>Feature sequence01 1415 750 gene locus_tag LOCUS_00010 1415 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2128 1568 gene locus_tag LOCUS_00020 2128 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 >Feature sequence02 713 1819 gene locus_tag LOCUS_00030 713 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 >Feature sequence03 1796 630 gene locus_tag LOCUS_00040 1796 630 CDS product ISH3-like element ISH3B family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289545.1 protein_id gnl|my_center|LOCUS_00040 2117 2361 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2387 2959 gene locus_tag LOCUS_00050 2387 2959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 >Feature sequence04 <1 766 gene locus_tag LOCUS_00060 <1 766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012289518.1:acyl-CoA dehydrogenase family protein 844 1383 gene locus_tag LOCUS_00070 844 1383 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903007.1 protein_id gnl|my_center|LOCUS_00070 2621 1452 gene locus_tag LOCUS_00080 2621 1452 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902627.1 protein_id gnl|my_center|LOCUS_00080 3598 2711 gene locus_tag LOCUS_00090 gene rocF 3598 2711 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258791.1 protein_id gnl|my_center|LOCUS_00090 3760 4440 gene locus_tag LOCUS_00100 3760 4440 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289175.1 protein_id gnl|my_center|LOCUS_00100 4616 5548 gene locus_tag LOCUS_00110 4616 5548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 5713 6246 gene locus_tag LOCUS_00120 5713 6246 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902626.1 protein_id gnl|my_center|LOCUS_00120 8774 6297 gene locus_tag LOCUS_00130 gene gyrA 8774 6297 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902625.1 protein_id gnl|my_center|LOCUS_00130 10722 8791 gene locus_tag LOCUS_00140 gene gyrB 10722 8791 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049928262.1 protein_id gnl|my_center|LOCUS_00140 11048 11566 gene locus_tag LOCUS_00150 11048 11566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 11723 13744 gene locus_tag LOCUS_00160 11723 13744 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784260.1 protein_id gnl|my_center|LOCUS_00160 13792 14052 gene locus_tag LOCUS_00170 13792 14052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 14860 14072 gene locus_tag LOCUS_00180 14860 14072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 15435 14959 gene locus_tag LOCUS_00190 15435 14959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 15667 15879 gene locus_tag LOCUS_00200 15667 15879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 16212 15964 gene locus_tag LOCUS_00210 16212 15964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 17808 16282 gene locus_tag LOCUS_00220 gene gcvPB 17808 16282 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903165.1 protein_id gnl|my_center|LOCUS_00220 19142 17805 gene locus_tag LOCUS_00230 gene gcvPA 19142 17805 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903166.1 protein_id gnl|my_center|LOCUS_00230 20535 19282 gene locus_tag LOCUS_00240 20535 19282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 23065 20597 gene locus_tag LOCUS_00250 23065 20597 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903632.1 protein_id gnl|my_center|LOCUS_00250 23911 23072 gene locus_tag LOCUS_00260 23911 23072 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070807659.1 protein_id gnl|my_center|LOCUS_00260 25105 24068 gene locus_tag LOCUS_00270 25105 24068 CDS product TIGR04024 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902973.1 protein_id gnl|my_center|LOCUS_00270 25592 25143 gene locus_tag LOCUS_00280 25592 25143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 25873 26724 gene locus_tag LOCUS_00290 25873 26724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 26946 27335 gene locus_tag LOCUS_00300 26946 27335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 27747 27673 gene locus_tag LOCUS_t00010 27747 27673 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 27981 29429 gene locus_tag LOCUS_00310 27981 29429 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902698.1 protein_id gnl|my_center|LOCUS_00310 29731 29426 gene locus_tag LOCUS_00320 29731 29426 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902697.1 protein_id gnl|my_center|LOCUS_00320 31015 29834 gene locus_tag LOCUS_00330 31015 29834 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902666.1 protein_id gnl|my_center|LOCUS_00330 33108 31012 gene locus_tag LOCUS_00340 33108 31012 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902665.1 protein_id gnl|my_center|LOCUS_00340 34274 33180 gene locus_tag LOCUS_00350 34274 33180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 35014 34274 gene locus_tag LOCUS_00360 35014 34274 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904122.1 protein_id gnl|my_center|LOCUS_00360 36506 35118 gene locus_tag LOCUS_00370 36506 35118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 37587 36652 gene locus_tag LOCUS_00380 37587 36652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 38589 38113 gene locus_tag LOCUS_00390 38589 38113 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975651.1 protein_id gnl|my_center|LOCUS_00390 39033 38623 gene locus_tag LOCUS_00400 39033 38623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903493.1 protein_id gnl|my_center|LOCUS_00400 40276 39155 gene locus_tag LOCUS_00410 40276 39155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 40678 40295 gene locus_tag LOCUS_00420 gene gcvH 40678 40295 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903167.1 protein_id gnl|my_center|LOCUS_00420 41817 40675 gene locus_tag LOCUS_00430 gene gcvT 41817 40675 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903168.1 protein_id gnl|my_center|LOCUS_00430 41986 43464 gene locus_tag LOCUS_00440 41986 43464 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903877.1 protein_id gnl|my_center|LOCUS_00440 45754 43508 gene locus_tag LOCUS_00450 45754 43508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 46127 46603 gene locus_tag LOCUS_00460 46127 46603 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289360.1 protein_id gnl|my_center|LOCUS_00460 46760 47473 gene locus_tag LOCUS_00470 46760 47473 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890736.1 protein_id gnl|my_center|LOCUS_00470 48069 47596 gene locus_tag LOCUS_00480 48069 47596 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902059.1 protein_id gnl|my_center|LOCUS_00480 48902 48183 gene locus_tag LOCUS_00490 48902 48183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 49972 49223 gene locus_tag LOCUS_00500 49972 49223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00500 50928 50761 gene locus_tag LOCUS_00510 50928 50761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 51465 50980 gene locus_tag LOCUS_00520 51465 50980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 52204 51548 gene locus_tag LOCUS_00530 52204 51548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 52347 53813 gene locus_tag LOCUS_00540 52347 53813 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903057.1 protein_id gnl|my_center|LOCUS_00540 54627 53953 gene locus_tag LOCUS_00550 54627 53953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 54980 54624 gene locus_tag LOCUS_00560 54980 54624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 55082 56047 gene locus_tag LOCUS_00570 55082 56047 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903775.1 protein_id gnl|my_center|LOCUS_00570 56044 56964 gene locus_tag LOCUS_00580 56044 56964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 57940 57074 gene locus_tag LOCUS_00590 57940 57074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 59007 57937 gene locus_tag LOCUS_00600 59007 57937 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250976.1 protein_id gnl|my_center|LOCUS_00600 59413 59201 gene locus_tag LOCUS_00610 59413 59201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 59564 60568 gene locus_tag LOCUS_00620 gene moaA 59564 60568 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289091.1 protein_id gnl|my_center|LOCUS_00620 61324 60641 gene locus_tag LOCUS_00630 61324 60641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 63312 61321 gene locus_tag LOCUS_00640 63312 61321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 64049 63309 gene locus_tag LOCUS_00650 64049 63309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 64086 64280 gene locus_tag LOCUS_00660 64086 64280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 64436 64521 gene locus_tag LOCUS_t00020 64436 64521 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 64594 65115 gene locus_tag LOCUS_00670 64594 65115 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902812.1 protein_id gnl|my_center|LOCUS_00670 65115 65636 gene locus_tag LOCUS_00680 65115 65636 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902813.1 protein_id gnl|my_center|LOCUS_00680 65638 66027 gene locus_tag LOCUS_00690 65638 66027 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902814.1 protein_id gnl|my_center|LOCUS_00690 66031 66780 gene locus_tag LOCUS_00700 66031 66780 CDS product DNA-directed RNA polymerase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902815.1 protein_id gnl|my_center|LOCUS_00700 66909 66993 gene locus_tag LOCUS_t00030 66909 66993 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 67203 67556 gene locus_tag LOCUS_00710 67203 67556 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902816.1 protein_id gnl|my_center|LOCUS_00710 67553 68002 gene locus_tag LOCUS_00720 67553 68002 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902817.1 protein_id gnl|my_center|LOCUS_00720 67996 68394 gene locus_tag LOCUS_00730 67996 68394 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902818.1 protein_id gnl|my_center|LOCUS_00730 68407 68601 gene locus_tag LOCUS_00740 68407 68601 CDS product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902819.1 protein_id gnl|my_center|LOCUS_00740 68603 68788 gene locus_tag LOCUS_00750 68603 68788 CDS product DNA-directed RNA polymerase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902820.1 protein_id gnl|my_center|LOCUS_00750 68785 69990 gene locus_tag LOCUS_00760 68785 69990 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902821.1 protein_id gnl|my_center|LOCUS_00760 69987 70790 gene locus_tag LOCUS_00770 gene rpsB 69987 70790 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902822.1 protein_id gnl|my_center|LOCUS_00770 71988 71227 gene locus_tag LOCUS_00780 71988 71227 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869263.1 protein_id gnl|my_center|LOCUS_00780 74411 72069 gene locus_tag LOCUS_00790 gene tmcA 74411 72069 CDS product tRNA(Met) cytidine acetyltransferase TmcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289283.1 protein_id gnl|my_center|LOCUS_00790 74644 75048 gene locus_tag LOCUS_00800 74644 75048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 75414 75776 gene locus_tag LOCUS_00810 gene rpl7ae 75414 75776 CDS product 50S ribosomal protein L7Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902832.1 protein_id gnl|my_center|LOCUS_00810 75788 76012 gene locus_tag LOCUS_00820 75788 76012 CDS product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902833.1 protein_id gnl|my_center|LOCUS_00820 76016 76369 gene locus_tag LOCUS_00830 76016 76369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 76366 76830 gene locus_tag LOCUS_00840 gene ndk 76366 76830 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902835.1 protein_id gnl|my_center|LOCUS_00840 77032 77409 gene locus_tag LOCUS_00850 77032 77409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 77683 78285 gene locus_tag LOCUS_00860 gene sod 77683 78285 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902966.1 protein_id gnl|my_center|LOCUS_00860 78437 81565 gene locus_tag LOCUS_00870 78437 81565 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903811.1 protein_id gnl|my_center|LOCUS_00870 83869 82100 gene locus_tag LOCUS_00880 83869 82100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 83969 84235 gene locus_tag LOCUS_00890 83969 84235 CDS product DUF5827 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902964.1 protein_id gnl|my_center|LOCUS_00890 84232 85119 gene locus_tag LOCUS_00900 84232 85119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 85195 86355 gene locus_tag LOCUS_00910 85195 86355 CDS product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903788.1 protein_id gnl|my_center|LOCUS_00910 86359 88320 gene locus_tag LOCUS_00920 86359 88320 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903789.1 protein_id gnl|my_center|LOCUS_00920 88317 89363 gene locus_tag LOCUS_00930 88317 89363 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903790.1 protein_id gnl|my_center|LOCUS_00930 90075 89491 gene locus_tag LOCUS_00940 90075 89491 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902963.1 protein_id gnl|my_center|LOCUS_00940 90220 91416 gene locus_tag LOCUS_00950 90220 91416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903588.1 protein_id gnl|my_center|LOCUS_00950 92820 91498 gene locus_tag LOCUS_00960 92820 91498 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459437.1 protein_id gnl|my_center|LOCUS_00960 >Feature sequence05 776 93 gene locus_tag LOCUS_00970 776 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 1005 2030 gene locus_tag LOCUS_00980 1005 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 2139 2456 gene locus_tag LOCUS_00990 2139 2456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 3351 2458 gene locus_tag LOCUS_01000 3351 2458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 4454 3348 gene locus_tag LOCUS_01010 4454 3348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 5901 4600 gene locus_tag LOCUS_01020 5901 4600 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289069.1 protein_id gnl|my_center|LOCUS_01020 6433 6119 gene locus_tag LOCUS_01030 6433 6119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 6799 6524 gene locus_tag LOCUS_01040 6799 6524 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903037.1 protein_id gnl|my_center|LOCUS_01040 7191 8357 gene locus_tag LOCUS_01050 7191 8357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 8585 9658 gene locus_tag LOCUS_01060 8585 9658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 9668 9865 gene locus_tag LOCUS_01070 9668 9865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 10175 9810 gene locus_tag LOCUS_01080 10175 9810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 10905 10201 gene locus_tag LOCUS_01090 10905 10201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 12379 10922 gene locus_tag LOCUS_01100 12379 10922 CDS product IS66-like element ISH10B family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289081.1 protein_id gnl|my_center|LOCUS_01100 13001 15151 gene locus_tag LOCUS_01110 13001 15151 CDS product type B DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015299360.1 protein_id gnl|my_center|LOCUS_01110 15670 16893 gene locus_tag LOCUS_01120 15670 16893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 18341 17052 gene locus_tag LOCUS_01130 18341 17052 CDS product orc1/cdc6 family replication initiation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173362416.1 protein_id gnl|my_center|LOCUS_01130 19007 20236 gene locus_tag LOCUS_01140 19007 20236 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289069.1 protein_id gnl|my_center|LOCUS_01140 21180 20656 gene locus_tag LOCUS_01150 21180 20656 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904195.1 protein_id gnl|my_center|LOCUS_01150 21681 21358 gene locus_tag LOCUS_01160 21681 21358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904196.1 protein_id gnl|my_center|LOCUS_01160 22560 21886 gene locus_tag LOCUS_01170 22560 21886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 22925 22632 gene locus_tag LOCUS_01180 22925 22632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 23057 22984 gene locus_tag LOCUS_t00040 23057 22984 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 24607 23078 gene locus_tag LOCUS_01190 24607 23078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 24796 24717 gene locus_tag LOCUS_t00050 24796 24717 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 25296 25221 gene locus_tag LOCUS_t00060 25296 25221 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 25743 25339 gene locus_tag LOCUS_01200 25743 25339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 25826 25756 gene locus_tag LOCUS_t00070 25826 25756 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 26002 25930 gene locus_tag LOCUS_t00080 26002 25930 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 26245 26173 gene locus_tag LOCUS_t00090 26245 26173 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 26332 26250 gene locus_tag LOCUS_t00100 26332 26250 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 26456 26375 gene locus_tag LOCUS_t00110 26456 26375 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 27874 26582 gene locus_tag LOCUS_01210 27874 26582 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289069.1 protein_id gnl|my_center|LOCUS_01210 28434 28345 gene locus_tag LOCUS_t00120 28434 28345 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 28510 28437 gene locus_tag LOCUS_t00130 28510 28437 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 28834 28759 gene locus_tag LOCUS_t00140 28834 28759 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 28915 28839 gene locus_tag LOCUS_t00150 28915 28839 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 30428 29628 gene locus_tag LOCUS_01220 30428 29628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070807669.1 protein_id gnl|my_center|LOCUS_01220 30544 31032 gene locus_tag LOCUS_01230 30544 31032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 31925 31095 gene locus_tag LOCUS_01240 31925 31095 CDS product type IV toxin-antitoxin system AbiEi family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890440.1 protein_id gnl|my_center|LOCUS_01240 >Feature sequence06 180 1628 gene locus_tag LOCUS_01250 180 1628 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902753.1 protein_id gnl|my_center|LOCUS_01250 2075 1800 gene locus_tag LOCUS_01260 2075 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289087.1 protein_id gnl|my_center|LOCUS_01260 2410 2153 gene locus_tag LOCUS_01270 2410 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 2661 3158 gene locus_tag LOCUS_01280 2661 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 3151 4182 gene locus_tag LOCUS_01290 3151 4182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 4484 5182 gene locus_tag LOCUS_01300 4484 5182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 5172 5681 gene locus_tag LOCUS_01310 5172 5681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 5991 6494 gene locus_tag LOCUS_01320 5991 6494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 6649 6960 gene locus_tag LOCUS_01330 6649 6960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890452.1 protein_id gnl|my_center|LOCUS_01330 6957 7460 gene locus_tag LOCUS_01340 6957 7460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890451.1 protein_id gnl|my_center|LOCUS_01340 7931 8665 gene locus_tag LOCUS_01350 gene aglF 7931 8665 CDS product UTP--glucose-1-phosphate uridylyltransferase AglF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901983.1 protein_id gnl|my_center|LOCUS_01350 8861 10345 gene locus_tag LOCUS_01360 gene crtI 8861 10345 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903230.1 protein_id gnl|my_center|LOCUS_01360 10342 11280 gene locus_tag LOCUS_01370 10342 11280 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903229.1 protein_id gnl|my_center|LOCUS_01370 11273 12238 gene locus_tag LOCUS_01380 gene cruF 11273 12238 CDS product bisanhydrobacterioruberin hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903228.1 protein_id gnl|my_center|LOCUS_01380 12522 12319 gene locus_tag LOCUS_01390 12522 12319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 13601 12651 gene locus_tag LOCUS_01400 13601 12651 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903227.1 protein_id gnl|my_center|LOCUS_01400 15391 13721 gene locus_tag LOCUS_01410 15391 13721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 16702 15461 gene locus_tag LOCUS_01420 16702 15461 CDS product TIGR00300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876500.1 protein_id gnl|my_center|LOCUS_01420 16991 17437 gene locus_tag LOCUS_01430 16991 17437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 17695 18099 gene locus_tag LOCUS_01440 gene msrB 17695 18099 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876350.1 protein_id gnl|my_center|LOCUS_01440 18150 18572 gene locus_tag LOCUS_01450 gene hisI 18150 18572 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903699.1 protein_id gnl|my_center|LOCUS_01450 18578 19729 gene locus_tag LOCUS_01460 18578 19729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903638.1 protein_id gnl|my_center|LOCUS_01460 21419 19758 gene locus_tag LOCUS_01470 21419 19758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 21705 23534 gene locus_tag LOCUS_01480 21705 23534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 23887 32484 gene locus_tag LOCUS_01490 23887 32484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 34466 33102 gene locus_tag LOCUS_01500 gene glmM 34466 33102 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903637.1 protein_id gnl|my_center|LOCUS_01500 34550 35440 gene locus_tag LOCUS_01510 34550 35440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903635.1 protein_id gnl|my_center|LOCUS_01510 35487 36338 gene locus_tag LOCUS_01520 35487 36338 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903634.1 protein_id gnl|my_center|LOCUS_01520 36408 37418 gene locus_tag LOCUS_01530 gene aglJ 36408 37418 CDS product S-layer glycoprotein N-glycosyltransferase AglJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902752.1 protein_id gnl|my_center|LOCUS_01530 37758 37429 gene locus_tag LOCUS_01540 37758 37429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902494.1 protein_id gnl|my_center|LOCUS_01540 37903 38112 gene locus_tag LOCUS_01550 37903 38112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 38821 38390 gene locus_tag LOCUS_01560 38821 38390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903839.1 protein_id gnl|my_center|LOCUS_01560 39594 38911 gene locus_tag LOCUS_01570 39594 38911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902751.1 protein_id gnl|my_center|LOCUS_01570 39783 40829 gene locus_tag LOCUS_01580 39783 40829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 40934 41623 gene locus_tag LOCUS_01590 40934 41623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 42177 41803 gene locus_tag LOCUS_01600 42177 41803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 42605 42315 gene locus_tag LOCUS_01610 42605 42315 CDS product DUF5779 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902748.1 protein_id gnl|my_center|LOCUS_01610 43285 42830 gene locus_tag LOCUS_01620 43285 42830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 43880 44923 gene locus_tag LOCUS_01630 43880 44923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01630 45229 47055 gene locus_tag LOCUS_01640 45229 47055 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023692.1 protein_id gnl|my_center|LOCUS_01640 47052 47717 gene locus_tag LOCUS_01650 47052 47717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 47710 48768 gene locus_tag LOCUS_01660 gene ilvC 47710 48768 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392863.1 protein_id gnl|my_center|LOCUS_01660 48786 49052 gene locus_tag LOCUS_01670 48786 49052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 49049 50470 gene locus_tag LOCUS_01680 gene leuC 49049 50470 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404876.1 protein_id gnl|my_center|LOCUS_01680 50467 51108 gene locus_tag LOCUS_01690 gene leuD 50467 51108 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404878.1 protein_id gnl|my_center|LOCUS_01690 51487 51143 gene locus_tag LOCUS_01700 51487 51143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 51635 52615 gene locus_tag LOCUS_01710 gene leuB 51635 52615 CDS product bifunctional 3-isopropylmalate/3-methylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870225.1 protein_id gnl|my_center|LOCUS_01710 52792 53295 gene locus_tag LOCUS_01720 52792 53295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 53391 53918 gene locus_tag LOCUS_01730 53391 53918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 55091 53985 gene locus_tag LOCUS_01740 55091 53985 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976898.1 protein_id gnl|my_center|LOCUS_01740 >Feature sequence07 1101 772 gene locus_tag LOCUS_01750 1101 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 1436 2335 gene locus_tag LOCUS_01760 gene map 1436 2335 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903366.1 protein_id gnl|my_center|LOCUS_01760 2976 2368 gene locus_tag LOCUS_01770 2976 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 3145 4563 gene locus_tag LOCUS_01780 3145 4563 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262233.1 protein_id gnl|my_center|LOCUS_01780 4760 4984 gene locus_tag LOCUS_01790 4760 4984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 5040 6290 gene locus_tag LOCUS_01800 gene gatD 5040 6290 CDS product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903349.1 protein_id gnl|my_center|LOCUS_01800 6390 7343 gene locus_tag LOCUS_01810 6390 7343 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289391.1 protein_id gnl|my_center|LOCUS_01810 7703 7407 gene locus_tag LOCUS_01820 7703 7407 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289392.1 protein_id gnl|my_center|LOCUS_01820 7854 8252 gene locus_tag LOCUS_01830 7854 8252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 9576 8344 gene locus_tag LOCUS_01840 9576 8344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 10835 9573 gene locus_tag LOCUS_01850 10835 9573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 10931 12118 gene locus_tag LOCUS_01860 10931 12118 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289393.1 protein_id gnl|my_center|LOCUS_01860 12848 12168 gene locus_tag LOCUS_01870 gene deoC 12848 12168 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903361.1 protein_id gnl|my_center|LOCUS_01870 12920 13900 gene locus_tag LOCUS_01880 12920 13900 CDS product ribose 1,5-bisphosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903358.1 protein_id gnl|my_center|LOCUS_01880 14008 14829 gene locus_tag LOCUS_01890 14008 14829 CDS product DUF63 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903357.1 protein_id gnl|my_center|LOCUS_01890 14865 15746 gene locus_tag LOCUS_01900 14865 15746 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903356.1 protein_id gnl|my_center|LOCUS_01900 16077 15718 gene locus_tag LOCUS_01910 16077 15718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 16076 16378 gene locus_tag LOCUS_01920 16076 16378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 16529 17305 gene locus_tag LOCUS_01930 16529 17305 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903355.1 protein_id gnl|my_center|LOCUS_01930 17302 17751 gene locus_tag LOCUS_01940 17302 17751 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526466.1 protein_id gnl|my_center|LOCUS_01940 18659 17841 gene locus_tag LOCUS_01950 18659 17841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 18809 19810 gene locus_tag LOCUS_01960 18809 19810 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384035.1 protein_id gnl|my_center|LOCUS_01960 22073 19941 gene locus_tag LOCUS_01970 gene ligA 22073 19941 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403650.1 protein_id gnl|my_center|LOCUS_01970 23393 22170 gene locus_tag LOCUS_01980 23393 22170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 24845 23574 gene locus_tag LOCUS_01990 24845 23574 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902278.1 protein_id gnl|my_center|LOCUS_01990 25228 24893 gene locus_tag LOCUS_02000 25228 24893 CDS product uS10/mL48 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902275.1 protein_id gnl|my_center|LOCUS_02000 25505 25948 gene locus_tag LOCUS_02010 25505 25948 CDS product bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902274.1 protein_id gnl|my_center|LOCUS_02010 27075 26056 gene locus_tag LOCUS_02020 27075 26056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 29101 27794 gene locus_tag LOCUS_02030 29101 27794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 30441 29098 gene locus_tag LOCUS_02040 30441 29098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 30605 31723 gene locus_tag LOCUS_02050 30605 31723 CDS product DUF354 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024333.1 protein_id gnl|my_center|LOCUS_02050 32143 33498 gene locus_tag LOCUS_02060 gene glnA 32143 33498 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013060929.1 protein_id gnl|my_center|LOCUS_02060 33991 33758 gene locus_tag LOCUS_02070 33991 33758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 34067 34504 gene locus_tag LOCUS_02080 34067 34504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 35258 34548 gene locus_tag LOCUS_02090 35258 34548 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903123.1 protein_id gnl|my_center|LOCUS_02090 35775 35326 gene locus_tag LOCUS_02100 35775 35326 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889463.1 protein_id gnl|my_center|LOCUS_02100 35984 36649 gene locus_tag LOCUS_02110 35984 36649 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903351.1 protein_id gnl|my_center|LOCUS_02110 36852 37976 gene locus_tag LOCUS_02120 36852 37976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 37973 38272 gene locus_tag LOCUS_02130 37973 38272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 39545 38280 gene locus_tag LOCUS_02140 39545 38280 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929725.1 protein_id gnl|my_center|LOCUS_02140 40007 39609 gene locus_tag LOCUS_02150 40007 39609 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879542.1 protein_id gnl|my_center|LOCUS_02150 40712 40029 gene locus_tag LOCUS_02160 40712 40029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 42890 40860 gene locus_tag LOCUS_02170 42890 40860 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902517.1 protein_id gnl|my_center|LOCUS_02170 44211 42883 gene locus_tag LOCUS_02180 44211 42883 CDS product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902518.1 protein_id gnl|my_center|LOCUS_02180 46519 44234 gene locus_tag LOCUS_02190 46519 44234 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902519.1 protein_id gnl|my_center|LOCUS_02190 48593 46521 gene locus_tag LOCUS_02200 48593 46521 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902520.1 protein_id gnl|my_center|LOCUS_02200 49111 49536 gene locus_tag