673 product DUF5362 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227738.1 transl_table 11 codon_start 1 locus_tag LOCUS_35180 CDS complement(3588708..3589349) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227736.1 transl_table 11 codon_start 1 locus_tag LOCUS_35190 CDS complement(3589418..3589819) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227734.1 transl_table 11 codon_start 1 locus_tag LOCUS_35200 CDS complement(3589953..3591662) product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243090.1 transl_table 11 codon_start 1 locus_tag LOCUS_35210 gene ureC CDS complement(3591659..3592033) product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227726.1 transl_table 11 codon_start 1 locus_tag LOCUS_35220 gene ureB CDS complement(3592030..3592347) product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227724.1 transl_table 11 codon_start 1 locus_tag LOCUS_35230 gene ureA CDS complement(3592447..3593148) product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972304.1 transl_table 11 codon_start 1 locus_tag LOCUS_35240 gene urtE CDS complement(3593145..3593894) product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972305.1 transl_table 11 codon_start 1 locus_tag LOCUS_35250 gene urtD CDS complement(3593869..3594939) product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056964.1 transl_table 11 codon_start 1 locus_tag LOCUS_35260 gene urtC CDS complement(3594951..3595853) product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894361.1 transl_table 11 codon_start 1 locus_tag LOCUS_35270 gene urtB CDS complement(3595886..3597142) product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860043.1 transl_table 11 codon_start 1 locus_tag LOCUS_35280 gene urtA CDS complement(3597351..3597539) product stress response protein CsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227718.1 transl_table 11 codon_start 1 locus_tag LOCUS_35290 gene csbD CDS complement(3597611..3598090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244390.1 transl_table 11 codon_start 1 locus_tag LOCUS_35300 CDS complement(3598261..3599394) product response regulator aspartate phosphatase RapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227715.1 transl_table 11 codon_start 1 locus_tag LOCUS_35310 gene rapB CDS complement(3599591..3600616) product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243488.1 transl_table 11 codon_start 1 locus_tag LOCUS_35320 gene moaA CDS complement(3600632..3601420) product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227709.1 transl_table 11 codon_start 1 locus_tag LOCUS_35330 gene fdhD CDS complement(3601520..3601681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227706.1 transl_table 11 codon_start 1 locus_tag LOCUS_35340 CDS complement(3601777..3602451) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243553.1 transl_table 11 codon_start 1 locus_tag LOCUS_35350 CDS complement(3602773..3603456) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227700.1 transl_table 11 codon_start 1 locus_tag LOCUS_35360 CDS complement(3603843..3604874) product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243408.1 transl_table 11 codon_start 1 locus_tag LOCUS_35370 gene spoIID CDS complement(3605070..3606380) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227695.1 transl_table 11 codon_start 1 locus_tag LOCUS_35380 gene murA CDS complement(3606414..3607154) product YwmB family TATA-box binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244344.1 transl_table 11 codon_start 1 locus_tag LOCUS_35390 CDS complement(3607289..3607519) product DUF1146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227691.1 transl_table 11 codon_start 1 locus_tag LOCUS_35400 CDS 3607697..3608170 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243900.1 transl_table 11 codon_start 1 locus_tag LOCUS_35410 CDS complement(3608205..3608603) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227688.1 transl_table 11 codon_start 1 locus_tag LOCUS_35420 CDS complement(3608627..3610048) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227686.1 transl_table 11 codon_start 1 locus_tag LOCUS_35430 gene atpD CDS complement(3610074..3610937) product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244388.1 transl_table 11 codon_start 1 locus_tag LOCUS_35440 gene atpG CDS complement(3611014..3612522) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243657.1 transl_table 11 codon_start 1 locus_tag LOCUS_35450 gene atpA CDS complement(3612539..3613084) product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243176.1 transl_table 11 codon_start 1 locus_tag LOCUS_35460 CDS complement(3613081..3613593) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244051.1 transl_table 11 codon_start 1 locus_tag LOCUS_35470 gene atpF CDS complement(3613756..3613968) product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151167.1 transl_table 11 codon_start 1 locus_tag LOCUS_35480 gene atpE CDS complement(3614014..3614748) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242621.1 transl_table 11 codon_start 1 locus_tag LOCUS_35490 gene atpB CDS complement(3614756..3615142) product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243159.1 transl_table 11 codon_start 1 locus_tag LOCUS_35500 gene atpI CDS complement(3615559..3616188) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227670.1 transl_table 11 codon_start 1 locus_tag LOCUS_35510 gene upp CDS complement(3616323..3617570) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227669.1 transl_table 11 codon_start 1 locus_tag LOCUS_35520 gene glyA CDS complement(3617776..3618318) product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227667.1 transl_table 11 codon_start 1 locus_tag LOCUS_35530 CDS complement(3618331..3618780) product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221910.1 transl_table 11 codon_start 1 locus_tag LOCUS_35540 gene rpiB CDS complement(3618936..3619388) product protein arginine phosphatase PrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227664.1 transl_table 11 codon_start 1 locus_tag LOCUS_35550 gene prpB CDS complement(3619466..3620023) product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227661.1 transl_table 11 codon_start 1 locus_tag LOCUS_35560 CDS complement(3620101..3621141) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227659.1 transl_table 11 codon_start 1 locus_tag LOCUS_35570 CDS complement(3621299..3621742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244265.1 transl_table 11 codon_start 1 locus_tag LOCUS_35580 CDS complement(3621809..3622483) product stage II sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227654.1 transl_table 11 codon_start 1 locus_tag LOCUS_35590 gene spoIIR CDS 3622624..3622986 product UPF0715 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227651.1 transl_table 11 codon_start 1 locus_tag LOCUS_35600 CDS complement(3623005..3623289) product DUF5316 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244050.1 transl_table 11 codon_start 1 locus_tag LOCUS_35610 CDS complement(3623351..3624217) product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227647.1 transl_table 11 codon_start 1 locus_tag LOCUS_35620 gene prmC CDS complement(3624219..3625289) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227645.1 transl_table 11 codon_start 1 locus_tag LOCUS_35630 gene prfA CDS 3625418..3625801 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227644.1 transl_table 11 codon_start 1 locus_tag LOCUS_35640 CDS 3625923..3626477 product chromosome-anchoring protein RacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227642.1 transl_table 11 codon_start 1 locus_tag LOCUS_35650 gene racA CDS complement(3626512..3627468) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242497.1 transl_table 11 codon_start 1 locus_tag LOCUS_35660 CDS complement(3627550..3629247) product oxaloacetate-decarboxylating malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227639.1 transl_table 11 codon_start 1 locus_tag LOCUS_35670 gene malS CDS complement(3629536..3630123) product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243018.1 transl_table 11 codon_start 1 locus_tag LOCUS_35680 CDS complement(3630212..3630412) product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151132.1 transl_table 11 codon_start 1 locus_tag LOCUS_35690 gene rpmE CDS complement(3630531..3631814) product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221939.1 transl_table 11 codon_start 1 locus_tag LOCUS_35700 gene rho CDS complement(3632217..3633182) product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242962.1 transl_table 11 codon_start 1 locus_tag LOCUS_35710 gene glpX CDS complement(3633213..3634502) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227628.1 transl_table 11 codon_start 1 locus_tag LOCUS_35720 CDS complement(3634881..3635519) product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227626.1 transl_table 11 codon_start 1 locus_tag LOCUS_35730 gene fsa CDS complement(3635638..3636495) product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243339.1 transl_table 11 codon_start 