>Feature sequence01 483 734 gene locus_tag LOCUS_00010 483 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1344 868 gene locus_tag LOCUS_00020 1344 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2290 1490 gene locus_tag LOCUS_00030 2290 1490 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979837.1 protein_id gnl|my_center|LOCUS_00030 2997 2287 gene locus_tag LOCUS_00040 gene mntB 2997 2287 CDS product manganese ABC transporter ATP-binding protein MntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398644.1 protein_id gnl|my_center|LOCUS_00040 3122 3367 gene locus_tag LOCUS_00050 3122 3367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 3389 3673 gene locus_tag LOCUS_00060 3389 3673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 3670 4398 gene locus_tag LOCUS_00070 3670 4398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 4438 4779 gene locus_tag LOCUS_00080 4438 4779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 5271 5939 gene locus_tag LOCUS_00090 5271 5939 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254077.1 protein_id gnl|my_center|LOCUS_00090 6079 6009 gene locus_tag LOCUS_t00010 6079 6009 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 6260 7285 gene locus_tag LOCUS_00100 gene trpS 6260 7285 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548870.1 protein_id gnl|my_center|LOCUS_00100 7323 7769 gene locus_tag LOCUS_00110 7323 7769 CDS product ComE operon protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548871.1 protein_id gnl|my_center|LOCUS_00110 7750 8364 gene locus_tag LOCUS_00120 7750 8364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 8723 11413 gene locus_tag LOCUS_00130 gene mgtA 8723 11413 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548873.1 protein_id gnl|my_center|LOCUS_00130 11549 13531 gene locus_tag LOCUS_00140 gene metG 11549 13531 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254078.1 protein_id gnl|my_center|LOCUS_00140 13531 14310 gene locus_tag LOCUS_00150 13531 14310 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548876.1 protein_id gnl|my_center|LOCUS_00150 14294 14866 gene locus_tag LOCUS_00160 gene rnmV 14294 14866 CDS product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548877.1 protein_id gnl|my_center|LOCUS_00160 14841 15731 gene locus_tag LOCUS_00170 gene rsmA 14841 15731 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548878.1 protein_id gnl|my_center|LOCUS_00170 15791 16042 gene locus_tag LOCUS_00180 15791 16042 CDS product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548879.1 protein_id gnl|my_center|LOCUS_00180 16148 16978 gene locus_tag LOCUS_00190 gene purR 16148 16978 CDS product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548880.1 protein_id gnl|my_center|LOCUS_00190 17040 18425 gene locus_tag LOCUS_00200 gene glmU 17040 18425 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548882.1 protein_id gnl|my_center|LOCUS_00200 18595 19293 gene locus_tag LOCUS_00210 18595 19293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 19523 20503 gene locus_tag LOCUS_00220 19523 20503 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254080.1 protein_id gnl|my_center|LOCUS_00220 21888 20575 gene locus_tag LOCUS_00230 21888 20575 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548899.1 protein_id gnl|my_center|LOCUS_00230 22078 21875 gene locus_tag LOCUS_00240 22078 21875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 22028 22426 gene locus_tag LOCUS_00250 22028 22426 CDS product DUF1934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548902.1 protein_id gnl|my_center|LOCUS_00250 22472 23041 gene locus_tag LOCUS_00260 gene rpoE 22472 23041 CDS product DNA-directed RNA polymerase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548904.1 protein_id gnl|my_center|LOCUS_00260 23158 24777 gene locus_tag LOCUS_00270 23158 24777 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254085.1 protein_id gnl|my_center|LOCUS_00270 24897 26168 gene locus_tag LOCUS_00280 24897 26168 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254086.1 protein_id gnl|my_center|LOCUS_00280 26268 26519 gene locus_tag LOCUS_00290 26268 26519 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548978.1 protein_id gnl|my_center|LOCUS_00290 26627 27994 gene locus_tag LOCUS_00300 26627 27994 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548990.1 protein_id gnl|my_center|LOCUS_00300 28004 29455 gene locus_tag LOCUS_00310 28004 29455 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548992.1 protein_id gnl|my_center|LOCUS_00310 29540 29953 gene locus_tag LOCUS_00320 gene acpS 29540 29953 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254099.1 protein_id gnl|my_center|LOCUS_00320 29950 31080 gene locus_tag LOCUS_00330 gene alr 29950 31080 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548996.1 protein_id gnl|my_center|LOCUS_00330 31832 31134 gene locus_tag LOCUS_00340 gene cbpA 31832 31134 CDS product cyclic di-AMP binding protein CbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254100.1 protein_id gnl|my_center|LOCUS_00340 32056 32613 gene locus_tag LOCUS_00350 gene pth 32056 32613 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549001.1 protein_id gnl|my_center|LOCUS_00350 32630 36106 gene locus_tag LOCUS_00360 gene mfd 32630 36106 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254101.1 protein_id gnl|my_center|LOCUS_00360 36175 36417 gene locus_tag LOCUS_00370 36175 36417 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254102.1 protein_id gnl|my_center|LOCUS_00370 36483 36863 gene locus_tag LOCUS_00380 36483 36863 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254103.1 protein_id gnl|my_center|LOCUS_00380 36863 37216 gene locus_tag LOCUS_00390 36863 37216 CDS product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549009.1 protein_id gnl|my_center|LOCUS_00390 37263 38558 gene locus_tag LOCUS_00400 gene tilS 37263 38558 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549010.1 protein_id gnl|my_center|LOCUS_00400 38629 40842 gene locus_tag LOCUS_00410 gene ftsH 38629 40842 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254105.1 protein_id gnl|my_center|LOCUS_00410 40887 41768 gene locus_tag LOCUS_00420 gene hslO 40887 41768 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549012.1 protein_id gnl|my_center|LOCUS_00420 42222 43847 gene locus_tag LOCUS_00430 42222 43847 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254634.1 protein_id gnl|my_center|LOCUS_00430 43857 45143 gene locus_tag LOCUS_00440 gene pepT 43857 45143 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548288.1 protein_id gnl|my_center|LOCUS_00440 45257 46291 gene locus_tag LOCUS_00450 gene dusB 45257 46291 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254106.1 protein_id gnl|my_center|LOCUS_00450 46308 47813 gene locus_tag LOCUS_00460 gene lysS 46308 47813 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254107.1 protein_id gnl|my_center|LOCUS_00460 47965 48369 gene locus_tag LOCUS_00470 47965 48369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 48393 49142 gene locus_tag LOCUS_00480 48393 49142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 49408 49626 gene locus_tag LOCUS_00490 49408 49626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 49890 50051 gene locus_tag LOCUS_00500 49890 50051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00500 50113 51180 gene locus_tag LOCUS_00510 50113 51180 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101818.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00510 51851 51243 gene locus_tag LOCUS_00520 51851 51243 CDS product DUF5052 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254351.1 protein_id gnl|my_center|LOCUS_00520 51987 52058 gene locus_tag LOCUS_t00020 51987 52058 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 52062 52137 gene locus_tag LOCUS_t00030 52062 52137 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 52245 52316 gene locus_tag LOCUS_t00040 52245 52316 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 52475 52936 gene locus_tag LOCUS_00530 52475 52936 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549015.1 protein_id gnl|my_center|LOCUS_00530 52960 55419 gene locus_tag LOCUS_00540 52960 55419 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549016.1 protein_id gnl|my_center|LOCUS_00540 55444 55632 gene locus_tag LOCUS_00550 55444 55632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 55632 55787 gene locus_tag LOCUS_00560 55632 55787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 55998 59663 gene locus_tag LOCUS_00570 55998 59663 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254108.1 protein_id gnl|my_center|LOCUS_00570 59679 63344 gene locus_tag LOCUS_00580 gene rpoC 59679 63344 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254109.1 protein_id gnl|my_center|LOCUS_00580 63972 63412 gene locus_tag LOCUS_00590 63972 63412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 64424 64263 gene locus_tag LOCUS_00600 64424 64263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00600 64688 65095 gene locus_tag LOCUS_00610 gene rpsL 64688 65095 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549020.1 protein_id gnl|my_center|LOCUS_00610 65111 65581 gene locus_tag LOCUS_00620 gene rpsG 65111 65581 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549021.1 protein_id gnl|my_center|LOCUS_00620 65615 67699 gene locus_tag LOCUS_00630 gene fusA 65615 67699 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549022.1 protein_id gnl|my_center|LOCUS_00630 68086 68394 gene locus_tag LOCUS_00640 gene rpsJ 68086 68394 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549023.1 protein_id gnl|my_center|LOCUS_00640 68420 69049 gene locus_tag LOCUS_00650 gene rplC 68420 69049 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549024.1 protein_id gnl|my_center|LOCUS_00650 69064 69681 gene locus_tag LOCUS_00660 gene rplD 69064 69681 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549025.1 protein_id gnl|my_center|LOCUS_00660 69681 69977 gene locus_tag LOCUS_00670 gene rplW 69681 69977 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549026.1 protein_id gnl|my_center|LOCUS_00670 70003 70839 gene locus_tag LOCUS_00680 gene rplB 70003 70839 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254111.1 protein_id gnl|my_center|LOCUS_00680 70857 71132 gene locus_tag LOCUS_00690 gene rpsS 70857 71132 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356205.1 protein_id gnl|my_center|LOCUS_00690 71154 71507 gene locus_tag LOCUS_00700 gene rplV 71154 71507 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549029.1 protein_id gnl|my_center|LOCUS_00700 71521 72192 gene locus_tag LOCUS_00710 gene rpsC 71521 72192 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254113.1 protein_id gnl|my_center|LOCUS_00710 72192 72635 gene locus_tag LOCUS_00720 gene rplP 72192 72635 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549031.1 protein_id gnl|my_center|LOCUS_00720 72625 72822 gene locus_tag LOCUS_00730 gene rpmC 72625 72822 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549032.1 protein_id gnl|my_center|LOCUS_00730 72841 73107 gene locus_tag LOCUS_00740 gene rpsQ 72841 73107 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254114.1 protein_id gnl|my_center|LOCUS_00740 73138 73506 gene locus_tag LOCUS_00750 gene rplN 73138 73506 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549034.1 protein_id gnl|my_center|LOCUS_00750 73523 73762 gene locus_tag LOCUS_00760 73523 73762 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549035.1 protein_id gnl|my_center|LOCUS_00760 73782 74324 gene locus_tag LOCUS_00770 gene rplE 73782 74324 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549036.1 protein_id gnl|my_center|LOCUS_00770 74339 74524 gene locus_tag LOCUS_00780 74339 74524 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549037.1 protein_id gnl|my_center|LOCUS_00780 74547 74945 gene locus_tag LOCUS_00790 gene rpsH 74547 74945 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549038.1 protein_id gnl|my_center|LOCUS_00790 74970 75500 gene locus_tag LOCUS_00800 gene rplF 74970 75500 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549039.1 protein_id gnl|my_center|LOCUS_00800 75527 75886 gene locus_tag LOCUS_00810 gene rplR 75527 75886 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549040.1 protein_id gnl|my_center|LOCUS_00810 75903 76415 gene locus_tag LOCUS_00820 gene rpsE 75903 76415 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549041.1 protein_id gnl|my_center|LOCUS_00820 76427 76612 gene locus_tag LOCUS_00830 gene rpmD 76427 76612 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549042.1 protein_id gnl|my_center|LOCUS_00830 76633 77073 gene locus_tag LOCUS_00840 gene rplO 76633 77073 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549043.1 protein_id gnl|my_center|LOCUS_00840 77073 78368 gene locus_tag LOCUS_00850 gene secY 77073 78368 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549044.1 protein_id gnl|my_center|LOCUS_00850 78379 79032 gene locus_tag LOCUS_00860 78379 79032 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549045.1 protein_id gnl|my_center|LOCUS_00860 79108 79329 gene locus_tag LOCUS_00870 gene infA 79108 79329 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002878178.1 protein_id gnl|my_center|LOCUS_00870 79486 79836 gene locus_tag LOCUS_00880 gene rpsM 79486 79836 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549046.1 protein_id gnl|my_center|LOCUS_00880 79865 80254 gene locus_tag LOCUS_00890 gene rpsK 79865 80254 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613292.1 protein_id gnl|my_center|LOCUS_00890 80298 81236 gene locus_tag LOCUS_00900 80298 81236 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549048.1 protein_id gnl|my_center|LOCUS_00900 81260 81643 gene locus_tag LOCUS_00910 gene rplQ 81260 81643 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549049.1 protein_id gnl|my_center|LOCUS_00910 81833 82681 gene locus_tag LOCUS_00920 81833 82681 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549050.1 protein_id gnl|my_center|LOCUS_00920 82657 83520 gene locus_tag LOCUS_00930 82657 83520 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549051.1 protein_id gnl|my_center|LOCUS_00930 83513 84310 gene locus_tag LOCUS_00940 83513 84310 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549052.1 protein_id gnl|my_center|LOCUS_00940 84310 85098 gene locus_tag LOCUS_00950 gene truA 84310 85098 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549053.1 protein_id gnl|my_center|LOCUS_00950 85204 85647 gene locus_tag LOCUS_00960 gene rplM 85204 85647 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549054.1 protein_id gnl|my_center|LOCUS_00960 85660 86055 gene locus_tag LOCUS_00970 gene rpsI 85660 86055 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549055.1 protein_id gnl|my_center|LOCUS_00970 86538 86738 gene locus_tag LOCUS_00980 86538 86738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 86728 87009 gene locus_tag LOCUS_00990 86728 87009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 87043 87186 gene locus_tag LOCUS_01000 87043 87186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 87191 88564 gene locus_tag LOCUS_01010 87191 88564 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254071.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01010 88612 88758 gene locus_tag LOCUS_01020 88612 88758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 88874 89497 gene locus_tag LOCUS_01030 88874 89497 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002935569.1 protein_id gnl|my_center|LOCUS_01030 90238 89558 gene locus_tag LOCUS_01040 90238 89558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01040 90606 90235 gene locus_tag LOCUS_01050 90606 90235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01050 90520 90729 gene locus_tag LOCUS_01060 90520 90729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 90835 91326 gene locus_tag LOCUS_01070 90835 91326 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263276.1 protein_id gnl|my_center|LOCUS_01070 91424 91497 gene locus_tag LOCUS_t00050 91424 91497 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 91616 91786 gene locus_tag LOCUS_01080 91616 91786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 92111 93292 gene locus_tag LOCUS_01090 92111 93292 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475674.1 protein_id gnl|my_center|LOCUS_01090 93279 94334 gene locus_tag LOCUS_01100 93279 94334 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475676.1 protein_id gnl|my_center|LOCUS_01100 94410 94491 gene locus_tag LOCUS_t00060 94410 94491 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 94496 94569 gene locus_tag LOCUS_t00070 94496 94569 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 94706 95038 gene locus_tag LOCUS_01110 94706 95038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01110 95095 95250 gene locus_tag LOCUS_01120 95095 95250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 95396 96508 gene locus_tag LOCUS_01130 95396 96508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546248.1 protein_id gnl|my_center|LOCUS_01130 96523 97590 gene locus_tag LOCUS_01140 96523 97590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546248.1 protein_id gnl|my_center|LOCUS_01140 97657 98358 gene locus_tag LOCUS_01150 97657 98358 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546250.1 protein_id gnl|my_center|LOCUS_01150 98521 99660 gene locus_tag LOCUS_01160 98521 99660 CDS product CDP-glycerol--glycerophosphate glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546266.1 protein_id gnl|my_center|LOCUS_01160 99664 101091 gene locus_tag LOCUS_01170 99664 101091 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254175.1 protein_id gnl|my_center|LOCUS_01170 101143 101877 gene locus_tag LOCUS_01180 101143 101877 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546254.1 protein_id gnl|my_center|LOCUS_01180 101877 102977 gene locus_tag LOCUS_01190 101877 102977 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546257.1 protein_id gnl|my_center|LOCUS_01190 102974 103675 gene locus_tag LOCUS_01200 102974 103675 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546270.1 protein_id gnl|my_center|LOCUS_01200 103780 104610 gene locus_tag LOCUS_01210 gene nadE 103780 104610 CDS product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546262.1 protein_id gnl|my_center|LOCUS_01210 104816 107482 gene locus_tag LOCUS_01220 104816 107482 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546265.1 protein_id gnl|my_center|LOCUS_01220 107696 108022 gene locus_tag LOCUS_01230 107696 108022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 108166 108429 gene locus_tag LOCUS_01240 108166 108429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 108507 108716 gene locus_tag LOCUS_01250 108507 108716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 108734 109336 gene locus_tag LOCUS_01260 108734 109336 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460105.1 protein_id gnl|my_center|LOCUS_01260 109340 109837 gene locus_tag LOCUS_01270 109340 109837 CDS product SprT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296402.1 protein_id gnl|my_center|LOCUS_01270 109868 109954 gene locus_tag LOCUS_t00080 109868 109954 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 110071 110694 gene locus_tag LOCUS_01280 110071 110694 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254627.1 protein_id gnl|my_center|LOCUS_01280 110708 111361 gene locus_tag LOCUS_01290 110708 111361 CDS product glycoside hydrolase family 73 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546273.1 protein_id gnl|my_center|LOCUS_01290 111450 113711 gene locus_tag LOCUS_01300 gene pcrA 111450 113711 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546275.1 protein_id gnl|my_center|LOCUS_01300 113722 115737 gene locus_tag LOCUS_01310 gene ligA 113722 115737 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546277.1 protein_id gnl|my_center|LOCUS_01310 115734 116879 gene locus_tag LOCUS_01320 115734 116879 CDS product CamS family sex pheromone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546280.1 protein_id gnl|my_center|LOCUS_01320 116891 117196 gene locus_tag LOCUS_01330 gene gatC 116891 117196 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546283.1 protein_id gnl|my_center|LOCUS_01330 117196 118638 gene locus_tag LOCUS_01340 gene gatA 117196 118638 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546285.1 protein_id gnl|my_center|LOCUS_01340 118644 120074 gene locus_tag LOCUS_01350 gene gatB 118644 120074 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254176.1 protein_id gnl|my_center|LOCUS_01350 120110 121036 gene locus_tag LOCUS_01360 120110 121036 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546288.1 protein_id gnl|my_center|LOCUS_01360 121097 121819 gene locus_tag LOCUS_01370 121097 121819 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701796.1 protein_id gnl|my_center|LOCUS_01370 121822 123177 gene locus_tag LOCUS_01380 gene rlmD 121822 123177 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546298.1 protein_id gnl|my_center|LOCUS_01380 123361 124218 gene locus_tag LOCUS_01390 123361 124218 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101571.1 protein_id gnl|my_center|LOCUS_01390 124472 125107 gene locus_tag LOCUS_01400 124472 125107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 125598 125281 gene locus_tag LOCUS_01410 125598 125281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 125551 125841 gene locus_tag LOCUS_01420 125551 125841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 125989 127242 gene locus_tag LOCUS_01430 125989 127242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01430 127205 127879 gene locus_tag LOCUS_01440 127205 127879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01440 127944 128171 gene locus_tag LOCUS_01450 127944 128171 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703288.1 protein_id gnl|my_center|LOCUS_01450 128243 128488 gene locus_tag LOCUS_01460 128243 128488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 128513 129163 gene locus_tag LOCUS_01470 128513 129163 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289290.1 protein_id gnl|my_center|LOCUS_01470 130558 129218 gene locus_tag LOCUS_01480 gene brnQ 130558 129218 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032833879.1 protein_id gnl|my_center|LOCUS_01480 130701 131366 gene locus_tag LOCUS_01490 130701 131366 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362928.1 protein_id gnl|my_center|LOCUS_01490 131410 131916 gene locus_tag LOCUS_01500 131410 131916 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262000.1 protein_id gnl|my_center|LOCUS_01500 132212 132721 gene locus_tag LOCUS_01510 132212 132721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 132774 133220 gene locus_tag LOCUS_01520 132774 133220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 133189 133464 gene locus_tag LOCUS_01530 133189 133464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 133541 133798 gene locus_tag LOCUS_01540 133541 133798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 134195 134551 gene locus_tag LOCUS_01550 134195 134551 CDS product DUF1304 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836732.1 protein_id gnl|my_center|LOCUS_01550 134669 135154 gene locus_tag LOCUS_01560 134669 135154 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642743.1 protein_id gnl|my_center|LOCUS_01560 135363 137174 gene locus_tag LOCUS_01570 gene glmS 135363 137174 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546133.1 protein_id gnl|my_center|LOCUS_01570 137311 137646 gene locus_tag LOCUS_01580 137311 137646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 137619 137750 gene locus_tag LOCUS_01590 137619 137750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01590 137857 138066 gene locus_tag LOCUS_01600 137857 138066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01600 138078 138317 gene locus_tag LOCUS_01610 138078 138317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01610 141265 138536 gene locus_tag LOCUS_01620 gene ppc 141265 138536 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254335.1 protein_id gnl|my_center|LOCUS_01620 142376 141432 gene locus_tag LOCUS_01630 142376 141432 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546354.1 protein_id gnl|my_center|LOCUS_01630 142557 144179 gene locus_tag LOCUS_01640 142557 144179 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546358.1 protein_id gnl|my_center|LOCUS_01640 144907 144239 gene locus_tag LOCUS_01650 144907 144239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01650 145251 144925 gene locus_tag LOCUS_01660 145251 144925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01660 145935 146144 gene locus_tag LOCUS_01670 145935 146144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 146566 146201 gene locus_tag LOCUS_01680 146566 146201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 148008 146809 gene locus_tag LOCUS_01690 148008 146809 CDS product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254190.1 protein_id gnl|my_center|LOCUS_01690 148861 148148 gene locus_tag LOCUS_01700 148861 148148 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640270.1 protein_id gnl|my_center|LOCUS_01700 149129 149914 gene locus_tag LOCUS_01710 gene murI 149129 149914 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475984.1 protein_id gnl|my_center|LOCUS_01710 149993 151414 gene locus_tag LOCUS_01720 149993 151414 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674698.1 protein_id gnl|my_center|LOCUS_01720 151428 152513 gene locus_tag LOCUS_01730 151428 152513 CDS product M42 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546357.1 protein_id gnl|my_center|LOCUS_01730 152721 153290 gene locus_tag LOCUS_01740 152721 153290 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546364.1 protein_id gnl|my_center|LOCUS_01740 153402 153533 gene locus_tag LOCUS_01750 153402 153533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 154246 153620 gene locus_tag LOCUS_01760 gene udk 154246 153620 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546365.1 protein_id gnl|my_center|LOCUS_01760 154902 154249 gene locus_tag LOCUS_01770 gene udk 154902 154249 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546365.1 protein_id gnl|my_center|LOCUS_01770 155452 156192 gene locus_tag LOCUS_01780 155452 156192 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546366.1 protein_id gnl|my_center|LOCUS_01780 156214 157053 gene locus_tag LOCUS_01790 156214 157053 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004563836.1 protein_id gnl|my_center|LOCUS_01790 157053 157694 gene locus_tag LOCUS_01800 157053 157694 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701287.1 protein_id gnl|my_center|LOCUS_01800 157706 158374 gene locus_tag LOCUS_01810 157706 158374 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546369.1 protein_id gnl|my_center|LOCUS_01810 158416 159261 gene locus_tag LOCUS_01820 158416 159261 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546367.1 protein_id gnl|my_center|LOCUS_01820 159467 160978 gene locus_tag LOCUS_01830 159467 160978 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641096.1 protein_id gnl|my_center|LOCUS_01830 160982 163147 gene locus_tag LOCUS_01840 160982 163147 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641095.1 protein_id gnl|my_center|LOCUS_01840 163176 164441 gene locus_tag LOCUS_01850 163176 164441 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641832.1 protein_id gnl|my_center|LOCUS_01850 164438 164575 gene locus_tag LOCUS_01860 164438 164575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 164579 164902 gene locus_tag LOCUS_01870 164579 164902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 165165 164959 gene locus_tag LOCUS_01880 165165 164959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 165302 165478 gene locus_tag LOCUS_01890 165302 165478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01890 165495 165740 gene locus_tag LOCUS_01900 165495 165740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547379.1 protein_id gnl|my_center|LOCUS_01900 165887 166384 gene locus_tag LOCUS_01910 165887 166384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546371.1 protein_id gnl|my_center|LOCUS_01910 166452 167372 gene locus_tag LOCUS_01920 gene rbsK 166452 167372 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254195.1 protein_id gnl|my_center|LOCUS_01920 167388 168038 gene locus_tag LOCUS_01930 gene rpe 167388 168038 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547914.1 protein_id gnl|my_center|LOCUS_01930 168051 168743 gene locus_tag LOCUS_01940 gene rpiA 168051 168743 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254196.1 protein_id gnl|my_center|LOCUS_01940 168839 169774 gene locus_tag LOCUS_01950 168839 169774 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546379.1 protein_id gnl|my_center|LOCUS_01950 169783 170505 gene locus_tag LOCUS_01960 169783 170505 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546381.1 protein_id gnl|my_center|LOCUS_01960 170709 173111 gene locus_tag LOCUS_01970 170709 173111 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254199.1 protein_id gnl|my_center|LOCUS_01970 173532 174080 gene locus_tag LOCUS_01980 173532 174080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 174135 174434 gene locus_tag LOCUS_01990 174135 174434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01990 174574 175920 gene locus_tag LOCUS_02000 174574 175920 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546431.1 protein_id gnl|my_center|LOCUS_02000 176030 176599 gene locus_tag LOCUS_02010 gene hpt 176030 176599 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254205.1 protein_id gnl|my_center|LOCUS_02010 177973 176681 gene locus_tag LOCUS_02020 177973 176681 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254206.1 protein_id gnl|my_center|LOCUS_02020 178079 178765 gene locus_tag LOCUS_02030 178079 178765 CDS product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546437.1 protein_id gnl|my_center|LOCUS_02030 178762 180006 gene locus_tag LOCUS_02040 178762 180006 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546440.1 protein_id gnl|my_center|LOCUS_02040 179999 181318 gene locus_tag LOCUS_02050 179999 181318 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546442.1 protein_id gnl|my_center|LOCUS_02050 181379 181455 gene locus_tag LOCUS_t00090 181379 181455 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 181796 182869 gene locus_tag LOCUS_02060 181796 182869 CDS product PTS transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185920.1 protein_id gnl|my_center|LOCUS_02060 183101 184384 gene locus_tag LOCUS_02070 183101 184384 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700158.1 protein_id gnl|my_center|LOCUS_02070 184497 185747 gene locus_tag LOCUS_02080 184497 185747 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548246.1 protein_id gnl|my_center|LOCUS_02080 187918 185831 gene locus_tag LOCUS_02090 187918 185831 CDS product putative ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475545.1 protein_id gnl|my_center|LOCUS_02090 188200 187958 gene locus_tag LOCUS_02100 188200 187958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 188627 188989 gene locus_tag LOCUS_02110 188627 188989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02110 188986 189372 gene locus_tag LOCUS_02120 188986 189372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02120 189351 190070 gene locus_tag LOCUS_02130 189351 190070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02130 190368 190174 gene locus_tag LOCUS_02140 190368 190174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 190470 191612 gene locus_tag LOCUS_02150 gene wecB 190470 191612 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254552.1 protein_id gnl|my_center|LOCUS_02150 192133 191654 gene locus_tag LOCUS_02160 192133 191654 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546446.1 protein_id gnl|my_center|LOCUS_02160 192572 192126 gene locus_tag LOCUS_02170 192572 192126 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546448.1 protein_id gnl|my_center|LOCUS_02170 192719 193546 gene locus_tag LOCUS_02180 gene map 192719 193546 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254208.1 protein_id gnl|my_center|LOCUS_02180 193549 194463 gene locus_tag LOCUS_02190 193549 194463 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546451.1 protein_id gnl|my_center|LOCUS_02190 