LOCUS_02210 49111 49536 CDS product DUF5820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903019.1 protein_id gnl|my_center|LOCUS_02210 49562 50008 gene locus_tag LOCUS_02220 49562 50008 CDS product UPF0179 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903018.1 protein_id gnl|my_center|LOCUS_02220 50398 51339 gene locus_tag LOCUS_02230 50398 51339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 51556 52617 gene locus_tag LOCUS_02240 51556 52617 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902258.1 protein_id gnl|my_center|LOCUS_02240 52667 53077 gene locus_tag LOCUS_02250 52667 53077 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903622.1 protein_id gnl|my_center|LOCUS_02250 54244 53093 gene locus_tag LOCUS_02260 gene trpB 54244 53093 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064422.1 protein_id gnl|my_center|LOCUS_02260 55145 54309 gene locus_tag LOCUS_02270 gene pstB 55145 54309 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906105.1 protein_id gnl|my_center|LOCUS_02270 56002 55142 gene locus_tag LOCUS_02280 gene pstA 56002 55142 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140450.1 protein_id gnl|my_center|LOCUS_02280 56943 56002 gene locus_tag LOCUS_02290 gene pstC 56943 56002 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877335.1 protein_id gnl|my_center|LOCUS_02290 57872 56952 gene locus_tag LOCUS_02300 57872 56952 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803239.1 protein_id gnl|my_center|LOCUS_02300 59267 58284 gene locus_tag LOCUS_02310 59267 58284 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111816.1 protein_id gnl|my_center|LOCUS_02310 61272 59587 gene locus_tag LOCUS_02320 61272 59587 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902435.1 protein_id gnl|my_center|LOCUS_02320 62266 61535 gene locus_tag LOCUS_02330 62266 61535 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902086.1 protein_id gnl|my_center|LOCUS_02330 62625 63035 gene locus_tag LOCUS_02340 62625 63035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 63549 63872 gene locus_tag LOCUS_02350 63549 63872 CDS product DUF5785 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902883.1 protein_id gnl|my_center|LOCUS_02350 64056 64793 gene locus_tag LOCUS_02360 64056 64793 CDS product GTP cyclohydrolase IIa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902721.1 protein_id gnl|my_center|LOCUS_02360 64887 65495 gene locus_tag LOCUS_02370 64887 65495 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870158.1 protein_id gnl|my_center|LOCUS_02370 65621 66835 gene locus_tag LOCUS_02380 gene pgk 65621 66835 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902880.1 protein_id gnl|my_center|LOCUS_02380 66813 67319 gene locus_tag LOCUS_02390 66813 67319 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902879.1 protein_id gnl|my_center|LOCUS_02390 67332 67406 gene locus_tag LOCUS_t00160 67332 67406 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 67683 67970 gene locus_tag LOCUS_02400 67683 67970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 68833 68081 gene locus_tag LOCUS_02410 68833 68081 CDS product ribonuclease H-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289293.1 protein_id gnl|my_center|LOCUS_02410 70278 68872 gene locus_tag LOCUS_02420 70278 68872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 70536 72326 gene locus_tag LOCUS_02430 70536 72326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 73384 72401 gene locus_tag LOCUS_02440 73384 72401 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902188.1 protein_id gnl|my_center|LOCUS_02440 73605 74147 gene locus_tag LOCUS_02450 73605 74147 CDS product DUF84 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869966.1 protein_id gnl|my_center|LOCUS_02450 74377 74598 gene locus_tag LOCUS_02460 74377 74598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902191.1 protein_id gnl|my_center|LOCUS_02460 74718 75371 gene locus_tag LOCUS_02470 74718 75371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 76080 75445 gene locus_tag LOCUS_02480 76080 75445 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902192.1 protein_id gnl|my_center|LOCUS_02480 76601 76332 gene locus_tag LOCUS_02490 76601 76332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 76869 77609 gene locus_tag LOCUS_02500 76869 77609 CDS product DUF4397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257289.1 protein_id gnl|my_center|LOCUS_02500 77673 79805 gene locus_tag LOCUS_02510 gene uvrB 77673 79805 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903784.1 protein_id gnl|my_center|LOCUS_02510 79941 81308 gene locus_tag LOCUS_02520 gene hemL 79941 81308 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875867.1 protein_id gnl|my_center|LOCUS_02520 81905 81423 gene locus_tag LOCUS_02530 81905 81423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 82564 82061 gene locus_tag LOCUS_02540 82564 82061 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222818.1 protein_id gnl|my_center|LOCUS_02540 83002 82628 gene locus_tag LOCUS_02550 83002 82628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 83498 83208 gene locus_tag LOCUS_02560 83498 83208 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902241.1 protein_id gnl|my_center|LOCUS_02560 83627 84598 gene locus_tag LOCUS_02570 83627 84598 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289150.1 protein_id gnl|my_center|LOCUS_02570 84921 84703 gene locus_tag LOCUS_02580 84921 84703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 86251 85118 gene locus_tag LOCUS_02590 86251 85118 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902627.1 protein_id gnl|my_center|LOCUS_02590 87298 86315 gene locus_tag LOCUS_02600 gene mvaD 87298 86315 CDS product phosphomevalonate decarboxylase MvaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289187.1 protein_id gnl|my_center|LOCUS_02600 87673 87500 gene locus_tag LOCUS_02610 87673 87500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 87958 88311 gene locus_tag LOCUS_02620 87958 88311 CDS product DUF555 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902617.1 protein_id gnl|my_center|LOCUS_02620 88367 88906 gene locus_tag LOCUS_02630 88367 88906 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902616.1 protein_id gnl|my_center|LOCUS_02630 89857 89069 gene locus_tag LOCUS_02640 89857 89069 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532996.1 protein_id gnl|my_center|LOCUS_02640 90636 89857 gene locus_tag LOCUS_02650 gene urtD 90636 89857 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889582.1 protein_id gnl|my_center|LOCUS_02650 91736 90636 gene locus_tag LOCUS_02660 91736 90636 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083027.1 protein_id gnl|my_center|LOCUS_02660 92623 91733 gene locus_tag LOCUS_02670 92623 91733 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083029.1 protein_id gnl|my_center|LOCUS_02670 93896 92625 gene locus_tag LOCUS_02680 gene urtA 93896 92625 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860043.1 protein_id gnl|my_center|LOCUS_02680 94519 96048 gene locus_tag LOCUS_02690 94519 96048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 96101 97084 gene locus_tag LOCUS_02700 96101 97084 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904121.1 protein_id gnl|my_center|LOCUS_02700 97337 97726 gene locus_tag LOCUS_02710 97337 97726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 97723 99429 gene locus_tag LOCUS_02720 gene ureC 97723 99429 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267497.1 protein_id gnl|my_center|LOCUS_02720 99514 99930 gene locus_tag LOCUS_02730 99514 99930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 99930 100550 gene locus_tag LOCUS_02740 gene ureG 99930 100550 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004390399.1 protein_id gnl|my_center|LOCUS_02740 100547 101512 gene locus_tag LOCUS_02750 100547 101512 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815718.1 protein_id gnl|my_center|LOCUS_02750 101512 102105 gene locus_tag LOCUS_02760 101512 102105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 102095 102868 gene locus_tag LOCUS_02770 102095 102868 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095528.1 protein_id gnl|my_center|LOCUS_02770 103978 102980 gene locus_tag LOCUS_02780 103978 102980 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902188.1 protein_id gnl|my_center|LOCUS_02780 105211 104237 gene locus_tag LOCUS_02790 105211 104237 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257134.1 protein_id gnl|my_center|LOCUS_02790 106005 105544 gene locus_tag LOCUS_02800 106005 105544 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289215.1 protein_id gnl|my_center|LOCUS_02800 106231 106971 gene locus_tag LOCUS_02810 106231 106971 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903969.1 protein_id gnl|my_center|LOCUS_02810 107061 107858 gene locus_tag LOCUS_02820 107061 107858 CDS product YqcI/YcgG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902790.1 protein_id gnl|my_center|LOCUS_02820 107855 108418 gene locus_tag LOCUS_02830 107855 108418 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902791.1 protein_id gnl|my_center|LOCUS_02830 108970 109116 gene locus_tag LOCUS_02840 108970 109116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 109317 110486 gene locus_tag LOCUS_02850 109317 110486 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063903.1 protein_id gnl|my_center|LOCUS_02850 110601 112637 gene locus_tag LOCUS_02860 110601 112637 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925163.1 protein_id gnl|my_center|LOCUS_02860 112718 113488 gene locus_tag LOCUS_02870 112718 113488 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533049.1 protein_id gnl|my_center|LOCUS_02870 114607 113600 gene locus_tag LOCUS_02880 114607 113600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 115911 114706 gene locus_tag LOCUS_02890 115911 114706 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229596.1 protein_id gnl|my_center|LOCUS_02890 116034 116816 gene locus_tag LOCUS_02900 116034 116816 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925927.1 protein_id gnl|my_center|LOCUS_02900 118018 116885 gene locus_tag LOCUS_02910 118018 116885 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225693.1 protein_id gnl|my_center|LOCUS_02910 118129 119289 gene locus_tag LOCUS_02920 118129 119289 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967073.1 protein_id gnl|my_center|LOCUS_02920 119286 119705 gene locus_tag LOCUS_02930 119286 119705 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813481.1 protein_id gnl|my_center|LOCUS_02930 122106 120385 gene locus_tag LOCUS_02940 122106 120385 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090028.1 protein_id gnl|my_center|LOCUS_02940 122768 122103 gene locus_tag LOCUS_02950 122768 122103 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969826.1 protein_id gnl|my_center|LOCUS_02950 122930 124102 gene locus_tag LOCUS_02960 122930 124102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 124217 125431 gene locus_tag LOCUS_02970 124217 125431 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808803.1 protein_id gnl|my_center|LOCUS_02970 125607 126101 gene locus_tag LOCUS_02980 125607 126101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 126891 126124 gene locus_tag LOCUS_02990 126891 126124 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861082.1 protein_id gnl|my_center|LOCUS_02990 128100 126943 gene locus_tag LOCUS_03000 128100 126943 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405273.1 protein_id gnl|my_center|LOCUS_03000 128263 129951 gene locus_tag LOCUS_03010 128263 129951 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930084.1 protein_id gnl|my_center|LOCUS_03010 130034 130825 gene locus_tag LOCUS_03020 130034 130825 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090625.1 protein_id gnl|my_center|LOCUS_03020 131647 130850 gene locus_tag LOCUS_03030 131647 130850 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090625.1 protein_id gnl|my_center|LOCUS_03030 132481 131711 gene locus_tag LOCUS_03040 132481 131711 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391955.1 protein_id gnl|my_center|LOCUS_03040 133597 132803 gene locus_tag LOCUS_03050 133597 132803 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256011.1 protein_id gnl|my_center|LOCUS_03050 134177 134986 gene locus_tag LOCUS_03060 134177 134986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 135196 135906 gene locus_tag LOCUS_03070 135196 135906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 136273 136004 gene locus_tag LOCUS_03080 136273 136004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 136993 136430 gene locus_tag LOCUS_03090 136993 136430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 137127 137732 gene locus_tag LOCUS_03100 137127 137732 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289316.1 protein_id gnl|my_center|LOCUS_03100 138579 137746 gene locus_tag LOCUS_03110 138579 137746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 139991 138582 gene locus_tag LOCUS_03120 139991 138582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 140139 141116 gene locus_tag LOCUS_03130 gene fen 140139 141116 CDS product flap endonuclease-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902986.1 protein_id gnl|my_center|LOCUS_03130 141213 141767 gene locus_tag LOCUS_03140 141213 141767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 141872 144142 gene locus_tag LOCUS_03150 141872 144142 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243331.1 protein_id gnl|my_center|LOCUS_03150 144543 145046 gene locus_tag LOCUS_03160 144543 145046 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389344.1 protein_id gnl|my_center|LOCUS_03160 145043 146740 gene locus_tag LOCUS_03170 145043 146740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 147391 146795 gene locus_tag LOCUS_03180 147391 146795 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087162.1 protein_id gnl|my_center|LOCUS_03180 147529 147711 gene locus_tag LOCUS_03190 147529 147711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 149650 147893 gene locus_tag LOCUS_03200 gene arcS 149650 147893 CDS product archaeosine synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903438.1 protein_id gnl|my_center|LOCUS_03200 149754 150890 gene locus_tag LOCUS_03210 149754 150890 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289424.1 protein_id gnl|my_center|LOCUS_03210 150962 151345 gene locus_tag LOCUS_03220 150962 151345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 151692 151360 gene locus_tag LOCUS_03230 151692 151360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 152038 151694 gene locus_tag LOCUS_03240 152038 151694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 152144 154258 gene locus_tag LOCUS_03250 152144 154258 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021363.1 protein_id gnl|my_center|LOCUS_03250 155973 154291 gene locus_tag LOCUS_03260 155973 154291 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066253.1 protein_id gnl|my_center|LOCUS_03260 156151 156573 gene locus_tag LOCUS_03270 156151 156573 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289494.1 protein_id gnl|my_center|LOCUS_03270 156718 159948 gene locus_tag LOCUS_03280 156718 159948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 160180 160875 gene locus_tag LOCUS_03290 160180 160875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 162919 160892 gene locus_tag LOCUS_03300 162919 160892 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762583.1 protein_id gnl|my_center|LOCUS_03300 >Feature sequence08 395 84 gene locus_tag LOCUS_03310 395 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 1330 494 gene locus_tag LOCUS_03320 1330 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 1919 2959 gene locus_tag LOCUS_03330 1919 2959 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890425.1 protein_id gnl|my_center|LOCUS_03330 >Feature sequence09 1272 2759 gene locus_tag LOCUS_03340 gene proS 1272 2759 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902251.1 protein_id gnl|my_center|LOCUS_03340 3390 3043 gene locus_tag LOCUS_03350 3390 3043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 4373 3519 gene locus_tag LOCUS_03360 4373 3519 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903173.1 protein_id gnl|my_center|LOCUS_03360 5333 6115 gene locus_tag LOCUS_03370 5333 6115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 7085 6174 gene locus_tag LOCUS_03380 7085 6174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 7420 7082 gene locus_tag LOCUS_03390 7420 7082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 7734 7456 gene locus_tag LOCUS_03400 7734 7456 CDS product ribonuclease P protein component 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902407.1 protein_id gnl|my_center|LOCUS_03400 7945 9672 gene locus_tag LOCUS_03410 7945 9672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 9672 10517 gene locus_tag LOCUS_03420 9672 10517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 11005 10535 gene locus_tag LOCUS_03430 11005 10535 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289136.1 protein_id gnl|my_center|LOCUS_03430 12034 11060 gene locus_tag LOCUS_03440 12034 11060 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903967.1 protein_id gnl|my_center|LOCUS_03440 12880 12137 gene locus_tag LOCUS_03450 12880 12137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 13833 12997 gene locus_tag LOCUS_03460 13833 12997 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764971.1 protein_id gnl|my_center|LOCUS_03460 14175 14474 gene locus_tag LOCUS_03470 14175 14474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 14545 15858 gene locus_tag LOCUS_03480 14545 15858 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289356.1 protein_id gnl|my_center|LOCUS_03480 15941 16867 gene locus_tag LOCUS_03490 15941 16867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 16938 18602 gene locus_tag LOCUS_03500 16938 18602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 18703 19308 gene locus_tag LOCUS_03510 gene cbiT 18703 19308 CDS product precorrin-6Y C5,15-methyltransferase (decarboxylating) subunit CbiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903131.1 protein_id gnl|my_center|LOCUS_03510 19305 20129 gene locus_tag LOCUS_03520 19305 20129 CDS product cobalt-factor II C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903132.1 protein_id gnl|my_center|LOCUS_03520 20126 20992 gene locus_tag LOCUS_03530 20126 20992 CDS product cobalt-precorrin-4/precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903133.1 protein_id gnl|my_center|LOCUS_03530 21034 22380 gene locus_tag LOCUS_03540 21034 22380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 22383 23546 gene locus_tag LOCUS_03550 22383 23546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 23543 24709 gene locus_tag LOCUS_03560 23543 24709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 24717 25085 gene locus_tag LOCUS_03570 24717 25085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 25082 25804 gene locus_tag LOCUS_03580 25082 25804 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877442.1 protein_id gnl|my_center|LOCUS_03580 25873 26724 gene locus_tag LOCUS_03590 25873 26724 CDS product translation initiation factor eIF-2B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903055.1 protein_id gnl|my_center|LOCUS_03590 26795 28084 gene locus_tag LOCUS_03600 26795 28084 CDS product TIGR00341 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021940.1 protein_id gnl|my_center|LOCUS_03600 28370 29473 gene locus_tag LOCUS_03610 28370 29473 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989911.1 protein_id gnl|my_center|LOCUS_03610 30343 29612 gene locus_tag LOCUS_03620 gene psmB 30343 29612 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289244.1 protein_id gnl|my_center|LOCUS_03620 30505 31257 gene locus_tag LOCUS_03630 30505 31257 CDS product DUF2797 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289189.1 protein_id gnl|my_center|LOCUS_03630 31383 31772 gene locus_tag LOCUS_03640 31383 31772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 31924 32715 gene locus_tag LOCUS_03650 31924 32715 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902893.1 protein_id gnl|my_center|LOCUS_03650 32712 34262 gene locus_tag LOCUS_03660 32712 34262 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902894.1 protein_id gnl|my_center|LOCUS_03660 34375 35187 gene locus_tag LOCUS_03670 gene surE 34375 35187 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902899.1 protein_id gnl|my_center|LOCUS_03670 35370 35765 gene locus_tag LOCUS_03680 35370 35765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 38315 35820 gene locus_tag LOCUS_03690 gene folP 38315 35820 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902259.1 protein_id gnl|my_center|LOCUS_03690 39229 38384 gene locus_tag LOCUS_03700 39229 38384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 40065 39325 gene locus_tag LOCUS_03710 40065 39325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 41591 40137 gene locus_tag LOCUS_03720 41591 40137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 44925 41680 gene locus_tag LOCUS_03730 gene carB 44925 41680 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903325.1 protein_id gnl|my_center|LOCUS_03730 45400 45726 gene locus_tag LOCUS_03740 45400 45726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 45801 46850 gene locus_tag LOCUS_03750 45801 46850 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405564.1 protein_id gnl|my_center|LOCUS_03750 48089 46899 gene locus_tag LOCUS_03760 48089 46899 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902891.1 protein_id gnl|my_center|LOCUS_03760 48271 49368 gene locus_tag LOCUS_03770 48271 49368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 49468 50772 gene locus_tag LOCUS_03780 gene aroA 49468 50772 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289296.1 protein_id gnl|my_center|LOCUS_03780 51534 50776 gene locus_tag LOCUS_03790 51534 50776 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902086.1 protein_id gnl|my_center|LOCUS_03790 51666 52037 gene locus_tag LOCUS_03800 51666 52037 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902944.1 protein_id gnl|my_center|LOCUS_03800 53183 52053 gene locus_tag LOCUS_03810 53183 52053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 54702 53245 gene locus_tag LOCUS_03820 54702 53245 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256148.1 protein_id gnl|my_center|LOCUS_03820 57014 54876 gene locus_tag LOCUS_03830 57014 54876 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289305.1 protein_id gnl|my_center|LOCUS_03830 58122 57127 gene locus_tag LOCUS_03840 58122 57127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 61179 58420 gene locus_tag LOCUS_03850 gene acnA 61179 58420 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839326.1 protein_id gnl|my_center|LOCUS_03850 61862 61305 gene locus_tag LOCUS_03860 61862 61305 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403191.1 protein_id gnl|my_center|LOCUS_03860 62875 61859 gene locus_tag LOCUS_03870 62875 61859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 63471 63031 gene locus_tag LOCUS_03880 63471 63031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 64736 63873 gene locus_tag LOCUS_03890 64736 63873 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289221.1 protein_id gnl|my_center|LOCUS_03890 64817 66076 gene locus_tag LOCUS_03900 64817 66076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 66142 67284 gene locus_tag LOCUS_03910 66142 67284 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902541.1 protein_id gnl|my_center|LOCUS_03910 67897 67286 gene locus_tag LOCUS_03920 67897 67286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 68709 68065 gene locus_tag LOCUS_03930 gene tpiA 68709 68065 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902734.1 protein_id gnl|my_center|LOCUS_03930 69075 68779 gene locus_tag LOCUS_03940 69075 68779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 69074 69331 gene locus_tag LOCUS_03950 69074 69331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 69905 69381 gene locus_tag LOCUS_03960 69905 69381 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903120.1 protein_id gnl|my_center|LOCUS_03960 70381 70596 gene locus_tag LOCUS_03970 70381 70596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 70730 72658 gene locus_tag LOCUS_03980 70730 72658 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227739.1 protein_id gnl|my_center|LOCUS_03980 72791 73357 gene locus_tag LOCUS_03990 72791 73357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 73460 74017 gene locus_tag LOCUS_04000 73460 74017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902733.1 protein_id gnl|my_center|LOCUS_04000 74747 74361 gene locus_tag LOCUS_04010 74747 74361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 74878 75540 gene locus_tag LOCUS_04020 74878 75540 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903087.1 protein_id gnl|my_center|LOCUS_04020 76234 75806 gene locus_tag LOCUS_04030 76234 75806 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903086.1 protein_id gnl|my_center|LOCUS_04030 76744 76448 gene locus_tag LOCUS_04040 76744 76448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 77186 76824 gene locus_tag LOCUS_04050 77186 76824 CDS product AzlD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530970.1 protein_id gnl|my_center|LOCUS_04050 77979 77179 gene locus_tag LOCUS_04060 77979 77179 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480275.1 protein_id gnl|my_center|LOCUS_04060 78420 78142 gene locus_tag LOCUS_04070 gene moaD 78420 78142 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251068.1 protein_id gnl|my_center|LOCUS_04070 78937 78488 gene locus_tag LOCUS_04080 78937 78488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 79042 79233 gene locus_tag LOCUS_04090 79042 79233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 79484 80617 gene locus_tag LOCUS_04100 79484 80617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 81041 80754 gene locus_tag LOCUS_04110 81041 80754 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903037.1 protein_id gnl|my_center|LOCUS_04110 81223 81789 gene locus_tag LOCUS_04120 81223 81789 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903441.1 protein_id gnl|my_center|LOCUS_04120 82911 81817 gene locus_tag LOCUS_04130 82911 81817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 84462 83176 gene locus_tag LOCUS_04140 84462 83176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 84815 86293 gene locus_tag LOCUS_04150 gene tgtA 84815 86293 CDS product tRNA guanosine(15) transglycosylase TgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903439.1 protein_id gnl|my_center|LOCUS_04150 86380 86736 gene locus_tag LOCUS_04160 86380 86736 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902750.1 protein_id gnl|my_center|LOCUS_04160 86787 87992 gene locus_tag LOCUS_04170 86787 87992 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903549.1 protein_id gnl|my_center|LOCUS_04170 88386 88066 gene locus_tag LOCUS_04180 88386 88066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 89047 88460 gene locus_tag LOCUS_04190 89047 88460 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903836.1 protein_id gnl|my_center|LOCUS_04190 89619 89047 gene locus_tag LOCUS_04200 89619 89047 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903837.1 protein_id gnl|my_center|LOCUS_04200 89852 90019 gene locus_tag LOCUS_04210 89852 90019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 90006 91049 gene locus_tag LOCUS_04220 90006 91049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 91122 92477 gene locus_tag LOCUS_04230 91122 92477 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063670.1 protein_id gnl|my_center|LOCUS_04230 92526 93596 gene locus_tag LOCUS_04240 92526 93596 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903871.1 protein_id gnl|my_center|LOCUS_04240 93596 93835 gene locus_tag LOCUS_04250 93596 93835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 95323 93719 gene locus_tag LOCUS_04260 95323 93719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 96087 95320 gene locus_tag LOCUS_04270 96087 95320 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903387.1 protein_id gnl|my_center|LOCUS_04270 97531 96149 gene locus_tag LOCUS_04280 gene allB 97531 96149 CDS product allantoinase AllB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461638.1 protein_id gnl|my_center|LOCUS_04280 97687 98196 gene locus_tag LOCUS_04290 97687 98196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 98463 98203 gene locus_tag LOCUS_04300 98463 98203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 98616 99356 gene locus_tag LOCUS_04310 98616 99356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 99456 100505 gene locus_tag LOCUS_04320 99456 100505 CDS product DUF5787 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289155.1 protein_id gnl|my_center|LOCUS_04320 101036 100530 gene locus_tag LOCUS_04330 101036 100530 CDS product DUF5797 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902272.1 protein_id gnl|my_center|LOCUS_04330 102465 101179 gene locus_tag LOCUS_04340 102465 101179 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902270.1 protein_id gnl|my_center|LOCUS_04340 102723 103031 gene locus_tag LOCUS_04350 102723 103031 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902269.1 protein_id gnl|my_center|LOCUS_04350 103104 103592 gene locus_tag LOCUS_04360 103104 103592 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902968.1 protein_id gnl|my_center|LOCUS_04360 104004 103837 gene locus_tag LOCUS_04370 104004 103837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 104897 104325 gene locus_tag LOCUS_04380 104897 104325 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903898.1 protein_id gnl|my_center|LOCUS_04380 105040 106722 gene locus_tag LOCUS_04390 105040 106722 CDS product Hvo_1808 family surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903899.1 protein_id gnl|my_center|LOCUS_04390 106812 107984 gene locus_tag LOCUS_04400 106812 107984 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903900.1 protein_id gnl|my_center|LOCUS_04400 108698 108087 gene locus_tag LOCUS_04410 108698 108087 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903901.1 protein_id gnl|my_center|LOCUS_04410 109239 108898 gene locus_tag LOCUS_04420 109239 108898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 109391 110491 gene locus_tag LOCUS_04430 109391 110491 CDS product archaeosine biosynthesis radical SAM protein RaSEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903425.1 protein_id gnl|my_center|LOCUS_04430 111127 110612 gene locus_tag LOCUS_04440 111127 110612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 111131 111859 gene locus_tag LOCUS_04450 111131 111859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 111927 