1 locus_tag LOCUS_35740 CDS complement(3636675..3637046) product sporulation initiation phosphotransferase Spo0F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227621.1 transl_table 11 codon_start 1 locus_tag LOCUS_35750 gene spo0F CDS 3637215..3637736 product DUF2529 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242809.1 transl_table 11 codon_start 1 locus_tag LOCUS_35760 CDS complement(3637819..3639426) product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227612.1 transl_table 11 codon_start 1 locus_tag LOCUS_35770 gene pyrG CDS complement(3639666..3640187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35780 CDS complement(3640370..3641509) product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242719.1 transl_table 11 codon_start 1 locus_tag LOCUS_35790 gene acdA CDS complement(3641506..3643623) product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244084.1 transl_table 11 codon_start 1 locus_tag LOCUS_35800 CDS 3643778..3644977 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227602.1 transl_table 11 codon_start 1 locus_tag LOCUS_35810 gene cls CDS 3644990..3645952 product UV DNA damage repair endonuclease UvsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227599.1 transl_table 11 codon_start 1 locus_tag LOCUS_35820 gene uvsE CDS 3646033..3646305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227597.1 transl_table 11 codon_start 1 locus_tag LOCUS_35830 CDS complement(3646355..3646879) product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227595.1 transl_table 11 codon_start 1 locus_tag LOCUS_35840 CDS complement(3646889..3648532) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968321.1 transl_table 11 codon_start 1 locus_tag LOCUS_35850 CDS complement(3648702..3650204) product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242612.1 transl_table 11 codon_start 1 locus_tag LOCUS_35860 gene cls CDS complement(3650306..3650935) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464880.1 transl_table 11 codon_start 1 locus_tag LOCUS_35870 CDS complement(3651107..3651778) product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242665.1 transl_table 11 codon_start 1 locus_tag LOCUS_35880 gene narI CDS complement(3651775..3652329) product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242466.1 transl_table 11 codon_start 1 locus_tag LOCUS_35890 gene narJ CDS complement(3652355..3653818) product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244173.1 transl_table 11 codon_start 1 locus_tag LOCUS_35900 gene narH CDS complement(3653808..3657494) product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243085.1 transl_table 11 codon_start 1 locus_tag LOCUS_35910 CDS complement(3657712..3658188) product Crp/Fnr family transcriptional regulator ArfM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243032.1 transl_table 11 codon_start 1 locus_tag LOCUS_35920 gene arfM CDS 3658371..3659051 product YwiC-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243773.1 transl_table 11 codon_start 1 locus_tag LOCUS_35930 CDS complement(3659084..3659800) product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243241.1 transl_table 11 codon_start 1 locus_tag LOCUS_35940 gene fnr CDS complement(3659898..3661085) product nitrate transporter NarK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886631.1 transl_table 11 codon_start 1 locus_tag LOCUS_35950 gene narK CDS complement(3661220..3662890) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227570.1 transl_table 11 codon_start 1 locus_tag LOCUS_35960 gene argS CDS complement(3662887..3663315) product DUF1934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243604.1 transl_table 11 codon_start 1 locus_tag LOCUS_35970 CDS 3663629..3663760 product subtilosin A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222002.1 transl_table 11 codon_start 1 locus_tag LOCUS_35980 gene sboA CDS 3663905..3665251 product subtilosin maturase AlbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242599.1 transl_table 11 codon_start 1 locus_tag LOCUS_35990 gene albA CDS 3665264..3665425 product antilisterial bacteriocin subtilosin biosynthesis protein AlbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222006.1 transl_table 11 codon_start 1 locus_tag LOCUS_36000 gene albB CDS 3665422..3666141 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227564.1 transl_table 11 codon_start 1 locus_tag LOCUS_36010 CDS 3666134..3667444 product antilisterial bacteriocin subtilosin biosynthesis protein AlbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243158.1 transl_table 11 codon_start 1 locus_tag LOCUS_36020 gene albD CDS 3667434..3668594 product antilisterial bacteriocin subtilosin biosynthesis protein AlbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886633.1 transl_table 11 codon_start 1 locus_tag LOCUS_36030 gene albE CDS 3668599..3669882 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242974.1 transl_table 11 codon_start 1 locus_tag LOCUS_36040 CDS 3669879..3670580 product antilisterial bacteriocin subtilosin biosynthesis protein AlbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243391.1 transl_table 11 codon_start 1 locus_tag LOCUS_36050 gene albG CDS complement(3670717..3672072) product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227552.1 transl_table 11 codon_start 1 locus_tag LOCUS_36060 CDS 3672299..3673444 product response regulator aspartate phosphatase RapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227549.1 transl_table 11 codon_start 1 locus_tag LOCUS_36070 gene rapF CDS 3673428..3673547 product phosphatase RapF inhibitor PhrF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968329.1 transl_table 11 codon_start 1 locus_tag LOCUS_36080 gene phrF CDS complement(3673700..3674572) product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227545.1 transl_table 11 codon_start 1 locus_tag LOCUS_36090 gene speB CDS complement(3674633..3675463) product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227543.1 transl_table 11 codon_start 1 locus_tag LOCUS_36100 gene speE CDS 3675665..3677740 product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227540.1 transl_table 11 codon_start 1 locus_tag LOCUS_36110 CDS complement(3678061..3678579) product YwhD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244446.1 transl_table 11 codon_start 1 locus_tag LOCUS_36120 CDS complement(3678592..3679251) product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243167.1 transl_table 11 codon_start 1 locus_tag LOCUS_36130 CDS 3679360..3679548 product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222038.1 transl_table 11 codon_start 1 locus_tag LOCUS_36140 CDS complement(3679592..3680011) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242889.1 transl_table 11 codon_start 1 locus_tag LOCUS_36150 CDS complement(3680131..3682047) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243399.1 transl_table 11 codon_start 1 locus_tag LOCUS_36160 gene thrS CDS complement(3682950..3683450) product YwgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227524.1 transl_table 11 codon_start 1 locus_tag LOCUS_36170 CDS complement(3683486..3684787) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243873.1 transl_table 11 codon_start 1 locus_tag LOCUS_36180 CDS complement(3684949..3685173) product DUF1450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222050.1 transl_table 11 codon_start 1 locus_tag LOCUS_36190 CDS 3685388..3686173 product prespore-specific transcription regulator RsfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243464.1 transl_table 11 codon_start 1 locus_tag LOCUS_36200 gene rsfA CDS complement(3686317..3687207) product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242581.1 transl_table 11 codon_start 1 locus_tag LOCUS_36210 CDS complement(3687376..3688221) product octanoyl-[GcvH]:protein N-octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227511.1 transl_table 11 codon_start 1 locus_tag LOCUS_36220 gene ywfL CDS complement(3688269..3689168) product cysJI operon transcriptional regulator CysL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243173.1 transl_table 11 codon_start 1 locus_tag LOCUS_36230 gene cysL CDS complement(3689315..3690286) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243393.1 transl_table 11 codon_start 1 locus_tag LOCUS_36240 gene pta CDS 3690556..3691320 product heme-dependent peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242896.1 transl_table 11 codon_start 1 locus_tag LOCUS_36250 CDS 3691453..3692232 product NADPH-dependent reductase BacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244095.1 transl_table 11 codon_start 1 locus_tag LOCUS_36260 gene bacG CDS complement(3692247..3693446) product transaminase BacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242568.1 transl_table 11 codon_start 1 locus_tag LOCUS_36270 gene bacF CDS complement(3693447..3694631) product bacilysin exporter BacE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244502.1 transl_table 11 codon_start 1 locus_tag LOCUS_36280 gene bacE CDS complement(3694628..3696046) product alanine--anticapsin ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242921.1 transl_table 11 codon_start 1 locus_tag LOCUS_36290 gene bacD CDS complement(3696065..3696826) product dihydroanticapsin 7-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243359.1 transl_table 11 codon_start 1 locus_tag LOCUS_36300 gene bacC CDS complement(3696829..3697536) product 3-((4R)-4-hydroxycyclohexa-1,5-dien-1-yl)-2-oxopropanoate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244300.1 transl_table 11 codon_start 1 locus_tag LOCUS_36310 gene bacB CDS complement(3697526..3698140) product prephenate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968341.1 transl_table 11 codon_start 1 locus_tag LOCUS_36320 gene bacA CDS complement(3698293..3699531) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242790.1 transl_table 11 codon_start 1 locus_tag LOCUS_36330 CDS complement(3699748..3701160) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244348.1 transl_table 11 codon_start 1 locus_tag LOCUS_36340 CDS complement(3701160..3702860) product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227487.1 transl_table 11 codon_start 1 locus_tag LOCUS_36350 CDS complement(3702933..3704480) product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243454.1 transl_table 11 codon_start 1 locus_tag LOCUS_36360 gene pruA CDS complement(3704719..3705993) product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227482.1 transl_table 11 codon_start 1 locus_tag LOCUS_36370 gene rocG CDS complement(3706167..3706631) product biofilm-surface layer protein BslB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242493.1 transl_table 11 codon_start 1 locus_tag LOCUS_36380 gene bslB CDS complement(3706956..3707411) product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242881.1 transl_table 11 codon_start 1 locus_tag LOCUS_36390 CDS complement(3707404..3708255) product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242585.1 transl_table 11 codon_start 1 locus_tag LOCUS_36400 gene rfbD CDS complement(3708269..3709219) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244201.1 transl_table 11 codon_start 1 locus_tag LOCUS_36410 gene rfbB CDS complement(3709216..3709956) product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243368.1 transl_table 11 codon_start 1 locus_tag LOCUS_36420 CDS complement(3709981..3711000) product PseG/SpsG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244190.1 transl_table 11 codon_start 1 locus_tag LOCUS_36430 CDS complement(3711003..3711725) product spore coat polysaccharide biosynthesis protein SpsF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243421.1 transl_table 11 codon_start 1 locus_tag LOCUS_36440 CDS complement(3711718..3712839) product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243135.1 transl_table 11 codon_start 1 locus_tag LOCUS_36450 CDS complement(3712839..3713708) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243179.1 transl_table 11 codon_start 1 locus_tag LOCUS_36460 CDS complement(3713709..3714878) product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243878.1 transl_table 11 codon_start 1 locus_tag LOCUS_36470 CDS complement(3714899..3716323) product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243510.1 transl_table 11 codon_start 1 locus_tag LOCUS_36480 CDS complement(3716328..3717098) product spore coat dTDP-glycosyltransferase SpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244383.1 transl_table 11 codon_start 1 locus_tag LOCUS_36490 gene spsA CDS 3717418..3717963 product spore coat protein GerQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227448.1 transl_table 11 codon_start 1 locus_tag LOCUS_36500 gene gerQ CDS complement(3718007..3718378) product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227446.1 transl_table 11 codon_start 1 locus_tag LOCUS_36510 CDS complement(3718440..3719771) product purine/pyrimidine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886635.1 transl_table 11 codon_start 1 locus_tag LOCUS_36520 CDS complement(3719781..3720098) product YwdI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243806.1 transl_table 11 codon_start 1 locus_tag LOCUS_36530 CDS 3720266..3721636 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227441.1 transl_table 11 codon_start 1 locus_tag LOCUS_36540 CDS complement(3721662..3722339) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242965.1 transl_table 11 codon_start 1 locus_tag LOCUS_36550 CDS complement(3722353..3723159) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242519.1 transl_table 11 codon_start 1 locus_tag LOCUS_36560 CDS complement(3723249..3723782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968358.1 transl_table 11 codon_start 1 locus_tag LOCUS_36570 CDS complement(3723830..3724465) product permease prefix domain 1-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227434.1 transl_table 11 codon_start 1 locus_tag LOCUS_36580 CDS complement(3724458..3724796) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227432.1 transl_table 11 codon_start 1 locus_tag LOCUS_36590 CDS 3724940..3725755 product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242645.1 transl_table 11 codon_start 1 locus_tag LOCUS_36600 CDS complement(3725844..3726092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243437.1 transl_table 11 codon_start 1 locus_tag LOCUS_36610 CDS complement(3726185..3727624) product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886636.1 transl_table 11 codon_start 1 locus_tag LOCUS_36620 gene sacA CDS complement(3727621..3729006) product PTS system sucrose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227426.1 transl_table 11 codon_start 1 locus_tag LOCUS_36630 gene scrA CDS 3729307..3730077 product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243563.1 transl_table 11 codon_start 1 locus_tag LOCUS_36640 CDS complement(3730116..3730946) product sac operon transcriptional antiterminator SacT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243088.1 transl_table 11 codon_start 1 locus_tag LOCUS_36650 gene sacT CDS complement(3730986..3731288) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222155.1 transl_table 11 codon_start 1 locus_tag LOCUS_36660 CDS 3731817..3734237 product serine protease Vpr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227419.1 transl_table 11 codon_start 1 locus_tag LOCUS_36670 gene vpr CDS complement(3734275..3735276) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244349.1 transl_table 11 codon_start 1 locus_tag LOCUS_36680 CDS complement(3735452..3736201) product oxygen-insensitive NADPH nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244098.1 transl_table 11 codon_start 1 locus_tag LOCUS_36690 gene nfsA CDS complement(3736307..3737491) product cell shape-determining peptidoglycan glycosyltransferase RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227413.1 transl_table 11 codon_start 1 locus_tag LOCUS_36700 gene rodA CDS complement(3737820..3738122) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36710 note possible pseudo, internal stop codon, frameshifted CDS complement(3738127..3738273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36720 CDS complement(3738379..3738801) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36730 note possible pseudo, internal stop codon, frameshifted CDS 3739074..3739334 product spore morphogenesis/germination protein YwcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227411.1 transl_table 11 codon_start 1 locus_tag LOCUS_36740 gene ywcE CDS complement(3739575..3739949) product cytochrome aa3 quinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227410.1 transl_table 11 codon_start 1 locus_tag LOCUS_36750 gene qoxD CDS complement(3739951..3740565) product cytochrome aa3 quinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227409.1 transl_table 11 codon_start 1 locus_tag LOCUS_36760 gene qoxC CDS complement(3740579..3742528) product cytochrome aa3 quinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227407.1 transl_table 11 codon_start 1 locus_tag LOCUS_36770 gene qoxB CDS complement(3742556..3743512) product cytochrome aa3 quinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886637.1 transl_table 11 codon_start 1 locus_tag LOCUS_36780 gene qoxA CDS 3744035..3744280 product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968363.1 transl_table 11 codon_start 1 locus_tag LOCUS_36790 CDS complement(3744350..3745891) product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227402.1 transl_table 11 codon_start 1 locus_tag LOCUS_36800 gene galT CDS complement(3745895..3747067) product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227400.1 transl_table 11 codon_start 1 locus_tag LOCUS_36810 CDS complement(3747152..3747556) product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227398.1 transl_table 11 codon_start 1 locus_tag LOCUS_36820 CDS complement(3747553..3748224) product transcriptional regulator SlrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227396.1 transl_table 11 codon_start 1 locus_tag LOCUS_36830 gene slrC CDS 3748577..3748735 product transcriptional regulator SlrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243648.1 transl_table 11 codon_start 1 locus_tag LOCUS_36840 gene slrA CDS 3749175..3749483 product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227392.1 transl_table 11 codon_start 1 locus_tag LOCUS_36850 CDS 3749480..3751021 product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227390.1 transl_table 11 codon_start 1 locus_tag LOCUS_36860 CDS complement(3751054..3751653) product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242591.1 transl_table 11 codon_start 1 locus_tag LOCUS_36870 CDS complement(3751742..3752992) product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243445.1 transl_table 11 codon_start 1 locus_tag LOCUS_36880 gene efeB CDS complement(3753011..3753349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36890 CDS complement(3753505..3754167) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244128.1 transl_table 11 codon_start 1 locus_tag LOCUS_36900 gene thiE CDS complement(3754164..3754982) product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244274.1 transl_table 11 codon_start 1 locus_tag LOCUS_36910 gene thiM CDS complement(3754990..3755895) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227377.1 transl_table 11 codon_start 1 locus_tag LOCUS_36920 CDS 3756001..3756387 product CidA/LrgA family holin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227375.1 transl_table 11 codon_start 1 locus_tag LOCUS_36930 CDS 3756369..3757046 product CidB/LrgB family autolysis modulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227371.1 transl_table 11 codon_start 1 locus_tag LOCUS_36940 CDS complement(3757101..3757751) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243153.1 transl_table 11 codon_start 1 locus_tag LOCUS_36950 CDS complement(3758453..3758725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36960 CDS complement(3759153..3759950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36970 CDS complement(3760016..3760447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36980 CDS 3760855..3762057 product major facilitator superfamily domain-containing protein 6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242781.1 transl_table 11 codon_start 1 locus_tag LOCUS_36990 CDS 3762091..3762288 product YwbE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243869.1 transl_table 11 codon_start 1 locus_tag LOCUS_37000 CDS complement(3762323..3763510) product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244593.1 transl_table 11 codon_start 1 locus_tag LOCUS_37010 CDS 3763632..3764012 product glyoxalase GlxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243380.1 transl_table 11 codon_start 1 locus_tag LOCUS_37020 gene glxA CDS complement(3764050..3764727) product DUF2711 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242887.1 transl_table 11 codon_start 1 locus_tag LOCUS_37030 CDS complement(3764808..3766130) product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242539.1 transl_table 11 codon_start 1 locus_tag LOCUS_37040 gene celB CDS 3766354..3768291 product minor protease Epr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243950.1 transl_table 11 codon_start 1 locus_tag LOCUS_37050 gene epr CDS 3768735..3770114 product SacY negative regulator SacX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243800.1 transl_table 11 codon_start 1 locus_tag LOCUS_37060 gene sacX CDS 3770168..3771010 product transcription antiterminator SacY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244589.1 transl_table 11 codon_start 1 locus_tag LOCUS_37070 gene sacY CDS complement(3771063..3771923) product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242748.1 transl_table 11 codon_start 1 locus_tag LOCUS_37080 CDS complement(3772034..3772747) product TIGR02206 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242863.1 transl_table 11 codon_start 1 locus_tag LOCUS_37090 CDS 3772898..3773413 product tyrZ transcriptional regulator YwaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243598.1 transl_table 11 codon_start 1 locus_tag LOCUS_37100 gene ywaE CDS 3773665..3774903 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886638.1 transl_table 11 codon_start 1 locus_tag LOCUS_37110 gene tyrS CDS 3775058..3776425 product aminopeptidase YwaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242515.1 transl_table 11 codon_start 1 locus_tag LOCUS_37120 gene ywaD CDS complement(3776452..3777084) product GTP pyrophosphokinase YwaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244564.1 transl_table 11 codon_start 1 locus_tag LOCUS_37130 gene ywaC CDS complement(3777324..3777836) product DUF2199 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830214.1 transl_table 11 codon_start 1 locus_tag LOCUS_37140 CDS complement(3778190..3779125) product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968370.1 transl_table 11 codon_start 1 locus_tag LOCUS_37150 CDS 3779721..3781235 product D-alanine--poly(phosphoribitol) ligase subunit DltA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242511.1 transl_table 11 codon_start 1 locus_tag LOCUS_37160 gene dltA CDS 3781232..3782419 product D-alanyl-lipoteichoic acid biosynthesis protein DltB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227327.1 transl_table 11 codon_start 1 locus_tag LOCUS_37170 gene dltB CDS 3782436..3782672 product D-alanine--poly(phosphoribitol) ligase subunit DltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227325.1 transl_table 11 codon_start 1 locus_tag LOCUS_37180 gene dltC CDS 3782672..3783850 product D-alanyl-lipoteichoic acid biosynthesis protein DltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227323.1 transl_table 11 codon_start 1 locus_tag LOCUS_37190 gene dltD CDS 3783938..3784696 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242574.1 transl_table 11 codon_start 1 locus_tag LOCUS_37200 CDS 3784838..3785929 product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 transl_table 11 codon_start 1 locus_tag LOCUS_37210 CDS complement(3785963..3787291) product 6-phospho-beta-glucosidase LicH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244285.1 transl_table 11 codon_start 1 locus_tag LOCUS_37220 gene licH CDS complement(3787288..3787551) product PTS lichenan transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227313.1 transl_table 11 codon_start 1 locus_tag LOCUS_37230 gene licA CDS complement(3787639..3788997) product PTS lichenan transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243273.1 transl_table 11 codon_start 1 locus_tag LOCUS_37240 gene licC CDS complement(3789013..3789321) product PTS lichenan transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218755.1 transl_table 11 codon_start 1 locus_tag LOCUS_37250 gene licB CDS complement(3789445..3791370) product transcriptional regulator LicR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243034.1 transl_table 11 codon_start 1 locus_tag LOCUS_37260 gene licR CDS complement(3791709..3792299) product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227303.1 transl_table 11 codon_start 1 locus_tag LOCUS_37270 CDS 3792428..3794071 product catalase KatX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243042.1 transl_table 11 codon_start 1 locus_tag LOCUS_37280 gene katX CDS 3794173..3795375 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244027.1 transl_table 11 codon_start 1 locus_tag LOCUS_37290 CDS complement(3795372..3796148) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243335.1 transl_table 11 codon_start 1 locus_tag LOCUS_37300 CDS complement(3796145..3797032) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244494.1 transl_table 11 codon_start 1 locus_tag LOCUS_37310 CDS complement(3797039..3797227) product PLD nuclease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227293.1 transl_table 11 codon_start 1 locus_tag LOCUS_37320 CDS complement(3797224..3797430) product sigma Y negative regulator YxlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242917.1 transl_table 11 codon_start 1 locus_tag LOCUS_37330 gene yxlD CDS complement(3797427..3797747) product YxlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227289.1 transl_table 11 codon_start 1 locus_tag LOCUS_37340 CDS complement(3797740..3798276) product RNA polymerase sigma factor SigY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243678.1 transl_table 11 codon_start 1 locus_tag LOCUS_37350 gene sigY CDS 3798488..3799858 product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244111.1 transl_table 11 codon_start 1 locus_tag LOCUS_37360 CDS complement(3799872..3800702) product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244033.1 transl_table 11 codon_start 1 locus_tag LOCUS_37370 CDS complement(3800789..3802516) product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244401.1 transl_table 11 codon_start 1 locus_tag LOCUS_37380 gene cydC CDS complement(3802513..3804216) product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244017.1 transl_table 11 codon_start 1 locus_tag LOCUS_37390 gene cydD CDS complement(3804216..3805232) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244559.1 