194587 195501 gene locus_tag LOCUS_02200 gene galU 194587 195501 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254551.1 protein_id gnl|my_center|LOCUS_02200 195843 195562 gene locus_tag LOCUS_02210 195843 195562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 195959 196927 gene locus_tag LOCUS_02220 195959 196927 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254232.1 protein_id gnl|my_center|LOCUS_02220 198691 197309 gene locus_tag LOCUS_02230 gene rlmD 198691 197309 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546467.1 protein_id gnl|my_center|LOCUS_02230 198852 199667 gene locus_tag LOCUS_02240 gene recX 198852 199667 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546469.1 protein_id gnl|my_center|LOCUS_02240 199689 200165 gene locus_tag LOCUS_02250 199689 200165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254210.1 protein_id gnl|my_center|LOCUS_02250 200629 200162 gene locus_tag LOCUS_02260 200629 200162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 200730 201587 gene locus_tag LOCUS_02270 200730 201587 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546472.1 protein_id gnl|my_center|LOCUS_02270 201594 203165 gene locus_tag LOCUS_02280 201594 203165 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546473.1 protein_id gnl|my_center|LOCUS_02280 203455 203267 gene locus_tag LOCUS_02290 203455 203267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 203725 203477 gene locus_tag LOCUS_02300 203725 203477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 204124 203771 gene locus_tag LOCUS_02310 204124 203771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02310 204493 204125 gene locus_tag LOCUS_02320 204493 204125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02320 204662 204495 gene locus_tag LOCUS_02330 204662 204495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02330 205149 204631 gene locus_tag LOCUS_02340 205149 204631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02340 205713 205435 gene locus_tag LOCUS_02350 205713 205435 CDS product DUF1827 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546474.1 protein_id gnl|my_center|LOCUS_02350 207895 205829 gene locus_tag LOCUS_02360 207895 205829 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254211.1 protein_id gnl|my_center|LOCUS_02360 208193 208393 gene locus_tag LOCUS_02370 208193 208393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 208501 208767 gene locus_tag LOCUS_02380 208501 208767 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546482.1 protein_id gnl|my_center|LOCUS_02380 208767 210494 gene locus_tag LOCUS_02390 gene ptsP 208767 210494 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254212.1 protein_id gnl|my_center|LOCUS_02390 210673 211077 gene locus_tag LOCUS_02400 gene spxA 210673 211077 CDS product transcriptional regulator SpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254213.1 protein_id gnl|my_center|LOCUS_02400 211181 211930 gene locus_tag LOCUS_02410 211181 211930 CDS product adaptor protein MecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546487.1 protein_id gnl|my_center|LOCUS_02410 212032 212229 gene locus_tag LOCUS_02420 212032 212229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02420 212248 212892 gene locus_tag LOCUS_02430 212248 212892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02430 213549 212905 gene locus_tag LOCUS_02440 213549 212905 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546492.1 protein_id gnl|my_center|LOCUS_02440 214232 213630 gene locus_tag LOCUS_02450 214232 213630 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546493.1 protein_id gnl|my_center|LOCUS_02450 214330 214968 gene locus_tag LOCUS_02460 214330 214968 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546495.1 protein_id gnl|my_center|LOCUS_02460 214965 215762 gene locus_tag LOCUS_02470 214965 215762 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254215.1 protein_id gnl|my_center|LOCUS_02470 215777 216670 gene locus_tag LOCUS_02480 215777 216670 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546500.1 protein_id gnl|my_center|LOCUS_02480 216944 216756 gene locus_tag LOCUS_02490 216944 216756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 217843 217016 gene locus_tag LOCUS_02500 217843 217016 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645539.1 protein_id gnl|my_center|LOCUS_02500 218877 217867 gene locus_tag LOCUS_02510 218877 217867 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546505.1 protein_id gnl|my_center|LOCUS_02510 219042 219422 gene locus_tag LOCUS_02520 219042 219422 CDS product PTS glucitol/sorbitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546509.1 protein_id gnl|my_center|LOCUS_02520 219432 220568 gene locus_tag LOCUS_02530 219432 220568 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546511.1 protein_id gnl|my_center|LOCUS_02530 220614 221171 gene locus_tag LOCUS_02540 220614 221171 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546513.1 protein_id gnl|my_center|LOCUS_02540 221203 221598 gene locus_tag LOCUS_02550 221203 221598 CDS product DUF1149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546515.1 protein_id gnl|my_center|LOCUS_02550 221681 223936 gene locus_tag LOCUS_02560 221681 223936 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546517.1 protein_id gnl|my_center|LOCUS_02560 223942 225165 gene locus_tag LOCUS_02570 223942 225165 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254218.1 protein_id gnl|my_center|LOCUS_02570 225162 226415 gene locus_tag LOCUS_02580 225162 226415 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546521.1 protein_id gnl|my_center|LOCUS_02580 226412 227140 gene locus_tag LOCUS_02590 226412 227140 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546523.1 protein_id gnl|my_center|LOCUS_02590 227209 228384 gene locus_tag LOCUS_02600 227209 228384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 228411 228974 gene locus_tag LOCUS_02610 gene pgsA 228411 228974 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546529.1 protein_id gnl|my_center|LOCUS_02610 229180 230289 gene locus_tag LOCUS_02620 gene recA 229180 230289 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546531.1 protein_id gnl|my_center|LOCUS_02620 230437 232080 gene locus_tag LOCUS_02630 gene rny 230437 232080 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254219.1 protein_id gnl|my_center|LOCUS_02630 232184 233383 gene locus_tag LOCUS_02640 232184 233383 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546535.1 protein_id gnl|my_center|LOCUS_02640 234095 233436 gene locus_tag LOCUS_02650 234095 233436 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546537.1 protein_id gnl|my_center|LOCUS_02650 234139 235416 gene locus_tag LOCUS_02660 234139 235416 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546538.1 protein_id gnl|my_center|LOCUS_02660 235413 235967 gene locus_tag LOCUS_02670 235413 235967 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254220.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02670 235927 236100 gene locus_tag LOCUS_02680 235927 236100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02680 236180 236737 gene locus_tag LOCUS_02690 gene raiA 236180 236737 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254221.1 protein_id gnl|my_center|LOCUS_02690 236897 239299 gene locus_tag LOCUS_02700 gene secA 236897 239299 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254222.1 protein_id gnl|my_center|LOCUS_02700 239506 240504 gene locus_tag LOCUS_02710 gene prfB 239506 240504 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095522727.1 protein_id gnl|my_center|LOCUS_02710 240515 240817 gene locus_tag LOCUS_02720 240515 240817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 240792 241742 gene locus_tag LOCUS_02730 gene hprK 240792 241742 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546560.1 protein_id gnl|my_center|LOCUS_02730 241752 242585 gene locus_tag LOCUS_02740 gene lgt 241752 242585 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613330.1 protein_id gnl|my_center|LOCUS_02740 242591 243607 gene locus_tag LOCUS_02750 242591 243607 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546563.1 protein_id gnl|my_center|LOCUS_02750 243679 244611 gene locus_tag LOCUS_02760 gene trxB 243679 244611 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254223.1 protein_id gnl|my_center|LOCUS_02760 244732 246774 gene locus_tag LOCUS_02770 gene uvrB 244732 246774 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546586.1 protein_id gnl|my_center|LOCUS_02770 246764 249619 gene locus_tag LOCUS_02780 gene uvrA 246764 249619 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546588.1 protein_id gnl|my_center|LOCUS_02780 249716 250258 gene locus_tag LOCUS_02790 249716 250258 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546590.1 protein_id gnl|my_center|LOCUS_02790 250409 251182 gene locus_tag LOCUS_02800 250409 251182 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889182.1 protein_id gnl|my_center|LOCUS_02800 251285 251890 gene locus_tag LOCUS_02810 251285 251890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02810 252116 252256 gene locus_tag LOCUS_02820 252116 252256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 252358 253236 gene locus_tag LOCUS_02830 gene rapZ 252358 253236 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546593.1 protein_id gnl|my_center|LOCUS_02830 253246 254268 gene locus_tag LOCUS_02840 253246 254268 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546595.1 protein_id gnl|my_center|LOCUS_02840 254276 255208 gene locus_tag LOCUS_02850 gene whiA 254276 255208 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546596.1 protein_id gnl|my_center|LOCUS_02850 255860 255276 gene locus_tag LOCUS_02860 gene clpP 255860 255276 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564255.1 protein_id gnl|my_center|LOCUS_02860 256044 256304 gene locus_tag LOCUS_02870 256044 256304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 256407 257540 gene locus_tag LOCUS_02880 256407 257540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02880 257940 258146 gene locus_tag LOCUS_02890 257940 258146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02890 258249 258446 gene locus_tag LOCUS_02900 258249 258446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02900 258367 258774 gene locus_tag LOCUS_02910 258367 258774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02910 258755 258880 gene locus_tag LOCUS_02920 258755 258880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 258899 259801 gene locus_tag LOCUS_02930 258899 259801 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549276.1 protein_id gnl|my_center|LOCUS_02930 259794 260558 gene locus_tag LOCUS_02940 259794 260558 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549277.1 protein_id gnl|my_center|LOCUS_02940 260715 260644 gene locus_tag LOCUS_t00100 260715 260644 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 261013 262056 gene locus_tag LOCUS_02950 261013 262056 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546600.1 protein_id gnl|my_center|LOCUS_02950 262094 263110 gene locus_tag LOCUS_02960 gene gap 262094 263110 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546601.1 protein_id gnl|my_center|LOCUS_02960 263207 264418 gene locus_tag LOCUS_02970 263207 264418 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546602.1 protein_id gnl|my_center|LOCUS_02970 264437 265195 gene locus_tag LOCUS_02980 gene tpiA 264437 265195 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546605.1 protein_id gnl|my_center|LOCUS_02980 265730 265948 gene locus_tag LOCUS_02990 265730 265948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 265924 266223 gene locus_tag LOCUS_03000 265924 266223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03000 266749 266180 gene locus_tag LOCUS_03010 266749 266180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254226.1 protein_id gnl|my_center|LOCUS_03010 267630 266746 gene locus_tag LOCUS_03020 267630 266746 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546611.1 protein_id gnl|my_center|LOCUS_03020 267792 268475 gene locus_tag LOCUS_03030 267792 268475 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546612.1 protein_id gnl|my_center|LOCUS_03030 268496 269485 gene locus_tag LOCUS_03040 gene pta 268496 269485 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254227.1 protein_id gnl|my_center|LOCUS_03040 269496 269981 gene locus_tag LOCUS_03050 gene tsaE 269496 269981 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546616.1 protein_id gnl|my_center|LOCUS_03050 270592 270056 gene locus_tag LOCUS_03060 270592 270056 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546623.1 protein_id gnl|my_center|LOCUS_03060 270714 271607 gene locus_tag LOCUS_03070 gene murB 270714 271607 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546624.1 protein_id gnl|my_center|LOCUS_03070 271594 272736 gene locus_tag LOCUS_03080 271594 272736 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546625.1 protein_id gnl|my_center|LOCUS_03080 272739 273551 gene locus_tag LOCUS_03090 272739 273551 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546626.1 protein_id gnl|my_center|LOCUS_03090 273548 274351 gene locus_tag LOCUS_03100 273548 274351 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254228.1 protein_id gnl|my_center|LOCUS_03100 274348 275430 gene locus_tag LOCUS_03110 274348 275430 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546630.1 protein_id gnl|my_center|LOCUS_03110 275463 276302 gene locus_tag LOCUS_03120 gene cdaA 275463 276302 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254229.1 protein_id gnl|my_center|LOCUS_03120 276302 277132 gene locus_tag LOCUS_03130 276302 277132 CDS product CdaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546633.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03130 277080 277253 gene locus_tag LOCUS_03140 277080 277253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 277278 278630 gene locus_tag LOCUS_03150 gene glmM 277278 278630 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546635.1 protein_id gnl|my_center|LOCUS_03150 278779 279591 gene locus_tag LOCUS_03160 278779 279591 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546636.1 protein_id gnl|my_center|LOCUS_03160 279643 279981 gene locus_tag LOCUS_03170 279643 279981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03170 280150 280767 gene locus_tag LOCUS_03180 280150 280767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03180 280691 281134 gene locus_tag LOCUS_03190 280691 281134 CDS product CopY/TcrY family copper transport repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549441.1 protein_id gnl|my_center|LOCUS_03190 281128 281502 gene locus_tag LOCUS_03200 281128 281502 CDS product cupredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549440.1 protein_id gnl|my_center|LOCUS_03200 281502 283418 gene locus_tag LOCUS_03210 281502 283418 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549436.1 protein_id gnl|my_center|LOCUS_03210 283570 283956 gene locus_tag LOCUS_03220 283570 283956 CDS product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254309.1 protein_id gnl|my_center|LOCUS_03220 283961 284320 gene locus_tag LOCUS_03230 gene crcB 283961 284320 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547161.1 protein_id gnl|my_center|LOCUS_03230 284304 285074 gene locus_tag LOCUS_03240 284304 285074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 285394 286197 gene locus_tag LOCUS_03250 285394 286197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 286278 287219 gene locus_tag LOCUS_03260 286278 287219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 287220 287381 gene locus_tag LOCUS_03270 287220 287381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 287421 288836 gene locus_tag LOCUS_03280 287421 288836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 288886 289284 gene locus_tag LOCUS_03290 288886 289284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 289287 289697 gene locus_tag LOCUS_03300 289287 289697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 289830 290240 gene locus_tag LOCUS_03310 289830 290240 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_03310 290337 290735 gene locus_tag LOCUS_03320 290337 290735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 292454 290823 gene locus_tag LOCUS_03330 292454 290823 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546656.1 protein_id gnl|my_center|LOCUS_03330 292714 293241 gene locus_tag LOCUS_03340 gene msrA 292714 293241 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547717.1 protein_id gnl|my_center|LOCUS_03340 293257 294105 gene locus_tag LOCUS_03350 293257 294105 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546408.1 protein_id gnl|my_center|LOCUS_03350 295072 294191 gene locus_tag LOCUS_03360 295072 294191 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254571.1 protein_id gnl|my_center|LOCUS_03360 295181 295708 gene locus_tag LOCUS_03370 295181 295708 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254234.1 protein_id gnl|my_center|LOCUS_03370 295785 296516 gene locus_tag LOCUS_03380 295785 296516 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546668.1 protein_id gnl|my_center|LOCUS_03380 296675 297646 gene locus_tag LOCUS_03390 gene comGA 296675 297646 CDS product competence type IV pilus ATPase ComGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546670.1 protein_id gnl|my_center|LOCUS_03390 297618 297785 gene locus_tag LOCUS_03400 297618 297785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 297790 298617 gene locus_tag LOCUS_03410 297790 298617 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721297.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03410 298639 298962 gene locus_tag LOCUS_03420 gene comGC 298639 298962 CDS product competence type IV pilus major pilin ComGC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546673.1 protein_id gnl|my_center|LOCUS_03420 298959 299396 gene locus_tag LOCUS_03430 298959 299396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 299410 299652 gene locus_tag LOCUS_03440 299410 299652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 299618 300238 gene locus_tag LOCUS_03450 299618 300238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 300380 301378 gene locus_tag LOCUS_03460 300380 301378 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546680.1 protein_id gnl|my_center|LOCUS_03460 301414 302601 gene locus_tag LOCUS_03470 301414 302601 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546683.1 protein_id gnl|my_center|LOCUS_03470 302668 303026 gene locus_tag LOCUS_tm00010 302668 303026 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 303324 303479 gene locus_tag LOCUS_03480 303324 303479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 303659 304384 gene locus_tag LOCUS_03490 303659 304384 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254236.1 protein_id gnl|my_center|LOCUS_03490 304381 305946 gene locus_tag LOCUS_03500 304381 305946 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546698.1 protein_id gnl|my_center|LOCUS_03500 308215 305993 gene locus_tag LOCUS_03510 308215 305993 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546703.1 protein_id gnl|my_center|LOCUS_03510 308349 308990 gene locus_tag LOCUS_03520 308349 308990 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254238.1 protein_id gnl|my_center|LOCUS_03520 309067 310407 gene locus_tag LOCUS_03530 309067 310407 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546706.1 protein_id gnl|my_center|LOCUS_03530 310582 311073 gene locus_tag LOCUS_03540 310582 311073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03540 311082 312065 gene locus_tag LOCUS_03550 311082 312065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03550 312195 312123 gene locus_tag LOCUS_t00110 312195 312123 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 312273 312200 gene locus_tag LOCUS_t00120 312273 312200 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 312442 313446 gene locus_tag LOCUS_03560 312442 313446 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546711.1 protein_id gnl|my_center|LOCUS_03560 313469 313720 gene locus_tag LOCUS_03570 313469 313720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 315137 313782 gene locus_tag LOCUS_03580 315137 313782 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546733.1 protein_id gnl|my_center|LOCUS_03580 315278 315880 gene locus_tag LOCUS_03590 315278 315880 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613340.1 protein_id gnl|my_center|LOCUS_03590 315904 316989 gene locus_tag LOCUS_03600 gene prfA 315904 316989 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546735.1 protein_id gnl|my_center|LOCUS_03600 316982 317824 gene locus_tag LOCUS_03610 gene prmC 316982 317824 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546736.1 protein_id gnl|my_center|LOCUS_03610 317824 318819 gene locus_tag LOCUS_03620 317824 318819 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546737.1 protein_id gnl|my_center|LOCUS_03620 318919 319548 gene locus_tag LOCUS_03630 gene upp 318919 319548 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546738.1 protein_id gnl|my_center|LOCUS_03630 319658 320377 gene locus_tag LOCUS_03640 gene atpB 319658 320377 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546739.1 protein_id gnl|my_center|LOCUS_03640 320396 320620 gene locus_tag LOCUS_03650 gene atpE 320396 320620 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029779745.1 protein_id gnl|my_center|LOCUS_03650 320674 321180 gene locus_tag LOCUS_03660 gene atpF 320674 321180 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546741.1 protein_id gnl|my_center|LOCUS_03660 321180 321722 gene locus_tag LOCUS_03670 321180 321722 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546742.1 protein_id gnl|my_center|LOCUS_03670 321745 323256 gene locus_tag LOCUS_03680 gene atpA 321745 323256 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254246.1 protein_id gnl|my_center|LOCUS_03680 323267 324229 gene locus_tag LOCUS_03690 323267 324229 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546744.1 protein_id gnl|my_center|LOCUS_03690 324249 325688 gene locus_tag LOCUS_03700 gene atpD 324249 325688 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254247.1 protein_id gnl|my_center|LOCUS_03700 325700 326140 gene locus_tag LOCUS_03710 325700 326140 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546746.1 protein_id gnl|my_center|LOCUS_03710 326189 326419 gene locus_tag LOCUS_03720 326189 326419 CDS product DUF1146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356560.1 protein_id gnl|my_center|LOCUS_03720 326505 327494 gene locus_tag LOCUS_03730 326505 327494 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546749.1 protein_id gnl|my_center|LOCUS_03730 327509 327784 gene locus_tag LOCUS_03740 327509 327784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 327797 328024 gene locus_tag LOCUS_03750 327797 328024 CDS product DUF2969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546751.1 protein_id gnl|my_center|LOCUS_03750 328049 329239 gene locus_tag LOCUS_03760 328049 329239 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546752.1 protein_id gnl|my_center|LOCUS_03760 329772 329311 gene locus_tag LOCUS_03770 329772 329311 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546753.1 protein_id gnl|my_center|LOCUS_03770 330114 329830 gene locus_tag LOCUS_03780 330114 329830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 330043 330216 gene locus_tag LOCUS_03790 330043 330216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 331769 330465 gene locus_tag LOCUS_03800 331769 330465 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546755.1 protein_id gnl|my_center|LOCUS_03800 332230 331766 gene locus_tag LOCUS_03810 332230 331766 CDS product YueI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254248.1 protein_id gnl|my_center|LOCUS_03810 332912 332355 gene locus_tag LOCUS_03820 gene rpsD 332912 332355 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254249.1 protein_id gnl|my_center|LOCUS_03820 333262 334980 gene locus_tag LOCUS_03830 gene ezrA 333262 334980 CDS product septation ring formation regulator EzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546759.1 protein_id gnl|my_center|LOCUS_03830 335066 336223 gene locus_tag LOCUS_03840 335066 336223 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546760.1 protein_id gnl|my_center|LOCUS_03840 336226 337443 gene locus_tag LOCUS_03850 gene thiI 336226 337443 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546762.1 protein_id gnl|my_center|LOCUS_03850 337443 338168 gene locus_tag LOCUS_03860 337443 338168 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546764.1 protein_id gnl|my_center|LOCUS_03860 338429 341068 gene locus_tag LOCUS_03870 338429 341068 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254252.1 protein_id gnl|my_center|LOCUS_03870 341073 342338 gene locus_tag LOCUS_03880 341073 342338 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254253.1 protein_id gnl|my_center|LOCUS_03880 342356 343036 gene locus_tag LOCUS_03890 342356 343036 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546772.1 protein_id gnl|my_center|LOCUS_03890 343079 343699 gene locus_tag LOCUS_03900 gene radC 343079 343699 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546774.1 protein_id gnl|my_center|LOCUS_03900 343790 344794 gene locus_tag LOCUS_03910 343790 344794 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546776.1 protein_id gnl|my_center|LOCUS_03910 344872 345696 gene locus_tag LOCUS_03920 gene mreC 344872 345696 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546779.1 protein_id gnl|my_center|LOCUS_03920 345696 346235 gene locus_tag LOCUS_03930 gene mreD 345696 346235 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546782.1 protein_id gnl|my_center|LOCUS_03930 346532 346861 gene locus_tag LOCUS_03940 346532 346861 CDS product DUF3397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254254.1 protein_id gnl|my_center|LOCUS_03940 346994 347425 gene locus_tag LOCUS_03950 gene mraZ 346994 347425 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355890.1 protein_id gnl|my_center|LOCUS_03950 347428 348372 gene locus_tag LOCUS_03960 gene rsmH 347428 348372 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546789.1 protein_id gnl|my_center|LOCUS_03960 348384 348740 gene locus_tag LOCUS_03970 gene ftsL 348384 348740 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254255.1 protein_id gnl|my_center|LOCUS_03970 348740 350902 gene locus_tag LOCUS_03980 348740 350902 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546793.1 protein_id gnl|my_center|LOCUS_03980 350910 351869 gene locus_tag LOCUS_03990 gene mraY 350910 351869 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546795.1 protein_id gnl|my_center|LOCUS_03990 351876 353258 gene locus_tag LOCUS_04000 gene murD 351876 353258 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546797.1 protein_id gnl|my_center|LOCUS_04000 353260 354372 gene locus_tag LOCUS_04010 gene murG 353260 354372 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254256.1 protein_id gnl|my_center|LOCUS_04010 354396 355241 gene locus_tag LOCUS_04020 354396 355241 CDS product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546801.1 protein_id gnl|my_center|LOCUS_04020 355300 356682 gene locus_tag LOCUS_04030 gene ftsA 355300 356682 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254257.1 protein_id gnl|my_center|LOCUS_04030 356698 358056 gene locus_tag LOCUS_04040 gene ftsZ 356698 358056 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546805.1 protein_id gnl|my_center|LOCUS_04040 358071 358487 gene locus_tag LOCUS_04050 gene sepF 358071 358487 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254258.1 protein_id gnl|my_center|LOCUS_04050 358517 358819 gene locus_tag LOCUS_04060 358517 358819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 358816 359616 gene locus_tag LOCUS_04070 358816 359616 CDS product YlmH/Sll1252 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546811.1 protein_id gnl|my_center|LOCUS_04070 359966 362761 gene locus_tag LOCUS_04080 gene ileS 359966 362761 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254260.1 protein_id gnl|my_center|LOCUS_04080 362761 362970 gene locus_tag LOCUS_04090 362761 362970 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546816.1 protein_id gnl|my_center|LOCUS_04090 362986 363543 gene locus_tag LOCUS_04100 362986 363543 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254261.1 protein_id gnl|my_center|LOCUS_04100 363547 363753 gene locus_tag LOCUS_04110 363547 363753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 363773 364471 gene locus_tag LOCUS_04120 363773 364471 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254262.1 protein_id gnl|my_center|LOCUS_04120 364471 365634 gene locus_tag LOCUS_04130 364471 365634 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101678.1 protein_id gnl|my_center|LOCUS_04130 365689 366030 gene locus_tag LOCUS_04140 365689 366030 CDS product DUF1831 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546822.1 protein_id gnl|my_center|LOCUS_04140 366035 367162 gene locus_tag LOCUS_04150 gene mnmA 366035 367162 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546824.1 protein_id gnl|my_center|LOCUS_04150 367262 367921 gene locus_tag LOCUS_04160 367262 367921 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546826.1 protein_id gnl|my_center|LOCUS_04160 367921 368574 gene locus_tag LOCUS_04170 367921 368574 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546828.1 protein_id gnl|my_center|LOCUS_04170 368588 370978 gene locus_tag LOCUS_04180 368588 370978 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546830.1 protein_id gnl|my_center|LOCUS_04180 371144 372493 gene locus_tag LOCUS_04190 371144 372493 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254382.1 protein_id gnl|my_center|LOCUS_04190 374212 372533 gene locus_tag LOCUS_04200 374212 372533 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546834.1 protein_id gnl|my_center|LOCUS_04200 374435 374202 gene locus_tag LOCUS_04210 374435 374202 CDS product DNA-dependent RNA polymerase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546835.1 protein_id gnl|my_center|LOCUS_04210 375168 374614 gene locus_tag LOCUS_04220 gene def 375168 374614 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546838.1 protein_id gnl|my_center|LOCUS_04220 375414 377261 gene locus_tag LOCUS_04230 gene typA 375414 377261 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254264.1 protein_id gnl|my_center|LOCUS_04230 377360 378562 gene locus_tag LOCUS_04240 377360 378562 CDS product putative peptidoglycan glycosyltransferase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254265.1 protein_id gnl|my_center|LOCUS_04240 378552 378893 gene locus_tag LOCUS_04250 378552 378893 CDS product YlbG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546844.1 protein_id gnl|my_center|LOCUS_04250 378890 379441 gene locus_tag LOCUS_04260 gene rsmD 378890 379441 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546846.1 protein_id gnl|my_center|LOCUS_04260 379442 379936 gene locus_tag LOCUS_04270 gene coaD 379442 379936 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546847.1 protein_id gnl|my_center|LOCUS_04270 379926 380966 gene locus_tag LOCUS_04280 379926 380966 CDS product SepM family pheromone-processing serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546849.1 protein_id gnl|my_center|LOCUS_04280 381102 381848 gene locus_tag LOCUS_04290 381102 381848 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546852.1 protein_id gnl|my_center|LOCUS_04290 381874 384060 gene locus_tag LOCUS_04300 381874 384060 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546854.1 protein_id gnl|my_center|LOCUS_04300 384091 385080 gene locus_tag LOCUS_04310 gene holA 384091 385080 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546856.1 protein_id gnl|my_center|LOCUS_04310 385424 385173 gene locus_tag LOCUS_04320 gene rpsT 385424 385173 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546858.1 protein_id gnl|my_center|LOCUS_04320 385628 385897 gene locus_tag LOCUS_04330 gene rpsO 385628 385897 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546859.1 protein_id gnl|my_center|LOCUS_04330 386099 387943 gene locus_tag LOCUS_04340 386099 387943 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546860.1 protein_id gnl|my_center|LOCUS_04340 387930 388757 gene locus_tag