112982 gene locus_tag LOCUS_04460 111927 112982 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861524.1 protein_id gnl|my_center|LOCUS_04460 114442 113009 gene locus_tag LOCUS_04470 gene lpdA 114442 113009 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903648.1 protein_id gnl|my_center|LOCUS_04470 115733 114636 gene locus_tag LOCUS_04480 115733 114636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 115927 117915 gene locus_tag LOCUS_04490 115927 117915 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064637.1 protein_id gnl|my_center|LOCUS_04490 119159 117993 gene locus_tag LOCUS_04500 119159 117993 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728380.1 protein_id gnl|my_center|LOCUS_04500 119325 120308 gene locus_tag LOCUS_04510 gene pdhA 119325 120308 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963513.1 protein_id gnl|my_center|LOCUS_04510 120305 121312 gene locus_tag LOCUS_04520 120305 121312 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453964.1 protein_id gnl|my_center|LOCUS_04520 121318 122778 gene locus_tag LOCUS_04530 121318 122778 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404704.1 protein_id gnl|my_center|LOCUS_04530 123689 122880 gene locus_tag LOCUS_04540 gene fabG 123689 122880 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099550.1 protein_id gnl|my_center|LOCUS_04540 124569 123796 gene locus_tag LOCUS_04550 124569 123796 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730560.1 protein_id gnl|my_center|LOCUS_04550 125240 126895 gene locus_tag LOCUS_04560 125240 126895 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980180.1 protein_id gnl|my_center|LOCUS_04560 126888 127652 gene locus_tag LOCUS_04570 126888 127652 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337278.1 protein_id gnl|my_center|LOCUS_04570 127841 129025 gene locus_tag LOCUS_04580 127841 129025 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093005186.1 protein_id gnl|my_center|LOCUS_04580 130207 129029 gene locus_tag LOCUS_04590 130207 129029 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048095472.1 protein_id gnl|my_center|LOCUS_04590 130811 130209 gene locus_tag LOCUS_04600 130811 130209 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903704.1 protein_id gnl|my_center|LOCUS_04600 132098 130893 gene locus_tag LOCUS_04610 132098 130893 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085913.1 protein_id gnl|my_center|LOCUS_04610 132399 133130 gene locus_tag LOCUS_04620 132399 133130 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393281.1 protein_id gnl|my_center|LOCUS_04620 134749 133553 gene locus_tag LOCUS_04630 134749 133553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 134906 136051 gene locus_tag LOCUS_04640 134906 136051 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225693.1 protein_id gnl|my_center|LOCUS_04640 136262 137419 gene locus_tag LOCUS_04650 136262 137419 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728068.1 protein_id gnl|my_center|LOCUS_04650 138217 137462 gene locus_tag LOCUS_04660 138217 137462 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391955.1 protein_id gnl|my_center|LOCUS_04660 138527 139789 gene locus_tag LOCUS_04670 138527 139789 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944609.1 protein_id gnl|my_center|LOCUS_04670 140197 141120 gene locus_tag LOCUS_04680 140197 141120 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088950.1 protein_id gnl|my_center|LOCUS_04680 141142 141690 gene locus_tag LOCUS_04690 141142 141690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 141691 143205 gene locus_tag LOCUS_04700 141691 143205 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903081.1 protein_id gnl|my_center|LOCUS_04700 143990 143244 gene locus_tag LOCUS_04710 143990 143244 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902346.1 protein_id gnl|my_center|LOCUS_04710 144148 144579 gene locus_tag LOCUS_04720 144148 144579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 145944 144733 gene locus_tag LOCUS_04730 145944 144733 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808803.1 protein_id gnl|my_center|LOCUS_04730 146701 146880 gene locus_tag LOCUS_04740 146701 146880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 147166 148281 gene locus_tag LOCUS_04750 147166 148281 CDS product KaiC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892523.1 protein_id gnl|my_center|LOCUS_04750 148662 148904 gene locus_tag LOCUS_04760 148662 148904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 149065 149493 gene locus_tag LOCUS_04770 149065 149493 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903278.1 protein_id gnl|my_center|LOCUS_04770 149568 150965 gene locus_tag LOCUS_04780 149568 150965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 151059 151898 gene locus_tag LOCUS_04790 151059 151898 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903393.1 protein_id gnl|my_center|LOCUS_04790 152579 151929 gene locus_tag LOCUS_04800 152579 151929 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136361074.1 protein_id gnl|my_center|LOCUS_04800 153357 152644 gene locus_tag LOCUS_04810 153357 152644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902080.1 protein_id gnl|my_center|LOCUS_04810 153899 153714 gene locus_tag LOCUS_04820 153899 153714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 154100 153906 gene locus_tag LOCUS_04830 154100 153906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 155500 154391 gene locus_tag LOCUS_04840 155500 154391 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902123.1 protein_id gnl|my_center|LOCUS_04840 155704 156876 gene locus_tag LOCUS_04850 155704 156876 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049926525.1 protein_id gnl|my_center|LOCUS_04850 157401 156901 gene locus_tag LOCUS_04860 157401 156901 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902163.1 protein_id gnl|my_center|LOCUS_04860 157700 157542 gene locus_tag LOCUS_04870 157700 157542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 157866 159629 gene locus_tag LOCUS_04880 157866 159629 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902165.1 protein_id gnl|my_center|LOCUS_04880 159705 160145 gene locus_tag LOCUS_04890 159705 160145 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902168.1 protein_id gnl|my_center|LOCUS_04890 160971 160192 gene locus_tag LOCUS_04900 160971 160192 CDS product heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903407.1 protein_id gnl|my_center|LOCUS_04900 161110 162345 gene locus_tag LOCUS_04910 gene lysA 161110 162345 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876948.1 protein_id gnl|my_center|LOCUS_04910 162345 163442 gene locus_tag LOCUS_04920 gene argE 162345 163442 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813846.1 protein_id gnl|my_center|LOCUS_04920 164415 163771 gene locus_tag LOCUS_04930 164415 163771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902206.1 protein_id gnl|my_center|LOCUS_04930 164583 165320 gene locus_tag LOCUS_04940 164583 165320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 165711 165352 gene locus_tag LOCUS_04950 165711 165352 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902658.1 protein_id gnl|my_center|LOCUS_04950 166865 165708 gene locus_tag LOCUS_04960 166865 165708 CDS product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902657.1 protein_id gnl|my_center|LOCUS_04960 168265 166958 gene locus_tag LOCUS_04970 gene hflX 168265 166958 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902924.1 protein_id gnl|my_center|LOCUS_04970 170105 168462 gene locus_tag LOCUS_04980 170105 168462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 170997 170272 gene locus_tag LOCUS_04990 170997 170272 CDS product ribosome assembly factor SBDS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902925.1 protein_id gnl|my_center|LOCUS_04990 171920 171165 gene locus_tag LOCUS_05000 gene psmA 171920 171165 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902078.1 protein_id gnl|my_center|LOCUS_05000 172510 172160 gene locus_tag LOCUS_05010 172510 172160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 173157 172507 gene locus_tag LOCUS_05020 173157 172507 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902927.1 protein_id gnl|my_center|LOCUS_05020 173842 173141 gene locus_tag LOCUS_05030 173842 173141 CDS product RNase P subunit p30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289302.1 protein_id gnl|my_center|LOCUS_05030 174757 173939 gene locus_tag LOCUS_05040 174757 173939 CDS product DUF5821 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289323.1 protein_id gnl|my_center|LOCUS_05040 177618 175519 gene locus_tag LOCUS_05050 177618 175519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289324.1 protein_id gnl|my_center|LOCUS_05050 177867 179144 gene locus_tag LOCUS_05060 177867 179144 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459437.1 protein_id gnl|my_center|LOCUS_05060 179334 180584 gene locus_tag LOCUS_05070 179334 180584 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289325.1 protein_id gnl|my_center|LOCUS_05070 181959 180694 gene locus_tag LOCUS_05080 181959 180694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 183595 182213 gene locus_tag LOCUS_05090 183595 182213 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902524.1 protein_id gnl|my_center|LOCUS_05090 185529 183901 gene locus_tag LOCUS_05100 185529 183901 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902419.1 protein_id gnl|my_center|LOCUS_05100 185885 185691 gene locus_tag LOCUS_05110 185885 185691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 186093 186986 gene locus_tag LOCUS_05120 186093 186986 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903030.1 protein_id gnl|my_center|LOCUS_05120 187093 188727 gene locus_tag LOCUS_05130 187093 188727 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903150.1 protein_id gnl|my_center|LOCUS_05130 189187 188798 gene locus_tag LOCUS_05140 189187 188798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 189442 189693 gene locus_tag LOCUS_05150 189442 189693 CDS product MTH865 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902385.1 protein_id gnl|my_center|LOCUS_05150 189972 191948 gene locus_tag LOCUS_05160 189972 191948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 192573 193328 gene locus_tag LOCUS_05170 192573 193328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 193708 193361 gene locus_tag LOCUS_05180 193708 193361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903436.1 protein_id gnl|my_center|LOCUS_05180 194696 193884 gene locus_tag LOCUS_05190 194696 193884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 196258 194702 gene locus_tag LOCUS_05200 196258 194702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 196521 197669 gene locus_tag LOCUS_05210 196521 197669 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902498.1 protein_id gnl|my_center|LOCUS_05210 197965 197747 gene locus_tag LOCUS_05220 197965 197747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 198177 198983 gene locus_tag LOCUS_05230 198177 198983 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902066.1 protein_id gnl|my_center|LOCUS_05230 198986 199630 gene locus_tag LOCUS_05240 198986 199630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 199627 200301 gene locus_tag LOCUS_05250 199627 200301 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902064.1 protein_id gnl|my_center|LOCUS_05250 200800 200730 gene locus_tag LOCUS_t00170 200800 200730 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 201599 200895 gene locus_tag LOCUS_05260 201599 200895 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902573.1 protein_id gnl|my_center|LOCUS_05260 202187 201645 gene locus_tag LOCUS_05270 202187 201645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 202543 203553 gene locus_tag LOCUS_05280 202543 203553 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902703.1 protein_id gnl|my_center|LOCUS_05280 203791 204306 gene locus_tag LOCUS_05290 203791 204306 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289745.1 protein_id gnl|my_center|LOCUS_05290 204312 204857 gene locus_tag LOCUS_05300 204312 204857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 204973 204899 gene locus_tag LOCUS_t00180 204973 204899 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 205114 205305 gene locus_tag LOCUS_05310 205114 205305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 205421 206269 gene locus_tag LOCUS_05320 205421 206269 CDS product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902414.1 protein_id gnl|my_center|LOCUS_05320 206433 207053 gene locus_tag LOCUS_05330 206433 207053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902413.1 protein_id gnl|my_center|LOCUS_05330 207125 207535 gene locus_tag LOCUS_05340 207125 207535 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902412.1 protein_id gnl|my_center|LOCUS_05340 207681 207947 gene locus_tag LOCUS_05350 207681 207947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 208228 212691 gene locus_tag LOCUS_05360 gene gltB 208228 212691 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421590.1 protein_id gnl|my_center|LOCUS_05360 213318 212716 gene locus_tag LOCUS_05370 213318 212716 CDS product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086598.1 protein_id gnl|my_center|LOCUS_05370 213801 213388 gene locus_tag LOCUS_05380 213801 213388 CDS product DUF123 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902479.1 protein_id gnl|my_center|LOCUS_05380 214343 215404 gene locus_tag LOCUS_05390 214343 215404 CDS product NAD(P)-dependent glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902254.1 protein_id gnl|my_center|LOCUS_05390 216424 215426 gene locus_tag LOCUS_05400 216424 215426 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081422757.1 protein_id gnl|my_center|LOCUS_05400 217023 216517 gene locus_tag LOCUS_05410 217023 216517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 >Feature sequence10 1759 737 gene locus_tag LOCUS_05420 1759 737 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890425.1 protein_id gnl|my_center|LOCUS_05420 1909 1760 gene locus_tag LOCUS_05430 1909 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 2346 3182 gene locus_tag LOCUS_05440 2346 3182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 4044 3694 gene locus_tag LOCUS_05450 4044 3694 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545882.1 protein_id gnl|my_center|LOCUS_05450 4227 4598 gene locus_tag LOCUS_05460 4227 4598 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289111.1 protein_id gnl|my_center|LOCUS_05460 5503 4949 gene locus_tag LOCUS_05470 5503 4949 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880118.1 protein_id gnl|my_center|LOCUS_05470 7597 5570 gene locus_tag LOCUS_05480 7597 5570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 8493 8059 gene locus_tag LOCUS_05490 8493 8059 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890418.1 protein_id gnl|my_center|LOCUS_05490 9079 8522 gene locus_tag LOCUS_05500 9079 8522 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890417.1 protein_id gnl|my_center|LOCUS_05500 10336 9095 gene locus_tag LOCUS_05510 10336 9095 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890416.1 protein_id gnl|my_center|LOCUS_05510 10582 10827 gene locus_tag LOCUS_05520 10582 10827 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890415.1 protein_id gnl|my_center|LOCUS_05520 10829 11425 gene locus_tag LOCUS_05530 10829 11425 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890414.1 protein_id gnl|my_center|LOCUS_05530 12302 11829 gene locus_tag LOCUS_05540 12302 11829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 12845 12306 gene locus_tag LOCUS_05550 12845 12306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890498.1 protein_id gnl|my_center|LOCUS_05550 13609 15126 gene locus_tag LOCUS_05560 13609 15126 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144042.1 protein_id gnl|my_center|LOCUS_05560 16017 16457 gene locus_tag LOCUS_05570 16017 16457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 17086 16802 gene locus_tag LOCUS_05580 17086 16802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 16979 17239 gene locus_tag LOCUS_05590 16979 17239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 19496 17619 gene locus_tag LOCUS_05600 19496 17619 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027969.1 protein_id gnl|my_center|LOCUS_05600 19842 20798 gene locus_tag LOCUS_05610 19842 20798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 20743 21378 gene locus_tag LOCUS_05620 20743 21378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 22059 21421 gene locus_tag LOCUS_05630 22059 21421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 23053 22166 gene locus_tag LOCUS_05640 23053 22166 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902591.1 protein_id gnl|my_center|LOCUS_05640 23326 24351 gene locus_tag LOCUS_05650 23326 24351 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903775.1 protein_id gnl|my_center|LOCUS_05650 24348 25196 gene locus_tag LOCUS_05660 24348 25196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 26272 28194 gene locus_tag LOCUS_05670 26272 28194 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880423.1 protein_id gnl|my_center|LOCUS_05670 28191 29927 gene locus_tag LOCUS_05680 28191 29927 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881258.1 protein_id gnl|my_center|LOCUS_05680 30023 31894 gene locus_tag LOCUS_05690 30023 31894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 >Feature sequence11 448 457 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1122 2327 gene locus_tag LOCUS_05700 1122 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 2405 2414 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3093 4307 gene locus_tag LOCUS_05710 gene orc4 3093 4307 CDS product DNA replication protein Orc4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006183330.1 protein_id gnl|my_center|LOCUS_05710 4848 4483 gene locus_tag LOCUS_05720 4848 4483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 5457 4999 gene locus_tag LOCUS_05730 5457 4999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 7630 6209 gene locus_tag LOCUS_05740 7630 6209 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861828.1 protein_id gnl|my_center|LOCUS_05740 9400 7979 gene locus_tag LOCUS_05750 9400 7979 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453606.1 protein_id gnl|my_center|LOCUS_05750 10918 9593 gene locus_tag LOCUS_05760 10918 9593 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902386.1 protein_id gnl|my_center|LOCUS_05760 11501 12910 gene locus_tag LOCUS_05770 11501 12910 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902497.1 protein_id gnl|my_center|LOCUS_05770 13224 14852 gene locus_tag LOCUS_05780 13224 14852 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385396.1 protein_id gnl|my_center|LOCUS_05780 14915 15904 gene locus_tag LOCUS_05790 gene appB 14915 15904 CDS product oligopeptide ABC transporter permease AppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245828.1 protein_id gnl|my_center|LOCUS_05790 15909 16925 gene locus_tag LOCUS_05800 15909 16925 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328129.1 protein_id gnl|my_center|LOCUS_05800 16928 18082 gene locus_tag LOCUS_05810 16928 18082 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583524.1 protein_id gnl|my_center|LOCUS_05810 18083 19117 gene locus_tag LOCUS_05820 18083 19117 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084175.1 protein_id gnl|my_center|LOCUS_05820 19150 20541 gene locus_tag LOCUS_05830 19150 20541 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903796.1 protein_id gnl|my_center|LOCUS_05830 20878 21258 gene locus_tag LOCUS_05840 20878 21258 CDS product Rid family detoxifying hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903545.1 protein_id gnl|my_center|LOCUS_05840 22758 21304 gene locus_tag LOCUS_05850 gene lpdA 22758 21304 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903648.1 protein_id gnl|my_center|LOCUS_05850 24209 22779 gene locus_tag LOCUS_05860 gene gcvPB 24209 22779 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903165.1 protein_id gnl|my_center|LOCUS_05860 25576 24209 gene locus_tag LOCUS_05870 gene gcvPA 25576 24209 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903166.1 protein_id gnl|my_center|LOCUS_05870 25958 25584 gene locus_tag LOCUS_05880 gene gcvH 25958 25584 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903167.1 protein_id gnl|my_center|LOCUS_05880 26995 25961 gene locus_tag LOCUS_05890 gene gcvT 26995 25961 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903168.1 protein_id gnl|my_center|LOCUS_05890 28482 27244 gene locus_tag LOCUS_05900 gene ilvA 28482 27244 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839699.1 protein_id gnl|my_center|LOCUS_05900 28944 29702 gene locus_tag LOCUS_05910 28944 29702 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904162.1 protein_id gnl|my_center|LOCUS_05910 31428 30193 gene locus_tag LOCUS_05920 31428 30193 CDS product methylaspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903703.1 protein_id gnl|my_center|LOCUS_05920 31872 32636 gene locus_tag LOCUS_05930 31872 32636 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904162.1 protein_id gnl|my_center|LOCUS_05930 32883 34652 gene locus_tag LOCUS_05940 32883 34652 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903566.1 protein_id gnl|my_center|LOCUS_05940 34758 35756 gene locus_tag LOCUS_05950 34758 35756 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263467.1 protein_id gnl|my_center|LOCUS_05950 37693 36698 gene locus_tag LOCUS_05960 37693 36698 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902294.1 protein_id gnl|my_center|LOCUS_05960 38176 39129 gene locus_tag LOCUS_05970 38176 39129 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064375.1 protein_id gnl|my_center|LOCUS_05970 39145 40140 gene locus_tag LOCUS_05980 gene pstC 39145 40140 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902292.1 protein_id gnl|my_center|LOCUS_05980 40137 41036 gene locus_tag LOCUS_05990 40137 41036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 41038 41892 gene locus_tag LOCUS_06000 gene pstB 41038 41892 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902290.1 protein_id gnl|my_center|LOCUS_06000 41895 42554 gene locus_tag LOCUS_06010 gene phoU 41895 42554 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892486.1 protein_id gnl|my_center|LOCUS_06010 42554 43564 gene locus_tag LOCUS_06020 42554 43564 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902294.1 protein_id gnl|my_center|LOCUS_06020 44518 43811 gene locus_tag LOCUS_06030 44518 43811 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902025.1 protein_id gnl|my_center|LOCUS_06030 45572 44775 gene locus_tag LOCUS_06040 gene phnE 45572 44775 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104070585.1 protein_id gnl|my_center|LOCUS_06040 46405 45572 gene locus_tag LOCUS_06050 gene phnE 46405 45572 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524368.1 protein_id gnl|my_center|LOCUS_06050 47243 46407 gene locus_tag LOCUS_06060 gene phnC 47243 46407 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939222.1 protein_id gnl|my_center|LOCUS_06060 48467 47274 gene locus_tag LOCUS_06070 48467 47274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 48722 49420 gene locus_tag LOCUS_06080 48722 49420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138005421.1 protein_id gnl|my_center|LOCUS_06080 50659 49457 gene locus_tag LOCUS_06090 50659 49457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 50970 51656 gene locus_tag LOCUS_06100 50970 51656 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398389.1 protein_id gnl|my_center|LOCUS_06100 51653 53968 gene locus_tag LOCUS_06110 gene ppk1 51653 53968 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141500.1 protein_id gnl|my_center|LOCUS_06110 55423 54431 gene locus_tag LOCUS_06120 55423 54431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 56678 55875 gene locus_tag LOCUS_06130 56678 55875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 57040 57267 gene locus_tag LOCUS_06140 57040 57267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 57552 57980 gene locus_tag LOCUS_06150 57552 57980 CDS product low molecular weight phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890456.1 protein_id gnl|my_center|LOCUS_06150 58268 58053 gene locus_tag LOCUS_06160 58268 58053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 60951 59470 gene locus_tag LOCUS_06170 60951 59470 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218124.1 protein_id gnl|my_center|LOCUS_06170 61884 61270 gene locus_tag LOCUS_06180 61884 61270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 62199 61960 gene locus_tag LOCUS_06190 62199 61960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 63104 62913 gene locus_tag LOCUS_06200 63104 62913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 63781 63368 gene locus_tag LOCUS_06210 63781 63368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 63552 63561 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 65683 64037 gene locus_tag LOCUS_06220 65683 64037 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869775.1 protein_id gnl|my_center|LOCUS_06220 66108 65746 gene locus_tag LOCUS_06230 66108 65746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 66215 67555 gene locus_tag LOCUS_06240 66215 67555 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259389.1 protein_id gnl|my_center|LOCUS_06240 68099 67662 gene locus_tag LOCUS_06250 68099 67662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 69314 68151 gene locus_tag LOCUS_06260 69314 68151 CDS product mandelate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973053.1 protein_id gnl|my_center|LOCUS_06260 70898 70131 gene locus_tag LOCUS_06270 70898 70131 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460928.1 protein_id gnl|my_center|LOCUS_06270 71109 72104 gene locus_tag LOCUS_06280 71109 72104 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403708.1 protein_id gnl|my_center|LOCUS_06280 72532 72356 gene locus_tag LOCUS_06290 72532 72356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 >Feature sequence12 <1 880 gene locus_tag LOCUS_06300 <1 880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012289426.1:cation:proton antiporter 1511 1212 gene locus_tag LOCUS_06310 1511 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892715.1 protein_id gnl|my_center|LOCUS_06310 1791 1522 gene locus_tag LOCUS_06320 1791 1522 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904139.1 protein_id gnl|my_center|LOCUS_06320 2179 2412 gene locus_tag LOCUS_06330 2179 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 2409 3050 gene locus_tag LOCUS_06340 2409 3050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 3057 3926 gene locus_tag LOCUS_06350 3057 3926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 3927 4706 gene locus_tag LOCUS_06360 3927 4706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 5032 5241 gene locus_tag LOCUS_06370 5032 5241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 5696 5460 gene locus_tag LOCUS_06380 5696 5460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 6112 5828 gene locus_tag LOCUS_06390 6112 5828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903776.1 protein_id gnl|my_center|LOCUS_06390 6620 6967 gene locus_tag LOCUS_06400 gene trxA 6620 6967 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890427.1 protein_id gnl|my_center|LOCUS_06400 6964 8082 gene locus_tag LOCUS_06410 6964 8082 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115864200.1 protein_id gnl|my_center|LOCUS_06410 9766 8669 gene locus_tag LOCUS_06420 9766 8669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 10724 9993 gene locus_tag LOCUS_06430 10724 9993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 11636 10854 gene locus_tag LOCUS_06440 11636 10854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 12571 11633 gene locus_tag LOCUS_06450 12571 11633 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080497.1 protein_id gnl|my_center|LOCUS_06450 14683 13130 gene locus_tag LOCUS_06460 14683 13130 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289376.1 protein_id gnl|my_center|LOCUS_06460 15418 15077 gene locus_tag LOCUS_06470 15418 15077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06470 15902 15678 gene locus_tag LOCUS_06480 15902 15678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 17883 15895 gene locus_tag LOCUS_06490 17883 15895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 17995 18675 gene locus_tag LOCUS_06500 17995 18675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 >Feature sequence13 1610 636 gene locus_tag LOCUS_06510 1610 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 2048 1614 gene locus_tag LOCUS_06520 2048 1614 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289215.1 protein_id gnl|my_center|LOCUS_06520 2346 3722 gene locus_tag LOCUS_06530 2346 3722 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461181.1 protein_id gnl|my_center|LOCUS_06530 4068 5117 gene locus_tag LOCUS_06540 4068 5117 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339265.1 protein_id gnl|my_center|LOCUS_06540 5179 5760 gene locus_tag LOCUS_06550 5179 5760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 5757 7247 gene locus_tag LOCUS_06560 5757 7247 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903081.1 protein_id gnl|my_center|LOCUS_06560 8431 7454 gene locus_tag LOCUS_06570 8431 7454 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393776.1 protein_id gnl|my_center|LOCUS_06570 8587 9714 gene locus_tag LOCUS_06580 8587 9714 CDS product PrpF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065187.1 protein_id gnl|my_center|LOCUS_06580 9864 10838 gene locus_tag LOCUS_06590 9864 10838 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393776.1 protein_id gnl|my_center|LOCUS_06590 12068 10908 gene locus_tag LOCUS_06600 12068 10908 CDS product PrpF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928924.1 protein_id gnl|my_center|LOCUS_06600 12320 13705 gene locus_tag LOCUS_06610 12320 13705 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533420.1 protein_id gnl|my_center|LOCUS_06610 13817 14320 gene locus_tag LOCUS_06620 13817 14320 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979852.1 protein_id gnl|my_center|LOCUS_06620 14418 15179 gene locus_tag LOCUS_06630 gene fabG 14418 15179 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830161.1 protein_id gnl|my_center|LOCUS_06630 15259 16668 gene locus_tag LOCUS_06640 gene tcuA 15259 16668 CDS product FAD-dependent tricarballylate dehydrogenase TcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208452.1 protein_id gnl|my_center|LOCUS_06640 16983 19439 gene locus_tag LOCUS_06650 gene htr18 16983 19439 CDS product chemotaxis signal transducer protein Htr18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289229.1 protein_id