transl_table 11 codon_start 1 locus_tag LOCUS_37400 gene cydB CDS complement(3805216..3806622) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243795.1 transl_table 11 codon_start 1 locus_tag LOCUS_37410 gene cydA CDS 3807179..3808531 product citrate/malate transporter CimH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227271.1 transl_table 11 codon_start 1 locus_tag LOCUS_37420 gene cimH CDS 3808656..3810143 product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886639.1 transl_table 11 codon_start 1 locus_tag LOCUS_37430 CDS 3810402..3810602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37440 CDS complement(3810616..3811455) product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244194.1 transl_table 11 codon_start 1 locus_tag LOCUS_37450 CDS complement(3811726..3812076) product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232839.1 transl_table 11 codon_start 1 locus_tag LOCUS_37460 CDS complement(3812291..3813019) product ZIP family zinc transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225190.1 transl_table 11 codon_start 1 locus_tag LOCUS_37470 CDS complement(3813125..3814222) product maltodextrin ABC transporter ATP-binding protein MsmX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242648.1 transl_table 11 codon_start 1 locus_tag LOCUS_37480 gene msmX CDS complement(3814342..3815235) product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242549.1 transl_table 11 codon_start 1 locus_tag LOCUS_37490 CDS 3815421..3816878 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243062.1 transl_table 11 codon_start 1 locus_tag LOCUS_37500 CDS complement(3816918..3817754) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242615.1 transl_table 11 codon_start 1 locus_tag LOCUS_37510 CDS 3818214..3818852 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37520 CDS complement(3818928..3819947) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 transl_table 11 codon_start 1 locus_tag LOCUS_37530 gene galE CDS 3820466..3821698 product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244314.1 transl_table 11 codon_start 1 locus_tag LOCUS_37540 gene pepT CDS 3821803..3821928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37550 CDS 3822315..3822485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37560 CDS 3822661..3823149 product LURP-one-related/scramblase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242923.1 transl_table 11 codon_start 1 locus_tag LOCUS_37570 CDS 3823406..3824539 product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244296.1 transl_table 11 codon_start 1 locus_tag LOCUS_37580 CDS 3824692..3824886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37590 CDS 3824792..3825928 product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244221.1 transl_table 11 codon_start 1 locus_tag LOCUS_37600 CDS complement(3825980..3826753) product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244042.1 transl_table 11 codon_start 1 locus_tag LOCUS_37610 CDS complement(3826770..3827426) product succinyl-CoA--3-ketoacid CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243049.1 transl_table 11 codon_start 1 locus_tag LOCUS_37620 CDS complement(3827423..3828139) product succinyl-CoA--3-ketoacid CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244373.1 transl_table 11 codon_start 1 locus_tag LOCUS_37630 CDS complement(3828163..3829581) product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243205.1 transl_table 11 codon_start 1 locus_tag LOCUS_37640 CDS complement(3829732..3830292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37650 CDS 3831207..3832400 product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227216.1 transl_table 11 codon_start 1 locus_tag LOCUS_37660 CDS complement(3832445..3833116) product DUF3298 and DUF4163 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810357.1 transl_table 11 codon_start 1 locus_tag LOCUS_37670 CDS complement(3833259..3833549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242704.1 transl_table 11 codon_start 1 locus_tag LOCUS_37680 CDS complement(3833599..3835659) product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243331.1 transl_table 11 codon_start 1 locus_tag LOCUS_37690 CDS 3835855..3837135 product citrate transporter CitH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227205.1 transl_table 11 codon_start 1 locus_tag LOCUS_37700 gene citH CDS 3837234..3837818 product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886423.1 transl_table 11 codon_start 1 locus_tag LOCUS_37710 CDS complement(3837856..3838962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37720 CDS complement(3839059..3840480) product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890696.1 transl_table 11 codon_start 1 locus_tag LOCUS_37730 CDS complement(3840501..3842333) product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721858.1 transl_table 11 codon_start 1 locus_tag LOCUS_37740 CDS complement(3842648..3843481) product transcriptional antiterminator LicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242598.1 transl_table 11 codon_start 1 locus_tag LOCUS_37750 gene licT CDS complement(3843576..3844256) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886641.1 transl_table 11 codon_start 1 locus_tag LOCUS_37760 CDS 3844462..3845748 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968391.1 transl_table 11 codon_start 1 locus_tag LOCUS_37770 CDS complement(3845767..3847206) product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243023.1 transl_table 11 codon_start 1 locus_tag LOCUS_37780 gene dbpA CDS complement(3847288..3848436) product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242617.1 transl_table 11 codon_start 1 locus_tag LOCUS_37790 CDS 3848601..3848936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37800 CDS 3848939..3849496 product DUF2812 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986155.1 transl_table 11 codon_start 1 locus_tag LOCUS_37810 CDS complement(3849515..3849952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37820 CDS complement(3850554..3850904) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37830 CDS complement(3850922..3851374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243382.1 transl_table 11 codon_start 1 locus_tag LOCUS_37840 CDS complement(3851390..3851686) product YxiJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227182.1 transl_table 11 codon_start 1 locus_tag LOCUS_37850 CDS complement(3851679..3852008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37860 CDS complement(3852035..3852517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37870 CDS complement(3852548..3853306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37880 CDS complement(3853332..3853817) product DUF2716 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886642.1 transl_table 11 codon_start 1 locus_tag LOCUS_37890 CDS complement(3853837..3854412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227178.1 transl_table 11 codon_start 1 locus_tag LOCUS_37900 CDS complement(3854436..3854648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37910 note possible pseudo, frameshifted CDS complement(3854713..3855582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37920 CDS complement(3855755..3856132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37930 CDS complement(3856279..3856710) product immunity protein WapI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227169.1 transl_table 11 codon_start 1 locus_tag LOCUS_37940 gene wapI CDS complement(3856858..3857319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227174.1 transl_table 11 codon_start 1 locus_tag LOCUS_37950 CDS complement(3857321..3857566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37960 CDS complement(3857833..3858138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37970 note possible pseudo, internal stop codon, frameshifted CDS complement(3858280..3858648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37980 note possible pseudo, frameshifted CDS complement(3858703..3859551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37990 CDS complement(3859604..3866620) product tRNA nuclease WapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243665.1 transl_table 11 codon_start 1 locus_tag LOCUS_38000 gene wapA CDS complement(3866790..3867725) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227165.1 transl_table 11 codon_start 1 locus_tag LOCUS_38010 CDS complement(3867895..3868140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38020 note possible pseudo, internal stop codon, frameshifted CDS complement(3868246..3868509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38030 note possible pseudo, internal stop codon CDS 3868919..3869683 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967096.1 transl_table 11 codon_start 1 locus_tag LOCUS_38040 CDS complement(3869927..3870373) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227162.1 transl_table 11 codon_start 1 locus_tag LOCUS_38050 CDS complement(3870477..3871886) product