LOCUS_04350 387930 388757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254267.1 protein_id gnl|my_center|LOCUS_04350 388946 390136 gene locus_tag LOCUS_04360 gene tuf 388946 390136 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546862.1 protein_id gnl|my_center|LOCUS_04360 390320 391639 gene locus_tag LOCUS_04370 gene tig 390320 391639 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546863.1 protein_id gnl|my_center|LOCUS_04370 391791 393044 gene locus_tag LOCUS_04380 gene clpX 391791 393044 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546864.1 protein_id gnl|my_center|LOCUS_04380 393034 393636 gene locus_tag LOCUS_04390 gene yihA 393034 393636 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546867.1 protein_id gnl|my_center|LOCUS_04390 394002 393685 gene locus_tag LOCUS_04400 394002 393685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04400 395279 394017 gene locus_tag LOCUS_04410 395279 394017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04410 395553 395413 gene locus_tag LOCUS_04420 395553 395413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 395691 396353 gene locus_tag LOCUS_04430 395691 396353 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100859.1 protein_id gnl|my_center|LOCUS_04430 >Feature sequence02 301 116 gene locus_tag LOCUS_04440 gene rpmB 301 116 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547911.1 protein_id gnl|my_center|LOCUS_04440 477 839 gene locus_tag LOCUS_04450 477 839 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547910.1 protein_id gnl|my_center|LOCUS_04450 859 2523 gene locus_tag LOCUS_04460 859 2523 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547907.1 protein_id gnl|my_center|LOCUS_04460 2523 4562 gene locus_tag LOCUS_04470 gene recG 2523 4562 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254414.1 protein_id gnl|my_center|LOCUS_04470 4593 5585 gene locus_tag LOCUS_04480 gene plsX 4593 5585 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547901.1 protein_id gnl|my_center|LOCUS_04480 5647 5889 gene locus_tag LOCUS_04490 gene acpP 5647 5889 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547899.1 protein_id gnl|my_center|LOCUS_04490 6180 7181 gene locus_tag LOCUS_04500 6180 7181 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547898.1 protein_id gnl|my_center|LOCUS_04500 7191 8147 gene locus_tag LOCUS_04510 7191 8147 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547895.1 protein_id gnl|my_center|LOCUS_04510 8151 9110 gene locus_tag LOCUS_04520 8151 9110 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547894.1 protein_id gnl|my_center|LOCUS_04520 9137 10033 gene locus_tag LOCUS_04530 9137 10033 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547893.1 protein_id gnl|my_center|LOCUS_04530 10193 11959 gene locus_tag LOCUS_04540 10193 11959 CDS product oligopeptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254413.1 protein_id gnl|my_center|LOCUS_04540 12093 13874 gene locus_tag LOCUS_04550 12093 13874 CDS product oligopeptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547891.1 protein_id gnl|my_center|LOCUS_04550 13999 14694 gene locus_tag LOCUS_04560 gene rnc 13999 14694 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547887.1 protein_id gnl|my_center|LOCUS_04560 14694 18254 gene locus_tag LOCUS_04570 gene smc 14694 18254 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254411.1 protein_id gnl|my_center|LOCUS_04570 18257 19585 gene locus_tag LOCUS_04580 18257 19585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 19811 19972 gene locus_tag LOCUS_04590 19811 19972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04590 19999 20472 gene locus_tag LOCUS_04600 19999 20472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04600 20644 21051 gene locus_tag LOCUS_04610 20644 21051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04610 21104 21445 gene locus_tag LOCUS_04620 21104 21445 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547875.1 protein_id gnl|my_center|LOCUS_04620 21447 22877 gene locus_tag LOCUS_04630 gene ffh 21447 22877 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547873.1 protein_id gnl|my_center|LOCUS_04630 22972 23244 gene locus_tag LOCUS_04640 gene rpsP 22972 23244 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547870.1 protein_id gnl|my_center|LOCUS_04640 23306 23809 gene locus_tag LOCUS_04650 gene rimM 23306 23809 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254408.1 protein_id gnl|my_center|LOCUS_04650 23809 24546 gene locus_tag LOCUS_04660 gene trmD 23809 24546 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254407.1 protein_id gnl|my_center|LOCUS_04660 24561 25037 gene locus_tag LOCUS_04670 24561 25037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 25043 25501 gene locus_tag LOCUS_04680 25043 25501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 25590 26672 gene locus_tag LOCUS_04690 25590 26672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04690 26624 27316 gene locus_tag LOCUS_04700 26624 27316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04700 27438 27785 gene locus_tag LOCUS_04710 gene rplS 27438 27785 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003629071.1 protein_id gnl|my_center|LOCUS_04710 28051 29892 gene locus_tag LOCUS_04720 28051 29892 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922164.1 protein_id gnl|my_center|LOCUS_04720 30025 31923 gene locus_tag LOCUS_04730 30025 31923 CDS product TerB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546145.1 protein_id gnl|my_center|LOCUS_04730 31923 33245 gene locus_tag LOCUS_04740 31923 33245 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546148.1 protein_id gnl|my_center|LOCUS_04740 33268 35502 gene locus_tag LOCUS_04750 33268 35502 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546149.1 protein_id gnl|my_center|LOCUS_04750 35559 36092 gene locus_tag LOCUS_04760 35559 36092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 36288 37166 gene locus_tag LOCUS_04770 36288 37166 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004563836.1 protein_id gnl|my_center|LOCUS_04770 38115 37267 gene locus_tag LOCUS_04780 38115 37267 CDS product GRP family sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254341.1 protein_id gnl|my_center|LOCUS_04780 38935 38315 gene locus_tag LOCUS_04790 gene lexA 38935 38315 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254404.1 protein_id gnl|my_center|LOCUS_04790 39090 39326 gene locus_tag LOCUS_04800 39090 39326 CDS product DUF896 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547851.1 protein_id gnl|my_center|LOCUS_04800 39439 39663 gene locus_tag LOCUS_04810 39439 39663 CDS product YneF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547849.1 protein_id gnl|my_center|LOCUS_04810 39773 41533 gene locus_tag LOCUS_04820 39773 41533 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254403.1 protein_id gnl|my_center|LOCUS_04820 41520 43316 gene locus_tag LOCUS_04830 41520 43316 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613381.1 protein_id gnl|my_center|LOCUS_04830 43799 43365 gene locus_tag LOCUS_04840 43799 43365 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964547.1 protein_id gnl|my_center|LOCUS_04840 43940 45088 gene locus_tag LOCUS_04850 43940 45088 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674788.1 protein_id gnl|my_center|LOCUS_04850 45081 46421 gene locus_tag LOCUS_04860 45081 46421 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963601.1 protein_id gnl|my_center|LOCUS_04860 46422 47408 gene locus_tag LOCUS_04870 46422 47408 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524132.1 protein_id gnl|my_center|LOCUS_04870 48104 47490 gene locus_tag LOCUS_04880 48104 47490 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547840.1 protein_id gnl|my_center|LOCUS_04880 48175 49185 gene locus_tag LOCUS_04890 48175 49185 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547839.1 protein_id gnl|my_center|LOCUS_04890 49349 50110 gene locus_tag LOCUS_04900 gene rpsB 49349 50110 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547837.1 protein_id gnl|my_center|LOCUS_04900 50173 51201 gene locus_tag LOCUS_04910 gene tsf 50173 51201 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808080.1 protein_id gnl|my_center|LOCUS_04910 51351 52076 gene locus_tag LOCUS_04920 gene pyrH 51351 52076 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254400.1 protein_id gnl|my_center|LOCUS_04920 52076 52633 gene locus_tag LOCUS_04930 gene frr 52076 52633 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095341972.1 protein_id gnl|my_center|LOCUS_04930 52636 53367 gene locus_tag LOCUS_04940 52636 53367 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547825.1 protein_id gnl|my_center|LOCUS_04940 53373 54170 gene locus_tag LOCUS_04950 53373 54170 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547823.1 protein_id gnl|my_center|LOCUS_04950 54180 55427 gene locus_tag LOCUS_04960 gene rseP 54180 55427 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547820.1 protein_id gnl|my_center|LOCUS_04960 55467 57164 gene locus_tag LOCUS_04970 55467 57164 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547819.1 protein_id gnl|my_center|LOCUS_04970 57279 61514 gene locus_tag LOCUS_04980 57279 61514 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547817.1 protein_id gnl|my_center|LOCUS_04980 61624 62100 gene locus_tag LOCUS_04990 gene rimP 61624 62100 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254398.1 protein_id gnl|my_center|LOCUS_04990 62120 63340 gene locus_tag LOCUS_05000 gene nusA 62120 63340 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254397.1 protein_id gnl|my_center|LOCUS_05000 63371 63649 gene locus_tag LOCUS_05010 63371 63649 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547812.1 protein_id gnl|my_center|LOCUS_05010 63676 63960 gene locus_tag LOCUS_05020 63676 63960 CDS product ribosomal L7Ae/L30e/S12e/Gadd45 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547810.1 protein_id gnl|my_center|LOCUS_05020 63965 66442 gene locus_tag LOCUS_05030 gene infB 63965 66442 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254396.1 protein_id gnl|my_center|LOCUS_05030 66455 66817 gene locus_tag LOCUS_05040 66455 66817 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547807.1 protein_id gnl|my_center|LOCUS_05040 66868 67764 gene locus_tag LOCUS_05050 gene truB 66868 67764 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547805.1 protein_id gnl|my_center|LOCUS_05050 69054 68647 gene locus_tag LOCUS_05060 69054 68647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 69565 69302 gene locus_tag LOCUS_05070 69565 69302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 70038 69706 gene locus_tag LOCUS_05080 70038 69706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 71188 70004 gene locus_tag LOCUS_05090 71188 70004 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100941.1 protein_id gnl|my_center|LOCUS_05090 72121 71210 gene locus_tag LOCUS_05100 72121 71210 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_056996568.1 protein_id gnl|my_center|LOCUS_05100 72922 73095 gene locus_tag LOCUS_05110 72922 73095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 73123 73332 gene locus_tag LOCUS_05120 73123 73332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 >Feature sequence03 95 1897 gene locus_tag LOCUS_05130 gene pepF 95 1897 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549813.1 protein_id gnl|my_center|LOCUS_05130 2573 2001 gene locus_tag LOCUS_05140 2573 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 3420 2866 gene locus_tag LOCUS_05150 3420 2866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 4354 3557 gene locus_tag LOCUS_05160 4354 3557 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613417.1 protein_id gnl|my_center|LOCUS_05160 5007 4354 gene locus_tag LOCUS_05170 5007 4354 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254570.1 protein_id gnl|my_center|LOCUS_05170 5833 5033 gene locus_tag LOCUS_05180 5833 5033 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367542.1 protein_id gnl|my_center|LOCUS_05180 8069 6099 gene locus_tag LOCUS_05190 8069 6099 CDS product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549797.1 protein_id gnl|my_center|LOCUS_05190 9032 8118 gene locus_tag LOCUS_05200 gene pfkB 9032 8118 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549796.1 protein_id gnl|my_center|LOCUS_05200 9781 9032 gene locus_tag LOCUS_05210 9781 9032 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549794.1 protein_id gnl|my_center|LOCUS_05210 10692 9943 gene locus_tag LOCUS_05220 10692 9943 CDS product amino acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549723.1 protein_id gnl|my_center|LOCUS_05220 12256 10706 gene locus_tag LOCUS_05230 12256 10706 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254584.1 protein_id gnl|my_center|LOCUS_05230 13501 12293 gene locus_tag LOCUS_05240 13501 12293 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549721.1 protein_id gnl|my_center|LOCUS_05240 14177 13491 gene locus_tag LOCUS_05250 14177 13491 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549720.1 protein_id gnl|my_center|LOCUS_05250 16150 14306 gene locus_tag LOCUS_05260 16150 14306 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721608.1 protein_id gnl|my_center|LOCUS_05260 17837 16161 gene locus_tag LOCUS_05270 17837 16161 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254586.1 protein_id gnl|my_center|LOCUS_05270 18794 18024 gene locus_tag LOCUS_05280 18794 18024 CDS product DUF1129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549711.1 protein_id gnl|my_center|LOCUS_05280 19909 18809 gene locus_tag LOCUS_05290 gene ychF 19909 18809 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549709.1 protein_id gnl|my_center|LOCUS_05290 20249 19986 gene locus_tag LOCUS_05300 20249 19986 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549703.1 protein_id gnl|my_center|LOCUS_05300 21132 20242 gene locus_tag LOCUS_05310 21132 20242 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549701.1 protein_id gnl|my_center|LOCUS_05310 21889 21110 gene locus_tag LOCUS_05320 21889 21110 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254587.1 protein_id gnl|my_center|LOCUS_05320 22715 21891 gene locus_tag LOCUS_05330 gene noc 22715 21891 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254588.1 protein_id gnl|my_center|LOCUS_05330 23453 22734 gene locus_tag LOCUS_05340 gene rsmG 23453 22734 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549696.1 protein_id gnl|my_center|LOCUS_05340 23617 24141 gene locus_tag LOCUS_05350 23617 24141 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549693.1 protein_id gnl|my_center|LOCUS_05350 25146 24187 gene locus_tag LOCUS_05360 25146 24187 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549691.1 protein_id gnl|my_center|LOCUS_05360 25940 25158 gene locus_tag LOCUS_05370 25940 25158 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549690.1 protein_id gnl|my_center|LOCUS_05370 26641 26093 gene locus_tag LOCUS_05380 26641 26093 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549689.1 protein_id gnl|my_center|LOCUS_05380 27197 26658 gene locus_tag LOCUS_05390 27197 26658 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549688.1 protein_id gnl|my_center|LOCUS_05390 27870 27325 gene locus_tag LOCUS_05400 27870 27325 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549687.1 protein_id gnl|my_center|LOCUS_05400 28148 29548 gene locus_tag LOCUS_05410 28148 29548 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549685.1 protein_id gnl|my_center|LOCUS_05410 29725 29949 gene locus_tag LOCUS_05420 29725 29949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 30504 30007 gene locus_tag LOCUS_05430 30504 30007 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546424.1 protein_id gnl|my_center|LOCUS_05430 30909 30619 gene locus_tag LOCUS_05440 30909 30619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 31692 31300 gene locus_tag LOCUS_05450 31692 31300 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102185.1 protein_id gnl|my_center|LOCUS_05450 31784 32710 gene locus_tag LOCUS_05460 31784 32710 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100868.1 protein_id gnl|my_center|LOCUS_05460 33698 33024 gene locus_tag LOCUS_05470 33698 33024 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254590.1 protein_id gnl|my_center|LOCUS_05470 34758 33700 gene locus_tag LOCUS_05480 34758 33700 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254591.1 protein_id gnl|my_center|LOCUS_05480 35304 34801 gene locus_tag LOCUS_05490 35304 34801 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003583259.1 protein_id gnl|my_center|LOCUS_05490 36562 35621 gene locus_tag LOCUS_05500 36562 35621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05500 36810 36559 gene locus_tag LOCUS_05510 36810 36559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 37724 36987 gene locus_tag LOCUS_05520 gene yaaA 37724 36987 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254594.1 protein_id gnl|my_center|LOCUS_05520 37789 38424 gene locus_tag LOCUS_05530 37789 38424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549674.1 protein_id gnl|my_center|LOCUS_05530 38518 39708 gene locus_tag LOCUS_05540 38518 39708 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549671.1 protein_id gnl|my_center|LOCUS_05540 39931 39779 gene locus_tag LOCUS_05550 39931 39779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 39950 40084 gene locus_tag LOCUS_05560 39950 40084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 40088 40285 gene locus_tag LOCUS_05570 40088 40285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05570 42887 40356 gene locus_tag LOCUS_05580 42887 40356 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549665.1 protein_id gnl|my_center|LOCUS_05580 43296 44102 gene locus_tag LOCUS_05590 43296 44102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 44273 45220 gene locus_tag LOCUS_05600 44273 45220 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547030.1 protein_id gnl|my_center|LOCUS_05600 45480 46832 gene locus_tag LOCUS_05610 45480 46832 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100925.1 protein_id gnl|my_center|LOCUS_05610 46875 47030 gene locus_tag LOCUS_05620 46875 47030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 48625 47207 gene locus_tag LOCUS_05630 48625 47207 CDS product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641299.1 protein_id gnl|my_center|LOCUS_05630 50053 48650 gene locus_tag LOCUS_05640 50053 48650 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546995.1 protein_id gnl|my_center|LOCUS_05640 50737 50498 gene locus_tag LOCUS_05650 50737 50498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 51495 52403 gene locus_tag LOCUS_05660 51495 52403 CDS product cytochrome C5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549662.1 protein_id gnl|my_center|LOCUS_05660 52707 52468 gene locus_tag LOCUS_05670 52707 52468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 53304 52804 gene locus_tag LOCUS_05680 53304 52804 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549649.1 protein_id gnl|my_center|LOCUS_05680 54086 53304 gene locus_tag LOCUS_05690 54086 53304 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549621.1 protein_id gnl|my_center|LOCUS_05690 55778 54198 gene locus_tag LOCUS_05700 55778 54198 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547992.1 protein_id gnl|my_center|LOCUS_05700 57960 55765 gene locus_tag LOCUS_05710 57960 55765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 59043 58285 gene locus_tag LOCUS_05720 59043 58285 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549621.1 protein_id gnl|my_center|LOCUS_05720 59838 59077 gene locus_tag LOCUS_05730 59838 59077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 60164 59769 gene locus_tag LOCUS_05740 60164 59769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05740 60426 60151 gene locus_tag LOCUS_05750 60426 60151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05750 60624 61292 gene locus_tag LOCUS_05760 60624 61292 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573114.1 protein_id gnl|my_center|LOCUS_05760 61486 61722 gene locus_tag LOCUS_05770 61486 61722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703180.1 protein_id gnl|my_center|LOCUS_05770 61846 63210 gene locus_tag LOCUS_05780 61846 63210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05780 63229 63936 gene locus_tag LOCUS_05790 63229 63936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05790 64327 64154 gene locus_tag LOCUS_05800 64327 64154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 64277 64864 gene locus_tag LOCUS_05810 64277 64864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 65569 64961 gene locus_tag LOCUS_05820 65569 64961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 65498 65686 gene locus_tag LOCUS_05830 65498 65686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 >Feature sequence04 244 44 gene locus_tag LOCUS_05840 244 44 CDS product YjzD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254299.1 protein_id gnl|my_center|LOCUS_05840 379 3858 gene locus_tag LOCUS_05850 379 3858 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547069.1 protein_id gnl|my_center|LOCUS_05850 4066 5025 gene locus_tag LOCUS_05860 gene pfkA 4066 5025 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547070.1 protein_id gnl|my_center|LOCUS_05860 5065 6834 gene locus_tag LOCUS_05870 gene pyk 5065 6834 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547072.1 protein_id gnl|my_center|LOCUS_05870 7464 7120 gene locus_tag LOCUS_05880 7464 7120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 7692 7507 gene locus_tag LOCUS_05890 7692 7507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 8200 7649 gene locus_tag LOCUS_05900 8200 7649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05900 8390 9268 gene locus_tag LOCUS_05910 8390 9268 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254300.1 protein_id gnl|my_center|LOCUS_05910 9261 10157 gene locus_tag LOCUS_05920 gene xerD 9261 10157 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547075.1 protein_id gnl|my_center|LOCUS_05920 10168 10521 gene locus_tag LOCUS_05930 10168 10521 CDS product reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254301.1 protein_id gnl|my_center|LOCUS_05930 10511 11245 gene locus_tag LOCUS_05940 10511 11245 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547078.1 protein_id gnl|my_center|LOCUS_05940 11235 11837 gene locus_tag LOCUS_05950 gene scpB 11235 11837 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547080.1 protein_id gnl|my_center|LOCUS_05950 11837 12556 gene locus_tag LOCUS_05960 11837 12556 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547082.1 protein_id gnl|my_center|LOCUS_05960 12781 13485 gene locus_tag LOCUS_05970 12781 13485 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547084.1 protein_id gnl|my_center|LOCUS_05970 13595 13990 gene locus_tag LOCUS_05980 13595 13990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 14089 14721 gene locus_tag LOCUS_05990 gene cmk 14089 14721 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254302.1 protein_id gnl|my_center|LOCUS_05990 14809 16014 gene locus_tag LOCUS_06000 gene rpsA 14809 16014 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547091.1 protein_id gnl|my_center|LOCUS_06000 16091 17398 gene locus_tag LOCUS_06010 gene der 16091 17398 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254303.1 protein_id gnl|my_center|LOCUS_06010 17602 17877 gene locus_tag LOCUS_06020 17602 17877 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547110.1 protein_id gnl|my_center|LOCUS_06020 17993 19246 gene locus_tag LOCUS_06030 17993 19246 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547113.1 protein_id gnl|my_center|LOCUS_06030 19368 22229 gene locus_tag LOCUS_06040 19368 22229 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476245.1 protein_id gnl|my_center|LOCUS_06040 23242 22307 gene locus_tag LOCUS_06050 23242 22307 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645746.1 protein_id gnl|my_center|LOCUS_06050 23704 23838 gene locus_tag LOCUS_06060 23704 23838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06060 23854 24507 gene locus_tag LOCUS_06070 23854 24507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06070 24690 24493 gene locus_tag LOCUS_06080 24690 24493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 24870 27305 gene locus_tag LOCUS_06090 24870 27305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 27328 27729 gene locus_tag LOCUS_06100 27328 27729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 27746 27958 gene locus_tag LOCUS_06110 27746 27958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 28005 29309 gene locus_tag LOCUS_06120 gene argH 28005 29309 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808617.1 protein_id gnl|my_center|LOCUS_06120 29546 29749 gene locus_tag LOCUS_06130 29546 29749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 30501 30413 gene locus_tag LOCUS_t00130 30501 30413 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 31291 34056 gene locus_tag LOCUS_06140 31291 34056 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674070.1 protein_id gnl|my_center|LOCUS_06140 34059 35783 gene locus_tag LOCUS_06150 34059 35783 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674071.1 protein_id gnl|my_center|LOCUS_06150 35793 36410 gene locus_tag LOCUS_06160 gene casB 35793 36410 CDS product type I-E CRISPR-associated protein Cse2/CasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003586648.1 protein_id gnl|my_center|LOCUS_06160 36428 37504 gene locus_tag LOCUS_06170 gene cas7e 36428 37504 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674072.1 protein_id gnl|my_center|LOCUS_06170 37485 38186 gene locus_tag LOCUS_06180 gene cas5e 37485 38186 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674073.1 protein_id gnl|my_center|LOCUS_06180 38199 38822 gene locus_tag LOCUS_06190 gene cas6e 38199 38822 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674074.1 protein_id gnl|my_center|LOCUS_06190 38825 39775 gene locus_tag LOCUS_06200 gene cas1e 38825 39775 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674075.1 protein_id gnl|my_center|LOCUS_06200 39820 40644 gene locus_tag LOCUS_06210 gene cas2e 39820 40644 CDS product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674076.1 protein_id gnl|my_center|LOCUS_06210 40674 43103 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtattccccacgcaagtgggggtgatcc 43362 43976 gene locus_tag LOCUS_06220 43362 43976 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548123.1 protein_id gnl|my_center|LOCUS_06220 43973 44641 gene locus_tag LOCUS_06230 43973 44641 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548121.1 protein_id gnl|my_center|LOCUS_06230 44644 45903 gene locus_tag LOCUS_06240 44644 45903 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254461.1 protein_id gnl|my_center|LOCUS_06240 46059 47159 gene locus_tag LOCUS_06250 46059 47159 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546457.1 protein_id gnl|my_center|LOCUS_06250 47162 48388 gene locus_tag LOCUS_06260 47162 48388 CDS product hydroxymethylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546459.1 protein_id gnl|my_center|LOCUS_06260 48392 49555 gene locus_tag LOCUS_06270 48392 49555 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546460.1 protein_id gnl|my_center|LOCUS_06270 49720 51078 gene locus_tag LOCUS_06280 49720 51078 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547031.1 protein_id gnl|my_center|LOCUS_06280 51642 51136 gene locus_tag LOCUS_06290 gene ybaK 51642 51136 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254291.1 protein_id gnl|my_center|LOCUS_06290 51723 52667 gene locus_tag LOCUS_06300 gene prmA 51723 52667 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547033.1 protein_id gnl|my_center|LOCUS_06300 52808 55069 gene locus_tag LOCUS_06310 52808 55069 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254292.1 protein_id gnl|my_center|LOCUS_06310 55098 55535 gene locus_tag LOCUS_06320 gene dtd 55098 55535 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547036.1 protein_id gnl|my_center|LOCUS_06320 55819 57105 gene locus_tag LOCUS_06330 gene hisS 55819 57105 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547037.1 protein_id gnl|my_center|LOCUS_06330 57121 58965 gene locus_tag LOCUS_06340 gene aspS 57121 58965 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547039.1 protein_id gnl|my_center|LOCUS_06340 59673 59038 gene locus_tag LOCUS_06350 59673 59038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 >Feature sequence05 710 42 gene locus_tag LOCUS_06360 710 42 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548607.1 protein_id gnl|my_center|LOCUS_06360 2075 720 gene locus_tag LOCUS_06370 2075 720 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548609.1 protein_id gnl|my_center|LOCUS_06370 2378 3853 gene locus_tag LOCUS_06380 2378 3853 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640572.1 protein_id gnl|my_center|LOCUS_06380 3917 4765 gene locus_tag LOCUS_06390 3917 4765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 4907 5839 gene locus_tag LOCUS_06400 4907 5839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 5952 6320 gene locus_tag LOCUS_06410 5952 6320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 6579 7343 gene locus_tag LOCUS_06420 6579 7343 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259154.1 protein_id gnl|my_center|LOCUS_06420 7376 7528 gene locus_tag LOCUS_06430 7376 7528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 7573 8571 gene locus_tag LOCUS_06440 7573 8571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 8618 8797 gene locus_tag LOCUS_06450 8618 8797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 9630 8791 gene locus_tag LOCUS_06460 9630 8791 CDS product Rgg/GadR/MutR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254624.1 protein_id gnl|my_center|LOCUS_06460 10673 9774 gene locus_tag LOCUS_06470 gene htpX 10673 9774 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254032.1 protein_id gnl|my_center|LOCUS_06470 11244 10690 gene locus_tag LOCUS_06480 11244 10690 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704892.1 protein_id gnl|my_center|LOCUS_06480 12547 11402 gene locus_tag LOCUS_06490 12547 11402 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254034.1 protein_id gnl|my_center|LOCUS_06490 13141 13275 gene locus_tag LOCUS_06500 13141 13275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548644.1 protein_id gnl|my_center|LOCUS_06500 13397 14308 gene locus_tag LOCUS_06510 13397 14308 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254041.1 protein_id gnl|my_center|LOCUS_06510 14538 15677 gene locus_tag LOCUS_06520 14538 15677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 15901 16068 gene locus_tag LOCUS_06530 15901 16068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 16084 16260 gene locus_tag LOCUS_06540 16084 16260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 17066 16305 gene locus_tag LOCUS_06550 17066 16305 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548674.1 protein_id gnl|my_center|LOCUS_06550 18653 17070 gene locus_tag LOCUS_06560 18653 17070 CDS product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254042.1 protein_id gnl|my_center|LOCUS_06560 19667 19041 gene locus_tag LOCUS_06570 19667 19041 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254043.1 protein_id gnl|my_center|LOCUS_06570 19750 20121 gene locus_tag LOCUS_06580 19750 20121 CDS product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548679.1 protein_id gnl|my_center|LOCUS_06580 20806 20108 gene locus_tag LOCUS_06590 20806 20108 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613281.1 protein_id gnl|my_center|LOCUS_06590 20919 21398 gene locus_tag LOCUS_06600 20919 21398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254045.1 protein_id gnl|my_center|LOCUS_06600 22931 21468 gene locus_tag LOCUS_06610 gene cls 22931 21468 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548687.1 protein_id gnl|my_center|LOCUS_06610 23877 22933 gene locus_tag LOCUS_06620 23877 22933 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548688.1 protein_id gnl|my_center|LOCUS_06620 23949 24716 gene locus_tag LOCUS_06630 23949 24716 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548691.1 protein_id gnl|my_center|LOCUS_06630 25760 24804 gene locus_tag LOCUS_06640 25760 24804 CDS product DUF1002 