gnl|my_center|LOCUS_06650 19764 20153 gene locus_tag LOCUS_06660 19764 20153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 20283 21383 gene locus_tag LOCUS_06670 20283 21383 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392012.1 protein_id gnl|my_center|LOCUS_06670 22092 23054 gene locus_tag LOCUS_06680 22092 23054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 24541 23621 gene locus_tag LOCUS_06690 gene trxB 24541 23621 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393897.1 protein_id gnl|my_center|LOCUS_06690 25663 24551 gene locus_tag LOCUS_06700 25663 24551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877149.1 protein_id gnl|my_center|LOCUS_06700 26267 25668 gene locus_tag LOCUS_06710 26267 25668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 26837 26532 gene locus_tag LOCUS_06720 26837 26532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 28342 27146 gene locus_tag LOCUS_06730 28342 27146 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903607.1 protein_id gnl|my_center|LOCUS_06730 29116 28376 gene locus_tag LOCUS_06740 29116 28376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 30042 29113 gene locus_tag LOCUS_06750 30042 29113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 30485 30712 gene locus_tag LOCUS_06760 30485 30712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 31803 30832 gene locus_tag LOCUS_06770 31803 30832 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229093.1 protein_id gnl|my_center|LOCUS_06770 31902 32387 gene locus_tag LOCUS_06780 31902 32387 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090630.1 protein_id gnl|my_center|LOCUS_06780 33460 32414 gene locus_tag LOCUS_06790 33460 32414 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967916.1 protein_id gnl|my_center|LOCUS_06790 35012 33843 gene locus_tag LOCUS_06800 35012 33843 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228126.1 protein_id gnl|my_center|LOCUS_06800 35879 35094 gene locus_tag LOCUS_06810 35879 35094 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902972.1 protein_id gnl|my_center|LOCUS_06810 36549 36046 gene locus_tag LOCUS_06820 36549 36046 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526466.1 protein_id gnl|my_center|LOCUS_06820 36662 37741 gene locus_tag LOCUS_06830 36662 37741 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967354.1 protein_id gnl|my_center|LOCUS_06830 39873 37798 gene locus_tag LOCUS_06840 39873 37798 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064637.1 protein_id gnl|my_center|LOCUS_06840 40983 39922 gene locus_tag LOCUS_06850 40983 39922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 41762 42862 gene locus_tag LOCUS_06860 41762 42862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 42890 44950 gene locus_tag LOCUS_06870 42890 44950 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925163.1 protein_id gnl|my_center|LOCUS_06870 45072 45884 gene locus_tag LOCUS_06880 45072 45884 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879137.1 protein_id gnl|my_center|LOCUS_06880 45881 46702 gene locus_tag LOCUS_06890 45881 46702 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403967.1 protein_id gnl|my_center|LOCUS_06890 46755 47108 gene locus_tag LOCUS_06900 46755 47108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 48953 47256 gene locus_tag LOCUS_06910 48953 47256 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049952164.1 protein_id gnl|my_center|LOCUS_06910 50685 49090 gene locus_tag LOCUS_06920 50685 49090 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877518.1 protein_id gnl|my_center|LOCUS_06920 50846 51976 gene locus_tag LOCUS_06930 50846 51976 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902861.1 protein_id gnl|my_center|LOCUS_06930 51973 53310 gene locus_tag LOCUS_06940 51973 53310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06940 53307 53645 gene locus_tag LOCUS_06950 53307 53645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 54905 53679 gene locus_tag LOCUS_06960 54905 53679 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877710.1 protein_id gnl|my_center|LOCUS_06960 56070 54961 gene locus_tag LOCUS_06970 56070 54961 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228741.1 protein_id gnl|my_center|LOCUS_06970 57743 56097 gene locus_tag LOCUS_06980 57743 56097 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065145.1 protein_id gnl|my_center|LOCUS_06980 58226 59407 gene locus_tag LOCUS_06990 58226 59407 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083559.1 protein_id gnl|my_center|LOCUS_06990 60600 59482 gene locus_tag LOCUS_07000 60600 59482 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889453.1 protein_id gnl|my_center|LOCUS_07000 61537 60725 gene locus_tag LOCUS_07010 61537 60725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 >Feature sequence14 548 2845 gene locus_tag LOCUS_07020 548 2845 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892477.1 protein_id gnl|my_center|LOCUS_07020 3034 5376 gene locus_tag LOCUS_07030 3034 5376 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892477.1 protein_id gnl|my_center|LOCUS_07030 5557 6555 gene locus_tag LOCUS_07040 5557 6555 CDS product NOP5/NOP56 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902847.1 protein_id gnl|my_center|LOCUS_07040 6548 7195 gene locus_tag LOCUS_07050 6548 7195 CDS product fibrillarin-like rRNA/tRNA 2'-O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902848.1 protein_id gnl|my_center|LOCUS_07050 8565 7261 gene locus_tag LOCUS_07060 8565 7261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 9456 10541 gene locus_tag LOCUS_07070 9456 10541 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903015.1 protein_id gnl|my_center|LOCUS_07070 10951 12339 gene locus_tag LOCUS_07080 10951 12339 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902546.1 protein_id gnl|my_center|LOCUS_07080 12640 12398 gene locus_tag LOCUS_07090 12640 12398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 12681 13748 gene locus_tag LOCUS_07100 12681 13748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 13943 15688 gene locus_tag LOCUS_07110 13943 15688 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136361675.1 protein_id gnl|my_center|LOCUS_07110 16290 15862 gene locus_tag LOCUS_07120 16290 15862 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902351.1 protein_id gnl|my_center|LOCUS_07120 16825 16331 gene locus_tag LOCUS_07130 16825 16331 CDS product rubrerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892592.1 protein_id gnl|my_center|LOCUS_07130 18133 16919 gene locus_tag LOCUS_07140 gene sufD 18133 16919 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902349.1 protein_id gnl|my_center|LOCUS_07140 19577 18147 gene locus_tag LOCUS_07150 gene sufB 19577 18147 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902348.1 protein_id gnl|my_center|LOCUS_07150 20550 19639 gene locus_tag LOCUS_07160 20550 19639 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902347.1 protein_id gnl|my_center|LOCUS_07160 24666 20704 gene locus_tag LOCUS_07170 24666 20704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 24785 24967 gene locus_tag LOCUS_07180 24785 24967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 25030 25530 gene locus_tag LOCUS_07190 25030 25530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 26306 25551 gene locus_tag LOCUS_07200 gene pstB 26306 25551 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902290.1 protein_id gnl|my_center|LOCUS_07200 28360 26660 gene locus_tag LOCUS_07210 28360 26660 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902998.1 protein_id gnl|my_center|LOCUS_07210 29418 28477 gene locus_tag LOCUS_07220 gene pstA 29418 28477 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878855.1 protein_id gnl|my_center|LOCUS_07220 30356 29415 gene locus_tag LOCUS_07230 gene pstC 30356 29415 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830936.1 protein_id gnl|my_center|LOCUS_07230 31342 30353 gene locus_tag LOCUS_07240 31342 30353 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227811.1 protein_id gnl|my_center|LOCUS_07240 31547 32542 gene locus_tag LOCUS_07250 31547 32542 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902294.1 protein_id gnl|my_center|LOCUS_07250 33118 32747 gene locus_tag LOCUS_07260 33118 32747 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903217.1 protein_id gnl|my_center|LOCUS_07260 33516 33208 gene locus_tag LOCUS_07270 33516 33208 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903375.1 protein_id gnl|my_center|LOCUS_07270 33952 33602 gene locus_tag LOCUS_07280 33952 33602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 34616 34071 gene locus_tag LOCUS_07290 34616 34071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902488.1 protein_id gnl|my_center|LOCUS_07290 34739 35113 gene locus_tag LOCUS_07300 34739 35113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 35486 35416 gene locus_tag LOCUS_t00190 35486 35416 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 35893 36555 gene locus_tag LOCUS_07310 35893 36555 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902596.1 protein_id gnl|my_center|LOCUS_07310 36744 37013 gene locus_tag LOCUS_07320 36744 37013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 37743 37027 gene locus_tag LOCUS_07330 37743 37027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 37932 37774 gene locus_tag LOCUS_07340 37932 37774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 38446 39387 gene locus_tag LOCUS_07350 38446 39387 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024132.1 protein_id gnl|my_center|LOCUS_07350 39414 40310 gene locus_tag LOCUS_07360 39414 40310 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990759.1 protein_id gnl|my_center|LOCUS_07360 40307 42511 gene locus_tag LOCUS_07370 40307 42511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 42508 44070 gene locus_tag LOCUS_07380 42508 44070 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065721.1 protein_id gnl|my_center|LOCUS_07380 44173 44658 gene locus_tag LOCUS_07390 44173 44658 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020962.1 protein_id gnl|my_center|LOCUS_07390 44661 45818 gene locus_tag LOCUS_07400 44661 45818 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392702.1 protein_id gnl|my_center|LOCUS_07400 47001 45832 gene locus_tag LOCUS_07410 47001 45832 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256328.1 protein_id gnl|my_center|LOCUS_07410 48190 47066 gene locus_tag LOCUS_07420 48190 47066 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867904.1 protein_id gnl|my_center|LOCUS_07420 48309 49325 gene locus_tag LOCUS_07430 48309 49325 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358614.1 protein_id gnl|my_center|LOCUS_07430 49644 51560 gene locus_tag LOCUS_07440 49644 51560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 52230 51643 gene locus_tag LOCUS_07450 52230 51643 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289247.1 protein_id gnl|my_center|LOCUS_07450 54603 52417 gene locus_tag LOCUS_07460 gene purL 54603 52417 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902605.1 protein_id gnl|my_center|LOCUS_07460 54968 54777 gene locus_tag LOCUS_07470 54968 54777 CDS product DUF5786 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289220.1 protein_id gnl|my_center|LOCUS_07470 55139 55756 gene locus_tag LOCUS_07480 55139 55756 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903013.1 protein_id gnl|my_center|LOCUS_07480 56934 55753 gene locus_tag LOCUS_07490 56934 55753 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816110.1 protein_id gnl|my_center|LOCUS_07490 57039 57899 gene locus_tag LOCUS_07500 57039 57899 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903182.1 protein_id gnl|my_center|LOCUS_07500 58642 58046 gene locus_tag LOCUS_07510 58642 58046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 58647 59042 gene locus_tag LOCUS_07520 gene nikR 58647 59042 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250390.1 protein_id gnl|my_center|LOCUS_07520 59106 59738 gene locus_tag LOCUS_07530 59106 59738 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289213.1 protein_id gnl|my_center|LOCUS_07530 61132 59744 gene locus_tag LOCUS_07540 61132 59744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 62488 61226 gene locus_tag LOCUS_07550 gene dinB 62488 61226 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289265.1 protein_id gnl|my_center|LOCUS_07550 62590 64056 gene locus_tag LOCUS_07560 62590 64056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 64410 64111 gene locus_tag LOCUS_07570 64410 64111 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289371.1 protein_id gnl|my_center|LOCUS_07570 65085 64561 gene locus_tag LOCUS_07580 65085 64561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 65984 65082 gene locus_tag LOCUS_07590 65984 65082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903271.1 protein_id gnl|my_center|LOCUS_07590 66863 66027 gene locus_tag LOCUS_07600 66863 66027 CDS product HtlC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903270.1 protein_id gnl|my_center|LOCUS_07600 67904 66888 gene locus_tag LOCUS_07610 67904 66888 CDS product beta-ribofuranosylaminobenzene 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876463.1 protein_id gnl|my_center|LOCUS_07610 68113 68493 gene locus_tag LOCUS_07620 68113 68493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 68595 68386 gene locus_tag LOCUS_07630 68595 68386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 68874 69122 gene locus_tag LOCUS_07640 68874 69122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 69213 69440 gene locus_tag LOCUS_07650 69213 69440 CDS product DUF5795 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902716.1 protein_id gnl|my_center|LOCUS_07650 70203 69454 gene locus_tag LOCUS_07660 70203 69454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 70547 71056 gene locus_tag LOCUS_07670 70547 71056 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902626.1 protein_id gnl|my_center|LOCUS_07670 71371 72525 gene locus_tag LOCUS_07680 gene sucC 71371 72525 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289349.1 protein_id gnl|my_center|LOCUS_07680 72525 73397 gene locus_tag LOCUS_07690 gene sucD 72525 73397 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903125.1 protein_id gnl|my_center|LOCUS_07690 73746 73420 gene locus_tag LOCUS_07700 73746 73420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 74829 73876 gene locus_tag LOCUS_07710 74829 73876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 75098 76348 gene locus_tag LOCUS_07720 gene rbcL 75098 76348 CDS product type III ribulose-bisphosphate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146906.1 protein_id gnl|my_center|LOCUS_07720 77272 76376 gene locus_tag LOCUS_07730 77272 76376 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167379699.1 protein_id gnl|my_center|LOCUS_07730 77519 78367 gene locus_tag LOCUS_07740 77519 78367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 78462 79616 gene locus_tag LOCUS_07750 gene bioB 78462 79616 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942229.1 protein_id gnl|my_center|LOCUS_07750 79674 80783 gene locus_tag LOCUS_07760 79674 80783 CDS product saccharopine dehydrogenase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928537.1 protein_id gnl|my_center|LOCUS_07760 80840 82045 gene locus_tag LOCUS_07770 gene bioF 80840 82045 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968008.1 protein_id gnl|my_center|LOCUS_07770 82042 82758 gene locus_tag LOCUS_07780 gene bioD 82042 82758 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111240.1 protein_id gnl|my_center|LOCUS_07780 84287 82797 gene locus_tag LOCUS_07790 84287 82797 CDS product replication factor C large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289363.1 protein_id gnl|my_center|LOCUS_07790 84705 84331 gene locus_tag LOCUS_07800 84705 84331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 84993 84706 gene locus_tag LOCUS_07810 84993 84706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 85335 85595 gene locus_tag LOCUS_07820 85335 85595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 86735 85635 gene locus_tag LOCUS_07830 86735 85635 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902428.1 protein_id gnl|my_center|LOCUS_07830 86992 87507 gene locus_tag LOCUS_07840 86992 87507 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902226.1 protein_id gnl|my_center|LOCUS_07840 87599 88096 gene locus_tag LOCUS_07850 87599 88096 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289144.1 protein_id gnl|my_center|LOCUS_07850 88240 89502 gene locus_tag LOCUS_07860 88240 89502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 89502 90071 gene locus_tag LOCUS_07870 89502 90071 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902837.1 protein_id gnl|my_center|LOCUS_07870 90252 90854 gene locus_tag LOCUS_07880 90252 90854 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903802.1 protein_id gnl|my_center|LOCUS_07880 91404 91330 gene locus_tag LOCUS_t00200 91404 91330 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 92145 91702 gene locus_tag LOCUS_07890 92145 91702 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903180.1 protein_id gnl|my_center|LOCUS_07890 93642 92293 gene locus_tag LOCUS_07900 93642 92293 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093094.1 protein_id gnl|my_center|LOCUS_07900 94488 93688 gene locus_tag LOCUS_07910 94488 93688 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902664.1 protein_id gnl|my_center|LOCUS_07910 95639 94551 gene locus_tag LOCUS_07920 95639 94551 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902622.1 protein_id gnl|my_center|LOCUS_07920 98098 95636 gene locus_tag LOCUS_07930 98098 95636 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902623.1 protein_id gnl|my_center|LOCUS_07930 98248 99444 gene locus_tag LOCUS_07940 98248 99444 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403144.1 protein_id gnl|my_center|LOCUS_07940 99723 101045 gene locus_tag LOCUS_07950 99723 101045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 101667 101437 gene locus_tag LOCUS_07960 101667 101437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 103054 101741 gene locus_tag LOCUS_07970 103054 101741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 103168 103701 gene locus_tag LOCUS_07980 103168 103701 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289350.1 protein_id gnl|my_center|LOCUS_07980 104306 103752 gene locus_tag LOCUS_07990 104306 103752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 104412 104486 gene locus_tag LOCUS_t00210 104412 104486 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 105709 106545 gene locus_tag LOCUS_08000 105709 106545 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289734.1 protein_id gnl|my_center|LOCUS_08000 106542 106985 gene locus_tag LOCUS_08010 106542 106985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289733.1 protein_id gnl|my_center|LOCUS_08010 108676 107435 gene locus_tag LOCUS_08020 108676 107435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 110975 113857 gene locus_tag LOCUS_08030 110975 113857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 114375 114052 gene locus_tag LOCUS_08040 114375 114052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 >Feature sequence15 1669 755 gene locus_tag LOCUS_08050 1669 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 2277 1705 gene locus_tag LOCUS_08060 2277 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 1788 1797 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3420 2515 gene locus_tag LOCUS_08070 3420 2515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 2566 2604 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3635 4543 gene locus_tag LOCUS_08080 3635 4543 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038051.1 protein_id gnl|my_center|LOCUS_08080 4800 5732 gene locus_tag LOCUS_08090 4800 5732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 5729 7588 gene locus_tag LOCUS_08100 5729 7588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 7722 8180 gene locus_tag LOCUS_08110 7722 8180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 8959 8342 gene locus_tag LOCUS_08120 8959 8342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 9526 10944 gene locus_tag LOCUS_08130 9526 10944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 11028 11378 gene locus_tag LOCUS_08140 11028 11378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 11972 11430 gene locus_tag LOCUS_08150 11972 11430 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890481.1 protein_id gnl|my_center|LOCUS_08150 14935 11972 gene locus_tag LOCUS_08160 14935 11972 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890482.1 protein_id gnl|my_center|LOCUS_08160 19148 14928 gene locus_tag LOCUS_08170 19148 14928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 19342 19151 gene locus_tag LOCUS_08180 19342 19151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115864263.1 protein_id gnl|my_center|LOCUS_08180 20893 20108 gene locus_tag LOCUS_08190 20893 20108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 21909 20893 gene locus_tag LOCUS_08200 21909 20893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 24280 21902 gene locus_tag LOCUS_08210 24280 21902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 24338 25069 gene locus_tag LOCUS_08220 24338 25069 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248957.1 protein_id gnl|my_center|LOCUS_08220 25202 27571 gene locus_tag LOCUS_08230 25202 27571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 28471 28701 gene locus_tag LOCUS_08240 28471 28701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 29646 29927 gene locus_tag LOCUS_08250 29646 29927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141466385.1 protein_id gnl|my_center|LOCUS_08250 33795 29962 gene locus_tag LOCUS_08260 33795 29962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 36075 33811 gene locus_tag LOCUS_08270 36075 33811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 37477 36509 gene locus_tag LOCUS_08280 37477 36509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890491.1 protein_id gnl|my_center|LOCUS_08280 37936 37754 gene locus_tag LOCUS_08290 37936 37754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 38097 38354 gene locus_tag LOCUS_08300 38097 38354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 38560 38351 gene locus_tag LOCUS_08310 38560 38351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 38927 39559 gene locus_tag LOCUS_08320 38927 39559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 40037 40306 gene locus_tag LOCUS_08330 40037 40306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 40351 40572 gene locus_tag LOCUS_08340 40351 40572 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901974.1 protein_id gnl|my_center|LOCUS_08340 41032 40709 gene locus_tag LOCUS_08350 41032 40709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904196.1 protein_id gnl|my_center|LOCUS_08350 41661 41269 gene locus_tag LOCUS_08360 41661 41269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 41914 45432 gene locus_tag LOCUS_08370 41914 45432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 46092 46655 gene locus_tag LOCUS_08380 46092 46655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 47815 47979 gene locus_tag LOCUS_08390 47815 47979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 48928 48158 gene locus_tag LOCUS_08400 48928 48158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 49290 49024 gene locus_tag LOCUS_08410 49290 49024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 49492 49767 gene locus_tag LOCUS_08420 49492 49767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903436.1 protein_id gnl|my_center|LOCUS_08420 49981 50286 gene locus_tag LOCUS_08430 49981 50286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 50343 50630 gene locus_tag LOCUS_08440 50343 50630 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890479.1 protein_id gnl|my_center|LOCUS_08440 50923 52092 gene locus_tag LOCUS_08450 50923 52092 CDS product ISH3-like element ISH3B family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289545.1 protein_id gnl|my_center|LOCUS_08450 52790 52431 gene locus_tag LOCUS_08460 52790 52431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 54743 52923 gene locus_tag LOCUS_08470 54743 52923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 55827 54805 gene locus_tag LOCUS_08480 55827 54805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 56180 57487 gene locus_tag LOCUS_08490 56180 57487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 57947 58858 gene locus_tag LOCUS_08500 57947 58858 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_079990227.1 protein_id gnl|my_center|LOCUS_08500 58861 59313 gene locus_tag LOCUS_08510 58861 59313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 59613 60137 gene locus_tag LOCUS_08520 59613 60137 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904190.1 protein_id gnl|my_center|LOCUS_08520 60143 60616 gene locus_tag LOCUS_08530 60143 60616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904189.1 protein_id gnl|my_center|LOCUS_08530 61497 61276 gene locus_tag LOCUS_08540 61497 61276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 61690 62718 gene locus_tag LOCUS_08550 61690 62718 CDS product orc1/cdc6 family replication initiation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289552.1 protein_id gnl|my_center|LOCUS_08550 62805 62927 gene locus_tag LOCUS_08560 62805 62927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 62949 64349 gene locus_tag LOCUS_08570 62949 64349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 64844 64530 gene locus_tag LOCUS_08580 64844 64530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08580 65459 66886 gene locus_tag LOCUS_08590 65459 66886 CDS product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073169946.1 protein_id gnl|my_center|LOCUS_08590 68114 66963 gene locus_tag LOCUS_08600 68114 66963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 69038 69982 gene locus_tag LOCUS_08610 69038 69982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 69985 70305 gene locus_tag LOCUS_08620 69985 70305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 70338 70715 gene locus_tag LOCUS_08630 70338 70715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 70985 73153 gene locus_tag LOCUS_08640 70985 73153 CDS product type B DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904193.1 protein_id gnl|my_center|LOCUS_08640 74523 73291 gene locus_tag LOCUS_08650 gene orc4 74523 73291 CDS product DNA replication protein Orc4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904194.1 protein_id gnl|my_center|LOCUS_08650 75476 75153 gene locus_tag LOCUS_08660 75476 75153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904196.1 protein_id gnl|my_center|LOCUS_08660 76070 75603 gene locus_tag LOCUS_08670 76070 75603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 76100 76540 gene locus_tag LOCUS_08680 76100 76540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08680 >Feature sequence16 101 505 gene locus_tag LOCUS_08690 101 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 663 826 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence17 1503 4574 gene locus_tag LOCUS_08700 1503 4574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 6865 7161 gene locus_tag LOCUS_08710 6865 7161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 7643 7921 gene locus_tag LOCUS_08720 7643 7921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 8112 8549 gene locus_tag LOCUS_08730 8112 8549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 9405 10112 gene locus_tag LOCUS_08740 9405 10112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 10240 10800 gene locus_tag LOCUS_08750 10240 10800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 10837 11517 gene locus_tag LOCUS_08760 10837 11517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 11552 11725 gene locus_tag LOCUS_08770 11552 11725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 11835 12185 gene locus_tag LOCUS_08780 11835 12185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 12284 12664 gene locus_tag LOCUS_08790 12284 12664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 12654 13013 gene locus_tag LOCUS_08800 12654 13013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289070.1 protein_id gnl|my_center|LOCUS_08800 13179 13709 gene locus_tag LOCUS_08810 13179 13709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 13854 14231 gene locus_tag LOCUS_08820 13854 14231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 14545 17319 gene locus_tag LOCUS_08830 14545 17319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 17767 19071 gene locus_tag LOCUS_08840 17767 19071 CDS product IS4-like element ISH8B family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890432.1 protein_id gnl|my_center|LOCUS_08840 19587 19847 gene locus_tag LOCUS_08850 19587 19847 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904211.1 protein_id gnl|my_center|LOCUS_08850 19982 20218 gene locus_tag LOCUS_08860 19982 20218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 20224 20697 gene locus_tag LOCUS_08870 20224 20697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 20702 21043 gene locus_tag LOCUS_08880 20702 21043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 21018 21227 gene locus_tag LOCUS_08890 21018 21227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 21484 21224 gene locus_tag LOCUS_08900 21484 21224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 21583 22347 gene locus_tag LOCUS_08910 21583 22347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 22387 23067 gene locus_tag LOCUS_08920 22387 23067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 23092 23421 gene locus_tag LOCUS_08930 23092 23421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 23495 23791 gene locus_tag LOCUS_08940 23495 23791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 23869 24783 gene locus_tag LOCUS_08950 23869 24783 CDS product replication protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289447.1 protein_id gnl|my_center|LOCUS_08950 24978 25631 gene locus_tag LOCUS_08960 24978 25631 CDS product RPA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903600.1 protein_id gnl|my_center|LOCUS_08960 26955 26425 gene locus_tag LOCUS_08970 26955 26425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 27842 26952 gene locus_tag LOCUS_08980 27842 26952 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115864494.1 protein_id gnl|my_center|LOCUS_08980 28166 27906 gene locus_tag LOCUS_08990 28166 27906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 28406 29230 gene locus_tag LOCUS_09000 28406 29230 CDS product IS5-like element ISH28 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890407.1 protein_id gnl|my_center|LOCUS_09000 29870 29400 gene locus_tag LOCUS_09010 29870 