aryl-phospho-beta-d-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243232.1 transl_table 11 codon_start 1 locus_tag LOCUS_38060 gene bglH CDS complement(3871908..3873746) product PTS beta-glucoside transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242943.1 transl_table 11 codon_start 1 locus_tag LOCUS_38070 gene bglP CDS complement(3874139..3874438) product contact-dependent growth inhibition system immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242733.1 transl_table 11 codon_start 1 locus_tag LOCUS_38080 CDS complement(3874580..3874843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38090 CDS complement(3874990..3875376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38100 CDS complement(3875429..3875656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963460.1 transl_table 11 codon_start 1 locus_tag LOCUS_38110 CDS complement(3875667..3876116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38120 CDS complement(3876277..3876609) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048526177.1 transl_table 11 codon_start 1 locus_tag LOCUS_38130 CDS complement(3876631..3878235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38140 CDS complement(3878255..3878524) product YwqI/YxiC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244193.1 transl_table 11 codon_start 1 locus_tag LOCUS_38150 CDS complement(3878536..3878901) product DUF5082 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968400.1 transl_table 11 codon_start 1 locus_tag LOCUS_38160 CDS complement(3879210..3880628) product arabinan endo-1,5-alpha-L-arabinosidase AbnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244268.1 transl_table 11 codon_start 1 locus_tag LOCUS_38170 gene abnB CDS complement(3880702..3881691) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966670.1 transl_table 11 codon_start 1 locus_tag LOCUS_38180 CDS 3881934..3882380 product hut operon transcriptional regulator HutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243875.1 transl_table 11 codon_start 1 locus_tag LOCUS_38190 gene hutP CDS 3882493..3884019 product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243255.1 transl_table 11 codon_start 1 locus_tag LOCUS_38200 gene hutH CDS 3884016..3885674 product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243634.1 transl_table 11 codon_start 1 locus_tag LOCUS_38210 gene hutU CDS 3885687..3886952 product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244327.1 transl_table 11 codon_start 1 locus_tag LOCUS_38220 gene hutI CDS 3886945..3887901 product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243908.1 transl_table 11 codon_start 1 locus_tag LOCUS_38230 gene hutG CDS 3887980..3889407 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227134.1 transl_table 11 codon_start 1 locus_tag LOCUS_38240 CDS complement(3889450..3890751) product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243952.1 transl_table 11 codon_start 1 locus_tag LOCUS_38250 CDS complement(3890781..3891962) product nucleoside permease NupC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244143.1 transl_table 11 codon_start 1 locus_tag LOCUS_38260 gene nupC CDS complement(3892057..3892728) product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244069.1 transl_table 11 codon_start 1 locus_tag LOCUS_38270 gene deoC CDS complement(3892834..3893775) product DNA-binding transcriptional repressor DeoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227124.1 transl_table 11 codon_start 1 locus_tag LOCUS_38280 gene deoR CDS complement(3893911..3894741) product DUF1206 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243667.1 transl_table 11 codon_start 1 locus_tag LOCUS_38290 CDS complement(3894806..3895915) product ethanolamine utilization protein EutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243423.1 transl_table 11 codon_start 1 locus_tag LOCUS_38300 gene eutH CDS complement(3895985..3897322) product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243743.1 transl_table 11 codon_start 1 locus_tag LOCUS_38310 CDS complement(3897319..3898461) product N-acetyl-sulfur-metabolite deacetylase SndB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243840.1 transl_table 11 codon_start 1 locus_tag LOCUS_38320 gene sndB CDS complement(3898478..3899227) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243284.1 transl_table 11 codon_start 1 locus_tag LOCUS_38330 CDS complement(3899240..3899914) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243465.1 transl_table 11 codon_start 1 locus_tag LOCUS_38340 CDS complement(3899937..3900731) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227109.1 transl_table 11 codon_start 1 locus_tag LOCUS_38350 CDS complement(3900756..3901253) product sulfur-containing aminoacid acetyltransferase SnaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242734.1 transl_table 11 codon_start 1 locus_tag LOCUS_38360 gene snaB CDS complement(3901267..3902592) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242500.1 transl_table 11 codon_start 1 locus_tag LOCUS_38370 CDS complement(3902970..3903956) product penicillin V amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243495.1 transl_table 11 codon_start 1 locus_tag LOCUS_38380 gene yxeI CDS complement(3904364..3905176) product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243315.1 transl_table 11 codon_start 1 locus_tag LOCUS_38390 gene yidA CDS complement(3905216..3905776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242636.1 transl_table 11 codon_start 1 locus_tag LOCUS_38400 CDS complement(3905796..3906191) product YxeF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244165.1 transl_table 11 codon_start 1 locus_tag LOCUS_38410 CDS 3906292..3906657 product inner spore coat protein CotNE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227093.1 transl_table 11 codon_start 1 locus_tag LOCUS_38420 gene cotNE CDS 3906908..3907261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242469.1 transl_table 11 codon_start 1 locus_tag LOCUS_38430 CDS complement(3907304..3907702) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243293.1 transl_table 11 codon_start 1 locus_tag LOCUS_38440 CDS 3907879..3908844 product iron-hydroxamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243725.1 transl_table 11 codon_start 1 locus_tag LOCUS_38450 CDS complement(3908885..3909232) product YxeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227084.1 transl_table 11 codon_start 1 locus_tag LOCUS_38460 CDS complement(3909245..3911113) product ABC transporter permease YxdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244410.1 transl_table 11 codon_start 1 locus_tag LOCUS_38470 gene yxdM CDS complement(3911088..3911861) product ABC transporter ATP-binding protein YxdL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243557.1 transl_table 11 codon_start 1 locus_tag LOCUS_38480 gene yxdL CDS complement(3912007..3912984) product two-component system sensor histidine kinase YxdK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243885.1 transl_table 11 codon_start 1 locus_tag LOCUS_38490 gene yxdK CDS complement(3912981..3913670) product two-component system response regulator YxdJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243527.1 transl_table 11 codon_start 1 locus_tag LOCUS_38500 gene yxdJ CDS complement(3913779..3914651) product 6-phospho-5-dehydro-2-deoxy-D-gluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242766.1 transl_table 11 codon_start 1 locus_tag LOCUS_38510 gene iolJ CDS complement(3914672..3915508) product 2-keto-myo-inositol isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244546.1 transl_table 11 codon_start 1 locus_tag LOCUS_38520 gene iolI CDS complement(3915595..3916464) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243149.1 transl_table 11 codon_start 1 locus_tag LOCUS_38530 CDS complement(3916486..3917520) product bifunctional inositol 2-dehydrogenase/D-chiro-inositol 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244482.1 transl_table 11 codon_start 1 locus_tag LOCUS_38540 gene iolG CDS complement(3917543..3918859) product myo-inositol transporter IolF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244597.1 transl_table 11 codon_start 1 locus_tag LOCUS_38550 gene iolF CDS complement(3918874..3919767) product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227062.1 transl_table 11 codon_start 1 locus_tag LOCUS_38560 gene iolE CDS complement(3919784..3921697) product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242642.1 transl_table 11 codon_start 1 locus_tag LOCUS_38570 gene iolD CDS complement(3921730..3922707) product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243753.1 transl_table 11 codon_start 1 locus_tag LOCUS_38580 gene iolC CDS complement(3922731..3923546) product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243247.1 transl_table 11 codon_start 1 locus_tag LOCUS_38590 gene iolB CDS complement(3923621..3925084) product methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243682.1 transl_table 11 codon_start 1 locus_tag LOCUS_38600 gene iolA CDS 3925502..3926257 product myo-inositol utilization transcriptional