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643525.1 protein_id gnl|my_center|LOCUS_06640 25894 26754 gene locus_tag LOCUS_06650 25894 26754 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254046.1 protein_id gnl|my_center|LOCUS_06650 26751 27410 gene locus_tag LOCUS_06660 26751 27410 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254047.1 protein_id gnl|my_center|LOCUS_06660 27537 28505 gene locus_tag LOCUS_06670 27537 28505 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548712.1 protein_id gnl|my_center|LOCUS_06670 28705 29367 gene locus_tag LOCUS_06680 28705 29367 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254049.1 protein_id gnl|my_center|LOCUS_06680 29378 30211 gene locus_tag LOCUS_06690 29378 30211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548717.1 protein_id gnl|my_center|LOCUS_06690 30901 30251 gene locus_tag LOCUS_06700 30901 30251 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549430.1 protein_id gnl|my_center|LOCUS_06700 32264 30939 gene locus_tag LOCUS_06710 32264 30939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 32418 33506 gene locus_tag LOCUS_06720 32418 33506 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548727.1 protein_id gnl|my_center|LOCUS_06720 33556 33831 gene locus_tag LOCUS_06730 33556 33831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 34036 34191 gene locus_tag LOCUS_06740 34036 34191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 34323 35432 gene locus_tag LOCUS_06750 34323 35432 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548730.1 protein_id gnl|my_center|LOCUS_06750 35520 36224 gene locus_tag LOCUS_06760 35520 36224 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548732.1 protein_id gnl|my_center|LOCUS_06760 36190 36984 gene locus_tag LOCUS_06770 36190 36984 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254053.1 protein_id gnl|my_center|LOCUS_06770 37197 37454 gene locus_tag LOCUS_06780 37197 37454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06780 37435 37743 gene locus_tag LOCUS_06790 37435 37743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06790 37792 38376 gene locus_tag LOCUS_06800 37792 38376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 38379 39236 gene locus_tag LOCUS_06810 38379 39236 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549634.1 protein_id gnl|my_center|LOCUS_06810 42393 39388 gene locus_tag LOCUS_06820 42393 39388 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548741.1 protein_id gnl|my_center|LOCUS_06820 42990 44138 gene locus_tag LOCUS_06830 gene nagA 42990 44138 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254054.1 protein_id gnl|my_center|LOCUS_06830 44682 44209 gene locus_tag LOCUS_06840 44682 44209 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613286.1 protein_id gnl|my_center|LOCUS_06840 44856 45335 gene locus_tag LOCUS_06850 44856 45335 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548750.1 protein_id gnl|my_center|LOCUS_06850 46142 45345 gene locus_tag LOCUS_06860 46142 45345 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548752.1 protein_id gnl|my_center|LOCUS_06860 46339 46812 gene locus_tag LOCUS_06870 46339 46812 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548753.1 protein_id gnl|my_center|LOCUS_06870 47231 48172 gene locus_tag LOCUS_06880 47231 48172 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254057.1 protein_id gnl|my_center|LOCUS_06880 48290 49060 gene locus_tag LOCUS_06890 gene phnC 48290 49060 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548759.1 protein_id gnl|my_center|LOCUS_06890 49063 49863 gene locus_tag LOCUS_06900 gene phnE 49063 49863 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254058.1 protein_id gnl|my_center|LOCUS_06900 49863 50675 gene locus_tag LOCUS_06910 gene phnE 49863 50675 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548762.1 protein_id gnl|my_center|LOCUS_06910 52554 50929 gene locus_tag LOCUS_06920 52554 50929 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254071.1 protein_id gnl|my_center|LOCUS_06920 52802 53287 gene locus_tag LOCUS_06930 52802 53287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548767.1 protein_id gnl|my_center|LOCUS_06930 53345 54745 gene locus_tag LOCUS_06940 53345 54745 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254060.1 protein_id gnl|my_center|LOCUS_06940 54842 56791 gene locus_tag LOCUS_06950 gene asnB 54842 56791 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548773.1 protein_id gnl|my_center|LOCUS_06950 >Feature sequence06 507 196 gene locus_tag LOCUS_06960 507 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06960 1935 751 gene locus_tag LOCUS_06970 1935 751 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547041.1 protein_id gnl|my_center|LOCUS_06970 3313 2117 gene locus_tag LOCUS_06980 gene lysA 3313 2117 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592630.1 protein_id gnl|my_center|LOCUS_06980 3657 3584 gene locus_tag LOCUS_t00140 3657 3584 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4478 3783 gene locus_tag LOCUS_06990 4478 3783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 4759 4628 gene locus_tag LOCUS_07000 4759 4628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 4881 4762 gene locus_tag LOCUS_07010 4881 4762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 6322 5426 gene locus_tag LOCUS_07020 6322 5426 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547149.1 protein_id gnl|my_center|LOCUS_07020 7798 6404 gene locus_tag LOCUS_07030 gene hslU 7798 6404 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254308.1 protein_id gnl|my_center|LOCUS_07030 8334 7801 gene locus_tag LOCUS_07040 gene hslV 8334 7801 CDS product HslU--HslV peptidase proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254307.1 protein_id gnl|my_center|LOCUS_07040 9331 8444 gene locus_tag LOCUS_07050 9331 8444 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547143.1 protein_id gnl|my_center|LOCUS_07050 10650 9331 gene locus_tag LOCUS_07060 gene trmFO 10650 9331 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547141.1 protein_id gnl|my_center|LOCUS_07060 12965 10782 gene locus_tag LOCUS_07070 gene topA 12965 10782 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547140.1 protein_id gnl|my_center|LOCUS_07070 13931 13092 gene locus_tag LOCUS_07080 gene dprA 13931 13092 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547135.1 protein_id gnl|my_center|LOCUS_07080 14799 14029 gene locus_tag LOCUS_07090 14799 14029 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254306.1 protein_id gnl|my_center|LOCUS_07090 15646 14789 gene locus_tag LOCUS_07100 gene ylqF 15646 14789 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547131.1 protein_id gnl|my_center|LOCUS_07100 15951 15721 gene locus_tag LOCUS_07110 15951 15721 CDS product YozE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547128.1 protein_id gnl|my_center|LOCUS_07110 16815 15955 gene locus_tag LOCUS_07120 16815 15955 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254305.1 protein_id gnl|my_center|LOCUS_07120 16935 17597 gene locus_tag LOCUS_07130 16935 17597 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254304.1 protein_id gnl|my_center|LOCUS_07130 18813 17623 gene locus_tag LOCUS_07140 18813 17623 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547116.1 protein_id gnl|my_center|LOCUS_07140 18894 19793 gene locus_tag LOCUS_07150 18894 19793 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547115.1 protein_id gnl|my_center|LOCUS_07150 20038 19832 gene locus_tag LOCUS_07160 20038 19832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 20225 19974 gene locus_tag LOCUS_07170 20225 19974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 20469 20305 gene locus_tag LOCUS_07180 20469 20305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 20964 20773 gene locus_tag LOCUS_07190 20964 20773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 21288 20995 gene locus_tag LOCUS_07200 21288 20995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 23212 21440 gene locus_tag LOCUS_07210 23212 21440 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965688.1 protein_id gnl|my_center|LOCUS_07210 24951 23209 gene locus_tag LOCUS_07220 24951 23209 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294013.1 protein_id gnl|my_center|LOCUS_07220 25345 26247 gene locus_tag LOCUS_07230 25345 26247 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423226.1 protein_id gnl|my_center|LOCUS_07230 27142 26318 gene locus_tag LOCUS_07240 27142 26318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 27388 27975 gene locus_tag LOCUS_07250 27388 27975 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546962.1 protein_id gnl|my_center|LOCUS_07250 28907 28071 gene locus_tag LOCUS_07260 28907 28071 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546960.1 protein_id gnl|my_center|LOCUS_07260 29214 30491 gene locus_tag LOCUS_07270 gene eno 29214 30491 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546959.1 protein_id gnl|my_center|LOCUS_07270 30565 30987 gene locus_tag LOCUS_07280 30565 30987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 31141 32499 gene locus_tag LOCUS_07290 31141 32499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 33164 32556 gene locus_tag LOCUS_07300 33164 32556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 33673 34413 gene locus_tag LOCUS_07310 33673 34413 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254050.1 protein_id gnl|my_center|LOCUS_07310 34434 35936 gene locus_tag LOCUS_07320 34434 35936 CDS product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548719.1 protein_id gnl|my_center|LOCUS_07320 36838 35984 gene locus_tag LOCUS_07330 36838 35984 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254391.1 protein_id gnl|my_center|LOCUS_07330 37016 39274 gene locus_tag LOCUS_07340 37016 39274 CDS product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254392.1 protein_id gnl|my_center|LOCUS_07340 39334 39783 gene locus_tag LOCUS_07350 39334 39783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07350 39780 40280 gene locus_tag LOCUS_07360 39780 40280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07360 41529 40396 gene locus_tag LOCUS_07370 41529 40396 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359094.1 protein_id gnl|my_center|LOCUS_07370 42672 41647 gene locus_tag LOCUS_07380 42672 41647 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964788.1 protein_id gnl|my_center|LOCUS_07380 43727 42873 gene locus_tag LOCUS_07390 43727 42873 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549073.1 protein_id gnl|my_center|LOCUS_07390 43872 44174 gene locus_tag LOCUS_07400 43872 44174 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227633.1 protein_id gnl|my_center|LOCUS_07400 44781 44254 gene locus_tag LOCUS_07410 44781 44254 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547784.1 protein_id gnl|my_center|LOCUS_07410 47047 44771 gene locus_tag LOCUS_07420 gene recJ 47047 44771 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547786.1 protein_id gnl|my_center|LOCUS_07420 47745 47044 gene locus_tag LOCUS_07430 47745 47044 CDS product class A sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547788.1 protein_id gnl|my_center|LOCUS_07430 49564 47726 gene locus_tag LOCUS_07440 gene lepA 49564 47726 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254395.1 protein_id gnl|my_center|LOCUS_07440 50822 49686 gene locus_tag LOCUS_07450 gene dnaJ 50822 49686 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547790.1 protein_id gnl|my_center|LOCUS_07450 52749 50905 gene locus_tag LOCUS_07460 gene dnaK 52749 50905 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547791.1 protein_id gnl|my_center|LOCUS_07460 53396 52809 gene locus_tag LOCUS_07470 gene grpE 53396 52809 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547792.1 protein_id gnl|my_center|LOCUS_07470 54454 53408 gene locus_tag LOCUS_07480 gene hrcA 54454 53408 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547794.1 protein_id gnl|my_center|LOCUS_07480 55530 54592 gene locus_tag LOCUS_07490 gene ribF 55530 54592 CDS product riboflavin biosynthesis protein RibF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547803.1 protein_id gnl|my_center|LOCUS_07490 <56253 55644 gene locus_tag LOCUS_07500 <56253 55644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_087235334.1:site-specific integrase >Feature sequence07 1361 18 gene locus_tag LOCUS_07510 1361 18 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673958.1 protein_id gnl|my_center|LOCUS_07510 3851 1473 gene locus_tag LOCUS_07520 3851 1473 CDS product Xaa-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548011.1 protein_id gnl|my_center|LOCUS_07520 4074 4147 gene locus_tag LOCUS_t00150 4074 4147 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4336 4776 gene locus_tag LOCUS_07530 4336 4776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07530 4793 6475 gene locus_tag LOCUS_07540 4793 6475 CDS product type IA DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222029.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07540 6661 8472 gene locus_tag LOCUS_07550 6661 8472 CDS product SH3-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546900.1 protein_id gnl|my_center|LOCUS_07550 8865 10124 gene locus_tag LOCUS_07560 8865 10124 CDS product SH3-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254386.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07560 10348 11562 gene locus_tag LOCUS_07570 10348 11562 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101557.1 protein_id gnl|my_center|LOCUS_07570 11563 11817 gene locus_tag LOCUS_07580 11563 11817 CDS product DUF2087 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360471.1 protein_id gnl|my_center|LOCUS_07580 11976 12467 gene locus_tag LOCUS_07590 gene purE 11976 12467 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548377.1 protein_id gnl|my_center|LOCUS_07590 12457 13581 gene locus_tag LOCUS_07600 gene purK 12457 13581 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697988.1 protein_id gnl|my_center|LOCUS_07600 13625 14920 gene locus_tag LOCUS_07610 gene purB 13625 14920 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475797.1 protein_id gnl|my_center|LOCUS_07610 15244 15966 gene locus_tag LOCUS_07620 15244 15966 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548371.1 protein_id gnl|my_center|LOCUS_07620 15971 16219 gene locus_tag LOCUS_07630 gene purS 15971 16219 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700038.1 protein_id gnl|my_center|LOCUS_07630 16219 16893 gene locus_tag LOCUS_07640 gene purQ 16219 16893 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475857.1 protein_id gnl|my_center|LOCUS_07640 16893 19115 gene locus_tag LOCUS_07650 gene purL 16893 19115 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475858.1 protein_id gnl|my_center|LOCUS_07650 19091 20569 gene locus_tag LOCUS_07660 gene purF 19091 20569 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475859.1 protein_id gnl|my_center|LOCUS_07660 20566 21615 gene locus_tag LOCUS_07670 gene purM 20566 21615 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254495.1 protein_id gnl|my_center|LOCUS_07670 21615 22196 gene locus_tag LOCUS_07680 gene purN 21615 22196 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700046.1 protein_id gnl|my_center|LOCUS_07680 22197 23738 gene locus_tag LOCUS_07690 gene purH 22197 23738 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548356.1 protein_id gnl|my_center|LOCUS_07690 23754 25019 gene locus_tag LOCUS_07700 gene purD 23754 25019 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548355.1 protein_id gnl|my_center|LOCUS_07700 25071 25487 gene locus_tag LOCUS_07710 25071 25487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 25657 26184 gene locus_tag LOCUS_07720 25657 26184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 26582 26226 gene locus_tag LOCUS_07730 26582 26226 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254429.1 protein_id gnl|my_center|LOCUS_07730 26823 27134 gene locus_tag LOCUS_07740 gene rplU 26823 27134 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547952.1 protein_id gnl|my_center|LOCUS_07740 27150 27449 gene locus_tag LOCUS_07750 gene rpmA 27150 27449 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254420.1 protein_id gnl|my_center|LOCUS_07750 27595 28701 gene locus_tag LOCUS_07760 27595 28701 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547949.1 protein_id gnl|my_center|LOCUS_07760 28771 29340 gene locus_tag LOCUS_07770 gene efp 28771 29340 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547948.1 protein_id gnl|my_center|LOCUS_07770 29357 29791 gene locus_tag LOCUS_07780 29357 29791 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547946.1 protein_id gnl|my_center|LOCUS_07780 29791 30189 gene locus_tag LOCUS_07790 gene nusB 29791 30189 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547945.1 protein_id gnl|my_center|LOCUS_07790 30248 31099 gene locus_tag LOCUS_07800 30248 31099 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547942.1 protein_id gnl|my_center|LOCUS_07800 31086 32456 gene locus_tag LOCUS_07810 gene xseA 31086 32456 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547941.1 protein_id gnl|my_center|LOCUS_07810 32449 32688 gene locus_tag LOCUS_07820 32449 32688 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547938.1 protein_id gnl|my_center|LOCUS_07820 32693 33556 gene locus_tag LOCUS_07830 32693 33556 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547935.1 protein_id gnl|my_center|LOCUS_07830 33556 34371 gene locus_tag LOCUS_07840 33556 34371 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547933.1 protein_id gnl|my_center|LOCUS_07840 34393 36081 gene locus_tag LOCUS_07850 gene recN 34393 36081 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547931.1 protein_id gnl|my_center|LOCUS_07850 36294 36602 gene locus_tag LOCUS_07860 36294 36602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07860 36755 36949 gene locus_tag LOCUS_07870 36755 36949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07870 36939 37163 gene locus_tag LOCUS_07880 36939 37163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07880 37530 37225 gene locus_tag LOCUS_07890 37530 37225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 37704 38318 gene locus_tag LOCUS_07900 gene gmk 37704 38318 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547929.1 protein_id gnl|my_center|LOCUS_07900 38320 38541 gene locus_tag LOCUS_07910 gene rpoZ 38320 38541 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547927.1 protein_id gnl|my_center|LOCUS_07910 38604 40985 gene locus_tag LOCUS_07920 gene priA 38604 40985 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547921.1 protein_id gnl|my_center|LOCUS_07920 41003 41950 gene locus_tag LOCUS_07930 gene fmt 41003 41950 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547919.1 protein_id gnl|my_center|LOCUS_07930 41940 43256 gene locus_tag LOCUS_07940 gene rsmB 41940 43256 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254418.1 protein_id gnl|my_center|LOCUS_07940 43262 44017 gene locus_tag LOCUS_07950 43262 44017 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254417.1 protein_id gnl|my_center|LOCUS_07950 44007 46013 gene locus_tag LOCUS_07960 gene pknB 44007 46013 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254416.1 protein_id gnl|my_center|LOCUS_07960 46014 46907 gene locus_tag LOCUS_07970 gene rsgA 46014 46907 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547915.1 protein_id gnl|my_center|LOCUS_07970 46937 47620 gene locus_tag LOCUS_07980 46937 47620 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254415.1 protein_id gnl|my_center|LOCUS_07980 48059 48397 gene locus_tag LOCUS_07990 48059 48397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 48609 49184 gene locus_tag LOCUS_08000 48609 49184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 49644 49835 gene locus_tag LOCUS_08010 49644 49835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 49832 50110 gene locus_tag LOCUS_08020 49832 50110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 50144 51403 gene locus_tag LOCUS_08030 50144 51403 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254534.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08030 52616 51762 gene locus_tag LOCUS_08040 52616 51762 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546967.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08040 52969 52748 gene locus_tag LOCUS_08050 52969 52748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 54593 53370 gene locus_tag LOCUS_08060 54593 53370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 55016 54639 gene locus_tag LOCUS_08070 55016 54639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 55076 55360 gene locus_tag LOCUS_08080 55076 55360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 >Feature sequence08 92 739 gene locus_tag LOCUS_08090 92 739 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547543.1 protein_id gnl|my_center|LOCUS_08090 761 1390 gene locus_tag LOCUS_08100 gene nth 761 1390 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254362.1 protein_id gnl|my_center|LOCUS_08100 1425 2228 gene locus_tag LOCUS_08110 1425 2228 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237528.1 protein_id gnl|my_center|LOCUS_08110 2643 2323 gene locus_tag LOCUS_08120 2643 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08120 4175 3174 gene locus_tag LOCUS_08130 4175 3174 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674791.1 protein_id gnl|my_center|LOCUS_08130 6153 4225 gene locus_tag LOCUS_08140 6153 4225 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016921.1 protein_id gnl|my_center|LOCUS_08140 8612 6300 gene locus_tag LOCUS_08150 8612 6300 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254361.1 protein_id gnl|my_center|LOCUS_08150 9231 8599 gene locus_tag LOCUS_08160 gene recU 9231 8599 CDS product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254360.1 protein_id gnl|my_center|LOCUS_08160 9392 9952 gene locus_tag LOCUS_08170 9392 9952 CDS product DUF1273 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547535.1 protein_id gnl|my_center|LOCUS_08170 10028 10492 gene locus_tag LOCUS_08180 10028 10492 CDS product cell division regulator GpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547534.1 protein_id gnl|my_center|LOCUS_08180 11009 12133 gene locus_tag LOCUS_08190 11009 12133 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547533.1 protein_id gnl|my_center|LOCUS_08190 12143 13117 gene locus_tag LOCUS_08200 12143 13117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08200 13149 13268 gene locus_tag LOCUS_08210 13149 13268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 13533 13889 gene locus_tag LOCUS_08220 13533 13889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 13882 15561 gene locus_tag LOCUS_08230 13882 15561 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254358.1 protein_id gnl|my_center|LOCUS_08230 15573 16025 gene locus_tag LOCUS_08240 gene lspA 15573 16025 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613370.1 protein_id gnl|my_center|LOCUS_08240 16027 16938 gene locus_tag LOCUS_08250 16027 16938 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254356.1 protein_id gnl|my_center|LOCUS_08250 16940 17995 gene locus_tag LOCUS_08260 16940 17995 CDS product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547524.1 protein_id gnl|my_center|LOCUS_08260 17995 21186 gene locus_tag LOCUS_08270 17995 21186 CDS product carbamoyl phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254355.1 protein_id gnl|my_center|LOCUS_08270 21280 21561 gene locus_tag LOCUS_08280 21280 21561 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703119.1 protein_id gnl|my_center|LOCUS_08280 21561 22904 gene locus_tag LOCUS_08290 21561 22904 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475560.1 protein_id gnl|my_center|LOCUS_08290 24662 22971 gene locus_tag LOCUS_08300 24662 22971 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547519.1 protein_id gnl|my_center|LOCUS_08300 24862 25356 gene locus_tag LOCUS_08310 24862 25356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08310 25353 25742 gene locus_tag LOCUS_08320 25353 25742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08320 26089 26868 gene locus_tag LOCUS_08330 26089 26868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 27839 26928 gene locus_tag LOCUS_08340 27839 26928 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549600.1 protein_id gnl|my_center|LOCUS_08340 28764 28087 gene locus_tag LOCUS_08350 28764 28087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08350 29264 28761 gene locus_tag LOCUS_08360 29264 28761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08360 30269 29283 gene locus_tag LOCUS_08370 gene serC 30269 29283 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475514.1 protein_id gnl|my_center|LOCUS_08370 30721 31344 gene locus_tag LOCUS_08380 30721 31344 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646364.1 protein_id gnl|my_center|LOCUS_08380 31744 31403 gene locus_tag LOCUS_08390 31744 31403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 32446 31928 gene locus_tag LOCUS_08400 32446 31928 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948983.1 protein_id gnl|my_center|LOCUS_08400 32896 33465 gene locus_tag LOCUS_08410 32896 33465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 33465 33605 gene locus_tag LOCUS_08420 33465 33605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 34893 33817 gene locus_tag LOCUS_08430 gene xerS 34893 33817 CDS product tyrosine recombinase XerS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547513.1 protein_id gnl|my_center|LOCUS_08430 35126 36274 gene locus_tag LOCUS_08440 35126 36274 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905594.1 protein_id gnl|my_center|LOCUS_08440 36414 37583 gene locus_tag LOCUS_08450 36414 37583 CDS product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102112.1 protein_id gnl|my_center|LOCUS_08450 37608 38186 gene locus_tag LOCUS_08460 37608 38186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 38345 38641 gene locus_tag LOCUS_08470 38345 38641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 39455 38997 gene locus_tag LOCUS_08480 39455 38997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08480 39888 42908 gene locus_tag LOCUS_08490 39888 42908 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476043.1 protein_id gnl|my_center|LOCUS_08490 42922 44520 gene locus_tag LOCUS_08500 42922 44520 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476042.1 protein_id gnl|my_center|LOCUS_08500 44520 45755 gene locus_tag LOCUS_08510 44520 45755 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027693.1 protein_id gnl|my_center|LOCUS_08510 46711 45794 gene locus_tag LOCUS_08520 46711 45794 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476040.1 protein_id gnl|my_center|LOCUS_08520 47916 46753 gene locus_tag LOCUS_08530 47916 46753 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101621619.1 protein_id gnl|my_center|LOCUS_08530 48503 47940 gene locus_tag LOCUS_08540 48503 47940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 >Feature sequence09 324 1025 gene locus_tag LOCUS_08550 324 1025 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566878.1 protein_id gnl|my_center|LOCUS_08550 2711 1089 gene locus_tag LOCUS_08560 2711 1089 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254631.1 protein_id gnl|my_center|LOCUS_08560 >Feature sequence10 555 61 gene locus_tag LOCUS_08570 555 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254364.1 protein_id gnl|my_center|LOCUS_08570 3340 548 gene locus_tag LOCUS_08580 3340 548 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254365.1 protein_id gnl|my_center|LOCUS_08580 7052 3369 gene locus_tag LOCUS_08590 gene addA 7052 3369 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254366.1 protein_id gnl|my_center|LOCUS_08590 10618 7079 gene locus_tag LOCUS_08600 10618 7079 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254367.1 protein_id gnl|my_center|LOCUS_08600 10752 11663 gene locus_tag LOCUS_08610 gene mvk 10752 11663 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547572.1 protein_id gnl|my_center|LOCUS_08610 11719 12678 gene locus_tag LOCUS_08620 gene mvaD 11719 12678 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547574.1 protein_id gnl|my_center|LOCUS_08620 12755 13837 gene locus_tag LOCUS_08630 12755 13837 CDS product phosphomevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254368.1 protein_id gnl|my_center|LOCUS_08630 13848 14873 gene locus_tag LOCUS_08640 gene fni 13848 14873 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254369.1 protein_id gnl|my_center|LOCUS_08640 16014 15079 gene locus_tag LOCUS_08650 16014 15079 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547481.1 protein_id gnl|my_center|LOCUS_08650 18612 16129 gene locus_tag LOCUS_08660 gene parC 18612 16129 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547478.1 protein_id gnl|my_center|LOCUS_08660 20558 18627 gene locus_tag LOCUS_08670 gene parE 20558 18627 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547476.1 protein_id gnl|my_center|LOCUS_08670 20655 21293 gene locus_tag LOCUS_08680 gene plsY 20655 21293 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547474.1 protein_id gnl|my_center|LOCUS_08680 21693 21364 gene locus_tag LOCUS_08690 21693 21364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08690 22666 21668 gene locus_tag LOCUS_08700 22666 21668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08700 23043 22702 gene locus_tag LOCUS_08710 23043 22702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08710 23323 23054 gene locus_tag LOCUS_08720 23323 23054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08720 23759 23517 gene locus_tag LOCUS_08730 23759 23517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08730 24250 23822 gene locus_tag LOCUS_08740 24250 23822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 25252 24431 gene locus_tag LOCUS_08750 25252 24431 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858506.1 protein_id gnl|my_center|LOCUS_08750 25933 25352 gene locus_tag LOCUS_08760 25933 25352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 26968 25940 gene locus_tag LOCUS_08770 26968 25940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 28279 27170 gene locus_tag LOCUS_08780 28279 27170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 28688 28218 gene locus_tag LOCUS_08790 28688 28218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 29205 29840 gene locus_tag LOCUS_08800 29205 29840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003648228.1 protein_id gnl|my_center|LOCUS_08800 29837 30613 gene locus_tag LOCUS_08810 29837 30613 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011241770.1 protein_id gnl|my_center|LOCUS_08810 30592 31410 gene locus_tag LOCUS_08820 30592 31410 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922272.1 protein_id gnl|my_center|LOCUS_08820 31400 32167 gene locus_tag LOCUS_08830 31400 32167 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011241772.1 protein_id gnl|my_center|LOCUS_08830 32340 33050 gene locus_tag LOCUS_08840 32340 33050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 33120 33266 gene locus_tag LOCUS_08850 33120 33266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 33627 34178 gene locus_tag LOCUS_08860 33627 34178 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454674.1 protein_id gnl|my_center|LOCUS_08860 35265 34237 gene locus_tag LOCUS_08870 35265 34237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 35320 35976 gene locus_tag LOCUS_08880 35320 35976 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889720.1 protein_id gnl|my_center|LOCUS_08880 36999 36310 gene locus_tag LOCUS_08890 36999 36310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08890 37249 37019 gene locus_tag LOCUS_08900 37249 37019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08900 37310 37456 gene locus_tag LOCUS_08910 37310 37456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 39196 37538 gene locus_tag LOCUS_08920 39196 37538 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162279.1 protein_id gnl|my_center|LOCUS_08920 39342 39196 gene locus_tag LOCUS_08930 39342 39196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08930 39873 39346 gene locus_tag LOCUS_08940 39873 39346 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08940 40593 39955 gene locus_tag LOCUS_08950 gene