29400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 30241 29867 gene locus_tag LOCUS_09020 30241 29867 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901954.1 protein_id gnl|my_center|LOCUS_09020 30476 30255 gene locus_tag LOCUS_09030 30476 30255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 32365 30656 gene locus_tag LOCUS_09040 32365 30656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 33382 32696 gene locus_tag LOCUS_09050 33382 32696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09050 33780 33439 gene locus_tag LOCUS_09060 33780 33439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09060 34136 33777 gene locus_tag LOCUS_09070 gene trxA 34136 33777 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890427.1 protein_id gnl|my_center|LOCUS_09070 34558 34842 gene locus_tag LOCUS_09080 34558 34842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903776.1 protein_id gnl|my_center|LOCUS_09080 35905 35513 gene locus_tag LOCUS_09090 35905 35513 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890426.1 protein_id gnl|my_center|LOCUS_09090 37184 36066 gene locus_tag LOCUS_09100 37184 36066 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867356.1 protein_id gnl|my_center|LOCUS_09100 37512 38123 gene locus_tag LOCUS_09110 37512 38123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 39527 38280 gene locus_tag LOCUS_09120 39527 38280 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979578.1 protein_id gnl|my_center|LOCUS_09120 39946 39536 gene locus_tag LOCUS_09130 39946 39536 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890426.1 protein_id gnl|my_center|LOCUS_09130 <40990 40111 gene locus_tag LOCUS_09140 <40990 40111 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012289426.1:cation:proton antiporter >Feature sequence18 868 86 gene locus_tag LOCUS_09150 868 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 1821 1048 gene locus_tag LOCUS_09160 1821 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 2411 1818 gene locus_tag LOCUS_09170 2411 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 2698 2573 gene locus_tag LOCUS_09180 2698 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 2958 2749 gene locus_tag LOCUS_09190 2958 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 >Feature sequence19 1116 2042 gene locus_tag LOCUS_09200 1116 2042 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289741.1 protein_id gnl|my_center|LOCUS_09200 2253 2480 gene locus_tag LOCUS_09210 2253 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 2477 2602 gene locus_tag LOCUS_09220 2477 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 >Feature sequence20 171 56 gene locus_tag LOCUS_r00010 171 56 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3203 312 gene locus_tag LOCUS_r00020 3203 312 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3545 3472 gene locus_tag LOCUS_t00220 3545 3472 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 5170 3706 gene locus_tag LOCUS_r00030 5170 3706 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence21 416 165 gene locus_tag LOCUS_09230 416 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 984 496 gene locus_tag LOCUS_09240 984 496 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223126.1 protein_id gnl|my_center|LOCUS_09240 1687 1229 gene locus_tag LOCUS_09250 1687 1229 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021289.1 protein_id gnl|my_center|LOCUS_09250 1976 1704 gene locus_tag LOCUS_09260 1976 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 2544 2056 gene locus_tag LOCUS_09270 2544 2056 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902895.1 protein_id gnl|my_center|LOCUS_09270 3081 3629 gene locus_tag LOCUS_09280 3081 3629 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289508.1 protein_id gnl|my_center|LOCUS_09280 4013 4147 gene locus_tag LOCUS_09290 4013 4147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 5213 4191 gene locus_tag LOCUS_09300 5213 4191 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289509.1 protein_id gnl|my_center|LOCUS_09300 5303 6088 gene locus_tag LOCUS_09310 5303 6088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 6784 6128 gene locus_tag LOCUS_09320 6784 6128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 7112 7348 gene locus_tag LOCUS_09330 7112 7348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 7400 8497 gene locus_tag LOCUS_09340 7400 8497 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903831.1 protein_id gnl|my_center|LOCUS_09340 8542 8958 gene locus_tag LOCUS_09350 8542 8958 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904081.1 protein_id gnl|my_center|LOCUS_09350 9146 8865 gene locus_tag LOCUS_09360 9146 8865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 9243 9926 gene locus_tag LOCUS_09370 9243 9926 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902596.1 protein_id gnl|my_center|LOCUS_09370 10830 9895 gene locus_tag LOCUS_09380 10830 9895 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256055.1 protein_id gnl|my_center|LOCUS_09380 11861 10827 gene locus_tag LOCUS_09390 11861 10827 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979838.1 protein_id gnl|my_center|LOCUS_09390 12211 12447 gene locus_tag LOCUS_09400 12211 12447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 13435 12545 gene locus_tag LOCUS_09410 13435 12545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 14623 13820 gene locus_tag LOCUS_09420 14623 13820 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122089467.1 protein_id gnl|my_center|LOCUS_09420 14743 15030 gene locus_tag LOCUS_09430 14743 15030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 15281 16435 gene locus_tag LOCUS_09440 15281 16435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 16514 17590 gene locus_tag LOCUS_09450 16514 17590 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903403.1 protein_id gnl|my_center|LOCUS_09450 17758 18930 gene locus_tag LOCUS_09460 17758 18930 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405273.1 protein_id gnl|my_center|LOCUS_09460 19617 18964 gene locus_tag LOCUS_09470 19617 18964 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879811.1 protein_id gnl|my_center|LOCUS_09470 20370 19684 gene locus_tag LOCUS_09480 20370 19684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 21209 20367 gene locus_tag LOCUS_09490 21209 20367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 22337 21408 gene locus_tag LOCUS_09500 22337 21408 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902500.1 protein_id gnl|my_center|LOCUS_09500 22709 22491 gene locus_tag LOCUS_09510 22709 22491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 23468 22890 gene locus_tag LOCUS_09520 23468 22890 CDS product DUF4188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141249.1 protein_id gnl|my_center|LOCUS_09520 23601 24236 gene locus_tag LOCUS_09530 23601 24236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 24981 24388 gene locus_tag LOCUS_09540 24981 24388 CDS product poly-gamma-glutamate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006182548.1 protein_id gnl|my_center|LOCUS_09540 25103 26239 gene locus_tag LOCUS_09550 25103 26239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 29923 26246 gene locus_tag LOCUS_09560 29923 26246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 30350 29925 gene locus_tag LOCUS_09570 30350 29925 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903746.1 protein_id gnl|my_center|LOCUS_09570 30585 32252 gene locus_tag LOCUS_09580 30585 32252 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016360.1 protein_id gnl|my_center|LOCUS_09580 32265 33266 gene locus_tag LOCUS_09590 32265 33266 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_09590 33269 34264 gene locus_tag LOCUS_09600 33269 34264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 34278 35501 gene locus_tag LOCUS_09610 34278 35501 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081442.1 protein_id gnl|my_center|LOCUS_09610 35494 36852 gene locus_tag LOCUS_09620 35494 36852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 37374 36868 gene locus_tag LOCUS_09630 37374 36868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 37966 37463 gene locus_tag LOCUS_09640 37966 37463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 38197 38015 gene locus_tag LOCUS_09650 38197 38015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 38307 39158 gene locus_tag LOCUS_09660 38307 39158 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903755.1 protein_id gnl|my_center|LOCUS_09660 39151 40944 gene locus_tag LOCUS_09670 gene glyS 39151 40944 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903756.1 protein_id gnl|my_center|LOCUS_09670 41538 41038 gene locus_tag LOCUS_09680 41538 41038 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962480.1 protein_id gnl|my_center|LOCUS_09680 41948 41631 gene locus_tag LOCUS_09690 41948 41631 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902297.1 protein_id gnl|my_center|LOCUS_09690 42693 42028 gene locus_tag LOCUS_09700 42693 42028 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894347.1 protein_id gnl|my_center|LOCUS_09700 42756 45218 gene locus_tag LOCUS_09710 42756 45218 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903758.1 protein_id gnl|my_center|LOCUS_09710 45482 47074 gene locus_tag LOCUS_09720 45482 47074 CDS product HTTM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902592.1 protein_id gnl|my_center|LOCUS_09720 47147 47584 gene locus_tag LOCUS_09730 47147 47584 CDS product thiol-disulfide oxidoreductase DCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228839.1 protein_id gnl|my_center|LOCUS_09730 48325 47615 gene locus_tag LOCUS_09740 48325 47615 CDS product Sjogren's syndrome/scleroderma autoantigen 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903764.1 protein_id gnl|my_center|LOCUS_09740 50030 48723 gene locus_tag LOCUS_09750 50030 48723 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041233550.1 protein_id gnl|my_center|LOCUS_09750 50285 51199 gene locus_tag LOCUS_09760 gene mdh 50285 51199 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903765.1 protein_id gnl|my_center|LOCUS_09760 52664 51246 gene locus_tag LOCUS_09770 52664 51246 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289154.1 protein_id gnl|my_center|LOCUS_09770 52745 53401 gene locus_tag LOCUS_09780 52745 53401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 53669 53427 gene locus_tag LOCUS_09790 53669 53427 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903766.1 protein_id gnl|my_center|LOCUS_09790 53804 55012 gene locus_tag LOCUS_09800 53804 55012 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904113.1 protein_id gnl|my_center|LOCUS_09800 55249 55022 gene locus_tag LOCUS_09810 55249 55022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 55684 55256 gene locus_tag LOCUS_09820 55684 55256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 56334 55822 gene locus_tag LOCUS_09830 56334 55822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 56701 57819 gene locus_tag LOCUS_09840 56701 57819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 57881 59044 gene locus_tag LOCUS_09850 57881 59044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 59121 60542 gene locus_tag LOCUS_09860 59121 60542 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903692.1 protein_id gnl|my_center|LOCUS_09860 62310 61009 gene locus_tag LOCUS_09870 62310 61009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 62846 63226 gene locus_tag LOCUS_09880 62846 63226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 64031 63249 gene locus_tag LOCUS_09890 64031 63249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 64684 64172 gene locus_tag LOCUS_09900 64684 64172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 64974 64684 gene locus_tag LOCUS_09910 64974 64684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 67945 65168 gene locus_tag LOCUS_09920 gene alaS 67945 65168 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903698.1 protein_id gnl|my_center|LOCUS_09920 68267 70228 gene locus_tag LOCUS_09930 68267 70228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 70811 70281 gene locus_tag LOCUS_09940 gene cgi121 70811 70281 CDS product KEOPS complex subunit Cgi121 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903768.1 protein_id gnl|my_center|LOCUS_09940 73174 70811 gene locus_tag LOCUS_09950 73174 70811 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903767.1 protein_id gnl|my_center|LOCUS_09950 73354 73830 gene locus_tag LOCUS_09960 73354 73830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 73973 74563 gene locus_tag LOCUS_09970 73973 74563 CDS product dolichol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289491.1 protein_id gnl|my_center|LOCUS_09970 74657 75295 gene locus_tag LOCUS_09980 74657 75295 CDS product DUF1684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902507.1 protein_id gnl|my_center|LOCUS_09980 76168 75488 gene locus_tag LOCUS_09990 76168 75488 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289497.1 protein_id gnl|my_center|LOCUS_09990 76549 77676 gene locus_tag LOCUS_10000 76549 77676 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974534.1 protein_id gnl|my_center|LOCUS_10000 77978 79597 gene locus_tag LOCUS_10010 77978 79597 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902650.1 protein_id gnl|my_center|LOCUS_10010 79710 80288 gene locus_tag LOCUS_10020 79710 80288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289498.1 protein_id gnl|my_center|LOCUS_10020 81805 80378 gene locus_tag LOCUS_10030 81805 80378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 82728 81946 gene locus_tag LOCUS_10040 82728 81946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903794.1 protein_id gnl|my_center|LOCUS_10040 84203 83103 gene locus_tag LOCUS_10050 84203 83103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 84604 84203 gene locus_tag LOCUS_10060 84604 84203 CDS product DUF2073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289500.1 protein_id gnl|my_center|LOCUS_10060 85248 84610 gene locus_tag LOCUS_10070 85248 84610 CDS product Era-like GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289501.1 protein_id gnl|my_center|LOCUS_10070 86578 88341 gene locus_tag LOCUS_10080 gene orc7 86578 88341 CDS product DNA replication protein Orc7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903800.1 protein_id gnl|my_center|LOCUS_10080 88407 88859 gene locus_tag LOCUS_10090 88407 88859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 89804 88893 gene locus_tag LOCUS_10100 89804 88893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 90757 89948 gene locus_tag LOCUS_10110 90757 89948 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903805.1 protein_id gnl|my_center|LOCUS_10110 90893 92470 gene locus_tag LOCUS_10120 90893 92470 CDS product DNA-directed DNA polymerase II small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289503.1 protein_id gnl|my_center|LOCUS_10120 92574 93749 gene locus_tag LOCUS_10130 92574 93749 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405273.1 protein_id gnl|my_center|LOCUS_10130 97845 93766 gene locus_tag LOCUS_10140 97845 93766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 99649 98015 gene locus_tag LOCUS_10150 99649 98015 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903647.1 protein_id gnl|my_center|LOCUS_10150 100661 99651 gene locus_tag LOCUS_10160 100661 99651 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289463.1 protein_id gnl|my_center|LOCUS_10160 101793 100666 gene locus_tag LOCUS_10170 gene pdhA 101793 100666 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197535910.1 protein_id gnl|my_center|LOCUS_10170 103072 102125 gene locus_tag LOCUS_10180 gene lipA 103072 102125 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903644.1 protein_id gnl|my_center|LOCUS_10180 103916 103131 gene locus_tag LOCUS_10190 103916 103131 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392229.1 protein_id gnl|my_center|LOCUS_10190 105829 103913 gene locus_tag LOCUS_10200 105829 103913 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392228.1 protein_id gnl|my_center|LOCUS_10200 106752 105910 gene locus_tag LOCUS_10210 106752 105910 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392230.1 protein_id gnl|my_center|LOCUS_10210 106973 108022 gene locus_tag LOCUS_10220 gene endA 106973 108022 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903640.1 protein_id gnl|my_center|LOCUS_10220 108101 109255 gene locus_tag LOCUS_10230 108101 109255 CDS product tubulin/FtsZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904119.1 protein_id gnl|my_center|LOCUS_10230 109404 111989 gene locus_tag LOCUS_10240 109404 111989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 111986 112813 gene locus_tag LOCUS_10250 111986 112813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 112806 114170 gene locus_tag LOCUS_10260 112806 114170 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902121.1 protein_id gnl|my_center|LOCUS_10260 114170 116554 gene locus_tag LOCUS_10270 114170 116554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 117521 116628 gene locus_tag LOCUS_10280 117521 116628 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902122.1 protein_id gnl|my_center|LOCUS_10280 118616 117687 gene locus_tag LOCUS_10290 118616 117687 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902989.1 protein_id gnl|my_center|LOCUS_10290 118856 118671 gene locus_tag LOCUS_10300 118856 118671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10300 119388 118987 gene locus_tag LOCUS_10310 119388 118987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 119847 119437 gene locus_tag LOCUS_10320 119847 119437 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080704.1 protein_id gnl|my_center|LOCUS_10320 121211 120003 gene locus_tag LOCUS_10330 121211 120003 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404011.1 protein_id gnl|my_center|LOCUS_10330 121428 123053 gene locus_tag LOCUS_10340 121428 123053 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903639.1 protein_id gnl|my_center|LOCUS_10340 123135 124430 gene locus_tag LOCUS_10350 123135 124430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 124808 126544 gene locus_tag LOCUS_10360 124808 126544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 126893 128419 gene locus_tag LOCUS_10370 126893 128419 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903869.1 protein_id gnl|my_center|LOCUS_10370 128419 130137 gene locus_tag LOCUS_10380 gene pheT 128419 130137 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903870.1 protein_id gnl|my_center|LOCUS_10380 131003 130203 gene locus_tag LOCUS_10390 131003 130203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 131887 131000 gene locus_tag LOCUS_10400 131887 131000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 132247 132050 gene locus_tag LOCUS_10410 132247 132050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 132484 132792 gene locus_tag LOCUS_10420 132484 132792 CDS product non-histone chromosomal MC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903872.1 protein_id gnl|my_center|LOCUS_10420 133112 135232 gene locus_tag LOCUS_10430 133112 135232 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113578.1 protein_id gnl|my_center|LOCUS_10430 135191 135098 gene locus_tag LOCUS_t00230 135191 135098 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 135863 137191 gene locus_tag LOCUS_10440 135863 137191 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524182.1 protein_id gnl|my_center|LOCUS_10440 138000 137260 gene locus_tag LOCUS_10450 138000 137260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 139643 138003 gene locus_tag LOCUS_10460 139643 138003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 139809 140627 gene locus_tag LOCUS_10470 gene pheA 139809 140627 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903649.1 protein_id gnl|my_center|LOCUS_10470 140727 141188 gene locus_tag LOCUS_10480 140727 141188 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143378.1 protein_id gnl|my_center|LOCUS_10480 141310 141729 gene locus_tag LOCUS_10490 141310 141729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 141838 144525 gene locus_tag LOCUS_10500 gene leuS 141838 144525 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903650.1 protein_id gnl|my_center|LOCUS_10500 144712 145467 gene locus_tag LOCUS_10510 144712 145467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 146549 145662 gene locus_tag LOCUS_10520 146549 145662 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123518.1 protein_id gnl|my_center|LOCUS_10520 147702 146569 gene locus_tag LOCUS_10530 147702 146569 CDS product PGF-CTERM-anchored ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902993.1 protein_id gnl|my_center|LOCUS_10530 149054 147810 gene locus_tag LOCUS_10540 149054 147810 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903847.1 protein_id gnl|my_center|LOCUS_10540 149513 149220 gene locus_tag LOCUS_10550 149513 149220 CDS product DUF424 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903846.1 protein_id gnl|my_center|LOCUS_10550 150411 149515 gene locus_tag LOCUS_10560 150411 149515 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903845.1 protein_id gnl|my_center|LOCUS_10560 151202 150513 gene locus_tag LOCUS_10570 151202 150513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289480.1 protein_id gnl|my_center|LOCUS_10570 152004 151408 gene locus_tag LOCUS_10580 152004 151408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289482.1 protein_id gnl|my_center|LOCUS_10580 152187 154400 gene locus_tag LOCUS_10590 152187 154400 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289484.1 protein_id gnl|my_center|LOCUS_10590 154490 155614 gene locus_tag LOCUS_10600 154490 155614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 155616 156206 gene locus_tag LOCUS_10610 155616 156206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 156399 156647 gene locus_tag LOCUS_10620 156399 156647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 156889 157308 gene locus_tag LOCUS_10630 156889 157308 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903848.1 protein_id gnl|my_center|LOCUS_10630 157452 157847 gene locus_tag LOCUS_10640 157452 157847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 158919 157888 gene locus_tag LOCUS_10650 gene radA 158919 157888 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289511.1 protein_id gnl|my_center|LOCUS_10650 160310 159156 gene locus_tag LOCUS_10660 160310 159156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 160694 161020 gene locus_tag LOCUS_10670 160694 161020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 161819 161214 gene locus_tag LOCUS_10680 161819 161214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022099.1 protein_id gnl|my_center|LOCUS_10680 161893 162720 gene locus_tag LOCUS_10690 161893 162720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 162948 163553 gene locus_tag LOCUS_10700 162948 163553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 163640 164866 gene locus_tag LOCUS_10710 163640 164866 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083825.1 protein_id gnl|my_center|LOCUS_10710 165093 166922 gene locus_tag LOCUS_10720 165093 166922 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877711.1 protein_id gnl|my_center|LOCUS_10720 167514 166987 gene locus_tag LOCUS_10730 gene hjc 167514 166987 CDS product Holliday junction resolvase Hjc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903673.1 protein_id gnl|my_center|LOCUS_10730 168409 167606 gene locus_tag LOCUS_10740 168409 167606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 168904 168461 gene locus_tag LOCUS_10750 168904 168461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 169082 170260 gene locus_tag LOCUS_10760 169082 170260 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903772.1 protein_id gnl|my_center|LOCUS_10760 170408 170917 gene locus_tag LOCUS_10770 170408 170917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 171097 172452 gene locus_tag LOCUS_10780 171097 172452 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289493.1 protein_id gnl|my_center|LOCUS_10780 172584 173441 gene locus_tag LOCUS_10790 172584 173441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 173814 173449 gene locus_tag LOCUS_10800 173814 173449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 174963 173875 gene locus_tag LOCUS_10810 174963 173875 CDS product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903788.1 protein_id gnl|my_center|LOCUS_10810 175073 176176 gene locus_tag LOCUS_10820 175073 176176 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250113.1 protein_id gnl|my_center|LOCUS_10820 176272 176976 gene locus_tag LOCUS_10830 176272 176976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 177028 177819 gene locus_tag LOCUS_10840 177028 177819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 178571 177822 gene locus_tag LOCUS_10850 178571 177822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 178940 178650 gene locus_tag LOCUS_10860 178940 178650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 179143 180657 gene locus_tag LOCUS_10870 gene lpdA 179143 180657 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903648.1 protein_id gnl|my_center|LOCUS_10870 180775 181944 gene locus_tag LOCUS_10880 180775 181944 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902857.1 protein_id gnl|my_center|LOCUS_10880 182257 181964 gene locus_tag LOCUS_10890 182257 181964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 182643 182254 gene locus_tag LOCUS_10900 182643 182254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 182997 183374 gene locus_tag LOCUS_10910 182997 183374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 >Feature sequence22 556 1518 gene locus_tag LOCUS_10920 556 1518 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902767.1 protein_id gnl|my_center|LOCUS_10920 3231 1594 gene locus_tag LOCUS_10930 3231 1594 CDS product formyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289152.1 protein_id gnl|my_center|LOCUS_10930 3409 4797 gene locus_tag LOCUS_10940 gene purB 3409 4797 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289153.1 protein_id gnl|my_center|LOCUS_10940 5856 4867 gene locus_tag LOCUS_10950 5856 4867 CDS product linear amide C-N hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973985.1 protein_id gnl|my_center|LOCUS_10950 6266 5856 gene locus_tag LOCUS_10960 6266 5856 CDS product DUF1269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065464.1 protein_id gnl|my_center|LOCUS_10960 8439 6349 gene locus_tag LOCUS_10970 8439 6349 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136361678.1 protein_id gnl|my_center|LOCUS_10970 10070 8436 gene locus_tag LOCUS_10980 10070 8436 CDS product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289232.1 protein_id gnl|my_center|LOCUS_10980 10215 10691 gene locus_tag LOCUS_10990 10215 10691 CDS product DUF5793 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902637.1 protein_id gnl|my_center|LOCUS_10990 10915 12099 gene locus_tag LOCUS_11000 10915 12099 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902649.1 protein_id gnl|my_center|LOCUS_11000 12305 12583 gene locus_tag LOCUS_11010 12305 12583 CDS product UPF0058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902779.1 protein_id gnl|my_center|LOCUS_11010 12708 15332 gene locus_tag LOCUS_11020 12708 15332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 15758 15513 gene locus_tag LOCUS_11030 15758 15513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289276.1 protein_id gnl|my_center|LOCUS_11030 16053 17432 gene locus_tag LOCUS_11040 16053 17432 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902782.1 protein_id gnl|my_center|LOCUS_11040 17503 17697 gene locus_tag LOCUS_11050 17503 17697 CDS product methytransferase partner Trm112 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902783.1 protein_id gnl|my_center|LOCUS_11050 17713 18303 gene locus_tag LOCUS_11060 17713 18303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 18370 18864 gene locus_tag LOCUS_11070 18370 18864 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396860.1 protein_id gnl|my_center|LOCUS_11070 18837 20462 gene locus_tag LOCUS_11080 gene gatB 18837 20462 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902210.1 protein_id gnl|my_center|LOCUS_11080 20515 21510 gene locus_tag LOCUS_11090 20515 21510 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902489.1 protein_id gnl|my_center|LOCUS_11090 21812 21534 gene locus_tag LOCUS_11100 21812 21534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 22688 21897 gene locus_tag LOCUS_11110 22688 21897 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902971.1 protein_id gnl|my_center|LOCUS_11110 22719 22940 gene locus_tag LOCUS_11120 22719 22940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 23048 24328 gene locus_tag LOCUS_11130 23048 24328 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289176.1 protein_id gnl|my_center|LOCUS_11130 25192 24470 gene locus_tag LOCUS_11140 25192 24470 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892488.1 protein_id gnl|my_center|LOCUS_11140 26170 25208 gene locus_tag LOCUS_11150 gene artA 26170 25208 CDS product archaeosortase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904000.1 protein_id gnl|my_center|LOCUS_11150 26712 26329 gene locus_tag LOCUS_11160 26712 26329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 27773 26796 gene locus_tag LOCUS_11170 27773 26796 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902943.1 protein_id gnl|my_center|LOCUS_11170 28016 28549 gene locus_tag LOCUS_11180 28016 28549 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289107.1 protein_id gnl|my_center|LOCUS_11180 28552 29247 gene locus_tag LOCUS_11190 28552 29247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 29278 30525 gene locus_tag LOCUS_11200 gene aroC 29278 30525 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902889.1 protein_id gnl|my_center|LOCUS_11200 30544 30765 gene locus_tag LOCUS_11210 30544 30765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 30941 31732 gene locus_tag LOCUS_11220 30941 31732 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809790.1 protein_id gnl|my_center|LOCUS_11220 31922 33826 gene locus_tag LOCUS_11230 31922 33826 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289282.1 protein_id gnl|my_center|LOCUS_11230 33829 34764 gene locus_tag LOCUS_11240 33829 34764 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902808.1 protein_id gnl|my_center|LOCUS_11240 35144 34818 gene locus_tag LOCUS_11250 35144 34818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 35327 35755 gene locus_tag LOCUS_11260 gene lrpA1 35327 35755 CDS product HTH-type transcriptional regulator LrpA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902807.1 protein_id gnl|my_center|LOCUS_11260 35842 36321 gene locus_tag LOCUS_11270 35842 36321 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902805.1 