regulator IolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227050.1 transl_table 11 codon_start 1 locus_tag LOCUS_38610 gene iolR CDS 3926311..3927243 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243075.1 transl_table 11 codon_start 1 locus_tag LOCUS_38620 CDS complement(3927746..3927874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38630 CDS 3928038..3928223 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38640 CDS 3928227..3928535 product YxcD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227046.1 transl_table 11 codon_start 1 locus_tag LOCUS_38650 CDS 3928741..3930126 product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244055.1 transl_table 11 codon_start 1 locus_tag LOCUS_38660 CDS complement(3930166..3932046) product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243561.1 transl_table 11 codon_start 1 locus_tag LOCUS_38670 gene htpG CDS complement(3932241..3932477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244458.1 transl_table 11 codon_start 1 locus_tag LOCUS_38680 CDS 3932593..3933414 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244072.1 transl_table 11 codon_start 1 locus_tag LOCUS_38690 CDS 3933633..3933800 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38700 CDS complement(3934435..3935574) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243187.1 transl_table 11 codon_start 1 locus_tag LOCUS_38710 CDS 3935717..3937054 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243415.1 transl_table 11 codon_start 1 locus_tag LOCUS_38720 CDS complement(3937412..3937837) product DUF5391 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242533.1 transl_table 11 codon_start 1 locus_tag LOCUS_38730 CDS 3938089..3938544 product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242940.1 transl_table 11 codon_start 1 locus_tag LOCUS_38740 CDS complement(3938574..3939782) product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244185.1 transl_table 11 codon_start 1 locus_tag LOCUS_38750 CDS complement(3939889..3940902) product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243000.1 transl_table 11 codon_start 1 locus_tag LOCUS_38760 gene qdoI CDS complement(3940994..3941569) product transcriptional regulator YxaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227022.1 transl_table 11 codon_start 1 locus_tag LOCUS_38770 gene yxaF CDS 3941699..3942763 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244500.1 transl_table 11 codon_start 1 locus_tag LOCUS_38780 CDS complement(3942820..3943251) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243994.1 transl_table 11 codon_start 1 locus_tag LOCUS_38790 CDS 3943479..3943883 product CidA/LrgA family holin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968420.1 transl_table 11 codon_start 1 locus_tag LOCUS_38800 CDS 3943853..3944545 product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227015.1 transl_table 11 codon_start 1 locus_tag LOCUS_38810 CDS 3944746..3946323 product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878349.1 transl_table 11 codon_start 1 locus_tag LOCUS_38820 CDS complement(3946361..3947392) product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242482.1 transl_table 11 codon_start 1 locus_tag LOCUS_38830 CDS complement(3947484..3948632) product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242551.1 transl_table 11 codon_start 1 locus_tag LOCUS_38840 CDS 3948828..3949559 product gluconate operon transcriptional repressor GntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243132.1 transl_table 11 codon_start 1 locus_tag LOCUS_38850 gene gntR CDS 3949552..3951093 product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968422.1 transl_table 11 codon_start 1 locus_tag LOCUS_38860 gene gntK CDS 3951122..3952468 product gluconate permease GntP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243139.1 transl_table 11 codon_start 1 locus_tag LOCUS_38870 gene gntP CDS 3952492..3953898 product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243876.1 transl_table 11 codon_start 1 locus_tag LOCUS_38880 gene gnd CDS 3954418..3954981 product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243686.1 transl_table 11 codon_start 1 locus_tag LOCUS_38890 gene ahpC CDS 3954995..3956524 product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243077.1 transl_table 11 codon_start 1 locus_tag LOCUS_38900 gene ahpF CDS complement(3956636..3957988) product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775825.1 transl_table 11 codon_start 1 locus_tag LOCUS_38910 CDS complement(3958279..3959718) product 6-phospho-beta-glucosidase BglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226994.1 transl_table 11 codon_start 1 locus_tag LOCUS_38920 gene bglA CDS complement(3959732..3961600) product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721858.1 transl_table 11 codon_start 1 locus_tag LOCUS_38930 CDS 3961755..3962465 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226988.1 transl_table 11 codon_start 1 locus_tag LOCUS_38940 CDS complement(3962597..3962767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38950 CDS 3962928..3964853 product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243329.1 transl_table 11 codon_start 1 locus_tag LOCUS_38960 gene fbp CDS 3964932..3965093 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38970 CDS complement(3965706..3967172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38980 CDS complement(3967567..3968232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38990 CDS complement(3968235..3970010) product DUF1998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861851.1 transl_table 11 codon_start 1 locus_tag LOCUS_39000 CDS complement(3970000..3973341) product DISARM system helicase DrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204892.1 transl_table 11 codon_start 1 locus_tag LOCUS_39010 gene drmA CDS complement(3973357..3975696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39020 CDS complement(3975726..3976205) product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243164.1 transl_table 11 codon_start 1 locus_tag LOCUS_39030 gene rlmH CDS complement(3976286..3976456) product CxxH/CxxC protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219122.1 transl_table 11 codon_start 1 locus_tag LOCUS_39040 CDS 3976641..3976916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39050 note possible pseudo, frameshifted CDS complement(3977138..3977308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244248.1 transl_table 11 codon_start 1 locus_tag LOCUS_39060 CDS 3977456..3977752 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39070 CDS complement(3977824..3978981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243905.1 transl_table 11 codon_start 1 locus_tag LOCUS_39080 CDS complement(3978992..3979729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243470.1 transl_table 11 codon_start 1 locus_tag LOCUS_39090 CDS complement(3979885..3980355) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243975.1 transl_table 11 codon_start 1 locus_tag LOCUS_39100 CDS 3980466..3981563 product response regulator aspartate phosphatase RapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243386.1 transl_table 11 codon_start 1 locus_tag LOCUS_39110 gene rapG CDS complement(3981716..3982606) product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226959.1 transl_table 11 codon_start 1 locus_tag LOCUS_39120 gene rocF CDS complement(3982680..3984083) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242721.1 transl_table 11 codon_start 1 locus_tag LOCUS_39130 CDS complement(3984308..3985513) product ornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242970.1 transl_table 11 codon_start 1 locus_tag LOCUS_39140 gene rocD CDS 3985754..3987139 product arginine utilization regulatory protein RocR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244510.1 transl_table 11 codon_start 1 locus_tag LOCUS_39150 gene rocR CDS complement(3987081..3987383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39160 CDS complement(3987528..3988736) product serine protease HtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969578.1 transl_table 11 codon_start 1 locus_tag LOCUS_39170 gene htrC CDS complement(3988821..3989615) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242676.1 transl_table 11 codon_start 1 locus_tag LOCUS_39180 CDS complement(3989638..3990480) product WalRK two-component regulatory system regulator WalI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244037.1 transl_table 11 codon_start 1 locus_tag LOCUS_39190 gene walI CDS complement(3990467..3991843) product WalRK two-component regulatory system regulator WalH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242498.1 transl_table 11 codon_start 1 locus_tag LOCUS_39200 gene walH CDS complement(3991824..3993659) product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968432.1 transl_table 11 codon_start 1 locus_tag LOCUS_39210 gene walK CDS complement(3993667..3994377) product cell wall metabolism DNA-binding response regulator WalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244363.1 