phoU 40593 39955 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621378.1 protein_id gnl|my_center|LOCUS_08950 41370 40612 gene locus_tag LOCUS_08960 gene pstB 41370 40612 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041121.1 protein_id gnl|my_center|LOCUS_08960 42245 41370 gene locus_tag LOCUS_08970 gene pstA 42245 41370 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994131.1 protein_id gnl|my_center|LOCUS_08970 43156 42248 gene locus_tag LOCUS_08980 gene pstC 43156 42248 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965013.1 protein_id gnl|my_center|LOCUS_08980 44018 43176 gene locus_tag LOCUS_08990 44018 43176 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073167205.1 protein_id gnl|my_center|LOCUS_08990 44580 44858 gene locus_tag LOCUS_09000 44580 44858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 45057 44830 gene locus_tag LOCUS_09010 45057 44830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 45056 45349 gene locus_tag LOCUS_09020 45056 45349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 45564 46259 gene locus_tag LOCUS_09030 45564 46259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 46552 46310 gene locus_tag LOCUS_09040 46552 46310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 47527 46892 gene locus_tag LOCUS_09050 47527 46892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09050 48265 47621 gene locus_tag LOCUS_09060 48265 47621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09060 >Feature sequence11 1092 76 gene locus_tag LOCUS_09070 gene asnA 1092 76 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641196.1 protein_id gnl|my_center|LOCUS_09070 2057 1443 gene locus_tag LOCUS_09080 2057 1443 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476278.1 protein_id gnl|my_center|LOCUS_09080 2178 2390 gene locus_tag LOCUS_09090 2178 2390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 2329 2682 gene locus_tag LOCUS_09100 2329 2682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 2808 3266 gene locus_tag LOCUS_09110 2808 3266 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100964.1 protein_id gnl|my_center|LOCUS_09110 3881 9559 gene locus_tag LOCUS_09120 gene prtP 3881 9559 CDS product PII-type proteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674840.1 protein_id gnl|my_center|LOCUS_09120 9650 9811 gene locus_tag LOCUS_09130 9650 9811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 9808 11001 gene locus_tag LOCUS_09140 9808 11001 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158181789.1 protein_id gnl|my_center|LOCUS_09140 11145 11570 gene locus_tag LOCUS_09150 11145 11570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 11722 12633 gene locus_tag LOCUS_09160 gene htpX 11722 12633 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254032.1 protein_id gnl|my_center|LOCUS_09160 13279 12695 gene locus_tag LOCUS_09170 13279 12695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09170 14029 13568 gene locus_tag LOCUS_09180 14029 13568 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641849.1 protein_id gnl|my_center|LOCUS_09180 14360 15283 gene locus_tag LOCUS_09190 14360 15283 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575213.1 protein_id gnl|my_center|LOCUS_09190 15287 16807 gene locus_tag LOCUS_09200 15287 16807 CDS product ABC transporter permease/substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050337793.1 protein_id gnl|my_center|LOCUS_09200 16908 18338 gene locus_tag LOCUS_09210 gene gapN 16908 18338 CDS product NADP-dependent glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262986.1 protein_id gnl|my_center|LOCUS_09210 18582 19340 gene locus_tag LOCUS_09220 18582 19340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09220 19289 19432 gene locus_tag LOCUS_09230 19289 19432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09230 20257 19505 gene locus_tag LOCUS_09240 20257 19505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 20336 20947 gene locus_tag LOCUS_09250 gene pcp 20336 20947 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592791.1 protein_id gnl|my_center|LOCUS_09250 21096 21293 gene locus_tag LOCUS_09260 21096 21293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 21404 22144 gene locus_tag LOCUS_09270 21404 22144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254372.1 protein_id gnl|my_center|LOCUS_09270 22144 23118 gene locus_tag LOCUS_09280 22144 23118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547594.1 protein_id gnl|my_center|LOCUS_09280 23111 24535 gene locus_tag LOCUS_09290 23111 24535 CDS product RsmF rRNA methyltransferase first C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254371.1 protein_id gnl|my_center|LOCUS_09290 24580 25428 gene locus_tag LOCUS_09300 24580 25428 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964728.1 protein_id gnl|my_center|LOCUS_09300 25478 25669 gene locus_tag LOCUS_09310 25478 25669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 25737 26153 gene locus_tag LOCUS_09320 25737 26153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09320 26231 26458 gene locus_tag LOCUS_09330 26231 26458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 27119 26529 gene locus_tag LOCUS_09340 27119 26529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 27311 27883 gene locus_tag LOCUS_09350 27311 27883 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699994.1 protein_id gnl|my_center|LOCUS_09350 27876 28649 gene locus_tag LOCUS_09360 gene ydcF 27876 28649 CDS product DUF218 domain-containing protein YdcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001027933.1 protein_id gnl|my_center|LOCUS_09360 28663 29256 gene locus_tag LOCUS_09370 28663 29256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 29261 30046 gene locus_tag LOCUS_09380 29261 30046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 30495 30965 gene locus_tag LOCUS_09390 30495 30965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 30996 31166 gene locus_tag LOCUS_09400 30996 31166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 31884 31696 gene locus_tag LOCUS_09410 31884 31696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 32036 32755 gene locus_tag LOCUS_09420 32036 32755 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109158.1 protein_id gnl|my_center|LOCUS_09420 32748 33023 gene locus_tag LOCUS_09430 32748 33023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 33051 33200 gene locus_tag LOCUS_09440 33051 33200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 33230 33712 gene locus_tag LOCUS_09450 33230 33712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 34009 34404 gene locus_tag LOCUS_09460 34009 34404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09460 34899 35540 gene locus_tag LOCUS_09470 34899 35540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09470 35557 35952 gene locus_tag LOCUS_09480 35557 35952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09480 36001 36309 gene locus_tag LOCUS_09490 36001 36309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 38149 36392 gene locus_tag LOCUS_09500 38149 36392 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254194.1 protein_id gnl|my_center|LOCUS_09500 39876 38149 gene locus_tag LOCUS_09510 39876 38149 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254193.1 protein_id gnl|my_center|LOCUS_09510 40247 39876 gene locus_tag LOCUS_09520 40247 39876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 40525 41475 gene locus_tag LOCUS_09530 40525 41475 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963416.1 protein_id gnl|my_center|LOCUS_09530 41679 45488 gene locus_tag LOCUS_09540 41679 45488 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254336.1 protein_id gnl|my_center|LOCUS_09540 45492 47432 gene locus_tag LOCUS_09550 45492 47432 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254337.1 protein_id gnl|my_center|LOCUS_09550 >Feature sequence12 26 102 gene locus_tag LOCUS_t00160 26 102 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 304 678 gene locus_tag LOCUS_09560 304 678 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987070.1 protein_id gnl|my_center|LOCUS_09560 665 1570 gene locus_tag LOCUS_09570 665 1570 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385582.1 protein_id gnl|my_center|LOCUS_09570 1542 3320 gene locus_tag LOCUS_09580 1542 3320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 3428 4816 gene locus_tag LOCUS_09590 3428 4816 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102117.1 protein_id gnl|my_center|LOCUS_09590 5020 5871 gene locus_tag LOCUS_09600 5020 5871 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528922.1 protein_id gnl|my_center|LOCUS_09600 5895 6455 gene locus_tag LOCUS_09610 5895 6455 CDS product ECF-type riboflavin transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547026.1 protein_id gnl|my_center|LOCUS_09610 6467 8185 gene locus_tag LOCUS_09620 6467 8185 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547024.1 protein_id gnl|my_center|LOCUS_09620 8178 9005 gene locus_tag LOCUS_09630 8178 9005 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547023.1 protein_id gnl|my_center|LOCUS_09630 9434 10828 gene locus_tag LOCUS_09640 9434 10828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 10990 11493 gene locus_tag LOCUS_09650 10990 11493 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869997.1 protein_id gnl|my_center|LOCUS_09650 11774 11589 gene locus_tag LOCUS_09660 11774 11589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 12388 11771 gene locus_tag LOCUS_09670 12388 11771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 12305 12541 gene locus_tag LOCUS_09680 12305 12541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 12787 12557 gene locus_tag LOCUS_09690 12787 12557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 13194 12748 gene locus_tag LOCUS_09700 13194 12748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 13570 13160 gene locus_tag LOCUS_09710 13570 13160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 13834 14955 gene locus_tag LOCUS_09720 13834 14955 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549213.1 protein_id gnl|my_center|LOCUS_09720 15240 16442 gene locus_tag LOCUS_09730 15240 16442 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921998.1 protein_id gnl|my_center|LOCUS_09730 16557 17282 gene locus_tag LOCUS_09740 gene rbsK 16557 17282 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949108.1 protein_id gnl|my_center|LOCUS_09740 17287 18354 gene locus_tag LOCUS_09750 17287 18354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 18370 19227 gene locus_tag LOCUS_09760 gene rfbA 18370 19227 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013572.1 protein_id gnl|my_center|LOCUS_09760 19224 19409 gene locus_tag LOCUS_09770 19224 19409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 19549 19740 gene locus_tag LOCUS_09780 19549 19740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 19737 20957 gene locus_tag LOCUS_09790 19737 20957 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238677.1 protein_id gnl|my_center|LOCUS_09790 21522 20998 gene locus_tag LOCUS_09800 21522 20998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 23241 21655 gene locus_tag LOCUS_09810 23241 21655 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548835.1 protein_id gnl|my_center|LOCUS_09810 23637 24005 gene locus_tag LOCUS_09820 23637 24005 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547604.1 protein_id gnl|my_center|LOCUS_09820 24007 24399 gene locus_tag LOCUS_09830 24007 24399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09830 24396 24704 gene locus_tag LOCUS_09840 24396 24704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09840 24704 25540 gene locus_tag LOCUS_09850 24704 25540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254375.1 protein_id gnl|my_center|LOCUS_09850 25686 27188 gene locus_tag LOCUS_09860 gene gltX 25686 27188 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254122.1 protein_id gnl|my_center|LOCUS_09860 28295 27270 gene locus_tag LOCUS_09870 28295 27270 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922256.1 protein_id gnl|my_center|LOCUS_09870 28414 29289 gene locus_tag LOCUS_09880 28414 29289 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262369.1 protein_id gnl|my_center|LOCUS_09880 29634 29344 gene locus_tag LOCUS_09890 29634 29344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 30392 29826 gene locus_tag LOCUS_09900 30392 29826 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701817.1 protein_id gnl|my_center|LOCUS_09900 30534 31958 gene locus_tag LOCUS_09910 gene cysS 30534 31958 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549082.1 protein_id gnl|my_center|LOCUS_09910 31951 32394 gene locus_tag LOCUS_09920 31951 32394 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549083.1 protein_id gnl|my_center|LOCUS_09920 32381 33130 gene locus_tag LOCUS_09930 gene rlmB 32381 33130 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254123.1 protein_id gnl|my_center|LOCUS_09930 33242 33811 gene locus_tag LOCUS_09940 33242 33811 CDS product DNA-directed RNA polymerase subunit sigma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254124.1 protein_id gnl|my_center|LOCUS_09940 33879 34094 gene locus_tag LOCUS_09950 33879 34094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549087.1 protein_id gnl|my_center|LOCUS_09950 34294 34782 gene locus_tag LOCUS_09960 34294 34782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09960 34742 35017 gene locus_tag LOCUS_09970 34742 35017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09970 35806 35120 gene locus_tag LOCUS_09980 35806 35120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09980 36317 35772 gene locus_tag LOCUS_09990 36317 35772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09990 36604 36302 gene locus_tag LOCUS_10000 36604 36302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10000 36857 36537 gene locus_tag LOCUS_10010 36857 36537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10010 37032 37181 gene locus_tag LOCUS_10020 gene rpmG 37032 37181 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549092.1 protein_id gnl|my_center|LOCUS_10020 37188 37358 gene locus_tag LOCUS_10030 gene secE 37188 37358 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549093.1 protein_id gnl|my_center|LOCUS_10030 37450 38004 gene locus_tag LOCUS_10040 gene nusG 37450 38004 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549094.1 protein_id gnl|my_center|LOCUS_10040 38130 38555 gene locus_tag LOCUS_10050 gene rplK 38130 38555 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549095.1 protein_id gnl|my_center|LOCUS_10050 38639 39334 gene locus_tag LOCUS_10060 gene rplA 38639 39334 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549096.1 protein_id gnl|my_center|LOCUS_10060 39497 40501 gene locus_tag LOCUS_10070 39497 40501 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475456.1 protein_id gnl|my_center|LOCUS_10070 41848 40598 gene locus_tag LOCUS_10080 41848 40598 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563654.1 protein_id gnl|my_center|LOCUS_10080 >Feature sequence13 1375 773 gene locus_tag LOCUS_10090 1375 773 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614999.1 protein_id gnl|my_center|LOCUS_10090 2324 1401 gene locus_tag LOCUS_10100 2324 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10100 2568 3362 gene locus_tag LOCUS_10110 2568 3362 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641965.1 protein_id gnl|my_center|LOCUS_10110 5057 3447 gene locus_tag LOCUS_10120 5057 3447 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547992.1 protein_id gnl|my_center|LOCUS_10120 7323 5071 gene locus_tag LOCUS_10130 7323 5071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 8128 7757 gene locus_tag LOCUS_10140 8128 7757 CDS product toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682305.1 protein_id gnl|my_center|LOCUS_10140 8366 8115 gene locus_tag LOCUS_10150 8366 8115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 10244 8691 gene locus_tag LOCUS_10160 gene guaA 10244 8691 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548925.1 protein_id gnl|my_center|LOCUS_10160 11401 10244 gene locus_tag LOCUS_10170 11401 10244 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254072.1 protein_id gnl|my_center|LOCUS_10170 11756 12325 gene locus_tag LOCUS_10180 11756 12325 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254090.1 protein_id gnl|my_center|LOCUS_10180 12355 13647 gene locus_tag LOCUS_10190 12355 13647 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548915.1 protein_id gnl|my_center|LOCUS_10190 14076 13717 gene locus_tag LOCUS_10200 14076 13717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224434963.1 protein_id gnl|my_center|LOCUS_10200 15376 14069 gene locus_tag LOCUS_10210 15376 14069 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564452.1 protein_id gnl|my_center|LOCUS_10210 16497 15505 gene locus_tag LOCUS_10220 16497 15505 CDS product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254608.1 protein_id gnl|my_center|LOCUS_10220 16683 17972 gene locus_tag LOCUS_10230 16683 17972 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549585.1 protein_id gnl|my_center|LOCUS_10230 18517 18056 gene locus_tag LOCUS_10240 gene greA 18517 18056 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548866.1 protein_id gnl|my_center|LOCUS_10240 18745 19170 gene locus_tag LOCUS_10250 18745 19170 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254076.1 protein_id gnl|my_center|LOCUS_10250 19267 20580 gene locus_tag LOCUS_10260 19267 20580 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254075.1 protein_id gnl|my_center|LOCUS_10260 20632 21945 gene locus_tag LOCUS_10270 20632 21945 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254075.1 protein_id gnl|my_center|LOCUS_10270 22215 22078 gene locus_tag LOCUS_10280 22215 22078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 23250 22297 gene locus_tag LOCUS_10290 23250 22297 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548861.1 protein_id gnl|my_center|LOCUS_10290 24308 23265 gene locus_tag LOCUS_10300 24308 23265 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476524.1 protein_id gnl|my_center|LOCUS_10300 25353 24322 gene locus_tag LOCUS_10310 25353 24322 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254074.1 protein_id gnl|my_center|LOCUS_10310 26295 25375 gene locus_tag LOCUS_10320 26295 25375 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254073.1 protein_id gnl|my_center|LOCUS_10320 28365 26719 gene locus_tag LOCUS_10330 28365 26719 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_154881464.1 protein_id gnl|my_center|LOCUS_10330 29087 28476 gene locus_tag LOCUS_10340 29087 28476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10340 29554 29084 gene locus_tag LOCUS_10350 29554 29084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10350 29970 29758 gene locus_tag LOCUS_10360 29970 29758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10360 31923 30295 gene locus_tag LOCUS_10370 31923 30295 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548835.1 protein_id gnl|my_center|LOCUS_10370 33123 32164 gene locus_tag LOCUS_10380 33123 32164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10380 33339 33127 gene locus_tag LOCUS_10390 33339 33127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10390 33689 33363 gene locus_tag LOCUS_10400 33689 33363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10400 33637 33849 gene locus_tag LOCUS_10410 33637 33849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 34650 34000 gene locus_tag LOCUS_10420 34650 34000 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254070.1 protein_id gnl|my_center|LOCUS_10420 36015 34750 gene locus_tag LOCUS_10430 36015 34750 CDS product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100975.1 protein_id gnl|my_center|LOCUS_10430 36308 36039 gene locus_tag LOCUS_10440 36308 36039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10440 37084 36350 gene locus_tag LOCUS_10450 37084 36350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10450 37426 37166 gene locus_tag LOCUS_10460 37426 37166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10460 37841 37452 gene locus_tag LOCUS_10470 37841 37452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 38083 37886 gene locus_tag LOCUS_10480 38083 37886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 39654 38467 gene locus_tag LOCUS_10490 39654 38467 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642297.1 protein_id gnl|my_center|LOCUS_10490 40088 39681 gene locus_tag LOCUS_10500 40088 39681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10500 40409 40101 gene locus_tag LOCUS_10510 40409 40101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10510 41071 40706 gene locus_tag LOCUS_10520 41071 40706 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254569.1 protein_id gnl|my_center|LOCUS_10520 >Feature sequence14 403 32 gene locus_tag LOCUS_10530 403 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 1679 504 gene locus_tag LOCUS_10540 1679 504 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548117.1 protein_id gnl|my_center|LOCUS_10540 3311 1974 gene locus_tag LOCUS_10550 gene glnA 3311 1974 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548245.1 protein_id gnl|my_center|LOCUS_10550 4423 3449 gene locus_tag LOCUS_10560 4423 3449 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548246.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10560 4651 4511 gene locus_tag LOCUS_10570 4651 4511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10570 5629 4703 gene locus_tag LOCUS_10580 gene miaA 5629 4703 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548247.1 protein_id gnl|my_center|LOCUS_10580 6111 5710 gene locus_tag LOCUS_10590 6111 5710 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548248.1 protein_id gnl|my_center|LOCUS_10590 6404 6174 gene locus_tag LOCUS_10600 6404 6174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 7072 6401 gene locus_tag LOCUS_10610 7072 6401 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254484.1 protein_id gnl|my_center|LOCUS_10610 7286 7065 gene locus_tag LOCUS_10620 7286 7065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10620 7638 7294 gene locus_tag LOCUS_10630 7638 7294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10630 7842 7693 gene locus_tag LOCUS_10640 gene rpmG 7842 7693 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548272.1 protein_id gnl|my_center|LOCUS_10640 10043 7929 gene locus_tag LOCUS_10650 10043 7929 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254485.1 protein_id gnl|my_center|LOCUS_10650 10212 12710 gene locus_tag LOCUS_10660 10212 12710 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548276.1 protein_id gnl|my_center|LOCUS_10660 13250 12762 gene locus_tag LOCUS_10670 gene greA 13250 12762 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548292.1 protein_id gnl|my_center|LOCUS_10670 15732 13321 gene locus_tag LOCUS_10680 gene pheT 15732 13321 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548294.1 protein_id gnl|my_center|LOCUS_10680 16781 15732 gene locus_tag LOCUS_10690 gene pheS 16781 15732 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548296.1 protein_id gnl|my_center|LOCUS_10690 17413 17063 gene locus_tag LOCUS_10700 17413 17063 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254487.1 protein_id gnl|my_center|LOCUS_10700 18277 17495 gene locus_tag LOCUS_10710 18277 17495 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548298.1 protein_id gnl|my_center|LOCUS_10710 18343 18615 gene locus_tag LOCUS_10720 18343 18615 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548299.1 protein_id gnl|my_center|LOCUS_10720 18649 19611 gene locus_tag LOCUS_10730 gene yidC 18649 19611 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254488.1 protein_id gnl|my_center|LOCUS_10730 21297 19705 gene locus_tag LOCUS_10740 21297 19705 CDS product HAMP domain-containing histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254489.1 protein_id gnl|my_center|LOCUS_10740 22003 21290 gene locus_tag LOCUS_10750 22003 21290 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548305.1 protein_id gnl|my_center|LOCUS_10750 22760 22182 gene locus_tag LOCUS_10760 22760 22182 CDS product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548307.1 protein_id gnl|my_center|LOCUS_10760 23914 22760 gene locus_tag LOCUS_10770 23914 22760 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548309.1 protein_id gnl|my_center|LOCUS_10770 24264 23917 gene locus_tag LOCUS_10780 gene rsfS 24264 23917 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548311.1 protein_id gnl|my_center|LOCUS_10780 24899 24306 gene locus_tag LOCUS_10790 gene yqeK 24899 24306 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548313.1 protein_id gnl|my_center|LOCUS_10790 25530 24892 gene locus_tag LOCUS_10800 25530 24892 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548315.1 protein_id gnl|my_center|LOCUS_10800 26650 25541 gene locus_tag LOCUS_10810 gene yqeH 26650 25541 CDS product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548317.1 protein_id gnl|my_center|LOCUS_10810 27115 26759 gene locus_tag LOCUS_10820 gene rplT 27115 26759 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548326.1 protein_id gnl|my_center|LOCUS_10820 27360 27160 gene locus_tag LOCUS_10830 gene rpmI 27360 27160 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548328.1 protein_id gnl|my_center|LOCUS_10830 27902 27381 gene locus_tag LOCUS_10840 gene infC 27902 27381 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075917325.1 protein_id gnl|my_center|LOCUS_10840 28304 28116 gene locus_tag LOCUS_10850 28304 28116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 28455 29855 gene locus_tag LOCUS_10860 28455 29855 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114264.1 protein_id gnl|my_center|LOCUS_10860 30172 29936 gene locus_tag LOCUS_10870 30172 29936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 30812 30192 gene locus_tag LOCUS_10880 30812 30192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547377.1 protein_id gnl|my_center|LOCUS_10880 32930 30999 gene locus_tag LOCUS_10890 gene thrS 32930 30999 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548338.1 protein_id gnl|my_center|LOCUS_10890 34154 33231 gene locus_tag LOCUS_10900 gene dnaI 34154 33231 CDS product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254494.1 protein_id gnl|my_center|LOCUS_10900 35499 34165 gene locus_tag LOCUS_10910 35499 34165 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548343.1 protein_id gnl|my_center|LOCUS_10910 35970 35503 gene locus_tag LOCUS_10920 gene nrdR 35970 35503 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548345.1 protein_id gnl|my_center|LOCUS_10920 36568 35984 gene locus_tag LOCUS_10930 gene coaE 36568 35984 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548347.1 protein_id gnl|my_center|LOCUS_10930 37398 36577 gene locus_tag LOCUS_10940 gene mutM 37398 36577 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548349.1 protein_id gnl|my_center|LOCUS_10940 40069 37409 gene locus_tag LOCUS_10950 gene polA 40069 37409 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548351.1 protein_id gnl|my_center|LOCUS_10950 40617 40141 gene locus_tag LOCUS_10960 40617 40141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10960 41255 40590 gene locus_tag LOCUS_10970 41255 40590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10970 >Feature sequence15 785 534 gene locus_tag LOCUS_10980 785 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 1555 788 gene locus_tag LOCUS_10990 gene fetB 1555 788 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254483.1 protein_id gnl|my_center|LOCUS_10990 2190 1552 gene locus_tag LOCUS_11000 2190 1552 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548243.1 protein_id gnl|my_center|LOCUS_11000 2397 2325 gene locus_tag LOCUS_t00170 2397 2325 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2654 2493 gene locus_tag LOCUS_11010 2654 2493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 5175 2674 gene locus_tag LOCUS_11020 gene lanKC 5175 2674 CDS product class III lanthionine synthetase LanKC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127742798.1 protein_id gnl|my_center|LOCUS_11020 6891 5182 gene locus_tag LOCUS_11030 6891 5182 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546396.1 protein_id gnl|my_center|LOCUS_11030 7062 6895 gene locus_tag LOCUS_11040 7062 6895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 7251 7084 gene locus_tag LOCUS_11050 7251 7084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 7435 8514 gene locus_tag LOCUS_11060 7435 8514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11060 8547 8738 gene locus_tag LOCUS_11070 8547 8738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 8744 9526 gene locus_tag LOCUS_11080 8744 9526 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721674.1 protein_id gnl|my_center|LOCUS_11080 9711 9556 gene locus_tag LOCUS_11090 9711 9556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11090 10908 9958 gene locus_tag LOCUS_11100 10908 9958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11100 12038 11076 gene locus_tag LOCUS_11110 12038 11076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 12672 12193 gene locus_tag LOCUS_11120 12672 12193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 12999 12925 gene locus_tag LOCUS_t00180 12999 12925 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 13127 13831 gene locus_tag LOCUS_11130 13127 13831 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966920.1 protein_id gnl|my_center|LOCUS_11130 14166 13942 gene locus_tag LOCUS_11140 14166 13942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 14568 14179 gene locus_tag LOCUS_11150 14568 14179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 14718 16823 gene locus_tag LOCUS_11160 14718 16823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 16931 18088 gene locus_tag LOCUS_11170 16931 18088 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254005.1 protein_id gnl|my_center|LOCUS_11170 19507 18137 gene locus_tag LOCUS_11180 gene dnaB 19507 18137 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549341.1 protein_id gnl|my_center|LOCUS_11180 19986 19531 gene locus_tag LOCUS_11190 gene rplI 19986 19531 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549343.1 protein_id gnl|my_center|LOCUS_11190 22030 20009 gene locus_tag LOCUS_11200 22030 20009 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549345.1 protein_id gnl|my_center|LOCUS_11200 22407 22171 gene locus_tag LOCUS_11210 gene rpsR 22407 22171 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549366.1 protein_id gnl|my_center|LOCUS_11210 23009 22434 gene locus_tag LOCUS_11220 gene ssb 23009 22434 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254001.1 protein_id gnl|my_center|LOCUS_11220 23343 23050 gene locus_tag LOCUS_11230 gene rpsF 23343 23050 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549370.1 protein_id gnl|my_center|LOCUS_11230 26030 23559 gene locus_tag LOCUS_11240 gene gyrA 26030 23559 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549372.1 protein_id gnl|my_center|LOCUS_11240 28004 26043 gene locus_tag LOCUS_11250 gene gyrB 28004 26043 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549374.1 protein_id gnl|my_center|LOCUS_11250 29133 27988 gene locus_tag LOCUS_11260 gene recF 29133 27988 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549377.1 protein_id gnl|my_center|LOCUS_11260 29357 29133 gene locus_tag LOCUS_11270 gene yaaA 29357 29133 CDS product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254000.1 protein_id gnl|my_center|LOCUS_11270 30715 29588 gene locus_tag LOCUS_11280 gene dnaN 30715 29588 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549381.1 protein_id gnl|my_center|LOCUS_11280 32260 30896 gene locus_tag LOCUS_11290 gene dnaA 32260 30896 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011253999.1 protein_id gnl|my_center|LOCUS_11290 32433 32627 gene locus_tag LOCUS_11300 32433 32627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 32925 33290 gene locus_tag LOCUS_11310 gene rnpA 32925 33290 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549413.1 protein_id gnl|my_center|LOCUS_11310 33290 34159 gene locus_tag LOCUS_11320 33290 34159 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254638.1 protein_id gnl|my_center|LOCUS_11320 34267 35100 gene locus_tag LOCUS_11330 34267 35100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11330 35087 35653 gene locus_tag LOCUS_11340 35087 35653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11340 35680 37575 gene locus_tag LOCUS_11350 gene mnmG 35680 37575 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549419.1 protein_id gnl|my_center|LOCUS_11350 >Feature sequence16 128 343 gene locus_tag LOCUS_11360 128 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11360 352 495 gene locus_tag LOCUS_11370 352 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 906 565 gene locus_tag LOCUS_11380 906 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 1385 1005 gene locus_tag LOCUS_11390 1385 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 1738 1403 gene locus_tag LOCUS_11400 1738 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 1841 1698 gene locus_tag LOCUS_11410 1841 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 2449 1970 gene locus_tag LOCUS_11420 gene rlmH 2449 1970 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548590.1 protein_id gnl|my_center|LOCUS_11420 4225 2942 gene locus_tag LOCUS_11430 4225 2942 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613276.1 protein_id gnl|my_center|LOCUS_11430 5117 4320 gene locus_tag LOCUS_11440 5117 4320 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254029.1 protein_id gnl|my_center|LOCUS_11440 5936 5136 gene locus_tag LOCUS_11450 5936 5136 CDS product two-component system regulatory protein YycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548584.1 protein_id gnl|my_center|LOCUS_11450 7484 5937 gene locus_tag LOCUS_11460 7484 5937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548582.1 protein_id gnl|my_center|LOCUS_11460 9381 7474 gene locus_tag LOCUS_11470 gene walK 9381 7474 CDS product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254027.1 protein_id gnl|my_center|LOCUS_11470 10144 9416 gene locus_tag LOCUS_11480 gene yycF 10144 9416 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548578.1 protein_id gnl|my_center|LOCUS_11480 10271 10343 gene locus_tag LOCUS_t00190 10271 10343 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 10403 11179 gene locus_tag LOCUS_11490 10403 11179 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254023.1 protein_id gnl|my_center|LOCUS_11490 11207 12031 gene locus_tag LOCUS_11500 11207 12031 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254021.1 protein_id gnl|my_center|LOCUS_11500 12410 13012 gene locus_tag LOCUS_11510 12410 13012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11510 13028 13891 gene locus_tag LOCUS_11520 13028 13891 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548564.1 protein_id gnl|my_center|LOCUS_11520 14307 14110 gene locus_tag LOCUS_11530 14307 14110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11530 16009 14348 gene locus_tag LOCUS_11540 16009 14348 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193363685.