protein_id gnl|my_center|LOCUS_11270 36407 37030 gene locus_tag LOCUS_11280 36407 37030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 37119 38024 gene locus_tag LOCUS_11290 37119 38024 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944001.1 protein_id gnl|my_center|LOCUS_11290 38085 38654 gene locus_tag LOCUS_11300 38085 38654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 38731 39261 gene locus_tag LOCUS_11310 38731 39261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 39708 40184 gene locus_tag LOCUS_11320 39708 40184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 41486 40299 gene locus_tag LOCUS_11330 41486 40299 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229261.1 protein_id gnl|my_center|LOCUS_11330 41901 45176 gene locus_tag LOCUS_11340 41901 45176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 45173 47245 gene locus_tag LOCUS_11350 45173 47245 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136361678.1 protein_id gnl|my_center|LOCUS_11350 47247 47798 gene locus_tag LOCUS_11360 47247 47798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 47800 48384 gene locus_tag LOCUS_11370 47800 48384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 48378 49304 gene locus_tag LOCUS_11380 48378 49304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 49301 49765 gene locus_tag LOCUS_11390 49301 49765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 49762 50550 gene locus_tag LOCUS_11400 49762 50550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 51849 50554 gene locus_tag LOCUS_11410 51849 50554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 52716 51916 gene locus_tag LOCUS_11420 gene cheR 52716 51916 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289253.1 protein_id gnl|my_center|LOCUS_11420 53231 52713 gene locus_tag LOCUS_11430 gene cheD 53231 52713 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244852.1 protein_id gnl|my_center|LOCUS_11430 54487 53228 gene locus_tag LOCUS_11440 54487 53228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 55089 54484 gene locus_tag LOCUS_11450 55089 54484 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902689.1 protein_id gnl|my_center|LOCUS_11450 56824 55118 gene locus_tag LOCUS_11460 56824 55118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 58568 56793 gene locus_tag LOCUS_11470 58568 56793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 56810 56819 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 59769 58561 gene locus_tag LOCUS_11480 gene cheB 59769 58561 CDS product protein-glutamate methylesterase CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902691.1 protein_id gnl|my_center|LOCUS_11480 60089 59766 gene locus_tag LOCUS_11490 gene cheY 60089 59766 CDS product chemotaxis protein CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902692.1 protein_id gnl|my_center|LOCUS_11490 61089 60430 gene locus_tag LOCUS_11500 61089 60430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 61239 61694 gene locus_tag LOCUS_11510 61239 61694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 62498 61725 gene locus_tag LOCUS_11520 62498 61725 CDS product DUF5803 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902529.1 protein_id gnl|my_center|LOCUS_11520 63186 62500 gene locus_tag LOCUS_11530 63186 62500 CDS product DUF2110 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902528.1 protein_id gnl|my_center|LOCUS_11530 63710 63186 gene locus_tag LOCUS_11540 63710 63186 CDS product transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289219.1 protein_id gnl|my_center|LOCUS_11540 63854 64846 gene locus_tag LOCUS_11550 63854 64846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 65194 64934 gene locus_tag LOCUS_11560 65194 64934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 65339 65572 gene locus_tag LOCUS_11570 65339 65572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 65638 66048 gene locus_tag LOCUS_11580 65638 66048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903322.1 protein_id gnl|my_center|LOCUS_11580 66115 66651 gene locus_tag LOCUS_11590 66115 66651 CDS product DUF5815 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903323.1 protein_id gnl|my_center|LOCUS_11590 66817 67323 gene locus_tag LOCUS_11600 66817 67323 CDS product lactate utilization protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289746.1 protein_id gnl|my_center|LOCUS_11600 67325 69682 gene locus_tag LOCUS_11610 67325 69682 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904206.1 protein_id gnl|my_center|LOCUS_11610 69971 69717 gene locus_tag LOCUS_11620 69971 69717 CDS product DUF3194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902128.1 protein_id gnl|my_center|LOCUS_11620 70370 69972 gene locus_tag LOCUS_11630 70370 69972 CDS product prefoldin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902129.1 protein_id gnl|my_center|LOCUS_11630 70477 70734 gene locus_tag LOCUS_11640 70477 70734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 71038 71529 gene locus_tag LOCUS_11650 71038 71529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 72071 71598 gene locus_tag LOCUS_11660 72071 71598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 72405 72118 gene locus_tag LOCUS_11670 72405 72118 CDS product KEOPS complex subunit Pcc1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289126.1 protein_id gnl|my_center|LOCUS_11670 72837 72574 gene locus_tag LOCUS_11680 72837 72574 CDS product 50S ribosomal protein L37ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289127.1 protein_id gnl|my_center|LOCUS_11680 73184 72972 gene locus_tag LOCUS_11690 73184 72972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 74080 73322 gene locus_tag LOCUS_11700 74080 73322 CDS product DUF2103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902133.1 protein_id gnl|my_center|LOCUS_11700 75011 74160 gene locus_tag LOCUS_11710 gene surE 75011 74160 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902899.1 protein_id gnl|my_center|LOCUS_11710 75111 75503 gene locus_tag LOCUS_11720 75111 75503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 75552 77072 gene locus_tag LOCUS_11730 75552 77072 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868291.1 protein_id gnl|my_center|LOCUS_11730 77275 79455 gene locus_tag LOCUS_11740 77275 79455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 79650 82139 gene locus_tag LOCUS_11750 79650 82139 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902213.1 protein_id gnl|my_center|LOCUS_11750 82747 82157 gene locus_tag LOCUS_11760 82747 82157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 83509 82835 gene locus_tag LOCUS_11770 83509 82835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 84757 83831 gene locus_tag LOCUS_11780 84757 83831 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903522.1 protein_id gnl|my_center|LOCUS_11780 84895 86043 gene locus_tag LOCUS_11790 84895 86043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 86957 86052 gene locus_tag LOCUS_11800 86957 86052 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903363.1 protein_id gnl|my_center|LOCUS_11800 87150 87539 gene locus_tag LOCUS_11810 87150 87539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 87536 87928 gene locus_tag LOCUS_11820 87536 87928 CDS product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903408.1 protein_id gnl|my_center|LOCUS_11820 88005 88229 gene locus_tag LOCUS_11830 88005 88229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902537.1 protein_id gnl|my_center|LOCUS_11830 88309 88749 gene locus_tag LOCUS_11840 88309 88749 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902538.1 protein_id gnl|my_center|LOCUS_11840 89980 89174 gene locus_tag LOCUS_11850 89980 89174 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902445.1 protein_id gnl|my_center|LOCUS_11850 91522 90026 gene locus_tag LOCUS_11860 91522 90026 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902444.1 protein_id gnl|my_center|LOCUS_11860 93123 91609 gene locus_tag LOCUS_11870 93123 91609 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289203.1 protein_id gnl|my_center|LOCUS_11870 94661 93123 gene locus_tag LOCUS_11880 94661 93123 CDS product NuoM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902442.1 protein_id gnl|my_center|LOCUS_11880 96694 94661 gene locus_tag LOCUS_11890 gene nuoL 96694 94661 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902441.1 protein_id gnl|my_center|LOCUS_11890 97001 96696 gene locus_tag LOCUS_11900 gene nuoK 97001 96696 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902440.1 protein_id gnl|my_center|LOCUS_11900 97444 96998 gene locus_tag LOCUS_11910 97444 96998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 97713 97441 gene locus_tag LOCUS_11920 97713 97441 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902438.1 protein_id gnl|my_center|LOCUS_11920 98171 97710 gene locus_tag LOCUS_11930 98171 97710 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902437.1 protein_id gnl|my_center|LOCUS_11930 99286 98168 gene locus_tag LOCUS_11940 99286 98168 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289200.1 protein_id gnl|my_center|LOCUS_11940 100935 99283 gene locus_tag LOCUS_11950 100935 99283 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902435.1 protein_id gnl|my_center|LOCUS_11950 101639 100932 gene locus_tag LOCUS_11960 101639 100932 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902434.1 protein_id gnl|my_center|LOCUS_11960 102085 101636 gene locus_tag LOCUS_11970 102085 101636 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902433.1 protein_id gnl|my_center|LOCUS_11970 103038 102409 gene locus_tag LOCUS_11980 gene purE 103038 102409 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902432.1 protein_id gnl|my_center|LOCUS_11980 104207 103104 gene locus_tag LOCUS_11990 104207 103104 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892490.1 protein_id gnl|my_center|LOCUS_11990 104475 106577 gene locus_tag LOCUS_12000 104475 106577 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902678.1 protein_id gnl|my_center|LOCUS_12000 106650 107063 gene locus_tag LOCUS_12010 gene ribH 106650 107063 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902429.1 protein_id gnl|my_center|LOCUS_12010 107068 108264 gene locus_tag LOCUS_12020 107068 108264 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902428.1 protein_id gnl|my_center|LOCUS_12020 108367 108885 gene locus_tag LOCUS_12030 108367 108885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 110389 109553 gene locus_tag LOCUS_12040 110389 109553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 111052 110414 gene locus_tag LOCUS_12050 111052 110414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12050 111569 110958 gene locus_tag LOCUS_12060 111569 110958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12060 112356 111763 gene locus_tag LOCUS_12070 112356 111763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 112421 113134 gene locus_tag LOCUS_12080 112421 113134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 113241 113588 gene locus_tag LOCUS_12090 113241 113588 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892503.1 protein_id gnl|my_center|LOCUS_12090 113585 113896 gene locus_tag LOCUS_12100 113585 113896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289278.1 protein_id gnl|my_center|LOCUS_12100 114400 114996 gene locus_tag LOCUS_12110 gene trmY 114400 114996 CDS product tRNA (pseudouridine(54)-N(1))-methyltransferase TrmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903455.1 protein_id gnl|my_center|LOCUS_12110 115089 115162 gene locus_tag LOCUS_t00240 115089 115162 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 115429 115220 gene locus_tag LOCUS_12120 115429 115220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 115928 115527 gene locus_tag LOCUS_12130 115928 115527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 116375 115986 gene locus_tag LOCUS_12140 116375 115986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 117393 117321 gene locus_tag LOCUS_t00250 117393 117321 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 117751 117407 gene locus_tag LOCUS_12150 117751 117407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 118223 118702 gene locus_tag LOCUS_12160 118223 118702 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979852.1 protein_id gnl|my_center|LOCUS_12160 118751 119566 gene locus_tag LOCUS_12170 118751 119566 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289227.1 protein_id gnl|my_center|LOCUS_12170 119790 119563 gene locus_tag LOCUS_12180 119790 119563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 120056 120250 gene locus_tag LOCUS_12190 120056 120250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 120485 120297 gene locus_tag LOCUS_12200 120485 120297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 122421 120583 gene locus_tag LOCUS_12210 122421 120583 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902947.1 protein_id gnl|my_center|LOCUS_12210 123298 122423 gene locus_tag LOCUS_12220 123298 122423 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902948.1 protein_id gnl|my_center|LOCUS_12220 123668 123300 gene locus_tag LOCUS_12230 123668 123300 CDS product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902949.1 protein_id gnl|my_center|LOCUS_12230 124099 123668 gene locus_tag LOCUS_12240 gene sdhC 124099 123668 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289306.1 protein_id gnl|my_center|LOCUS_12240 125256 124207 gene locus_tag LOCUS_12250 125256 124207 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037227959.1 protein_id gnl|my_center|LOCUS_12250 125358 126107 gene locus_tag LOCUS_12260 125358 126107 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902448.1 protein_id gnl|my_center|LOCUS_12260 126373 127836 gene locus_tag LOCUS_12270 126373 127836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 127925 129268 gene locus_tag LOCUS_12280 127925 129268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 129353 129586 gene locus_tag LOCUS_12290 129353 129586 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903468.1 protein_id gnl|my_center|LOCUS_12290 130933 129626 gene locus_tag LOCUS_12300 130933 129626 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165442178.1 protein_id gnl|my_center|LOCUS_12300 131774 130926 gene locus_tag LOCUS_12310 131774 130926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 132507 131767 gene locus_tag LOCUS_12320 gene proC 132507 131767 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023994.1 protein_id gnl|my_center|LOCUS_12320 132832 134979 gene locus_tag LOCUS_12330 gene katG 132832 134979 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904144.1 protein_id gnl|my_center|LOCUS_12330 136230 135004 gene locus_tag LOCUS_12340 136230 135004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 137340 136750 gene locus_tag LOCUS_12350 137340 136750 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902951.1 protein_id gnl|my_center|LOCUS_12350 137688 138218 gene locus_tag LOCUS_12360 137688 138218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 140779 138209 gene locus_tag LOCUS_12370 140779 138209 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902063.1 protein_id gnl|my_center|LOCUS_12370 141658 140915 gene locus_tag LOCUS_12380 141658 140915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 142964 141747 gene locus_tag LOCUS_12390 142964 141747 CDS product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289167.1 protein_id gnl|my_center|LOCUS_12390 143089 143358 gene locus_tag LOCUS_12400 143089 143358 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902339.1 protein_id gnl|my_center|LOCUS_12400 143533 144831 gene locus_tag LOCUS_12410 gene mre11 143533 144831 CDS product DNA double-strand break repair protein Mre11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902340.1 protein_id gnl|my_center|LOCUS_12410 144828 147527 gene locus_tag LOCUS_12420 gene rad50 144828 147527 CDS product DNA double-strand break repair ATPase Rad50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902341.1 protein_id gnl|my_center|LOCUS_12420 148145 147642 gene locus_tag LOCUS_12430 148145 147642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 148935 148189 gene locus_tag LOCUS_12440 148935 148189 CDS product protein sorting system archaetidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902547.1 protein_id gnl|my_center|LOCUS_12440 149020 149460 gene locus_tag LOCUS_12450 149020 149460 CDS product plastocyanin/azurin family copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289226.1 protein_id gnl|my_center|LOCUS_12450 149851 149501 gene locus_tag LOCUS_12460 149851 149501 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902668.1 protein_id gnl|my_center|LOCUS_12460 151599 149926 gene locus_tag LOCUS_12470 151599 149926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 152373 151615 gene locus_tag LOCUS_12480 152373 151615 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902673.1 protein_id gnl|my_center|LOCUS_12480 154538 152370 gene locus_tag LOCUS_12490 154538 152370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 154851 155507 gene locus_tag LOCUS_12500 154851 155507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902694.1 protein_id gnl|my_center|LOCUS_12500 155710 155576 gene locus_tag LOCUS_12510 155710 155576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 157570 155807 gene locus_tag LOCUS_12520 gene flaJ 157570 155807 CDS product archaellar assembly protein FlaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902671.1 protein_id gnl|my_center|LOCUS_12520 159003 157768 gene locus_tag LOCUS_12530 159003 157768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 159494 159009 gene locus_tag LOCUS_12540 159494 159009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903918.1 protein_id gnl|my_center|LOCUS_12540 160049 159495 gene locus_tag LOCUS_12550 160049 159495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 160981 160196 gene locus_tag LOCUS_12560 160981 160196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 161589 160984 gene locus_tag LOCUS_12570 161589 160984 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289250.1 protein_id gnl|my_center|LOCUS_12570 162438 161608 gene locus_tag LOCUS_12580 162438 161608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 163049 162441 gene locus_tag LOCUS_12590 163049 162441 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289250.1 protein_id gnl|my_center|LOCUS_12590 163705 163055 gene locus_tag LOCUS_12600 163705 163055 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902719.1 protein_id gnl|my_center|LOCUS_12600 164334 163708 gene locus_tag LOCUS_12610 164334 163708 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289250.1 protein_id gnl|my_center|LOCUS_12610 164882 165241 gene locus_tag LOCUS_12620 164882 165241 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902668.1 protein_id gnl|my_center|LOCUS_12620 165243 165521 gene locus_tag LOCUS_12630 165243 165521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902669.1 protein_id gnl|my_center|LOCUS_12630 166052 165669 gene locus_tag LOCUS_12640 166052 165669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 166273 166049 gene locus_tag LOCUS_12650 166273 166049 CDS product antitoxin VapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878975.1 protein_id gnl|my_center|LOCUS_12650 166416 168500 gene locus_tag LOCUS_12660 166416 168500 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138655632.1 protein_id gnl|my_center|LOCUS_12660 169017 170042 gene locus_tag LOCUS_12670 169017 170042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 170039 170545 gene locus_tag LOCUS_12680 170039 170545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 170546 171376 gene locus_tag LOCUS_12690 170546 171376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 171476 172315 gene locus_tag LOCUS_12700 171476 172315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 172543 172331 gene locus_tag LOCUS_12710 172543 172331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 172682 173113 gene locus_tag LOCUS_12720 172682 173113 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289521.1 protein_id gnl|my_center|LOCUS_12720 173173 173667 gene locus_tag LOCUS_12730 173173 173667 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157849921.1 protein_id gnl|my_center|LOCUS_12730 173762 175738 gene locus_tag LOCUS_12740 gene acs 173762 175738 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902710.1 protein_id gnl|my_center|LOCUS_12740 175865 178147 gene locus_tag LOCUS_12750 175865 178147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 178465 180441 gene locus_tag LOCUS_12760 gene acs 178465 180441 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902710.1 protein_id gnl|my_center|LOCUS_12760 180499 180942 gene locus_tag LOCUS_12770 180499 180942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 180939 182651 gene locus_tag LOCUS_12780 180939 182651 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941186.1 protein_id gnl|my_center|LOCUS_12780 182655 183116 gene locus_tag LOCUS_12790 182655 183116 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903120.1 protein_id gnl|my_center|LOCUS_12790 183288 183506 gene locus_tag LOCUS_12800 183288 183506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 183846 183619 gene locus_tag LOCUS_12810 183846 183619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 184294 183923 gene locus_tag LOCUS_12820 184294 183923 CDS product cyclophilin-like fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064546.1 protein_id gnl|my_center|LOCUS_12820 185278 184349 gene locus_tag LOCUS_12830 185278 184349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 187001 185379 gene locus_tag LOCUS_12840 187001 185379 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902160.1 protein_id gnl|my_center|LOCUS_12840 187161 188864 gene locus_tag LOCUS_12850 187161 188864 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903337.1 protein_id gnl|my_center|LOCUS_12850 188864 189781 gene locus_tag LOCUS_12860 gene guaA 188864 189781 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903336.1 protein_id gnl|my_center|LOCUS_12860 189778 190107 gene locus_tag LOCUS_12870 189778 190107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903335.1 protein_id gnl|my_center|LOCUS_12870 190121 190801 gene locus_tag LOCUS_12880 190121 190801 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978110.1 protein_id gnl|my_center|LOCUS_12880 192111 190867 gene locus_tag LOCUS_12890 192111 190867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 192858 192187 gene locus_tag LOCUS_12900 192858 192187 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289173.1 protein_id gnl|my_center|LOCUS_12900 193110 193526 gene locus_tag LOCUS_12910 193110 193526 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902462.1 protein_id gnl|my_center|LOCUS_12910 193523 194602 gene locus_tag LOCUS_12920 gene meaB 193523 194602 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902463.1 protein_id gnl|my_center|LOCUS_12920 195004 194642 gene locus_tag LOCUS_12930 195004 194642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 195393 194992 gene locus_tag LOCUS_12940 195393 194992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 195852 196802 gene locus_tag LOCUS_12950 195852 196802 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289638.1 protein_id gnl|my_center|LOCUS_12950 197243 196857 gene locus_tag LOCUS_12960 197243 196857 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902465.1 protein_id gnl|my_center|LOCUS_12960 198409 197240 gene locus_tag LOCUS_12970 198409 197240 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902466.1 protein_id gnl|my_center|LOCUS_12970 198521 199588 gene locus_tag LOCUS_12980 198521 199588 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249732.1 protein_id gnl|my_center|LOCUS_12980 200409 199804 gene locus_tag LOCUS_12990 200409 199804 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289184.1 protein_id gnl|my_center|LOCUS_12990 200608 201909 gene locus_tag LOCUS_13000 200608 201909 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289069.1 protein_id gnl|my_center|LOCUS_13000 201985 203190 gene locus_tag LOCUS_13010 201985 203190 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063170320.1 protein_id gnl|my_center|LOCUS_13010 203250 203984 gene locus_tag LOCUS_13020 203250 203984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 205613 204018 gene locus_tag LOCUS_13030 205613 204018 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005575582.1 protein_id gnl|my_center|LOCUS_13030 206034 206972 gene locus_tag LOCUS_13040 206034 206972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 207084 208175 gene locus_tag LOCUS_13050 207084 208175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 208172 209311 gene locus_tag LOCUS_13060 208172 209311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 209314 210306 gene locus_tag LOCUS_13070 209314 210306 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_13070 210471 211568 gene locus_tag LOCUS_13080 210471 211568 CDS product DUF354 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024333.1 protein_id gnl|my_center|LOCUS_13080 212831 211617 gene locus_tag LOCUS_13090 212831 211617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 214311 212824 gene locus_tag LOCUS_13100 214311 212824 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868281.1 protein_id gnl|my_center|LOCUS_13100 215318 214308 gene locus_tag LOCUS_13110 215318 214308 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141858.1 protein_id gnl|my_center|LOCUS_13110 216550 215315 gene locus_tag LOCUS_13120 216550 215315 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876812.1 protein_id gnl|my_center|LOCUS_13120 217125 216547 gene locus_tag LOCUS_13130 217125 216547 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763299.1 protein_id gnl|my_center|LOCUS_13130 217543 218067 gene locus_tag LOCUS_13140 217543 218067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 219162 218176 gene locus_tag LOCUS_13150 219162 218176 CDS product DUF1616 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065996.1 protein_id gnl|my_center|LOCUS_13150 219623 219348 gene locus_tag LOCUS_13160 219623 219348 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903037.1 protein_id gnl|my_center|LOCUS_13160 220142 219810 gene locus_tag LOCUS_13170 220142 219810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 221035 221538 gene locus_tag LOCUS_13180 221035 221538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 222005 221592 gene locus_tag LOCUS_13190 222005 221592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 222923 222534 gene locus_tag LOCUS_13200 222923 222534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 223472 223248 gene locus_tag LOCUS_13210 223472 223248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 224159 223698 gene locus_tag LOCUS_13220 224159 223698 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902425.1 protein_id gnl|my_center|LOCUS_13220 224246 225112 gene locus_tag LOCUS_13230 224246 225112 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289197.1 protein_id gnl|my_center|LOCUS_13230 225351 226607 gene locus_tag LOCUS_13240 gene gdhA1 225351 226607 CDS product NADP-specific glutamate dehydrogenase GdhA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289198.1 protein_id gnl|my_center|LOCUS_13240 226903 227376 gene locus_tag LOCUS_13250 226903 227376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 229195 227495 gene locus_tag LOCUS_13260 229195 227495 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289204.1 protein_id gnl|my_center|LOCUS_13260 230098 229541 gene locus_tag LOCUS_13270 230098 229541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 231794 230181 gene locus_tag LOCUS_13280 231794 230181 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902539.1 protein_id gnl|my_center|LOCUS_13280 232142 231954 gene locus_tag LOCUS_13290 232142 231954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 233282 232470 gene locus_tag LOCUS_13300 gene nadC 233282 232470 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903380.1 protein_id gnl|my_center|LOCUS_13300 234715 233285 gene locus_tag LOCUS_13310 234715 233285 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903379.1 protein_id gnl|my_center|LOCUS_13310 235959 234826 gene locus_tag LOCUS_13320 gene nadA 235959 234826 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903378.1 protein_id gnl|my_center|LOCUS_13320 239779 236159 gene locus_tag LOCUS_13330 239779 236159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 240646 239831 gene locus_tag LOCUS_13340 240646 239831 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289375.1 protein_id gnl|my_center|LOCUS_13340 240781 241209 gene locus_tag LOCUS_13350 240781 241209 CDS product CopG family ribbon-helix-helix protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289104.1 protein_id gnl|my_center|LOCUS_13350 242143 241724 gene locus_tag LOCUS_13360 242143 241724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 242497 242150 gene locus_tag LOCUS_13370 242497 242150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 242472 242729 gene locus_tag LOCUS_13380 242472 242729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 242850 243641 gene locus_tag LOCUS_13390 242850 243641 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877942.1 protein_id gnl|my_center|LOCUS_13390 243812 244579 gene locus_tag LOCUS_13400 243812 244579 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393281.1 protein_id gnl|my_center|LOCUS_13400 245541 244762 gene locus_tag LOCUS_13410 gene paaG 245541 244762 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186957.1 protein_id gnl|my_center|LOCUS_13410 246412 245645 gene locus_tag LOCUS_13420 246412 245645 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904162.1 protein_id gnl|my_center|LOCUS_13420 248054 246534 gene locus_tag LOCUS_13430 gene dhaS 248054 246534 CDS product aldehyde dehydrogenase DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399332.1 protein_id gnl|my_center|LOCUS_13430 248817 248146 gene locus_tag LOCUS_13440 248817 248146 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902271.1 protein_id gnl|my_center|LOCUS_13440 249646 248888 gene locus_tag LOCUS_13450 gene kdgR 249646 248888 CDS product DNA-binding transcriptional regulator KdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705934.1 protein_id gnl|my_center|LOCUS_13450 250549 250106 gene locus_tag LOCUS_13460 250549 250106 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229257.1 protein_id gnl|my_center|LOCUS_13460 251367 250609 gene locus_tag LOCUS_13470 251367 250609 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942026.1 protein_id gnl|my_center|LOCUS_13470 251535 253220 gene locus_tag LOCUS_13480 251535 253220 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534776.1 protein_id gnl|my_center|LOCUS_13480 253429 254688 gene locus_tag LOCUS_13490 