transl_table 11 codon_start 1 locus_tag LOCUS_39220 gene walR tRNA complement(3994757..3994830) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00830 tRNA complement(3994866..3994942) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00840 tRNA complement(3995025..3995096) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00850 tRNA complement(3995106..3995181) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00860 CDS complement(3995402..3996694) product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243325.1 transl_table 11 codon_start 1 locus_tag LOCUS_39230 gene purA CDS complement(3996900..3997319) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243491.1 transl_table 11 codon_start 1 locus_tag LOCUS_39240 CDS complement(3997436..3998800) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226923.1 transl_table 11 codon_start 1 locus_tag LOCUS_39250 gene dnaB CDS 3998970..3999170 product DUF2188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226922.1 transl_table 11 codon_start 1 locus_tag LOCUS_39260 CDS complement(3999215..3999418) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244312.1 transl_table 11 codon_start 1 locus_tag LOCUS_39270 CDS 3999539..3999682 product YycC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242786.1 transl_table 11 codon_start 1 locus_tag LOCUS_39280 CDS 3999755..4000963 product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226917.1 transl_table 11 codon_start 1 locus_tag LOCUS_39290 CDS 4001080..4003170 product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242651.1 transl_table 11 codon_start 1 locus_tag LOCUS_39300 CDS complement(4003207..4003656) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226915.1 transl_table 11 codon_start 1 locus_tag LOCUS_39310 gene rplI CDS complement(4003653..4005632) product cyclic-di-AMP phosphodiesterase GdpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242517.1 transl_table 11 codon_start 1 locus_tag LOCUS_39320 gene gdpP CDS complement(4005669..4006598) product YybS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243969.1 transl_table 11 codon_start 1 locus_tag LOCUS_39330 CDS complement(4006824..4006973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226909.1 transl_table 11 codon_start 1 locus_tag LOCUS_39340 CDS 4007118..4007600 product spore coat protein CotF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243364.1 transl_table 11 codon_start 1 locus_tag LOCUS_39350 gene cotF CDS complement(4007630..4008007) product transcriptional regulator HypR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242487.1 transl_table 11 codon_start 1 locus_tag LOCUS_39360 gene hypR CDS 4008213..4009142 product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226902.1 transl_table 11 codon_start 1 locus_tag LOCUS_39370 CDS complement(4009378..4009824) product DUF6376 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244214.1 transl_table 11 codon_start 1 locus_tag LOCUS_39380 CDS 4010282..4011571 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968439.1 transl_table 11 codon_start 1 locus_tag LOCUS_39390 CDS 4011843..4011998 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39400 CDS 4012023..4012205 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39410 CDS complement(4012346..4013146) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244492.1 transl_table 11 codon_start 1 locus_tag LOCUS_39420 CDS complement(4013253..4014212) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243239.1 transl_table 11 codon_start 1 locus_tag LOCUS_39430 CDS complement(4014548..4014706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39440 CDS 4014640..4015518 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242958.1 transl_table 11 codon_start 1 locus_tag LOCUS_39450 CDS 4015533..4015976 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226881.1 transl_table 11 codon_start 1 locus_tag LOCUS_39460 CDS 4016059..4016538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243923.1 transl_table 11 codon_start 1 locus_tag LOCUS_39470 CDS complement(4016654..4017316) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226877.1 transl_table 11 codon_start 1 locus_tag LOCUS_39480 CDS 4017422..4017712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39490 note possible pseudo, frameshifted CDS 4017878..4018795 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231350.1 transl_table 11 codon_start 1 locus_tag LOCUS_39500 CDS complement(4018884..4019336) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226875.1 transl_table 11 codon_start 1 locus_tag LOCUS_39510 CDS 4019457..4019903 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243577.1 transl_table 11 codon_start 1 locus_tag LOCUS_39520 CDS 4019900..4020490 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244154.1 transl_table 11 codon_start 1 locus_tag LOCUS_39530 CDS 4020779..4022848 product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968448.1 transl_table 11 codon_start 1 locus_tag LOCUS_39540 CDS complement(4022845..4023744) product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244361.1 transl_table 11 codon_start 1 locus_tag LOCUS_39550 CDS 4023971..4025326 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243011.1 transl_table 11 codon_start 1 locus_tag LOCUS_39560 CDS complement(4025359..4025913) product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242928.1 transl_table 11 codon_start 1 locus_tag LOCUS_39570 CDS complement(4025931..4026311) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244460.1 transl_table 11 codon_start 1 locus_tag LOCUS_39580 CDS complement(4026367..4027302) product transcriptional regulator CcpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243573.1 transl_table 11 codon_start 1 locus_tag LOCUS_39590 gene ccpB CDS complement(4027361..4028119) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243194.1 transl_table 11 codon_start 1 locus_tag LOCUS_39600 gene xth CDS complement(4028180..4028419) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219224.1 transl_table 11 codon_start 1 locus_tag LOCUS_39610 gene rpsR CDS complement(4028463..4028981) product single-stranded DNA-binding protein SsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219228.1 transl_table 11 codon_start 1 locus_tag LOCUS_39620 gene ssbA CDS complement(4029022..4029309) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244064.1 transl_table 11 codon_start 1 locus_tag LOCUS_39630 gene rpsF CDS complement(4029420..4030520) product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242727.1 transl_table 11 codon_start 1 locus_tag LOCUS_39640 gene ychF CDS complement(4030647..4032650) product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244290.1 transl_table 11 codon_start 1 locus_tag LOCUS_39650 CDS complement(4032701..4032907) product DUF951 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226838.1 transl_table 11 codon_start 1 locus_tag LOCUS_39660 CDS complement(4033001..4033999) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886647.1 transl_table 11 codon_start 1 locus_tag LOCUS_39670 CDS 4034433..4035050 product spore protease YyaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243890.1 transl_table 11 codon_start 1 locus_tag LOCUS_39680 gene yyaC CDS complement(4035090..4035938) product stage 0 sporulation protein Spo0J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226832.1 transl_table 11 codon_start 1 locus_tag LOCUS_39690 gene spo0J CDS complement(4035931..4036692) product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 transl_table 11 codon_start 1 locus_tag LOCUS_39700 gene soj CDS 4036936..4037376 product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244005.1 transl_table 11 codon_start 1 locus_tag LOCUS_39710 CDS complement(4037426..4038277) product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226829.1 transl_table 11 codon_start 1 locus_tag LOCUS_39720 gene noc CDS complement(4038399..4039118) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243029.1 transl_table 11 codon_start 1 locus_tag LOCUS_39730 gene rsmG CDS complement(4039132..4041018) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226825.1 transl_table 11 codon_start 1 locus_tag LOCUS_39740 gene mnmG CDS complement(4041039..4042418) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244507.1 transl_table 11 codon_start 1 locus_tag LOCUS_39750 gene mnmE CDS complement(4042730..4043356) product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243764.1 transl_table 11 codon_start 1 locus_tag LOCUS_39760 CDS complement(4043353..4044114) product YidC family membrane integrase SpoIIIJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886648.1 transl_table 11 codon_start 1 locus_tag LOCUS_39770 gene spoIIIJ CDS complement(4044283..4044633) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242628.1 transl_table 11 codon_start 1 locus_tag LOCUS_39780 gene rnpA CDS complement(4044785..4044919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39790 CDS complement(4045110..4045331) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39800