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11540 16194 17108 gene locus_tag LOCUS_11550 16194 17108 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102188.1 protein_id gnl|my_center|LOCUS_11550 18079 17243 gene locus_tag LOCUS_11560 18079 17243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 18330 18872 gene locus_tag LOCUS_11570 18330 18872 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003662275.1 protein_id gnl|my_center|LOCUS_11570 19073 20299 gene locus_tag LOCUS_11580 19073 20299 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288985.1 protein_id gnl|my_center|LOCUS_11580 21018 21941 gene locus_tag LOCUS_11590 21018 21941 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547001.1 protein_id gnl|my_center|LOCUS_11590 22930 21992 gene locus_tag LOCUS_11600 22930 21992 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965901.1 protein_id gnl|my_center|LOCUS_11600 23297 23103 gene locus_tag LOCUS_11610 23297 23103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 23980 23360 gene locus_tag LOCUS_11620 23980 23360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547377.1 protein_id gnl|my_center|LOCUS_11620 25361 24237 gene locus_tag LOCUS_11630 25361 24237 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547400.1 protein_id gnl|my_center|LOCUS_11630 25493 26407 gene locus_tag LOCUS_11640 25493 26407 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263217.1 protein_id gnl|my_center|LOCUS_11640 26634 27335 gene locus_tag LOCUS_11650 26634 27335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 27416 28648 gene locus_tag LOCUS_11660 27416 28648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11660 28587 29315 gene locus_tag LOCUS_11670 28587 29315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11670 29452 31020 gene locus_tag LOCUS_11680 29452 31020 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254430.1 protein_id gnl|my_center|LOCUS_11680 31017 32594 gene locus_tag LOCUS_11690 31017 32594 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547992.1 protein_id gnl|my_center|LOCUS_11690 32757 33056 gene locus_tag LOCUS_11700 32757 33056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 >Feature sequence17 37 2607 gene locus_tag LOCUS_11710 gene mutS 37 2607 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254144.1 protein_id gnl|my_center|LOCUS_11710 2607 4568 gene locus_tag LOCUS_11720 gene mutL 2607 4568 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549162.1 protein_id gnl|my_center|LOCUS_11720 4578 5171 gene locus_tag LOCUS_11730 gene ruvA 4578 5171 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549165.1 protein_id gnl|my_center|LOCUS_11730 5185 6195 gene locus_tag LOCUS_11740 gene ruvB 5185 6195 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549167.1 protein_id gnl|my_center|LOCUS_11740 6284 6679 gene locus_tag LOCUS_11750 6284 6679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 6772 8220 gene locus_tag LOCUS_11760 gene zwf 6772 8220 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549170.1 protein_id gnl|my_center|LOCUS_11760 8220 9335 gene locus_tag LOCUS_11770 gene dinB 8220 9335 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549172.1 protein_id gnl|my_center|LOCUS_11770 9398 10357 gene locus_tag LOCUS_11780 9398 10357 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254146.1 protein_id gnl|my_center|LOCUS_11780 10350 11711 gene locus_tag LOCUS_11790 10350 11711 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549176.1 protein_id gnl|my_center|LOCUS_11790 11950 14583 gene locus_tag LOCUS_11800 gene alaS 11950 14583 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549179.1 protein_id gnl|my_center|LOCUS_11800 14649 14906 gene locus_tag LOCUS_11810 14649 14906 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549189.1 protein_id gnl|my_center|LOCUS_11810 14906 15334 gene locus_tag LOCUS_11820 gene ruvX 14906 15334 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549192.1 protein_id gnl|my_center|LOCUS_11820 15337 15660 gene locus_tag LOCUS_11830 15337 15660 CDS product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549194.1 protein_id gnl|my_center|LOCUS_11830 15724 18087 gene locus_tag LOCUS_11840 15724 18087 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549197.1 protein_id gnl|my_center|LOCUS_11840 18181 18492 gene locus_tag LOCUS_11850 gene trxA 18181 18492 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254147.1 protein_id gnl|my_center|LOCUS_11850 18969 18574 gene locus_tag LOCUS_11860 18969 18574 CDS product YslB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549202.1 protein_id gnl|my_center|LOCUS_11860 19208 19828 gene locus_tag LOCUS_11870 19208 19828 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549206.1 protein_id gnl|my_center|LOCUS_11870 20719 19868 gene locus_tag LOCUS_11880 20719 19868 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641536.1 protein_id gnl|my_center|LOCUS_11880 20850 21269 gene locus_tag LOCUS_11890 20850 21269 CDS product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549209.1 protein_id gnl|my_center|LOCUS_11890 21292 21660 gene locus_tag LOCUS_11900 21292 21660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549212.1 protein_id gnl|my_center|LOCUS_11900 21922 21722 gene locus_tag LOCUS_11910 21922 21722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 22018 22263 gene locus_tag LOCUS_11920 22018 22263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 23434 22328 gene locus_tag LOCUS_11930 23434 22328 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549213.1 protein_id gnl|my_center|LOCUS_11930 23587 24588 gene locus_tag LOCUS_11940 23587 24588 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549214.1 protein_id gnl|my_center|LOCUS_11940 24695 25027 gene locus_tag LOCUS_11950 24695 25027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613308.1 protein_id gnl|my_center|LOCUS_11950 25038 26468 gene locus_tag LOCUS_11960 25038 26468 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254152.1 protein_id gnl|my_center|LOCUS_11960 26416 26961 gene locus_tag LOCUS_11970 26416 26961 CDS product YutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549221.1 protein_id gnl|my_center|LOCUS_11970 26958 27728 gene locus_tag LOCUS_11980 26958 27728 CDS product TIGR01457 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549224.1 protein_id gnl|my_center|LOCUS_11980 27725 28330 gene locus_tag LOCUS_11990 27725 28330 CDS product TIGR01906 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254154.1 protein_id gnl|my_center|LOCUS_11990 29061 28402 gene locus_tag LOCUS_12000 29061 28402 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549229.1 protein_id gnl|my_center|LOCUS_12000 30022 29096 gene locus_tag LOCUS_12010 30022 29096 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014565583.1 protein_id gnl|my_center|LOCUS_12010 >Feature sequence18 3330 331 gene locus_tag LOCUS_12020 3330 331 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548819.1 protein_id gnl|my_center|LOCUS_12020 4020 3403 gene locus_tag LOCUS_12030 4020 3403 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548818.1 protein_id gnl|my_center|LOCUS_12030 5312 4023 gene locus_tag LOCUS_12040 5312 4023 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548816.1 protein_id gnl|my_center|LOCUS_12040 6253 5564 gene locus_tag LOCUS_12050 6253 5564 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548802.1 protein_id gnl|my_center|LOCUS_12050 6417 7166 gene locus_tag LOCUS_12060 6417 7166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 7383 8012 gene locus_tag LOCUS_12070 7383 8012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12070 9921 8083 gene locus_tag LOCUS_12080 9921 8083 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254067.1 protein_id gnl|my_center|LOCUS_12080 11642 10032 gene locus_tag LOCUS_12090 11642 10032 CDS product SLAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548796.1 protein_id gnl|my_center|LOCUS_12090 12868 11663 gene locus_tag LOCUS_12100 gene acmB 12868 11663 CDS product beta-N-acetylglucosaminidase AcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548795.1 protein_id gnl|my_center|LOCUS_12100 13372 13136 gene locus_tag LOCUS_12110 13372 13136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 13641 13432 gene locus_tag LOCUS_12120 13641 13432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 13855 14802 gene locus_tag LOCUS_12130 13855 14802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 14919 15335 gene locus_tag LOCUS_12140 14919 15335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548785.1 protein_id gnl|my_center|LOCUS_12140 15503 17533 gene locus_tag LOCUS_12150 15503 17533 CDS product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087236515.1 protein_id gnl|my_center|LOCUS_12150 19802 17850 gene locus_tag LOCUS_12160 19802 17850 CDS product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548782.1 protein_id gnl|my_center|LOCUS_12160 20165 19827 gene locus_tag LOCUS_12170 20165 19827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 21473 20253 gene locus_tag LOCUS_12180 21473 20253 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548780.1 protein_id gnl|my_center|LOCUS_12180 22016 21573 gene locus_tag LOCUS_12190 22016 21573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 22275 22120 gene locus_tag LOCUS_12200 22275 22120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12200 23107 22385 gene locus_tag LOCUS_12210 gene nrdG 23107 22385 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548777.1 protein_id gnl|my_center|LOCUS_12210 25389 23179 gene locus_tag LOCUS_12220 gene nrdD 25389 23179 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254061.1 protein_id gnl|my_center|LOCUS_12220 >Feature sequence19 468 70 gene locus_tag LOCUS_12230 468 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 1994 741 gene locus_tag LOCUS_12240 1994 741 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642438.1 protein_id gnl|my_center|LOCUS_12240 2134 3048 gene locus_tag LOCUS_12250 2134 3048 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642437.1 protein_id gnl|my_center|LOCUS_12250 3283 4980 gene locus_tag LOCUS_12260 gene argS 3283 4980 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475862.1 protein_id gnl|my_center|LOCUS_12260 5200 5673 gene locus_tag LOCUS_12270 5200 5673 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475605.1 protein_id gnl|my_center|LOCUS_12270 5685 6884 gene locus_tag LOCUS_12280 gene coaBC 5685 6884 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254293.1 protein_id gnl|my_center|LOCUS_12280 7013 7987 gene locus_tag LOCUS_12290 7013 7987 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209628184.1 protein_id gnl|my_center|LOCUS_12290 7989 8939 gene locus_tag LOCUS_12300 7989 8939 CDS product 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254294.1 protein_id gnl|my_center|LOCUS_12300 9014 10783 gene locus_tag LOCUS_12310 gene recQ 9014 10783 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547178.1 protein_id gnl|my_center|LOCUS_12310 11778 10840 gene locus_tag LOCUS_12320 11778 10840 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254272.1 protein_id gnl|my_center|LOCUS_12320 12052 13854 gene locus_tag LOCUS_12330 gene uvrC 12052 13854 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547051.1 protein_id gnl|my_center|LOCUS_12330 13992 15245 gene locus_tag LOCUS_12340 gene obgE 13992 15245 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254297.1 protein_id gnl|my_center|LOCUS_12340 15297 16910 gene locus_tag LOCUS_12350 15297 16910 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025015105.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12350 16927 17241 gene locus_tag LOCUS_12360 16927 17241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12360 17278 18207 gene locus_tag LOCUS_12370 gene rnz 17278 18207 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547055.1 protein_id gnl|my_center|LOCUS_12370 18209 19012 gene locus_tag LOCUS_12380 18209 19012 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547056.1 protein_id gnl|my_center|LOCUS_12380 19127 19318 gene locus_tag LOCUS_12390 gene rpmF 19127 19318 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547064.1 protein_id gnl|my_center|LOCUS_12390 19387 20952 gene locus_tag LOCUS_12400 19387 20952 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547066.1 protein_id gnl|my_center|LOCUS_12400 21038 22954 gene locus_tag LOCUS_12410 21038 22954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 23172 22951 gene locus_tag LOCUS_12420 23172 22951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12420 23553 23374 gene locus_tag LOCUS_12430 23553 23374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 23701 24264 gene locus_tag LOCUS_12440 23701 24264 CDS product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228042.1 protein_id gnl|my_center|LOCUS_12440 24360 24602 gene locus_tag LOCUS_12450 24360 24602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12450 24554 24880 gene locus_tag LOCUS_12460 24554 24880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12460 25378 24995 gene locus_tag LOCUS_12470 25378 24995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12470 25533 25375 gene locus_tag LOCUS_12480 25533 25375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12480 25733 25593 gene locus_tag LOCUS_12490 25733 25593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 >Feature sequence20 201 677 gene locus_tag LOCUS_12500 201 677 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837026.1 protein_id gnl|my_center|LOCUS_12500 747 2285 gene locus_tag LOCUS_12510 747 2285 CDS product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549425.1 protein_id gnl|my_center|LOCUS_12510 3672 2362 gene locus_tag LOCUS_12520 3672 2362 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025014283.1 protein_id gnl|my_center|LOCUS_12520 4637 3891 gene locus_tag LOCUS_12530 4637 3891 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568275.1 protein_id gnl|my_center|LOCUS_12530 6117 4657 gene locus_tag LOCUS_12540 6117 4657 CDS product amino acid ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643977.1 protein_id gnl|my_center|LOCUS_12540 7107 6409 gene locus_tag LOCUS_12550 7107 6409 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549464.1 protein_id gnl|my_center|LOCUS_12550 7772 7125 gene locus_tag LOCUS_12560 7772 7125 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549467.1 protein_id gnl|my_center|LOCUS_12560 7984 8238 gene locus_tag LOCUS_12570 7984 8238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 8228 9196 gene locus_tag LOCUS_12580 8228 9196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 9837 10088 gene locus_tag LOCUS_12590 9837 10088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 10323 10114 gene locus_tag LOCUS_12600 10323 10114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 11333 10620 gene locus_tag LOCUS_12610 gene nagB 11333 10620 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549469.1 protein_id gnl|my_center|LOCUS_12610 11524 12366 gene locus_tag LOCUS_12620 11524 12366 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549471.1 protein_id gnl|my_center|LOCUS_12620 12564 12830 gene locus_tag LOCUS_12630 12564 12830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 13068 12871 gene locus_tag LOCUS_12640 13068 12871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 14260 13304 gene locus_tag LOCUS_12650 14260 13304 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549473.1 protein_id gnl|my_center|LOCUS_12650 15399 14260 gene locus_tag LOCUS_12660 15399 14260 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549477.1 protein_id gnl|my_center|LOCUS_12660 16936 15392 gene locus_tag LOCUS_12670 16936 15392 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549479.1 protein_id gnl|my_center|LOCUS_12670 18109 17024 gene locus_tag LOCUS_12680 18109 17024 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549489.1 protein_id gnl|my_center|LOCUS_12680 20401 18704 gene locus_tag LOCUS_12690 20401 18704 CDS product adenine deaminase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384673.1 protein_id gnl|my_center|LOCUS_12690 21524 20463 gene locus_tag LOCUS_12700 21524 20463 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379352.1 protein_id gnl|my_center|LOCUS_12700 22591 21557 gene locus_tag LOCUS_12710 22591 21557 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002413403.1 protein_id gnl|my_center|LOCUS_12710 23389 22601 gene locus_tag LOCUS_12720 23389 22601 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357916.1 protein_id gnl|my_center|LOCUS_12720 24212 23382 gene locus_tag LOCUS_12730 24212 23382 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382189.1 protein_id gnl|my_center|LOCUS_12730 24707 25039 gene locus_tag LOCUS_12740 24707 25039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 >Feature sequence21 756 331 gene locus_tag LOCUS_12750 756 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 1025 1657 gene locus_tag LOCUS_12760 1025 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12760 3006 1687 gene locus_tag LOCUS_12770 gene murC 3006 1687 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548413.1 protein_id gnl|my_center|LOCUS_12770 3773 3126 gene locus_tag LOCUS_12780 3773 3126 CDS product DUF4479 and tRNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548415.1 protein_id gnl|my_center|LOCUS_12780 4116 3796 gene locus_tag LOCUS_12790 4116 3796 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254504.1 protein_id gnl|my_center|LOCUS_12790 4851 4195 gene locus_tag LOCUS_12800 gene trmB 4851 4195 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548419.1 protein_id gnl|my_center|LOCUS_12800 6145 4928 gene locus_tag LOCUS_12810 6145 4928 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613400.1 protein_id gnl|my_center|LOCUS_12810 6899 6138 gene locus_tag LOCUS_12820 6899 6138 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548423.1 protein_id gnl|my_center|LOCUS_12820 6982 7419 gene locus_tag LOCUS_12830 6982 7419 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548425.1 protein_id gnl|my_center|LOCUS_12830 7436 7786 gene locus_tag LOCUS_12840 7436 7786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 8795 7866 gene locus_tag LOCUS_12850 8795 7866 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254443.1 protein_id gnl|my_center|LOCUS_12850 9068 9790 gene locus_tag LOCUS_12860 gene pyrF 9068 9790 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548039.1 protein_id gnl|my_center|LOCUS_12860 9780 10403 gene locus_tag LOCUS_12870 gene pyrE 9780 10403 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548040.1 protein_id gnl|my_center|LOCUS_12870 10530 11441 gene locus_tag LOCUS_12880 10530 11441 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254505.1 protein_id gnl|my_center|LOCUS_12880 12065 11523 gene locus_tag LOCUS_12890 12065 11523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 12504 12136 gene locus_tag LOCUS_12900 12504 12136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 13845 13042 gene locus_tag LOCUS_12910 13845 13042 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254506.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12910 16264 13838 gene locus_tag LOCUS_12920 16264 13838 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254507.1 protein_id gnl|my_center|LOCUS_12920 17466 16261 gene locus_tag LOCUS_12930 17466 16261 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548436.1 protein_id gnl|my_center|LOCUS_12930 17822 17469 gene locus_tag LOCUS_12940 17822 17469 CDS product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548438.1 protein_id gnl|my_center|LOCUS_12940 19951 17864 gene locus_tag LOCUS_12950 19951 17864 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548440.1 protein_id gnl|my_center|LOCUS_12950 20092 20940 gene locus_tag LOCUS_12960 20092 20940 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548442.1 protein_id gnl|my_center|LOCUS_12960 21946 21035 gene locus_tag LOCUS_12970 gene fba 21946 21035 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254510.1 protein_id gnl|my_center|LOCUS_12970 22584 22072 gene locus_tag LOCUS_12980 22584 22072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 23510 23139 gene locus_tag LOCUS_12990 23510 23139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 23706 23915 gene locus_tag LOCUS_13000 23706 23915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 24293 23901 gene locus_tag LOCUS_13010 24293 23901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 >Feature sequence22 235 744 gene locus_tag LOCUS_13020 235 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13020 1090 806 gene locus_tag LOCUS_13030 1090 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 2291 1146 gene locus_tag LOCUS_13040 2291 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13040 3798 2485 gene locus_tag LOCUS_13050 3798 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13050 4102 3842 gene locus_tag LOCUS_13060 4102 3842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 5171 4095 gene locus_tag LOCUS_13070 gene carA 5171 4095 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429883.1 protein_id gnl|my_center|LOCUS_13070 5610 5846 gene locus_tag LOCUS_13080 5610 5846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 7330 6044 gene locus_tag LOCUS_13090 7330 6044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 7424 7855 gene locus_tag LOCUS_13100 7424 7855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 7789 8160 gene locus_tag LOCUS_13110 7789 8160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 8324 8560 gene locus_tag LOCUS_13120 8324 8560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 8604 9089 gene locus_tag LOCUS_13130 8604 9089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13130 9499 10065 gene locus_tag LOCUS_13140 9499 10065 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290383.1 protein_id gnl|my_center|LOCUS_13140 10604 10257 gene locus_tag LOCUS_13150 10604 10257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 11356 11634 gene locus_tag LOCUS_13160 11356 11634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13160 11939 12127 gene locus_tag LOCUS_13170 11939 12127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 12042 12404 gene locus_tag LOCUS_13180 12042 12404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 12503 12937 gene locus_tag LOCUS_13190 12503 12937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 12950 13348 gene locus_tag LOCUS_13200 12950 13348 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462027.1 protein_id gnl|my_center|LOCUS_13200 13562 13888 gene locus_tag LOCUS_13210 13562 13888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 14050 14802 gene locus_tag LOCUS_13220 14050 14802 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549987.1 protein_id gnl|my_center|LOCUS_13220 14825 16699 gene locus_tag LOCUS_13230 14825 16699 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549988.1 protein_id gnl|my_center|LOCUS_13230 16908 16762 gene locus_tag LOCUS_13240 16908 16762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 17444 17238 gene locus_tag LOCUS_13250 17444 17238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 17897 17553 gene locus_tag LOCUS_13260 17897 17553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13260 18132 19601 gene locus_tag LOCUS_13270 18132 19601 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352327.1 protein_id gnl|my_center|LOCUS_13270 20076 19663 gene locus_tag LOCUS_13280 20076 19663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 20446 20063 gene locus_tag LOCUS_13290 20446 20063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 20675 20499 gene locus_tag LOCUS_13300 20675 20499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 20965 21171 gene locus_tag LOCUS_13310 20965 21171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 22350 21793 gene locus_tag LOCUS_13320 22350 21793 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467655.1 protein_id gnl|my_center|LOCUS_13320 <23087 22576 gene locus_tag LOCUS_13330 <23087 22576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014565478.1:SLAP domain-containing protein >Feature sequence23 574 299 gene locus_tag LOCUS_13340 574 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13340 1177 1686 gene locus_tag LOCUS_13350 gene rplJ 1177 1686 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549105.1 protein_id gnl|my_center|LOCUS_13350 1739 2104 gene locus_tag LOCUS_13360 gene rplL 1739 2104 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254128.1 protein_id gnl|my_center|LOCUS_13360 2393 2271 gene locus_tag LOCUS_13370 2393 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 2764 3264 gene locus_tag LOCUS_13380 2764 3264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13380 3544 4383 gene locus_tag LOCUS_13390 3544 4383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13390 4780 4547 gene locus_tag LOCUS_13400 4780 4547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 5291 4806 gene locus_tag LOCUS_13410 5291 4806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13410 5321 5461 gene locus_tag LOCUS_13420 5321 5461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 5872 5651 gene locus_tag LOCUS_13430 5872 5651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 6065 6241 gene locus_tag LOCUS_13440 6065 6241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13440 6320 6442 gene locus_tag LOCUS_13450 6320 6442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 6600 6872 gene locus_tag LOCUS_13460 6600 6872 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547110.1 protein_id gnl|my_center|LOCUS_13460 7029 8156 gene locus_tag LOCUS_13470 7029 8156 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025079807.1 protein_id gnl|my_center|LOCUS_13470 8256 9374 gene locus_tag LOCUS_13480 8256 9374 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254271.1 protein_id gnl|my_center|LOCUS_13480 9660 9505 gene locus_tag LOCUS_13490 9660 9505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 9815 9651 gene locus_tag LOCUS_13500 9815 9651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 10159 9950 gene locus_tag LOCUS_13510 10159 9950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 10464 10742 gene locus_tag LOCUS_13520 10464 10742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 10838 13666 gene locus_tag LOCUS_13530 10838 13666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 13757 14287 gene locus_tag LOCUS_13540 gene pyrR 13757 14287 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546345.1 protein_id gnl|my_center|LOCUS_13540 14289 14891 gene locus_tag LOCUS_13550 14289 14891 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254130.1 protein_id gnl|my_center|LOCUS_13550 14891 15400 gene locus_tag LOCUS_13560 gene tadA 14891 15400 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254132.1 protein_id gnl|my_center|LOCUS_13560 15560 17383 gene locus_tag LOCUS_13570 gene dnaX 15560 17383 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549111.1 protein_id gnl|my_center|LOCUS_13570 17465 17794 gene locus_tag LOCUS_13580 17465 17794 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549112.1 protein_id gnl|my_center|LOCUS_13580 17796 18395 gene locus_tag LOCUS_13590 gene recR 17796 18395 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549113.1 protein_id gnl|my_center|LOCUS_13590 18397 18633 gene locus_tag LOCUS_13600 18397 18633 CDS product YaaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549114.1 protein_id gnl|my_center|LOCUS_13600 18763 19401 gene locus_tag LOCUS_13610 gene tmk 18763 19401 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254134.1 protein_id gnl|my_center|LOCUS_13610 19413 19739 gene locus_tag LOCUS_13620 19413 19739 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549116.1 protein_id gnl|my_center|LOCUS_13620 19739 20611 gene locus_tag LOCUS_13630 19739 20611 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549117.1 protein_id gnl|my_center|LOCUS_13630 20626 20958 gene locus_tag LOCUS_13640 gene yabA 20626 20958 CDS product DNA replication initiation control protein YabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254135.1 protein_id gnl|my_center|LOCUS_13640 20958 21821 gene locus_tag LOCUS_13650 gene rsmI 20958 21821 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549119.1 protein_id gnl|my_center|LOCUS_13650 21818 22567 gene locus_tag LOCUS_13660 21818 22567 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254136.1 protein_id gnl|my_center|LOCUS_13660 >Feature sequence24 1188 313 gene locus_tag LOCUS_13670 1188 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13670 1581 1225 gene locus_tag LOCUS_13680 1581 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13680 2675 1728 gene locus_tag LOCUS_13690 2675 1728 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254020.1 protein_id gnl|my_center|LOCUS_13690 4161 2785 gene locus_tag LOCUS_13700 gene radA 4161 2785 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549080.1 protein_id gnl|my_center|LOCUS_13700 4715 4161 gene locus_tag LOCUS_13710 4715 4161 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254121.1 protein_id gnl|my_center|LOCUS_13710 4822 5109 gene locus_tag LOCUS_13720 4822 5109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 5195 6544 gene locus_tag LOCUS_13730 gene pepC 5195 6544 CDS product aminopeptidase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549077.1 protein_id gnl|my_center|LOCUS_13730 6765 6610 gene locus_tag LOCUS_13740 6765 6610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 