253429 254688 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931548.1 protein_id gnl|my_center|LOCUS_13490 254718 255626 gene locus_tag LOCUS_13500 254718 255626 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966751.1 protein_id gnl|my_center|LOCUS_13500 255623 256630 gene locus_tag LOCUS_13510 255623 256630 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259474.1 protein_id gnl|my_center|LOCUS_13510 256635 257378 gene locus_tag LOCUS_13520 256635 257378 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195806.1 protein_id gnl|my_center|LOCUS_13520 257375 258070 gene locus_tag LOCUS_13530 257375 258070 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259472.1 protein_id gnl|my_center|LOCUS_13530 259749 258076 gene locus_tag LOCUS_13540 259749 258076 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090028.1 protein_id gnl|my_center|LOCUS_13540 260903 259842 gene locus_tag LOCUS_13550 260903 259842 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327675.1 protein_id gnl|my_center|LOCUS_13550 261108 262802 gene locus_tag LOCUS_13560 261108 262802 CDS product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892286.1 protein_id gnl|my_center|LOCUS_13560 263201 263578 gene locus_tag LOCUS_13570 263201 263578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 263777 264211 gene locus_tag LOCUS_13580 263777 264211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 264315 265466 gene locus_tag LOCUS_13590 264315 265466 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289146.1 protein_id gnl|my_center|LOCUS_13590 265792 267780 gene locus_tag LOCUS_13600 265792 267780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 268345 267782 gene locus_tag LOCUS_13610 268345 267782 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902509.1 protein_id gnl|my_center|LOCUS_13610 270573 268597 gene locus_tag LOCUS_13620 270573 268597 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902952.1 protein_id gnl|my_center|LOCUS_13620 270688 271839 gene locus_tag LOCUS_13630 270688 271839 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902861.1 protein_id gnl|my_center|LOCUS_13630 272105 272536 gene locus_tag LOCUS_13640 272105 272536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 272539 272865 gene locus_tag LOCUS_13650 272539 272865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 273047 274165 gene locus_tag LOCUS_13660 273047 274165 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903671.1 protein_id gnl|my_center|LOCUS_13660 274244 275422 gene locus_tag LOCUS_13670 274244 275422 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902332.1 protein_id gnl|my_center|LOCUS_13670 276351 275647 gene locus_tag LOCUS_13680 276351 275647 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055908.1 protein_id gnl|my_center|LOCUS_13680 277208 276351 gene locus_tag LOCUS_13690 277208 276351 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073601368.1 protein_id gnl|my_center|LOCUS_13690 278553 277201 gene locus_tag LOCUS_13700 278553 277201 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173609.1 protein_id gnl|my_center|LOCUS_13700 279620 278550 gene locus_tag LOCUS_13710 279620 278550 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937854.1 protein_id gnl|my_center|LOCUS_13710 280649 279825 gene locus_tag LOCUS_13720 280649 279825 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902907.1 protein_id gnl|my_center|LOCUS_13720 282420 280657 gene locus_tag LOCUS_13730 282420 280657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902908.1 protein_id gnl|my_center|LOCUS_13730 283730 282417 gene locus_tag LOCUS_13740 283730 282417 CDS product Single-stranded DNA binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289299.1 protein_id gnl|my_center|LOCUS_13740 283856 284065 gene locus_tag LOCUS_13750 283856 284065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 284180 285067 gene locus_tag LOCUS_13760 284180 285067 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732982.1 protein_id gnl|my_center|LOCUS_13760 285195 285857 gene locus_tag LOCUS_13770 285195 285857 CDS product 2,5-diamino-6-(ribosylamino)-4(3H)-pyrimidinone 5'-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902910.1 protein_id gnl|my_center|LOCUS_13770 286532 285999 gene locus_tag LOCUS_13780 gene msrA 286532 285999 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902851.1 protein_id gnl|my_center|LOCUS_13780 288040 286625 gene locus_tag LOCUS_13790 288040 286625 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259421.1 protein_id gnl|my_center|LOCUS_13790 288274 289386 gene locus_tag LOCUS_13800 288274 289386 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254072.1 protein_id gnl|my_center|LOCUS_13800 289643 289972 gene locus_tag LOCUS_13810 289643 289972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 290383 290018 gene locus_tag LOCUS_13820 290383 290018 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136360906.1 protein_id gnl|my_center|LOCUS_13820 290516 291220 gene locus_tag LOCUS_13830 290516 291220 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892603.1 protein_id gnl|my_center|LOCUS_13830 291762 291376 gene locus_tag LOCUS_13840 291762 291376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 291867 292550 gene locus_tag LOCUS_13850 291867 292550 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902530.1 protein_id gnl|my_center|LOCUS_13850 292937 292581 gene locus_tag LOCUS_13860 292937 292581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 293511 292987 gene locus_tag LOCUS_13870 293511 292987 CDS product DUF5817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903373.1 protein_id gnl|my_center|LOCUS_13870 293624 293962 gene locus_tag LOCUS_13880 293624 293962 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403747.1 protein_id gnl|my_center|LOCUS_13880 294821 294087 gene locus_tag LOCUS_13890 294821 294087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 294911 296281 gene locus_tag LOCUS_13900 294911 296281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 296369 297103 gene locus_tag LOCUS_13910 gene fabG 296369 297103 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911773.1 protein_id gnl|my_center|LOCUS_13910 297221 298153 gene locus_tag LOCUS_13920 gene mptA 297221 298153 CDS product GTP cyclohydrolase MptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903394.1 protein_id gnl|my_center|LOCUS_13920 298947 298189 gene locus_tag LOCUS_13930 298947 298189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 299305 299232 gene locus_tag LOCUS_t00260 299305 299232 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 300013 299804 gene locus_tag LOCUS_13940 300013 299804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 300543 300471 gene locus_tag LOCUS_t00270 300543 300471 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 300852 301079 gene locus_tag LOCUS_13950 300852 301079 CDS product DNA-directed RNA polymerase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876674.1 protein_id gnl|my_center|LOCUS_13950 301080 302657 gene locus_tag LOCUS_13960 301080 302657 CDS product DNA-directed RNA polymerase subunit B'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755883.1 protein_id gnl|my_center|LOCUS_13960 302664 304493 gene locus_tag LOCUS_13970 gene rpoB 302664 304493 CDS product DNA-directed RNA polymerase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903997.1 protein_id gnl|my_center|LOCUS_13970 304497 307424 gene locus_tag LOCUS_13980 304497 307424 CDS product DNA-directed RNA polymerase subunit A' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903996.1 protein_id gnl|my_center|LOCUS_13980 307417 308610 gene locus_tag LOCUS_13990 gene rpoA2 307417 308610 CDS product DNA-directed RNA polymerase subunit A'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903995.1 protein_id gnl|my_center|LOCUS_13990 308614 309060 gene locus_tag LOCUS_14000 308614 309060 CDS product NusA-like transcription termination signal-binding factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903994.1 protein_id gnl|my_center|LOCUS_14000 309169 310680 gene locus_tag LOCUS_14010 309169 310680 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903877.1 protein_id gnl|my_center|LOCUS_14010 >Feature sequence23 408 1943 gene locus_tag LOCUS_14020 408 1943 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404995.1 protein_id gnl|my_center|LOCUS_14020 3157 2030 gene locus_tag LOCUS_14030 3157 2030 CDS product DUF63 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903025.1 protein_id gnl|my_center|LOCUS_14030 4422 3613 gene locus_tag LOCUS_14040 4422 3613 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903001.1 protein_id gnl|my_center|LOCUS_14040 4612 6315 gene locus_tag LOCUS_14050 4612 6315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 8705 6399 gene locus_tag LOCUS_14060 8705 6399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 8909 9646 gene locus_tag LOCUS_14070 8909 9646 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289269.1 protein_id gnl|my_center|LOCUS_14070 10130 9843 gene locus_tag LOCUS_14080 10130 9843 CDS product DUF357 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902913.1 protein_id gnl|my_center|LOCUS_14080 10526 10194 gene locus_tag LOCUS_14090 10526 10194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289070.1 protein_id gnl|my_center|LOCUS_14090 10904 10530 gene locus_tag LOCUS_14100 10904 10530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 11129 12451 gene locus_tag LOCUS_14110 11129 12451 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902912.1 protein_id gnl|my_center|LOCUS_14110 11486 11402 gene locus_tag LOCUS_t00280 11486 11402 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 12630 12448 gene locus_tag LOCUS_14120 12630 12448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 15848 12864 gene locus_tag LOCUS_14130 15848 12864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 18715 16082 gene locus_tag LOCUS_14140 18715 16082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 22962 18892 gene locus_tag LOCUS_14150 22962 18892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 24551 23547 gene locus_tag LOCUS_14160 24551 23547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 25403 25122 gene locus_tag LOCUS_14170 25403 25122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14170 25744 25415 gene locus_tag LOCUS_14180 25744 25415 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289086.1 protein_id gnl|my_center|LOCUS_14180 >Feature sequence24 1204 74 gene locus_tag LOCUS_14190 1204 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 1860 2381 gene locus_tag LOCUS_14200 1860 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 2713 2991 gene locus_tag LOCUS_14210 2713 2991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 2988 4508 gene locus_tag LOCUS_14220 2988 4508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 4580 5167 gene locus_tag LOCUS_14230 4580 5167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 5503 6132 gene locus_tag LOCUS_14240 5503 6132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 6146 6781 gene locus_tag LOCUS_14250 6146 6781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 6792 7220 gene locus_tag LOCUS_14260 6792 7220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 7221 7502 gene locus_tag LOCUS_14270 7221 7502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 7571 8026 gene locus_tag LOCUS_14280 7571 8026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 8309 8028 gene locus_tag LOCUS_14290 8309 8028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 8461 8895 gene locus_tag LOCUS_14300 8461 8895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 9107 8964 gene locus_tag LOCUS_14310 9107 8964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 10652 9180 gene locus_tag LOCUS_14320 gene purF 10652 9180 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903090.1 protein_id gnl|my_center|LOCUS_14320 11579 11010 gene locus_tag LOCUS_14330 11579 11010 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227885.1 protein_id gnl|my_center|LOCUS_14330 12442 11684 gene locus_tag LOCUS_14340 12442 11684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902320.1 protein_id gnl|my_center|LOCUS_14340 13726 12557 gene locus_tag LOCUS_14350 gene dnaJ 13726 12557 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902321.1 protein_id gnl|my_center|LOCUS_14350 13844 14254 gene locus_tag LOCUS_14360 13844 14254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 14965 14369 gene locus_tag LOCUS_14370 14965 14369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 16104 15205 gene locus_tag LOCUS_14380 16104 15205 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554892.1 protein_id gnl|my_center|LOCUS_14380 17099 16335 gene locus_tag LOCUS_14390 17099 16335 CDS product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035619.1 protein_id gnl|my_center|LOCUS_14390 17995 17096 gene locus_tag LOCUS_14400 17995 17096 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978819.1 protein_id gnl|my_center|LOCUS_14400 18761 17988 gene locus_tag LOCUS_14410 18761 17988 CDS product cysteine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705143.1 protein_id gnl|my_center|LOCUS_14410 19778 18993 gene locus_tag LOCUS_14420 gene yfaU 19778 18993 CDS product 2-keto-3-deoxy-L-rhamnonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992992.1 protein_id gnl|my_center|LOCUS_14420 20067 21023 gene locus_tag LOCUS_14430 20067 21023 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807688.1 protein_id gnl|my_center|LOCUS_14430 21072 22538 gene locus_tag LOCUS_14440 21072 22538 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533461.1 protein_id gnl|my_center|LOCUS_14440 22700 23638 gene locus_tag LOCUS_14450 22700 23638 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225690.1 protein_id gnl|my_center|LOCUS_14450 23862 23788 gene locus_tag LOCUS_t00290 23862 23788 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 24044 25060 gene locus_tag LOCUS_14460 gene trpD 24044 25060 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903202.1 protein_id gnl|my_center|LOCUS_14460 25057 25719 gene locus_tag LOCUS_14470 25057 25719 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903201.1 protein_id gnl|my_center|LOCUS_14470 25725 27425 gene locus_tag LOCUS_14480 gene trpE 25725 27425 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903200.1 protein_id gnl|my_center|LOCUS_14480 27422 28063 gene locus_tag LOCUS_14490 gene trpG 27422 28063 CDS product anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903199.1 protein_id gnl|my_center|LOCUS_14490 28239 28066 gene locus_tag LOCUS_14500 28239 28066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 28658 34477 gene locus_tag LOCUS_14510 28658 34477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 35441 34785 gene locus_tag LOCUS_14520 35441 34785 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903195.1 protein_id gnl|my_center|LOCUS_14520 35605 35988 gene locus_tag LOCUS_14530 35605 35988 CDS product DUF5830 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903194.1 protein_id gnl|my_center|LOCUS_14530 37158 36013 gene locus_tag LOCUS_14540 37158 36013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903193.1 protein_id gnl|my_center|LOCUS_14540 37605 38573 gene locus_tag LOCUS_14550 37605 38573 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902188.1 protein_id gnl|my_center|LOCUS_14550 38650 39039 gene locus_tag LOCUS_14560 38650 39039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 40719 39052 gene locus_tag LOCUS_14570 gene ggt 40719 39052 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839934.1 protein_id gnl|my_center|LOCUS_14570 41868 40813 gene locus_tag LOCUS_14580 41868 40813 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903126.1 protein_id gnl|my_center|LOCUS_14580 42590 42042 gene locus_tag LOCUS_14590 42590 42042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 42777 43478 gene locus_tag LOCUS_14600 42777 43478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 44069 43482 gene locus_tag LOCUS_14610 44069 43482 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903176.1 protein_id gnl|my_center|LOCUS_14610 45063 44140 gene locus_tag LOCUS_14620 45063 44140 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903108.1 protein_id gnl|my_center|LOCUS_14620 45240 46091 gene locus_tag LOCUS_14630 45240 46091 CDS product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020739.1 protein_id gnl|my_center|LOCUS_14630 46088 46693 gene locus_tag LOCUS_14640 46088 46693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 47826 46807 gene locus_tag LOCUS_14650 47826 46807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 48025 48216 gene locus_tag LOCUS_14660 48025 48216 CDS product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903043.1 protein_id gnl|my_center|LOCUS_14660 48587 48330 gene locus_tag LOCUS_14670 48587 48330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 48779 49813 gene locus_tag LOCUS_14680 gene asd 48779 49813 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903044.1 protein_id gnl|my_center|LOCUS_14680 49916 50098 gene locus_tag LOCUS_14690 49916 50098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 50527 50099 gene locus_tag LOCUS_14700 50527 50099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 51791 50787 gene locus_tag LOCUS_14710 51791 50787 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289328.1 protein_id gnl|my_center|LOCUS_14710 51971 53362 gene locus_tag LOCUS_14720 51971 53362 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902866.1 protein_id gnl|my_center|LOCUS_14720 <54653 53786 gene locus_tag LOCUS_14730 <54653 53786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004399111.1:DUF2071 domain-containing protein >Feature sequence25 779 39 gene locus_tag LOCUS_14740 779 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 603 612 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1178 1609 gene locus_tag LOCUS_14750 1178 1609 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903016.1 protein_id gnl|my_center|LOCUS_14750 2410 1628 gene locus_tag LOCUS_14760 2410 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 3158 2589 gene locus_tag LOCUS_14770 3158 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 3276 4292 gene locus_tag LOCUS_14780 3276 4292 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809024.1 protein_id gnl|my_center|LOCUS_14780 4829 4431 gene locus_tag LOCUS_14790 gene tnpA 4829 4431 CDS product IS200/IS605-like element ISH34 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903989.1 protein_id gnl|my_center|LOCUS_14790 4904 5071 gene locus_tag LOCUS_14800 4904 5071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 5068 6345 gene locus_tag LOCUS_14810 5068 6345 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049985681.1 protein_id gnl|my_center|LOCUS_14810 6320 6661 gene locus_tag LOCUS_14820 6320 6661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 6709 7578 gene locus_tag LOCUS_14830 gene larE 6709 7578 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584116.1 protein_id gnl|my_center|LOCUS_14830 7795 8151 gene locus_tag LOCUS_14840 7795 8151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 8219 8587 gene locus_tag LOCUS_14850 8219 8587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 10542 8776 gene locus_tag LOCUS_14860 10542 8776 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057189.1 protein_id gnl|my_center|LOCUS_14860 13509 11419 gene locus_tag LOCUS_14870 13509 11419 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117877.1 protein_id gnl|my_center|LOCUS_14870 14888 13878 gene locus_tag LOCUS_14880 14888 13878 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136361592.1 protein_id gnl|my_center|LOCUS_14880 15035 17347 gene locus_tag LOCUS_14890 gene tatC 15035 17347 CDS product Sec-independent protein translocase TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903685.1 protein_id gnl|my_center|LOCUS_14890 17801 17352 gene locus_tag LOCUS_14900 17801 17352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 18043 18219 gene locus_tag LOCUS_14910 18043 18219 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903684.1 protein_id gnl|my_center|LOCUS_14910 19230 18400 gene locus_tag LOCUS_14920 19230 18400 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903682.1 protein_id gnl|my_center|LOCUS_14920 19432 19725 gene locus_tag LOCUS_14930 19432 19725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 19725 20213 gene locus_tag LOCUS_14940 19725 20213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 20333 21418 gene locus_tag LOCUS_14950 gene mfnA 20333 21418 CDS product tyrosine decarboxylase MfnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902198.1 protein_id gnl|my_center|LOCUS_14950 22067 21456 gene locus_tag LOCUS_14960 22067 21456 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902736.1 protein_id gnl|my_center|LOCUS_14960 22621 22064 gene locus_tag LOCUS_14970 22621 22064 CDS product adenylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902737.1 protein_id gnl|my_center|LOCUS_14970 23742 22618 gene locus_tag LOCUS_14980 gene hisC 23742 22618 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289267.1 protein_id gnl|my_center|LOCUS_14980 24206 23895 gene locus_tag LOCUS_14990 24206 23895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 24643 24564 gene locus_tag LOCUS_t00300 24643 24564 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 25154 24708 gene locus_tag LOCUS_15000 25154 24708 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903519.1 protein_id gnl|my_center|LOCUS_15000 25242 26144 gene locus_tag LOCUS_15010 25242 26144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 26486 26220 gene locus_tag LOCUS_15020 26486 26220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289181.1 protein_id gnl|my_center|LOCUS_15020 26656 26937 gene locus_tag LOCUS_15030 26656 26937 CDS product 50S ribosomal protein L44e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289179.1 protein_id gnl|my_center|LOCUS_15030 26943 27116 gene locus_tag LOCUS_15040 26943 27116 CDS product 30S ribosomal protein S27e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902367.1 protein_id gnl|my_center|LOCUS_15040 27113 27913 gene locus_tag LOCUS_15050 27113 27913 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902366.1 protein_id gnl|my_center|LOCUS_15050 28103 28879 gene locus_tag LOCUS_15060 28103 28879 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902364.1 protein_id gnl|my_center|LOCUS_15060 29134 28907 gene locus_tag LOCUS_15070 29134 28907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 30187 29408 gene locus_tag LOCUS_15080 30187 29408 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903130.1 protein_id gnl|my_center|LOCUS_15080 30400 31644 gene locus_tag LOCUS_15090 30400 31644 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902302.1 protein_id gnl|my_center|LOCUS_15090 31798 32406 gene locus_tag LOCUS_15100 31798 32406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 33531 32488 gene locus_tag LOCUS_15110 33531 32488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 34641 33586 gene locus_tag LOCUS_15120 34641 33586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 35911 34634 gene locus_tag LOCUS_15130 35911 34634 CDS product methylaspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903703.1 protein_id gnl|my_center|LOCUS_15130 37347 35914 gene locus_tag LOCUS_15140 37347 35914 CDS product methylaspartate mutase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903702.1 protein_id gnl|my_center|LOCUS_15140 37824 37369 gene locus_tag LOCUS_15150 gene mamA 37824 37369 CDS product methylaspartate mutase subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903701.1 protein_id gnl|my_center|LOCUS_15150 37961 39133 gene locus_tag LOCUS_15160 37961 39133 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063669.1 protein_id gnl|my_center|LOCUS_15160 39232 39513 gene locus_tag LOCUS_15170 39232 39513 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008526012.1 protein_id gnl|my_center|LOCUS_15170 40220 39645 gene locus_tag LOCUS_15180 40220 39645 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903704.1 protein_id gnl|my_center|LOCUS_15180 41953 40334 gene locus_tag LOCUS_15190 41953 40334 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941764.1 protein_id gnl|my_center|LOCUS_15190 42372 42019 gene locus_tag LOCUS_15200 42372 42019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 42884 43921 gene locus_tag LOCUS_15210 42884 43921 CDS product monovalent cation/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902382.1 protein_id gnl|my_center|LOCUS_15210 43914 44198 gene locus_tag LOCUS_15220 43914 44198 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902381.1 protein_id gnl|my_center|LOCUS_15220 44195 44524 gene locus_tag LOCUS_15230 gene mnhG 44195 44524 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902380.1 protein_id gnl|my_center|LOCUS_15230 44521 45105 gene locus_tag LOCUS_15240 44521 45105 CDS product DUF4040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902379.1 protein_id gnl|my_center|LOCUS_15240 45102 45782 gene locus_tag LOCUS_15250 45102 45782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 45779 46165 gene locus_tag LOCUS_15260 45779 46165 CDS product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902377.1 protein_id gnl|my_center|LOCUS_15260 46158 47849 gene locus_tag LOCUS_15270 46158 47849 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902375.1 protein_id gnl|my_center|LOCUS_15270 47846 49648 gene locus_tag LOCUS_15280 47846 49648 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902374.1 protein_id gnl|my_center|LOCUS_15280 49749 51218 gene locus_tag LOCUS_15290 49749 51218 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289183.1 protein_id gnl|my_center|LOCUS_15290 52504 51326 gene locus_tag LOCUS_15300 52504 51326 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890429.1 protein_id gnl|my_center|LOCUS_15300 52698 53474 gene locus_tag LOCUS_15310 52698 53474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 55104 53491 gene locus_tag LOCUS_15320 55104 53491 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005575582.1 protein_id gnl|my_center|LOCUS_15320 55327 55728 gene locus_tag LOCUS_15330 55327 55728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 56816 55806 gene locus_tag LOCUS_15340 56816 55806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 56969 58054 gene locus_tag LOCUS_15350 56969 58054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 58192 60042 gene locus_tag LOCUS_15360 58192 60042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 60353 60919 gene locus_tag LOCUS_15370 60353 60919 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021228.1 protein_id gnl|my_center|LOCUS_15370 61983 61021 gene locus_tag LOCUS_15380 61983 61021 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903774.1 protein_id gnl|my_center|LOCUS_15380 62912 61980 gene locus_tag LOCUS_15390 62912 61980 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903775.1 protein_id gnl|my_center|LOCUS_15390 63273 63004 gene locus_tag LOCUS_15400 63273 63004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903776.1 protein_id gnl|my_center|LOCUS_15400 63480 64637 gene locus_tag LOCUS_15410 63480 64637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 64753 66567 gene locus_tag LOCUS_15420 64753 66567 CDS product excinuclease ABC subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903778.1 protein_id gnl|my_center|LOCUS_15420 66891 68045 gene locus_tag LOCUS_15430 66891 68045 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947133.1 protein_id gnl|my_center|LOCUS_15430 68198 68494 gene locus_tag LOCUS_15440 gene yciH 68198 68494 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903930.1 protein_id gnl|my_center|LOCUS_15440 68722 69006 gene locus_tag LOCUS_15450 68722 69006 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903306.1 protein_id gnl|my_center|LOCUS_15450 69219 69413 gene locus_tag LOCUS_15460 69219 69413 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289092.1 protein_id gnl|my_center|LOCUS_15460 70657 69512 gene locus_tag LOCUS_15470 70657 69512 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289209.1 protein_id gnl|my_center|LOCUS_15470 71359 70721 gene locus_tag LOCUS_15480 71359 70721 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902568.1 protein_id gnl|my_center|LOCUS_15480 71514 72560 gene locus_tag LOCUS_15490 71514 72560 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289210.1 protein_id gnl|my_center|LOCUS_15490 73171 72851 gene locus_tag LOCUS_15500 73171 72851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 73235 73513 gene locus_tag LOCUS_15510 73235 73513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 73611 74024 gene locus_tag LOCUS_15520 73611 74024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 74168 75643 gene locus_tag LOCUS_15530 74168 75643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 76136 75726 gene locus_tag LOCUS_15540 76136 75726 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187137.1 protein_id gnl|my_center|LOCUS_15540 76363 78540 gene locus_tag LOCUS_15550 76363 78540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 78533 79588 gene locus_tag LOCUS_15560 78533 79588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 79581 83423 gene locus_tag LOCUS_15570 79581 83423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 86529 83488 gene locus_tag LOCUS_15580 86529 83488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 87607 86609 gene locus_tag LOCUS_15590 87607 86609 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992236.1 protein_id gnl|my_center|LOCUS_15590 88011 88020 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 88106 88115 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence26 1150 461 gene locus_tag LOCUS_15600 1150 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 1865 1479 gene locus_tag LOCUS_15610 1865 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 2089 2397 gene locus_tag LOCUS_15620 2089 2397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 2627 2851 gene locus_tag LOCUS_15630 2627 2851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 2862 3230 gene locus_tag LOCUS_15640 2862 3230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 6120 3673 gene locus_tag LOCUS_15650 6120 3673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 8823 6511 gene locus_tag LOCUS_15660 8823 6511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 9248 9532 gene locus_tag LOCUS_15670 9248 9532 CDS product DUF5808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903504.1 protein_id gnl|my_center|LOCUS_15670 10538 9663 gene locus_tag LOCUS_15680 10538 9663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 11209 10679 gene locus_tag LOCUS_15690 gene pyrE 11209 10679 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903560.1 protein_id gnl|my_center|LOCUS_15690 11331 12290 gene locus_tag LOCUS_15700 11331 12290 