7832 6897 gene locus_tag LOCUS_13750 7832 6897 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549076.1 protein_id gnl|my_center|LOCUS_13750 8406 7945 gene locus_tag LOCUS_13760 gene fabZ 8406 7945 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004563897.1 protein_id gnl|my_center|LOCUS_13760 9254 8577 gene locus_tag LOCUS_13770 9254 8577 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721658.1 protein_id gnl|my_center|LOCUS_13770 9452 9267 gene locus_tag LOCUS_13780 9452 9267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 9639 9454 gene locus_tag LOCUS_13790 9639 9454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 10340 9660 gene locus_tag LOCUS_13800 10340 9660 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549072.1 protein_id gnl|my_center|LOCUS_13800 10840 10400 gene locus_tag LOCUS_13810 10840 10400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13810 11386 11967 gene locus_tag LOCUS_13820 11386 11967 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549069.1 protein_id gnl|my_center|LOCUS_13820 11969 12487 gene locus_tag LOCUS_13830 11969 12487 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642615.1 protein_id gnl|my_center|LOCUS_13830 12548 13606 gene locus_tag LOCUS_13840 12548 13606 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003585932.1 protein_id gnl|my_center|LOCUS_13840 14021 14776 gene locus_tag LOCUS_13850 14021 14776 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439904.1 protein_id gnl|my_center|LOCUS_13850 14922 16334 gene locus_tag LOCUS_13860 gene pepV 14922 16334 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547162.1 protein_id gnl|my_center|LOCUS_13860 16512 16871 gene locus_tag LOCUS_13870 16512 16871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13870 16926 17900 gene locus_tag LOCUS_13880 16926 17900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13880 18291 18070 gene locus_tag LOCUS_13890 18291 18070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 19759 18392 gene locus_tag LOCUS_13900 19759 18392 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963597.1 protein_id gnl|my_center|LOCUS_13900 20951 20058 gene locus_tag LOCUS_13910 20951 20058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 >Feature sequence25 18 102 gene locus_tag LOCUS_t00200 18 102 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 254 1423 gene locus_tag LOCUS_13920 254 1423 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550126.1 protein_id gnl|my_center|LOCUS_13920 1416 2465 gene locus_tag LOCUS_13930 1416 2465 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550128.1 protein_id gnl|my_center|LOCUS_13930 2458 3471 gene locus_tag LOCUS_13940 2458 3471 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550130.1 protein_id gnl|my_center|LOCUS_13940 3490 5562 gene locus_tag LOCUS_13950 3490 5562 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254156.1 protein_id gnl|my_center|LOCUS_13950 5617 5850 gene locus_tag LOCUS_13960 gene secG 5617 5850 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254157.1 protein_id gnl|my_center|LOCUS_13960 5917 8286 gene locus_tag LOCUS_13970 gene rnr 5917 8286 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550136.1 protein_id gnl|my_center|LOCUS_13970 8309 8770 gene locus_tag LOCUS_13980 gene smpB 8309 8770 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550138.1 protein_id gnl|my_center|LOCUS_13980 8936 9304 gene locus_tag LOCUS_13990 8936 9304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 9304 9780 gene locus_tag LOCUS_14000 9304 9780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 10440 11027 gene locus_tag LOCUS_14010 10440 11027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 11027 11707 gene locus_tag LOCUS_14020 11027 11707 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002993627.1 protein_id gnl|my_center|LOCUS_14020 11710 11877 gene locus_tag LOCUS_14030 11710 11877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 12142 12333 gene locus_tag LOCUS_14040 12142 12333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 12293 12469 gene locus_tag LOCUS_14050 12293 12469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 12469 12969 gene locus_tag LOCUS_14060 12469 12969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 12975 13463 gene locus_tag LOCUS_14070 12975 13463 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546424.1 protein_id gnl|my_center|LOCUS_14070 14158 13637 gene locus_tag LOCUS_14080 14158 13637 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550006.1 protein_id gnl|my_center|LOCUS_14080 14345 15124 gene locus_tag LOCUS_14090 gene sufC 14345 15124 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702968.1 protein_id gnl|my_center|LOCUS_14090 15134 16297 gene locus_tag LOCUS_14100 gene sufD 15134 16297 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702957.1 protein_id gnl|my_center|LOCUS_14100 16278 17492 gene locus_tag LOCUS_14110 16278 17492 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989988.1 protein_id gnl|my_center|LOCUS_14110 17479 17919 gene locus_tag LOCUS_14120 17479 17919 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287684.1 protein_id gnl|my_center|LOCUS_14120 17920 19347 gene locus_tag LOCUS_14130 gene sufB 17920 19347 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702990.1 protein_id gnl|my_center|LOCUS_14130 20229 19735 gene locus_tag LOCUS_14140 20229 19735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14140 20381 20226 gene locus_tag LOCUS_14150 20381 20226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 >Feature sequence26 453 1337 gene locus_tag LOCUS_14160 453 1337 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547719.1 protein_id gnl|my_center|LOCUS_14160 1454 1675 gene locus_tag LOCUS_14170 1454 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 2592 1735 gene locus_tag LOCUS_14180 2592 1735 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547712.1 protein_id gnl|my_center|LOCUS_14180 2761 2937 gene locus_tag LOCUS_14190 gene rpsU 2761 2937 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002880182.1 protein_id gnl|my_center|LOCUS_14190 3091 4038 gene locus_tag LOCUS_14200 3091 4038 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254379.1 protein_id gnl|my_center|LOCUS_14200 4038 4562 gene locus_tag LOCUS_14210 gene ybeY 4038 4562 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547628.1 protein_id gnl|my_center|LOCUS_14210 4564 4983 gene locus_tag LOCUS_14220 4564 4983 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289205.1 protein_id gnl|my_center|LOCUS_14220 4967 5872 gene locus_tag LOCUS_14230 gene era 4967 5872 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254378.1 protein_id gnl|my_center|LOCUS_14230 5872 6621 gene locus_tag LOCUS_14240 gene recO 5872 6621 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547622.1 protein_id gnl|my_center|LOCUS_14240 6886 7797 gene locus_tag LOCUS_14250 gene glyQ 6886 7797 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547621.1 protein_id gnl|my_center|LOCUS_14250 7790 9856 gene locus_tag LOCUS_14260 gene glyS 7790 9856 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547620.1 protein_id gnl|my_center|LOCUS_14260 9888 11726 gene locus_tag LOCUS_14270 gene dnaG 9888 11726 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547619.1 protein_id gnl|my_center|LOCUS_14270 11698 12816 gene locus_tag LOCUS_14280 gene rpoD 11698 12816 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254377.1 protein_id gnl|my_center|LOCUS_14280 12909 13988 gene locus_tag LOCUS_14290 gene rpoD 12909 13988 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254377.1 protein_id gnl|my_center|LOCUS_14290 14416 14231 gene locus_tag LOCUS_14300 14416 14231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14300 14736 14491 gene locus_tag LOCUS_14310 14736 14491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14310 15972 18260 gene locus_tag LOCUS_14320 15972 18260 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011669015.1 protein_id gnl|my_center|LOCUS_14320 18602 18336 gene locus_tag LOCUS_14330 18602 18336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14330 >Feature sequence27 95 1162 gene locus_tag LOCUS_14340 95 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 1231 2145 gene locus_tag LOCUS_14350 1231 2145 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550037.1 protein_id gnl|my_center|LOCUS_14350 2301 3077 gene locus_tag LOCUS_14360 2301 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 3690 3133 gene locus_tag LOCUS_14370 gene efp 3690 3133 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550017.1 protein_id gnl|my_center|LOCUS_14370 4658 3744 gene locus_tag LOCUS_14380 gene coaA 4658 3744 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550009.1 protein_id gnl|my_center|LOCUS_14380 4761 5330 gene locus_tag LOCUS_14390 4761 5330 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550008.1 protein_id gnl|my_center|LOCUS_14390 5468 5911 gene locus_tag LOCUS_14400 5468 5911 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721270.1 protein_id gnl|my_center|LOCUS_14400 5917 6666 gene locus_tag LOCUS_14410 5917 6666 CDS product LiaF-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549154.1 protein_id gnl|my_center|LOCUS_14410 7414 6728 gene locus_tag LOCUS_14420 7414 6728 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550005.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14420 7559 7314 gene locus_tag LOCUS_14430 7559 7314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14430 7849 7562 gene locus_tag LOCUS_14440 7849 7562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 10140 7861 gene locus_tag LOCUS_14450 gene helD 10140 7861 CDS product RNA polymerase recycling motor HelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_056990024.1 protein_id gnl|my_center|LOCUS_14450 10336 10998 gene locus_tag LOCUS_14460 10336 10998 CDS product matrixin family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549990.1 protein_id gnl|my_center|LOCUS_14460 11013 11666 gene locus_tag LOCUS_14470 11013 11666 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549989.1 protein_id gnl|my_center|LOCUS_14470 11783 12475 gene locus_tag LOCUS_14480 11783 12475 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013854628.1 protein_id gnl|my_center|LOCUS_14480 12848 12609 gene locus_tag LOCUS_14490 12848 12609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 14473 13052 gene locus_tag LOCUS_14500 14473 13052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 14786 14616 gene locus_tag LOCUS_14510 14786 14616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 15349 14783 gene locus_tag LOCUS_14520 15349 14783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14520 15605 15366 gene locus_tag LOCUS_14530 15605 15366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 16142 15681 gene locus_tag LOCUS_14540 16142 15681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 16860 16153 gene locus_tag LOCUS_14550 16860 16153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 17048 17476 gene locus_tag LOCUS_14560 17048 17476 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227398.1 protein_id gnl|my_center|LOCUS_14560 17586 18035 gene locus_tag LOCUS_14570 17586 18035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 >Feature sequence28 814 740 gene locus_tag LOCUS_t00210 814 740 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1390 968 gene locus_tag LOCUS_14580 1390 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 1959 1438 gene locus_tag LOCUS_14590 1959 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14590 2201 1911 gene locus_tag LOCUS_14600 2201 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14600 2512 3747 gene locus_tag LOCUS_14610 2512 3747 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476517.1 protein_id gnl|my_center|LOCUS_14610 3841 3963 gene locus_tag LOCUS_14620 3841 3963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 3976 4272 gene locus_tag LOCUS_14630 3976 4272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14630 4622 4317 gene locus_tag LOCUS_14640 4622 4317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 4762 7896 gene locus_tag LOCUS_14650 4762 7896 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149495417.1 protein_id gnl|my_center|LOCUS_14650 7977 8966 gene locus_tag LOCUS_14660 gene galE 7977 8966 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548187.1 protein_id gnl|my_center|LOCUS_14660 9369 9019 gene locus_tag LOCUS_14670 9369 9019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 10670 9828 gene locus_tag LOCUS_14680 10670 9828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 10863 12233 gene locus_tag LOCUS_14690 10863 12233 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546123.1 protein_id gnl|my_center|LOCUS_14690 12646 12284 gene locus_tag LOCUS_14700 12646 12284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 13172 12804 gene locus_tag LOCUS_14710 13172 12804 CDS product DUF956 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546115.1 protein_id gnl|my_center|LOCUS_14710 14096 13182 gene locus_tag LOCUS_14720 14096 13182 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254159.1 protein_id gnl|my_center|LOCUS_14720 14937 14125 gene locus_tag LOCUS_14730 14937 14125 CDS product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254158.1 protein_id gnl|my_center|LOCUS_14730 15959 14940 gene locus_tag LOCUS_14740 15959 14940 CDS product mannose/fructose/sorbose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546107.1 protein_id gnl|my_center|LOCUS_14740 >Feature sequence29 157 1752 gene locus_tag LOCUS_14750 157 1752 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254534.1 protein_id gnl|my_center|LOCUS_14750 1980 2165 gene locus_tag LOCUS_14760 1980 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 2226 2591 gene locus_tag LOCUS_14770 2226 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14770 2533 2916 gene locus_tag LOCUS_14780 2533 2916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14780 3460 3011 gene locus_tag LOCUS_14790 3460 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 4414 3584 gene locus_tag LOCUS_14800 4414 3584 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003709302.1 protein_id gnl|my_center|LOCUS_14800 4541 5386 gene locus_tag LOCUS_14810 4541 5386 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550055.1 protein_id gnl|my_center|LOCUS_14810 5466 5732 gene locus_tag LOCUS_14820 5466 5732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14820 5905 6492 gene locus_tag LOCUS_14830 5905 6492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 6547 7050 gene locus_tag LOCUS_14840 6547 7050 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002393999.1 protein_id gnl|my_center|LOCUS_14840 7934 7047 gene locus_tag LOCUS_14850 7934 7047 CDS product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548604.1 protein_id gnl|my_center|LOCUS_14850 8029 8946 gene locus_tag LOCUS_14860 8029 8946 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721382.1 protein_id gnl|my_center|LOCUS_14860 8978 9892 gene locus_tag LOCUS_14870 8978 9892 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254527.1 protein_id gnl|my_center|LOCUS_14870 10176 9931 gene locus_tag LOCUS_14880 10176 9931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 10348 10920 gene locus_tag LOCUS_14890 10348 10920 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254526.1 protein_id gnl|my_center|LOCUS_14890 10964 14146 gene locus_tag LOCUS_14900 10964 14146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 14259 15347 gene locus_tag LOCUS_14910 14259 15347 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550081.1 protein_id gnl|my_center|LOCUS_14910 >Feature sequence30 339 175 gene locus_tag LOCUS_14920 339 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 793 551 gene locus_tag LOCUS_14930 793 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 1059 1679 gene locus_tag LOCUS_14940 1059 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 1872 1789 gene locus_tag LOCUS_t00220 1872 1789 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2592 1927 gene locus_tag LOCUS_14950 2592 1927 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003583824.1 protein_id gnl|my_center|LOCUS_14950 3330 2602 gene locus_tag LOCUS_14960 gene fabI 3330 2602 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475769.1 protein_id gnl|my_center|LOCUS_14960 4143 3376 gene locus_tag LOCUS_14970 gene accA 4143 3376 CDS product carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057868922.1 protein_id gnl|my_center|LOCUS_14970 4984 4136 gene locus_tag LOCUS_14980 gene accD 4984 4136 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025022359.1 protein_id gnl|my_center|LOCUS_14980 6353 4971 gene locus_tag LOCUS_14990 gene accC 6353 4971 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475767.1 protein_id gnl|my_center|LOCUS_14990 6789 6346 gene locus_tag LOCUS_15000 gene fabZ 6789 6346 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699740.1 protein_id gnl|my_center|LOCUS_15000 7273 6791 gene locus_tag LOCUS_15010 gene accB 7273 6791 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475766.1 protein_id gnl|my_center|LOCUS_15010 8484 7264 gene locus_tag LOCUS_15020 gene fabF 8484 7264 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475765.1 protein_id gnl|my_center|LOCUS_15020 9216 8494 gene locus_tag LOCUS_15030 gene fabG 9216 8494 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699736.1 protein_id gnl|my_center|LOCUS_15030 10144 9200 gene locus_tag LOCUS_15040 10144 9200 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475764.1 protein_id gnl|my_center|LOCUS_15040 10402 10157 gene locus_tag LOCUS_15050 10402 10157 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699734.1 protein_id gnl|my_center|LOCUS_15050 11434 10475 gene locus_tag LOCUS_15060 11434 10475 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475763.1 protein_id gnl|my_center|LOCUS_15060 12791 11718 gene locus_tag LOCUS_15070 12791 11718 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549287.1 protein_id gnl|my_center|LOCUS_15070 14641 12866 gene locus_tag LOCUS_15080 14641 12866 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254424.1 protein_id gnl|my_center|LOCUS_15080 >Feature sequence31 900 244 gene locus_tag LOCUS_15090 900 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15090 1885 851 gene locus_tag LOCUS_15100 1885 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15100 3460 2063 gene locus_tag LOCUS_15110 3460 2063 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546997.1 protein_id gnl|my_center|LOCUS_15110 4296 3583 gene locus_tag LOCUS_15120 4296 3583 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254285.1 protein_id gnl|my_center|LOCUS_15120 5348 4293 gene locus_tag LOCUS_15130 5348 4293 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546989.1 protein_id gnl|my_center|LOCUS_15130 6206 5385 gene locus_tag LOCUS_15140 6206 5385 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254284.1 protein_id gnl|my_center|LOCUS_15140 7859 6651 gene locus_tag LOCUS_15150 7859 6651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15150 8727 7789 gene locus_tag LOCUS_15160 8727 7789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15160 9069 8779 gene locus_tag LOCUS_15170 9069 8779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15170 9582 9094 gene locus_tag LOCUS_15180 9582 9094 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475879.1 protein_id gnl|my_center|LOCUS_15180 10552 9596 gene locus_tag LOCUS_15190 10552 9596 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546979.1 protein_id gnl|my_center|LOCUS_15190 11377 10712 gene locus_tag LOCUS_15200 11377 10712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 11619 11996 gene locus_tag LOCUS_15210 11619 11996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643535.1 protein_id gnl|my_center|LOCUS_15210 13705 12056 gene locus_tag LOCUS_15220 13705 12056 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550020.1 protein_id gnl|my_center|LOCUS_15220 >Feature sequence32 247 603 gene locus_tag LOCUS_15230 247 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 704 829 gene locus_tag LOCUS_15240 704 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 951 1919 gene locus_tag LOCUS_15250 gene manA 951 1919 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101726.1 protein_id gnl|my_center|LOCUS_15250 1959 2162 gene locus_tag LOCUS_15260 1959 2162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 2552 2262 gene locus_tag LOCUS_15270 2552 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 3314 2712 gene locus_tag LOCUS_15280 3314 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 3672 4436 gene locus_tag LOCUS_15290 3672 4436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 4433 5215 gene locus_tag LOCUS_15300 4433 5215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 5751 5266 gene locus_tag LOCUS_15310 5751 5266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 6901 6179 gene locus_tag LOCUS_15320 6901 6179 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357197.1 protein_id gnl|my_center|LOCUS_15320 7242 8228 gene locus_tag LOCUS_15330 7242 8228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 8745 9650 gene locus_tag LOCUS_15340 8745 9650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15340 9741 10688 gene locus_tag LOCUS_15350 9741 10688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 10694 11641 gene locus_tag LOCUS_15360 10694 11641 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389346.1 protein_id gnl|my_center|LOCUS_15360 12190 11669 gene locus_tag LOCUS_15370 12190 11669 CDS product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476576.1 protein_id gnl|my_center|LOCUS_15370 12356 13189 gene locus_tag LOCUS_15380 12356 13189 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476577.1 protein_id gnl|my_center|LOCUS_15380 <13752 13136 gene locus_tag LOCUS_15390 <13752 13136 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003436710.1:EAL domain-containing protein >Feature sequence33 1960 716 gene locus_tag LOCUS_15400 1960 716 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704100.1 protein_id gnl|my_center|LOCUS_15400 2192 4297 gene locus_tag LOCUS_15410 2192 4297 CDS product putative ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475545.1 protein_id gnl|my_center|LOCUS_15410 4328 5869 gene locus_tag LOCUS_15420 4328 5869 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254225.1 protein_id gnl|my_center|LOCUS_15420 5897 7618 gene locus_tag LOCUS_15430 5897 7618 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546584.1 protein_id gnl|my_center|LOCUS_15430 8779 7700 gene locus_tag LOCUS_15440 8779 7700 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767561.1 protein_id gnl|my_center|LOCUS_15440 9415 8966 gene locus_tag LOCUS_15450 9415 8966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 9431 9727 gene locus_tag LOCUS_15460 9431 9727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15460 9720 10589 gene locus_tag LOCUS_15470 9720 10589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15470 10525 11286 gene locus_tag LOCUS_15480 10525 11286 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700709.1 protein_id gnl|my_center|LOCUS_15480 11397 11588 gene locus_tag LOCUS_15490 11397 11588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 11733 12437 gene locus_tag LOCUS_15500 11733 12437 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131353.1 protein_id gnl|my_center|LOCUS_15500 12897 12367 gene locus_tag LOCUS_15510 12897 12367 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986394.1 protein_id gnl|my_center|LOCUS_15510 13099 13011 gene locus_tag LOCUS_t00230 13099 13011 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence34 216 716 gene locus_tag LOCUS_15520 216 716 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549510.1 protein_id gnl|my_center|LOCUS_15520 849 2663 gene locus_tag LOCUS_15530 849 2663 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549508.1 protein_id gnl|my_center|LOCUS_15530 2825 3985 gene locus_tag LOCUS_15540 2825 3985 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549506.1 protein_id gnl|my_center|LOCUS_15540 4735 4079 gene locus_tag LOCUS_15550 4735 4079 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549496.1 protein_id gnl|my_center|LOCUS_15550 4828 5928 gene locus_tag LOCUS_15560 4828 5928 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254625.1 protein_id gnl|my_center|LOCUS_15560 6134 7228 gene locus_tag LOCUS_15570 6134 7228 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549489.1 protein_id gnl|my_center|LOCUS_15570 7711 7148 gene locus_tag LOCUS_15580 7711 7148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 8164 7754 gene locus_tag LOCUS_15590 8164 7754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 8207 8605 gene locus_tag LOCUS_15600 8207 8605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15600 8635 9246 gene locus_tag LOCUS_15610 8635 9246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15610 9433 9603 gene locus_tag LOCUS_15620 9433 9603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 9622 9825 gene locus_tag LOCUS_15630 9622 9825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 9833 10330 gene locus_tag LOCUS_15640 9833 10330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 10637 11734 gene locus_tag LOCUS_15650 10637 11734 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549489.1 protein_id gnl|my_center|LOCUS_15650 >Feature sequence35 956 426 gene locus_tag LOCUS_15660 956 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 1030 1212 gene locus_tag LOCUS_15670 1030 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 1693 1884 gene locus_tag LOCUS_15680 1693 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 2719 1916 gene locus_tag LOCUS_15690 2719 1916 CDS product DUF4422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986978.1 protein_id gnl|my_center|LOCUS_15690 3279 2776 gene locus_tag LOCUS_15700 3279 2776 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578443.1 protein_id gnl|my_center|LOCUS_15700 3566 3288 gene locus_tag LOCUS_15710 3566 3288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15710 3751 3563 gene locus_tag LOCUS_15720 3751 3563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15720 4468 3809 gene locus_tag LOCUS_15730 4468 3809 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721391.1 protein_id gnl|my_center|LOCUS_15730 5275 4499 gene locus_tag LOCUS_15740 5275 4499 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549867.1 protein_id gnl|my_center|LOCUS_15740 6052 5279 gene locus_tag LOCUS_15750 6052 5279 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549866.1 protein_id gnl|my_center|LOCUS_15750 6901 6062 gene locus_tag LOCUS_15760 6901 6062 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549864.1 protein_id gnl|my_center|LOCUS_15760 7932 6901 gene locus_tag LOCUS_15770 7932 6901 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549863.1 protein_id gnl|my_center|LOCUS_15770 8258 9538 gene locus_tag LOCUS_15780 gene hflX 8258 9538 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549861.1 protein_id gnl|my_center|LOCUS_15780 10366 9587 gene locus_tag LOCUS_15790 10366 9587 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549854.1 protein_id gnl|my_center|LOCUS_15790 11014 10412 gene locus_tag LOCUS_15800 11014 10412 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549854.1 protein_id gnl|my_center|LOCUS_15800 12050 11268 gene locus_tag LOCUS_15810 12050 11268 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549854.1 protein_id gnl|my_center|LOCUS_15810 >Feature sequence36 101 29 gene locus_tag LOCUS_t00240 101 29 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1461 196 gene locus_tag LOCUS_15820 gene tyrS 1461 196 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548823.1 protein_id gnl|my_center|LOCUS_15820 1905 1669 gene locus_tag LOCUS_15830 1905 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 2161 2039 gene locus_tag LOCUS_15840 2161 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 3418 2558 gene locus_tag LOCUS_15850 3418 2558 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254325.1 protein_id gnl|my_center|LOCUS_15850 4170 3430 gene locus_tag LOCUS_15860 4170 3430 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547328.1 protein_id gnl|my_center|LOCUS_15860 4854 4180 gene locus_tag LOCUS_15870 4854 4180 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547325.1 protein_id gnl|my_center|LOCUS_15870 5494 4835 gene locus_tag LOCUS_15880 5494 4835 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547323.1 protein_id gnl|my_center|LOCUS_15880 5758 5913 gene locus_tag LOCUS_15890 5758 5913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 6160 5864 gene locus_tag LOCUS_15900 6160 5864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 6854 6318 gene locus_tag LOCUS_15910 6854 6318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 7957 6866 gene locus_tag LOCUS_15920 gene folP 7957 6866 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132109.1 protein_id gnl|my_center|LOCUS_15920 9284 7947 gene locus_tag LOCUS_15930 9284 7947 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643484.1 protein_id gnl|my_center|LOCUS_15930 10341 9268 gene locus_tag LOCUS_15940 gene folE 10341 9268 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905789.1 protein_id gnl|my_center|LOCUS_15940 10688 10338 gene locus_tag LOCUS_15950 gene folB 10688 10338 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132106.1 protein_id gnl|my_center|LOCUS_15950 10950 10768 gene locus_tag LOCUS_15960 10950 10768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 >Feature sequence37 463 963 gene locus_tag LOCUS_15970 463 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 1298 4534 gene locus_tag LOCUS_15980 1298 4534 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401853.1 protein_id gnl|my_center|LOCUS_15980 4535 5158 gene locus_tag LOCUS_15990 4535 5158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 5151 7025 gene locus_tag LOCUS_16000 5151 7025 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211204934.1 protein_id gnl|my_center|LOCUS_16000 7036 7293 gene locus_tag LOCUS_16010 7036 7293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 7315 9588 gene locus_tag LOCUS_16020 7315 9588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16020 9634 10128 gene locus_tag LOCUS_16030 9634 10128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16030 10302 10634 gene locus_tag LOCUS_16040 10302 10634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 >Feature sequence38 552 1760 gene locus_tag LOCUS_16050 552 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549513.1 protein_id gnl|my_center|LOCUS_16050 1797 2099 gene locus_tag LOCUS_16060 1797 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 2286 2444 gene locus_tag LOCUS_16070 2286 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 2454 3962 gene locus_tag LOCUS_16080 gene dltA 2454 3962 CDS product D-alanine--poly(phosphoribitol) ligase subunit DltA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549519.1 protein_id gnl|my_center|LOCUS_16080 3959 5191 gene locus_tag LOCUS_16090 gene dltB 3959 5191 CDS product D-alanyl-lipoteichoic acid biosynthesis protein DltB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254621.1 protein_id gnl|my_center|LOCUS_16090 5273 5515 gene locus_tag LOCUS_16100 gene dltC 5273 5515 CDS product D-alanine--poly(phosphoribitol) ligase subunit DltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549523.1 protein_id gnl|my_center|LOCUS_16100 5505 6791 gene locus_tag LOCUS_16110 gene dltD 5505 6791 CDS product D-alanyl-lipoteichoic acid biosynthesis protein DltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549525.1 protein_id gnl|my_center|LOCUS_16110 7350 7739 gene locus_tag LOCUS_16120 7350 7739 CDS product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548621.1 protein_id gnl|my_center|LOCUS_16120 7876 9873 gene locus_tag LOCUS_16130 7876 9873 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475586.1 protein_id gnl|my_center|LOCUS_16130 9877 10503 gene locus_tag LOCUS_16140 9877 10503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 >Feature sequence39 761 189 gene locus_tag LOCUS_16150 761 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 1415 1227 gene locus_tag LOCUS_16160 1415 1227 CDS product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547962.1 protein_id gnl|my_center|LOCUS_16160 1640 1494 gene locus_tag LOCUS_16170 1640 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 2072 1683 gene locus_tag LOCUS_16180 2072 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16180 2323 2096 gene locus_tag LOCUS_16190 2323 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16190 2890 2462 gene locus_tag LOCUS_16200 2890 2462 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476083.1 protein_id gnl|my_center|LOCUS_16200 3460 2981 gene locus_tag LOCUS_16210 3460 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 4256 3729 gene locus_tag LOCUS_16220 4256 3729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 4404 7169 gene locus_tag LOCUS_16230 4404 7169 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254017.1 protein_id gnl|my_center|LOCUS_16230 7753 7196 gene locus_tag LOCUS_16240 7753 7196 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547188.1 protein_id gnl|my_center|LOCUS_16240 8619 7753 gene locus_tag LOCUS_16250 8619 7753 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254313.1 protein_id gnl|my_center|LOCUS_16250 9278 9024 gene locus_tag LOCUS_16260 9278 9024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16260 9453 9166 gene locus_tag LOCUS_16270 9453 9166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16270 >Feature sequence40 621 1763 gene locus_tag LOCUS_16280 621 1763 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549814.1 protein_id gnl|my_center|LOCUS_16280 1882 2259 gene locus_tag LOCUS_16290 1882 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 2274 3818 gene locus_tag LOCUS_16300 2274 3818 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549817.1 protein_id gnl|my_center|LOCUS_16300 3914 4627 gene locus_tag LOCUS_16310 3914 4627 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549818.1 protein_id gnl|my_center|LOCUS_16310 4630 5121 gene locus_tag LOCUS_16320 4630 5121 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549820.1 protein_id gnl|my_center|LOCUS_16320 5709 6224 gene locus_tag LOCUS_16330 5709 6224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254564.1 protein_id gnl|my_center|LOCUS_16330 6227 6853 gene locus_tag LOCUS_16340 6227 6853 CDS product LVIS_2131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549837.1 protein_id gnl|my_center|LOCUS_16340 8447 6909 gene locus_tag LOCUS_16350 8447 6909 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549839.1 protein_id gnl|my_center|LOCUS_16350 8846 8511 gene locus_tag LOCUS_16360 8846 8511 CDS product DUF2187 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549842.1 protein_id gnl|my_center|LOCUS_16360 8953 9495 gene locus_tag LOCUS_16370 8953 9495 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041814911.1 protein_id gnl|my_center|LOCUS_16370 >Feature sequence41 698 925 gene locus_tag LOCUS_16380 698 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 2407 1112 gene locus_tag LOCUS_16390 2407 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16390 4300 2426 gene locus_tag LOCUS_16400 4300 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16400 5378 4293 gene locus_tag LOCUS_16410 gene carA 5378 4293 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548026.1 protein_id gnl|my_center|LOCUS_16410 6655 5378 gene locus_tag LOCUS_16420 6655 5378 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254442.1 protein_id gnl|my_center|LOCUS_16420 7611 6655 gene locus_tag LOCUS_16430 7611 6655 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548032.1 protein_id gnl|my_center|LOCUS_16430 8298 7756 gene locus_tag LOCUS_16440 gene pyrR 8298 7756 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548034.1 protein_id gnl|my_center|LOCUS_16440 9381 8458 gene locus_tag LOCUS_16450 9381 8458 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254443.1 protein_id gnl|my_center|LOCUS_16450 >Feature sequence42 <1 1499 gene locus_tag LOCUS_16460 <1 1499 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011675014.1:nicotinate phosphoribosyltransferase 2055 1579 gene locus_tag LOCUS_16470 gene mscL 2055 1579 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814614.1 protein_id gnl|my_center|LOCUS_16470 2649 2140 gene locus_tag LOCUS_16480 2649 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16480 2968 2687 gene locus_tag LOCUS_16490 2968 2687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16490 4101 3094 gene locus_tag LOCUS_16500 4101 3094 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549977.1 protein_id gnl|my_center|LOCUS_16500 4547 4098 gene locus_tag LOCUS_16510 4547 4098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 4809 4606 gene locus_tag LOCUS_16520 4809 4606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 5494 5045 gene locus_tag LOCUS_16530 5494 5045 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437963.1 protein_id gnl|my_center|LOCUS_16530 6482 5550 gene locus_tag LOCUS_16540 gene mmuM 6482 5550 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476521.1 protein_id gnl|my_center|LOCUS_16540 6498 7451 gene locus_tag LOCUS_16550 6498 7451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16550 7364 7822 gene locus_tag LOCUS_16560 7364 7822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16560 7973 8938 gene locus_tag LOCUS_16570 7973 8938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 >Feature sequence43 1001 225 gene locus_tag LOCUS_16580 1001 225 CDS product DUF4422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549870.1 protein_id gnl|my_center|LOCUS_16580 1614 1018 gene locus_tag LOCUS_16590 1614 1018 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986980.1 protein_id gnl|my_center|LOCUS_16590 2658 1876 gene locus_tag LOCUS_16600 2658 1876 CDS product beta-1,6-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765273.1 protein_id gnl|my_center|LOCUS_16600 3956 2772 gene locus_tag LOCUS_16610 3956 2772 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641230.1 protein_id gnl|my_center|LOCUS_16610 4178 4360 gene locus_tag LOCUS_16620 4178 4360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 4382 5071 gene locus_tag LOCUS_16630 4382 5071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16630 5324 5079 gene locus_tag LOCUS_16640 5324 5079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 5718 5389 gene locus_tag LOCUS_16650 5718 5389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 6155 5724 gene locus_tag LOCUS_16660 6155 5724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 6621 6262 gene locus_tag LOCUS_16670 6621 6262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 7771 6758 gene locus_tag LOCUS_16680 7771 6758 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016741.1 protein_id gnl|my_center|LOCUS_16680 8414 8605 gene locus_tag LOCUS_16690 8414 8605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 8649 8933 gene locus_tag LOCUS_16700 8649 8933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 8947 9330 gene locus_tag LOCUS_16710 8947 9330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16710 >Feature sequence44 482 18 gene locus_tag LOCUS_16720 gene tagD 482 18 CDS product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646390.1 protein_id gnl|my_center|LOCUS_16720 1411 500 gene locus_tag LOCUS_16730 1411 500 CDS product phosphorylcholine transferase LicD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199652.1 protein_id gnl|my_center|LOCUS_16730 2865 1432 gene locus_tag LOCUS_16740 2865 1432 CDS product polysaccharide biosynthesis C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101282.1 protein_id gnl|my_center|LOCUS_16740 3235 3008 gene locus_tag LOCUS_16750 3235 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16750 3673 3347 gene locus_tag LOCUS_16760 3673 3347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 4481 3834 gene locus_tag LOCUS_16770 4481 3834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 5842 5084 gene locus_tag LOCUS_16780 5842 5084 CDS product DUF4422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986978.1 protein_id gnl|my_center|LOCUS_16780 6981 5863 gene locus_tag LOCUS_16790 6981 5863 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224434606.1 protein_id gnl|my_center|LOCUS_16790 7879 6974 gene locus_tag LOCUS_16800 7879 6974 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254560.1 protein_id gnl|my_center|LOCUS_16800 8584 7907 gene locus_tag LOCUS_16810 8584 7907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16810 8769 8587 gene locus_tag LOCUS_16820 8769 8587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16820 >Feature sequence45 1248 385 gene locus_tag LOCUS_16830 1248 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 1449 1285 gene locus_tag LOCUS_16840 1449 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 2081 1701 gene locus_tag LOCUS_16850 2081 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16850 2428 2024 gene locus_tag LOCUS_16860 2428 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16860 2923 2462 gene locus_tag LOCUS_16870 2923 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16870 3310 3053 gene locus_tag LOCUS_16880 3310 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16880 3844 3323 gene locus_tag LOCUS_16890 3844 3323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16890 5991 4372 gene locus_tag LOCUS_16900 5991 4372 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548498.1 protein_id gnl|my_center|LOCUS_16900 8500 6086 gene locus_tag LOCUS_16910 gene leuS 8500 6086 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548508.1 protein_id gnl|my_center|LOCUS_16910 >Feature sequence46 399 88 gene locus_tag LOCUS_16920 399 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16920 677 450 gene locus_tag LOCUS_16930 677 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 1057 746 gene locus_tag LOCUS_16940 1057 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 1237 2073 gene locus_tag LOCUS_16950 1237 2073 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547157.1 protein_id gnl|my_center|LOCUS_16950 2116 2682 gene locus_tag LOCUS_16960 gene lepB 2116 2682 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547598.1 protein_id gnl|my_center|LOCUS_16960 2752 2937 gene locus_tag LOCUS_16970 2752 2937 CDS product LBP_cg2779 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547599.1 protein_id gnl|my_center|LOCUS_16970 4567 3329 gene locus_tag LOCUS_16980 gene pepT 4567 3329 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547606.1 protein_id gnl|my_center|LOCUS_16980 5408 4611 gene locus_tag LOCUS_16990 5408 4611 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547612.1 protein_id gnl|my_center|LOCUS_16990 6093 5401 gene locus_tag LOCUS_17000 6093 5401 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547613.1 protein_id gnl|my_center|LOCUS_17000 6237 6677 gene locus_tag LOCUS_17010 6237 6677 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547614.1 protein_id gnl|my_center|LOCUS_17010 6677 7525 gene locus_tag LOCUS_17020 6677 7525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 8296 7571 gene locus_tag LOCUS_17030 8296 7571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 8434 8297 gene locus_tag LOCUS_17040 8434 8297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 >Feature sequence47 106 678 gene locus_tag LOCUS_17050 106 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 1399 851 gene locus_tag LOCUS_17060 1399 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 2130 2516 gene locus_tag LOCUS_17070 2130 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 2788 3228 gene locus_tag LOCUS_17080 2788 3228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 3239 3868 gene locus_tag LOCUS_17090 3239 3868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 3858 4367 gene locus_tag LOCUS_17100 3858 4367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 4379 5161 gene locus_tag LOCUS_17110 4379 5161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 5908 6330 gene locus_tag LOCUS_17120 5908 6330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 7970 6585 gene locus_tag LOCUS_17130 gene gndA 7970 6585 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254636.1 protein_id gnl|my_center|LOCUS_17130 >Feature sequence48 1134 268 gene locus_tag LOCUS_17140 gene rsiV 1134 268 CDS product anti-sigma-V factor RsiV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398482.1 protein_id gnl|my_center|LOCUS_17140 1711 1148 gene locus_tag LOCUS_17150 1711 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 3176 1869 gene locus_tag LOCUS_17160 gene serS 3176 1869 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254519.1 protein_id gnl|my_center|LOCUS_17160 3914 3420 gene locus_tag LOCUS_17170 3914 3420 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550097.1 protein_id gnl|my_center|LOCUS_17170 4507 3914 gene locus_tag LOCUS_17180 4507 3914 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550094.1 protein_id gnl|my_center|LOCUS_17180 4714 5517 gene locus_tag LOCUS_17190 4714 5517 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254520.1 protein_id gnl|my_center|LOCUS_17190 5520 6380 gene locus_tag LOCUS_17200 5520 6380 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550089.1 protein_id gnl|my_center|LOCUS_17200 6918 6421 gene locus_tag LOCUS_17210 6918 6421 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254521.1 protein_id gnl|my_center|LOCUS_17210 7598 6927 gene locus_tag LOCUS_17220 7598 6927 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254328.1 protein_id gnl|my_center|LOCUS_17220 >Feature sequence49 110 1993 gene locus_tag LOCUS_17230 110 1993 CDS product glycoside-pentoside-hexuronide (GPH):cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643065.1 protein_id gnl|my_center|LOCUS_17230 1997 5023 gene locus_tag LOCUS_17240 1997 5023 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475723.1 protein_id gnl|my_center|LOCUS_17240 5116 5415 gene locus_tag LOCUS_17250 5116 5415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17250 5427 5555 gene locus_tag LOCUS_17260 5427 5555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 5536 6072 gene locus_tag LOCUS_17270 5536 6072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17270 6307 7611 gene locus_tag LOCUS_17280 6307 7611 CDS product ISL3-like element ISP1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101247.1 protein_id gnl|my_center|LOCUS_17280 >Feature sequence50 203 595 gene locus_tag LOCUS_17290 203 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 595 1470 gene locus_tag LOCUS_17300 595 1470 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101137.1 protein_id gnl|my_center|LOCUS_17300 1714 2115 gene locus_tag LOCUS_17310 1714 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 2129 3103 gene locus_tag LOCUS_17320 gene rfbD 2129 3103 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664667.1 protein_id gnl|my_center|LOCUS_17320 3553 3789 gene locus_tag LOCUS_17330 3553 3789 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646479.1 protein_id gnl|my_center|LOCUS_17330 3971 4396 gene locus_tag LOCUS_17340 gene msrB 3971 4396 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548013.1 protein_id gnl|my_center|LOCUS_17340 4730 4449 gene locus_tag LOCUS_17350 4730 4449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 5013 4723 gene locus_tag LOCUS_17360 5013 4723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 6070 5081 gene locus_tag LOCUS_17370 6070 5081 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856994.1 protein_id gnl|my_center|LOCUS_17370 6752 6567 gene locus_tag LOCUS_17380 6752 6567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 7029 6859 gene locus_tag LOCUS_17390 7029 6859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 7210 6986 gene locus_tag LOCUS_17400 7210 6986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 >Feature sequence51 2361 142 gene locus_tag LOCUS_17410 gene nrdJ 2361 142 CDS product ribonucleoside-triphosphate reductase, adenosylcobalamin-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549289.1 protein_id gnl|my_center|LOCUS_17410 3514 2657 gene locus_tag LOCUS_17420 3514 2657 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254321.1 protein_id gnl|my_center|LOCUS_17420 4541 3633 gene locus_tag LOCUS_17430 4541 3633 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548290.1 protein_id gnl|my_center|LOCUS_17430 5204 4728 gene locus_tag LOCUS_17440 5204 4728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 6111 5284 gene locus_tag LOCUS_17450 6111 5284 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549252.1 protein_id gnl|my_center|LOCUS_17450 6606 6256 gene locus_tag LOCUS_17460 6606 6256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17460 6807 6634 gene locus_tag LOCUS_17470 6807 6634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 7570 6857 gene locus_tag LOCUS_17480 7570 6857 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025079808.1 protein_id gnl|my_center|LOCUS_17480 >Feature sequence52 1723 110 gene locus_tag LOCUS_17490 gene groL 1723 110 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549158.1 protein_id gnl|my_center|LOCUS_17490 2034 1750 gene locus_tag LOCUS_17500 gene groES 2034 1750 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549156.1 protein_id gnl|my_center|LOCUS_17500 2876 2190 gene locus_tag LOCUS_17510 2876 2190 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549143.1 protein_id gnl|my_center|LOCUS_17510 3181 5073 gene locus_tag LOCUS_17520 3181 5073 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549141.1 protein_id gnl|my_center|LOCUS_17520 6180 5140 gene locus_tag LOCUS_17530 gene tsaD 6180 5140 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549127.1 protein_id gnl|my_center|LOCUS_17530 6713 6183 gene locus_tag LOCUS_17540 gene rimI 6713 6183 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549125.1 protein_id gnl|my_center|LOCUS_17540 <7400 6718 gene locus_tag LOCUS_17550 <7400 6718 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003549123.1:tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB >Feature sequence53 270 1586 gene locus_tag LOCUS_17560 270 1586 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549552.1 protein_id gnl|my_center|LOCUS_17560 1579 2457 gene locus_tag LOCUS_17570 1579 2457 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549553.1 protein_id gnl|my_center|LOCUS_17570 2522 3328 gene locus_tag LOCUS_17580 2522 3328 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546636.1 protein_id gnl|my_center|LOCUS_17580 3333 4082 gene locus_tag LOCUS_17590 3333 4082 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254611.1 protein_id gnl|my_center|LOCUS_17590 4236 5147 gene locus_tag LOCUS_17600 4236 5147 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549598.1 protein_id gnl|my_center|LOCUS_17600 5999 5697 gene locus_tag LOCUS_17610 5999 5697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 6634 6437 gene locus_tag LOCUS_17620 6634 6437 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643615.1 protein_id gnl|my_center|LOCUS_17620 >Feature sequence54 459 374 gene locus_tag LOCUS_t00250 459 374 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 557 1843 gene locus_tag LOCUS_17630 557 1843 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254512.1 protein_id gnl|my_center|LOCUS_17630 1845 2696 gene locus_tag LOCUS_17640 1845 2696 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254511.1 protein_id gnl|my_center|LOCUS_17640 2712 4259 gene locus_tag LOCUS_17650 2712 4259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 4360 4584 gene locus_tag LOCUS_17660 4360 4584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 4781 5038 gene locus_tag LOCUS_17670 4781 5038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 5114 5707 gene locus_tag LOCUS_17680 5114 5707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 5712 6050 gene locus_tag LOCUS_17690 5712 6050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17690 >Feature sequence55 1365 577 gene locus_tag LOCUS_17700 1365 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 1518 2405 gene locus_tag LOCUS_17710 1518 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 6124 2477 gene locus_tag LOCUS_17720 6124 2477 CDS product P-loop NTPase fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399367.1 protein_id gnl|my_center|LOCUS_17720 >Feature sequence56 184 114 gene locus_tag LOCUS_t00260 184 114 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 286 213 gene locus_tag LOCUS_t00270 286 213 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 371 299 gene locus_tag LOCUS_t00280 371 299 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 457 374 gene locus_tag LOCUS_t00290 457 374 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 538 464 gene locus_tag LOCUS_t00300 538 464 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 618 543 gene locus_tag LOCUS_t00310 618 543 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 695 620 gene locus_tag LOCUS_t00320 695 620 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 791 704 gene locus_tag LOCUS_t00330 791 704 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 905 834 gene locus_tag LOCUS_t00340 905 834 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1254 1165 gene locus_tag LOCUS_t00350 1254 1165 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1331 1256 gene locus_tag LOCUS_t00360 1331 1256 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 1404 1334 gene locus_tag LOCUS_t00370 1404 1334 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1492 1418 gene locus_tag LOCUS_t00380 1492 1418 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1583 1508 gene locus_tag LOCUS_t00390 1583 1508 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1668 1593 gene locus_tag LOCUS_t00400 1668 1593 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1754 1679 gene locus_tag LOCUS_t00410 1754 1679 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1863 1790 gene locus_tag LOCUS_t00420 1863 1790 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1944 1869 gene locus_tag LOCUS_t00430 1944 1869 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2035 1948 gene locus_tag LOCUS_t00440 2035 1948 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2121 2050 gene locus_tag LOCUS_t00450 2121 2050 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2199 2125 gene locus_tag LOCUS_t00460 2199 2125 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2293 2209 gene locus_tag LOCUS_t00470 2293 2209 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2377 2305 gene locus_tag LOCUS_t00480 2377 2305 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2453 2378 gene locus_tag LOCUS_t00490 2453 2378 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2831 2610 gene locus_tag LOCUS_17730 2831 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 3316 2801 gene locus_tag LOCUS_17740 3316 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17740 3716 3207 gene locus_tag LOCUS_17750 3716 3207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17750 4043 3741 gene locus_tag LOCUS_17760 4043 3741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17760 4324 4503 gene locus_tag LOCUS_17770 4324 4503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 5454 4582 gene locus_tag LOCUS_17780 5454 4582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17780 5655 5512 gene locus_tag LOCUS_17790 5655 5512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 >Feature sequence57 235 1176 gene locus_tag LOCUS_17800 235 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 1203 1373 gene locus_tag LOCUS_17810 1203 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 1559 2281 gene locus_tag LOCUS_17820 1559 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17820 2294 3376 gene locus_tag LOCUS_17830 2294 3376 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461017.1 protein_id gnl|my_center|LOCUS_17830 4006 3683 gene locus_tag LOCUS_17840 4006 3683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17840 4343 4011 gene locus_tag LOCUS_17850 4343 4011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17850 4982 4530 gene locus_tag LOCUS_17860 4982 4530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17860 5559 5377 gene locus_tag LOCUS_17870 5559 5377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 >Feature sequence58 99 683 gene locus_tag LOCUS_17880 99 683 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549286.1 protein_id gnl|my_center|LOCUS_17880 680 1333 gene locus_tag LOCUS_17890 680 1333 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549989.1 protein_id gnl|my_center|LOCUS_17890 1524 1652 gene locus_tag LOCUS_17900 1524 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 1656 2129 gene locus_tag LOCUS_17910 1656 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 2978 3262 gene locus_tag LOCUS_17920 2978 3262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 3446 3715 gene locus_tag LOCUS_17930 3446 3715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 4679 4134 gene locus_tag LOCUS_17940 4679 4134 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087070.1 protein_id gnl|my_center|LOCUS_17940 >Feature sequence59 59 538 gene locus_tag LOCUS_17950 59 538 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547404.1 protein_id gnl|my_center|LOCUS_17950 566 1447 gene locus_tag LOCUS_17960 566 1447 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640478.1 protein_id gnl|my_center|LOCUS_17960 1921 1490 gene locus_tag LOCUS_17970 1921 1490 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254019.1 protein_id gnl|my_center|LOCUS_17970 2114 3505 gene locus_tag LOCUS_17980 2114 3505 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100951.1 protein_id gnl|my_center|LOCUS_17980 3796 4797 gene locus_tag LOCUS_17990 3796 4797 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613274.1 protein_id gnl|my_center|LOCUS_17990 >Feature sequence60 15 89 gene locus_tag LOCUS_t00500 15 89 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 250 1446 gene locus_tag LOCUS_18000 gene metK 250 1446 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548514.1 protein_id gnl|my_center|LOCUS_18000 1530 2957 gene locus_tag LOCUS_18010 1530 2957 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548513.1 protein_id gnl|my_center|LOCUS_18010 3671 3012 gene locus_tag LOCUS_18020 3671 3012 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254516.1 protein_id gnl|my_center|LOCUS_18020 >Feature sequence61 102 31 gene locus_tag LOCUS_t00510 102 31 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 201 126 gene locus_tag LOCUS_t00520 201 126 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 277 203 gene locus_tag LOCUS_t00530 277 203 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 791 1162 gene locus_tag LOCUS_18030 791 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18030 1110 2384 gene locus_tag LOCUS_18040 gene asnB 1110 2384 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905297.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18040 3296 2421 gene locus_tag LOCUS_18050 3296 2421 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109300.1 protein_id gnl|my_center|LOCUS_18050 >Feature sequence62 421 648 gene locus_tag LOCUS_18060 421 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 1086 2006 gene locus_tag LOCUS_18070 1086 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18070 1958 2344 gene locus_tag LOCUS_18080 1958 2344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18080 3136 2429 gene locus_tag LOCUS_18090 3136 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 3269 3138 gene locus_tag LOCUS_18100 3269 3138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 >Feature sequence63 966 1166 gene locus_tag LOCUS_18110 966 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 2184 1264 gene locus_tag LOCUS_18120 2184 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 2771 2193 gene locus_tag LOCUS_18130 2771 2193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 3240 2773 gene locus_tag LOCUS_18140 3240 2773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 >Feature sequence64 596 42 gene locus_tag LOCUS_18150 596 42 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254459.1 protein_id gnl|my_center|LOCUS_18150 851 1708 gene locus_tag LOCUS_18160 851 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 1967 1701 gene locus_tag LOCUS_18170 1967 1701 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022232.1 protein_id gnl|my_center|LOCUS_18170 2839 2063 gene locus_tag LOCUS_18180 2839 2063 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568116.1 protein_id gnl|my_center|LOCUS_18180 >Feature sequence65 112 3015 gene locus_tag LOCUS_r00010 112 3015 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence66 240 1391 gene locus_tag LOCUS_18190 240 1391 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813994.1 protein_id gnl|my_center|LOCUS_18190 1667 1413 gene locus_tag LOCUS_18200 1667 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 1861 3015 gene locus_tag LOCUS_18210 1861 3015 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813994.1 protein_id gnl|my_center|LOCUS_18210 >Feature sequence67 2 76 gene locus_tag LOCUS_t00540 2 76 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1661 183 gene locus_tag LOCUS_18220 gene thrC 1661 183 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547727.1 protein_id gnl|my_center|LOCUS_18220 1829 2692 gene locus_tag LOCUS_18230 gene thrB 1829 2692 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547723.1 protein_id gnl|my_center|LOCUS_18230 >Feature sequence68 1628 249 gene locus_tag LOCUS_18240 gene nhaC 1628 249 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546295.1 protein_id gnl|my_center|LOCUS_18240 >Feature sequence69 57 1238 gene locus_tag LOCUS_18250 57 1238 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254401.1 protein_id gnl|my_center|LOCUS_18250 2256 1297 gene locus_tag LOCUS_18260 2256 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 >Feature sequence70 16 88 gene locus_tag LOCUS_t00550 16 88 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 91 166 gene locus_tag LOCUS_t00560 91 166 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 268 672 gene locus_tag LOCUS_18270 268 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18270 669 1151 gene locus_tag LOCUS_18280 669 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 1427 1618 gene locus_tag LOCUS_18290 1427 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 >Feature sequence71 484 1530 gene locus_tag LOCUS_18300 484 1530 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321171.1 protein_id gnl|my_center|LOCUS_18300 >Feature sequence72 131 1691 gene locus_tag LOCUS_r00020 131 1691 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence73 152 493 gene locus_tag LOCUS_18310 152 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 715 1707 gene locus_tag LOCUS_18320 gene add 715 1707 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548323.1 protein_id gnl|my_center|LOCUS_18320 >Feature sequence74 655 92 gene locus_tag LOCUS_18330 655 92 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254011.1 protein_id gnl|my_center|LOCUS_18330 1196 648 gene locus_tag LOCUS_18340 1196 648 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549293.1 protein_id gnl|my_center|LOCUS_18340 >Feature sequence75 644 57 gene locus_tag LOCUS_18350 644 57 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547484.1 protein_id gnl|my_center|LOCUS_18350 <1359 743 gene locus_tag LOCUS_18360 <1359 743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546886.1:aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme >Feature sequence76 1299 1 gene locus_tag LOCUS_18370 gene asnS 1299 1 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547544.1 protein_id gnl|my_center|LOCUS_18370 >Feature sequence77 269 1108 gene locus_tag LOCUS_18380 269 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 >Feature sequence78 <1169 258 gene locus_tag LOCUS_18390 <1169 258 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_057797519.1:UDP-galactopyranose mutase >Feature sequence79 291 1073 gene locus_tag LOCUS_18400 291 1073 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476536.1 protein_id gnl|my_center|LOCUS_18400 >Feature sequence80 <1033 118 gene locus_tag LOCUS_18410 <1033 118 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003700922.1:cysteine synthase A >Feature sequence81 >Feature sequence82 >Feature sequence83 >Feature sequence84 >Feature sequence85 >Feature sequence86 >Feature sequence87 180 269 gene locus_tag LOCUS_t00570 180 269 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38