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230588.1 protein_id gnl|my_center|LOCUS_15700 14454 13030 gene locus_tag LOCUS_15710 14454 13030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 15562 14915 gene locus_tag LOCUS_15720 15562 14915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 15688 16299 gene locus_tag LOCUS_15730 15688 16299 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402896.1 protein_id gnl|my_center|LOCUS_15730 16482 16733 gene locus_tag LOCUS_15740 16482 16733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 16970 17386 gene locus_tag LOCUS_15750 16970 17386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 18135 19661 gene locus_tag LOCUS_15760 18135 19661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 19759 20235 gene locus_tag LOCUS_15770 19759 20235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 20281 21864 gene locus_tag LOCUS_15780 20281 21864 CDS product HTTM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902592.1 protein_id gnl|my_center|LOCUS_15780 22765 21971 gene locus_tag LOCUS_15790 22765 21971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 23005 24006 gene locus_tag LOCUS_15800 23005 24006 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904143.1 protein_id gnl|my_center|LOCUS_15800 26204 24003 gene locus_tag LOCUS_15810 gene rqcH 26204 24003 CDS product ribosome rescue protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903100.1 protein_id gnl|my_center|LOCUS_15810 26236 26727 gene locus_tag LOCUS_15820 26236 26727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 26839 28050 gene locus_tag LOCUS_15830 26839 28050 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877490.1 protein_id gnl|my_center|LOCUS_15830 28272 31490 gene locus_tag LOCUS_15840 28272 31490 CDS product tubulin-like doman-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022671.1 protein_id gnl|my_center|LOCUS_15840 31487 32944 gene locus_tag LOCUS_15850 31487 32944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 32951 34489 gene locus_tag LOCUS_15860 32951 34489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 34646 35857 gene locus_tag LOCUS_15870 34646 35857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 36337 35936 gene locus_tag LOCUS_15880 36337 35936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 36804 37340 gene locus_tag LOCUS_15890 36804 37340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 37452 37619 gene locus_tag LOCUS_15900 37452 37619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 37727 38974 gene locus_tag LOCUS_15910 37727 38974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 39447 39010 gene locus_tag LOCUS_15920 39447 39010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15920 40095 39454 gene locus_tag LOCUS_15930 40095 39454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15930 40682 40428 gene locus_tag LOCUS_15940 40682 40428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 41085 40876 gene locus_tag LOCUS_15950 41085 40876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 41749 41231 gene locus_tag LOCUS_15960 41749 41231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 42736 41939 gene locus_tag LOCUS_15970 gene cbiZ 42736 41939 CDS product adenosylcobinamide amidohydrolase CbiZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903156.1 protein_id gnl|my_center|LOCUS_15970 43831 42770 gene locus_tag LOCUS_15980 gene cobD 43831 42770 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903155.1 protein_id gnl|my_center|LOCUS_15980 44900 43821 gene locus_tag LOCUS_15990 44900 43821 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289355.1 protein_id gnl|my_center|LOCUS_15990 45562 44891 gene locus_tag LOCUS_16000 45562 44891 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197535909.1 protein_id gnl|my_center|LOCUS_16000 46353 45562 gene locus_tag LOCUS_16010 gene cobS 46353 45562 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289358.1 protein_id gnl|my_center|LOCUS_16010 47306 46350 gene locus_tag LOCUS_16020 47306 46350 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903152.1 protein_id gnl|my_center|LOCUS_16020 47985 47350 gene locus_tag LOCUS_16030 47985 47350 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892512.1 protein_id gnl|my_center|LOCUS_16030 48742 48131 gene locus_tag LOCUS_16040 48742 48131 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020240.1 protein_id gnl|my_center|LOCUS_16040 49221 48835 gene locus_tag LOCUS_16050 49221 48835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 50044 49415 gene locus_tag LOCUS_16060 50044 49415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 50229 51542 gene locus_tag LOCUS_16070 50229 51542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 51692 52999 gene locus_tag LOCUS_16080 51692 52999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 53158 53772 gene locus_tag LOCUS_16090 53158 53772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 53952 54725 gene locus_tag LOCUS_16100 53952 54725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 54827 55510 gene locus_tag LOCUS_16110 54827 55510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 55691 55969 gene locus_tag LOCUS_16120 55691 55969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 56292 56002 gene locus_tag LOCUS_16130 56292 56002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 56453 57421 gene locus_tag LOCUS_16140 56453 57421 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902500.1 protein_id gnl|my_center|LOCUS_16140 58597 57548 gene locus_tag LOCUS_16150 58597 57548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 59602 58718 gene locus_tag LOCUS_16160 59602 58718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 60687 59599 gene locus_tag LOCUS_16170 60687 59599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 61787 60684 gene locus_tag LOCUS_16180 61787 60684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 62943 62245 gene locus_tag LOCUS_16190 62943 62245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 64477 63062 gene locus_tag LOCUS_16200 64477 63062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 65288 64509 gene locus_tag LOCUS_16210 65288 64509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 65666 66202 gene locus_tag LOCUS_16220 65666 66202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 67217 66228 gene locus_tag LOCUS_16230 67217 66228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 67494 67925 gene locus_tag LOCUS_16240 67494 67925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 68580 67975 gene locus_tag LOCUS_16250 68580 67975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005553844.1 protein_id gnl|my_center|LOCUS_16250 69172 70371 gene locus_tag LOCUS_16260 69172 70371 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903276.1 protein_id gnl|my_center|LOCUS_16260 70710 70540 gene locus_tag LOCUS_16270 70710 70540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 >Feature sequence27 154 2805 gene locus_tag LOCUS_16280 154 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 3783 2881 gene locus_tag LOCUS_16290 3783 2881 CDS product transcription initiation factor IIB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903620.1 protein_id gnl|my_center|LOCUS_16290 4053 4730 gene locus_tag LOCUS_16300 4053 4730 CDS product DUF2071 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399111.1 protein_id gnl|my_center|LOCUS_16300 5745 4747 gene locus_tag LOCUS_16310 5745 4747 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289464.1 protein_id gnl|my_center|LOCUS_16310 7742 6063 gene locus_tag LOCUS_16320 gene thsA 7742 6063 CDS product thermosome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892611.1 protein_id gnl|my_center|LOCUS_16320 8528 7971 gene locus_tag LOCUS_16330 8528 7971 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903653.1 protein_id gnl|my_center|LOCUS_16330 8693 9868 gene locus_tag LOCUS_16340 8693 9868 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817791.1 protein_id gnl|my_center|LOCUS_16340 10033 10914 gene locus_tag LOCUS_16350 10033 10914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 11436 10933 gene locus_tag LOCUS_16360 11436 10933 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084126250.1 protein_id gnl|my_center|LOCUS_16360 11803 13506 gene locus_tag LOCUS_16370 11803 13506 CDS product histidine kinase N-terminal 7TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044948.1 protein_id gnl|my_center|LOCUS_16370 14428 13559 gene locus_tag LOCUS_16380 gene rio1 14428 13559 CDS product serine/threonine-protein kinase Rio1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289466.1 protein_id gnl|my_center|LOCUS_16380 15239 14478 gene locus_tag LOCUS_16390 15239 14478 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902086.1 protein_id gnl|my_center|LOCUS_16390 16262 15333 gene locus_tag LOCUS_16400 16262 15333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 16399 17532 gene locus_tag LOCUS_16410 16399 17532 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903039.1 protein_id gnl|my_center|LOCUS_16410 18151 17576 gene locus_tag LOCUS_16420 18151 17576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 19011 18217 gene locus_tag LOCUS_16430 19011 18217 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903787.1 protein_id gnl|my_center|LOCUS_16430 19296 20159 gene locus_tag LOCUS_16440 19296 20159 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289496.1 protein_id gnl|my_center|LOCUS_16440 21042 20311 gene locus_tag LOCUS_16450 21042 20311 CDS product DICT sensory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902515.1 protein_id gnl|my_center|LOCUS_16450 21403 21035 gene locus_tag LOCUS_16460 21403 21035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 21612 22355 gene locus_tag LOCUS_16470 21612 22355 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903867.1 protein_id gnl|my_center|LOCUS_16470 24199 22922 gene locus_tag LOCUS_16480 gene thrC 24199 22922 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903816.1 protein_id gnl|my_center|LOCUS_16480 25479 24565 gene locus_tag LOCUS_16490 gene argF 25479 24565 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878750.1 protein_id gnl|my_center|LOCUS_16490 26591 25479 gene locus_tag LOCUS_16500 26591 25479 CDS product [LysW]-lysine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867567.1 protein_id gnl|my_center|LOCUS_16500 27742 26588 gene locus_tag LOCUS_16510 27742 26588 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228893.1 protein_id gnl|my_center|LOCUS_16510 28593 27739 gene locus_tag LOCUS_16520 28593 27739 CDS product [LysW]-aminoadipate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888059.1 protein_id gnl|my_center|LOCUS_16520 29667 28594 gene locus_tag LOCUS_16530 gene argC 29667 28594 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256242.1 protein_id gnl|my_center|LOCUS_16530 30545 29667 gene locus_tag LOCUS_16540 gene lysX 30545 29667 CDS product lysine biosynthesis protein LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256241.1 protein_id gnl|my_center|LOCUS_16540 30816 30652 gene locus_tag LOCUS_16550 gene lysW 30816 30652 CDS product lysine biosynthesis protein LysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256240.1 protein_id gnl|my_center|LOCUS_16550 32553 31021 gene locus_tag LOCUS_16560 gene argH 32553 31021 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903820.1 protein_id gnl|my_center|LOCUS_16560 33740 32556 gene locus_tag LOCUS_16570 33740 32556 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903821.1 protein_id gnl|my_center|LOCUS_16570 35184 34069 gene locus_tag LOCUS_16580 35184 34069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 35326 35511 gene locus_tag LOCUS_16590 35326 35511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 35631 36131 gene locus_tag LOCUS_16600 35631 36131 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289507.1 protein_id gnl|my_center|LOCUS_16600 36309 36656 gene locus_tag LOCUS_16610 36309 36656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 38955 36724 gene locus_tag LOCUS_16620 38955 36724 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903824.1 protein_id gnl|my_center|LOCUS_16620 39347 39766 gene locus_tag LOCUS_16630 39347 39766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 >Feature sequence28 237 312 gene locus_tag LOCUS_t00310 237 312 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1717 755 gene locus_tag LOCUS_16640 1717 755 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902122.1 protein_id gnl|my_center|LOCUS_16640 2299 1763 gene locus_tag LOCUS_16650 2299 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 4236 2296 gene locus_tag LOCUS_16660 4236 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 5044 4229 gene locus_tag LOCUS_16670 5044 4229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 5243 7237 gene locus_tag LOCUS_16680 5243 7237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 8656 7472 gene locus_tag LOCUS_16690 8656 7472 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901949.1 protein_id gnl|my_center|LOCUS_16690 8788 10122 gene locus_tag LOCUS_16700 gene glmM 8788 10122 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065583.1 protein_id gnl|my_center|LOCUS_16700 10233 11444 gene locus_tag LOCUS_16710 10233 11444 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901948.1 protein_id gnl|my_center|LOCUS_16710 11444 13231 gene locus_tag LOCUS_16720 gene glmS 11444 13231 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901947.1 protein_id gnl|my_center|LOCUS_16720 13299 13562 gene locus_tag LOCUS_16730 13299 13562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 13559 14746 gene locus_tag LOCUS_16740 13559 14746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 14743 15822 gene locus_tag LOCUS_16750 14743 15822 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742066.1 protein_id gnl|my_center|LOCUS_16750 16771 15848 gene locus_tag LOCUS_16760 16771 15848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 17337 16768 gene locus_tag LOCUS_16770 17337 16768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 18692 17334 gene locus_tag LOCUS_16780 18692 17334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 18919 21102 gene locus_tag LOCUS_16790 18919 21102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 21307 22332 gene locus_tag LOCUS_16800 21307 22332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 22470 23657 gene locus_tag LOCUS_16810 22470 23657 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903720.1 protein_id gnl|my_center|LOCUS_16810 23856 24581 gene locus_tag LOCUS_16820 23856 24581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 24657 25883 gene locus_tag LOCUS_16830 24657 25883 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393494.1 protein_id gnl|my_center|LOCUS_16830 27509 25866 gene locus_tag LOCUS_16840 27509 25866 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812114.1 protein_id gnl|my_center|LOCUS_16840 27553 28839 gene locus_tag LOCUS_16850 27553 28839 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084676.1 protein_id gnl|my_center|LOCUS_16850 29147 30832 gene locus_tag LOCUS_16860 29147 30832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 30855 31844 gene locus_tag LOCUS_16870 30855 31844 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385787.1 protein_id gnl|my_center|LOCUS_16870 31849 32778 gene locus_tag LOCUS_16880 31849 32778 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385788.1 protein_id gnl|my_center|LOCUS_16880 32799 33863 gene locus_tag LOCUS_16890 32799 33863 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538195.1 protein_id gnl|my_center|LOCUS_16890 33931 34959 gene locus_tag LOCUS_16900 33931 34959 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080230.1 protein_id gnl|my_center|LOCUS_16900 35773 35243 gene locus_tag LOCUS_16910 35773 35243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 36052 36771 gene locus_tag LOCUS_16920 36052 36771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 37118 36849 gene locus_tag LOCUS_16930 37118 36849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903817.1 protein_id gnl|my_center|LOCUS_16930 38590 37193 gene locus_tag LOCUS_16940 38590 37193 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903721.1 protein_id gnl|my_center|LOCUS_16940 38639 38989 gene locus_tag LOCUS_16950 38639 38989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 38989 39513 gene locus_tag LOCUS_16960 38989 39513 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903723.1 protein_id gnl|my_center|LOCUS_16960 40390 39551 gene locus_tag LOCUS_16970 40390 39551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 41862 40474 gene locus_tag LOCUS_16980 41862 40474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 42304 41933 gene locus_tag LOCUS_16990 42304 41933 CDS product DUF5518 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903938.1 protein_id gnl|my_center|LOCUS_16990 42405 43478 gene locus_tag LOCUS_17000 42405 43478 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903937.1 protein_id gnl|my_center|LOCUS_17000 43497 43850 gene locus_tag LOCUS_17010 43497 43850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 44120 45121 gene locus_tag LOCUS_17020 44120 45121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 45991 45155 gene locus_tag LOCUS_17030 gene moeB 45991 45155 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902012.1 protein_id gnl|my_center|LOCUS_17030 46847 48727 gene locus_tag LOCUS_17040 46847 48727 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903960.1 protein_id gnl|my_center|LOCUS_17040 48731 49840 gene locus_tag LOCUS_17050 48731 49840 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903961.1 protein_id gnl|my_center|LOCUS_17050 50089 49844 gene locus_tag LOCUS_17060 50089 49844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 50209 50868 gene locus_tag LOCUS_17070 50209 50868 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289529.1 protein_id gnl|my_center|LOCUS_17070 51234 50884 gene locus_tag LOCUS_17080 51234 50884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 51937 51374 gene locus_tag LOCUS_17090 51937 51374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 53048 52038 gene locus_tag LOCUS_17100 53048 52038 CDS product PrsW family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289530.1 protein_id gnl|my_center|LOCUS_17100 53155 53556 gene locus_tag LOCUS_17110 53155 53556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 53553 54998 gene locus_tag LOCUS_17120 53553 54998 CDS product ribonuclease E/G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903965.1 protein_id gnl|my_center|LOCUS_17120 55511 55035 gene locus_tag LOCUS_17130 55511 55035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 56622 55636 gene locus_tag LOCUS_17140 56622 55636 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042144000.1 protein_id gnl|my_center|LOCUS_17140 56730 56945 gene locus_tag LOCUS_17150 56730 56945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 57026 57925 gene locus_tag LOCUS_17160 57026 57925 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903490.1 protein_id gnl|my_center|LOCUS_17160 57999 58322 gene locus_tag LOCUS_17170 57999 58322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 58406 59023 gene locus_tag LOCUS_17180 gene pdxT 58406 59023 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903941.1 protein_id gnl|my_center|LOCUS_17180 59467 59967 gene locus_tag LOCUS_17190 59467 59967 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903940.1 protein_id gnl|my_center|LOCUS_17190 59968 60252 gene locus_tag LOCUS_17200 gene hisE 59968 60252 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903939.1 protein_id gnl|my_center|LOCUS_17200 60356 61057 gene locus_tag LOCUS_17210 60356 61057 CDS product putative phosphoglycerol geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902143.1 protein_id gnl|my_center|LOCUS_17210 61139 61786 gene locus_tag LOCUS_17220 61139 61786 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902596.1 protein_id gnl|my_center|LOCUS_17220 62560 61808 gene locus_tag LOCUS_17230 62560 61808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 66063 62557 gene locus_tag LOCUS_17240 66063 62557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 66803 66279 gene locus_tag LOCUS_17250 66803 66279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 68049 66865 gene locus_tag LOCUS_17260 68049 66865 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903552.1 protein_id gnl|my_center|LOCUS_17260 69008 68049 gene locus_tag LOCUS_17270 69008 68049 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903551.1 protein_id gnl|my_center|LOCUS_17270 70216 69095 gene locus_tag LOCUS_17280 70216 69095 CDS product aminomethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903976.1 protein_id gnl|my_center|LOCUS_17280 70567 70265 gene locus_tag LOCUS_17290 70567 70265 CDS product DUF6432 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903977.1 protein_id gnl|my_center|LOCUS_17290 70686 71645 gene locus_tag LOCUS_17300 70686 71645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903978.1 protein_id gnl|my_center|LOCUS_17300 71807 72235 gene locus_tag LOCUS_17310 71807 72235 CDS product DUF5611 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903979.1 protein_id gnl|my_center|LOCUS_17310 72248 72436 gene locus_tag LOCUS_17320 72248 72436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 74091 72544 gene locus_tag LOCUS_17330 74091 72544 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903487.1 protein_id gnl|my_center|LOCUS_17330 74254 74778 gene locus_tag LOCUS_17340 74254 74778 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903486.1 protein_id gnl|my_center|LOCUS_17340 76651 74816 gene locus_tag LOCUS_17350 76651 74816 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903485.1 protein_id gnl|my_center|LOCUS_17350 78373 76694 gene locus_tag LOCUS_17360 gene lysS 78373 76694 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903484.1 protein_id gnl|my_center|LOCUS_17360 79065 78370 gene locus_tag LOCUS_17370 gene pyrH 79065 78370 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903483.1 protein_id gnl|my_center|LOCUS_17370 79239 80081 gene locus_tag LOCUS_17380 79239 80081 CDS product molybdopterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289090.1 protein_id gnl|my_center|LOCUS_17380 80270 80575 gene locus_tag LOCUS_17390 80270 80575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903482.1 protein_id gnl|my_center|LOCUS_17390 80757 81908 gene locus_tag LOCUS_17400 80757 81908 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903481.1 protein_id gnl|my_center|LOCUS_17400 82984 82079 gene locus_tag LOCUS_17410 gene thiL 82984 82079 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903480.1 protein_id gnl|my_center|LOCUS_17410 83119 83610 gene locus_tag LOCUS_17420 83119 83610 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903479.1 protein_id gnl|my_center|LOCUS_17420 83713 84063 gene locus_tag LOCUS_17430 83713 84063 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903478.1 protein_id gnl|my_center|LOCUS_17430 84063 84653 gene locus_tag LOCUS_17440 84063 84653 CDS product alpha hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903477.1 protein_id gnl|my_center|LOCUS_17440 84738 86327 gene locus_tag LOCUS_17450 84738 86327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 86355 87653 gene locus_tag LOCUS_17460 gene hisS 86355 87653 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903476.1 protein_id gnl|my_center|LOCUS_17460 87746 87982 gene locus_tag LOCUS_17470 87746 87982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 88000 89400 gene locus_tag LOCUS_17480 88000 89400 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904192.1 protein_id gnl|my_center|LOCUS_17480 89454 89714 gene locus_tag LOCUS_17490 89454 89714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 89793 91301 gene locus_tag LOCUS_17500 89793 91301 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111696793.1 protein_id gnl|my_center|LOCUS_17500 91376 91804 gene locus_tag LOCUS_17510 91376 91804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 92320 91841 gene locus_tag LOCUS_17520 92320 91841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 93348 92317 gene locus_tag LOCUS_17530 93348 92317 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057810.1 protein_id gnl|my_center|LOCUS_17530 94239 93352 gene locus_tag LOCUS_17540 gene hisG 94239 93352 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903669.1 protein_id gnl|my_center|LOCUS_17540 94376 95578 gene locus_tag LOCUS_17550 94376 95578 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405273.1 protein_id gnl|my_center|LOCUS_17550 96563 95649 gene locus_tag LOCUS_17560 96563 95649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 97362 96748 gene locus_tag LOCUS_17570 97362 96748 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903927.1 protein_id gnl|my_center|LOCUS_17570 97818 97408 gene locus_tag LOCUS_17580 97818 97408 CDS product DUF5809 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903925.1 protein_id gnl|my_center|LOCUS_17580 98302 97844 gene locus_tag LOCUS_17590 98302 97844 CDS product DUF5810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903924.1 protein_id gnl|my_center|LOCUS_17590 99659 98637 gene locus_tag LOCUS_17600 99659 98637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 99858 99652 gene locus_tag LOCUS_17610 99858 99652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 100520 100047 gene locus_tag LOCUS_17620 gene rimI 100520 100047 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289526.1 protein_id gnl|my_center|LOCUS_17620 101088 100771 gene locus_tag LOCUS_17630 101088 100771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403531.1 protein_id gnl|my_center|LOCUS_17630 102548 101088 gene locus_tag LOCUS_17640 102548 101088 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403532.1 protein_id gnl|my_center|LOCUS_17640 103401 102859 gene locus_tag LOCUS_17650 103401 102859 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001022822.1 protein_id gnl|my_center|LOCUS_17650 103781 103497 gene locus_tag LOCUS_17660 103781 103497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 104093 104287 gene locus_tag LOCUS_17670 104093 104287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 104345 105034 gene locus_tag LOCUS_17680 104345 105034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 105063 105137 gene locus_tag LOCUS_t00320 105063 105137 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 105866 107209 gene locus_tag LOCUS_17690 105866 107209 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940434.1 protein_id gnl|my_center|LOCUS_17690 107209 108288 gene locus_tag LOCUS_17700 107209 108288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 108285 109316 gene locus_tag LOCUS_17710 108285 109316 CDS product DUF354 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024333.1 protein_id gnl|my_center|LOCUS_17710 109313 110518 gene locus_tag LOCUS_17720 109313 110518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 110505 111245 gene locus_tag LOCUS_17730 110505 111245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 113038 111260 gene locus_tag LOCUS_17740 113038 111260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 114694 113225 gene locus_tag LOCUS_17750 114694 113225 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868291.1 protein_id gnl|my_center|LOCUS_17750 115687 114722 gene locus_tag LOCUS_17760 115687 114722 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902523.1 protein_id gnl|my_center|LOCUS_17760 116053 117264 gene locus_tag LOCUS_17770 116053 117264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 117261 119087 gene locus_tag LOCUS_17780 117261 119087 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405008.1 protein_id gnl|my_center|LOCUS_17780 119095 120978 gene locus_tag LOCUS_17790 119095 120978 CDS product lasso peptide isopeptide bond-forming cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528116.1 protein_id gnl|my_center|LOCUS_17790 121213 122136 gene locus_tag LOCUS_17800 121213 122136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 122234 123154 gene locus_tag LOCUS_17810 122234 123154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528117.1 protein_id gnl|my_center|LOCUS_17810 123652 123488 gene locus_tag LOCUS_17820 123652 123488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 125841 123943 gene locus_tag LOCUS_17830 125841 123943 CDS product lasso peptide isopeptide bond-forming cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528116.1 protein_id gnl|my_center|LOCUS_17830 126308 125838 gene locus_tag LOCUS_17840 126308 125838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 126636 126319 gene locus_tag LOCUS_17850 126636 126319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 126766 127188 gene locus_tag LOCUS_17860 126766 127188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 127181 127705 gene locus_tag LOCUS_17870 127181 127705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 128815 128096 gene locus_tag LOCUS_17880 128815 128096 CDS product DUF5828 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903719.1 protein_id gnl|my_center|LOCUS_17880 130163 128970 gene locus_tag LOCUS_17890 130163 128970 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902360.1 protein_id gnl|my_center|LOCUS_17890 130914 130216 gene locus_tag LOCUS_17900 130914 130216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 131614 131387 gene locus_tag LOCUS_17910 131614 131387 CDS product small nuclear ribonucleoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289341.1 protein_id gnl|my_center|LOCUS_17910 131752 132069 gene locus_tag LOCUS_17920 131752 132069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 132161 133117 gene locus_tag LOCUS_17930 132161 133117 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903094.1 protein_id gnl|my_center|LOCUS_17930 133588 133136 gene locus_tag LOCUS_17940 133588 133136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 134222 133671 gene locus_tag LOCUS_17950 134222 133671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289342.1 protein_id gnl|my_center|LOCUS_17950 134461 134742 gene locus_tag LOCUS_17960 134461 134742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 135350 134769 gene locus_tag LOCUS_17970 135350 134769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076580729.1 protein_id gnl|my_center|LOCUS_17970 135514 138456 gene locus_tag LOCUS_17980 135514 138456 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289343.1 protein_id gnl|my_center|LOCUS_17980 138849 138460 gene locus_tag LOCUS_17990 138849 138460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 139939 138980 gene locus_tag LOCUS_18000 139939 138980 CDS product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249983.1 protein_id gnl|my_center|LOCUS_18000 140288 140932 gene locus_tag LOCUS_18010 140288 140932 CDS product DUF2270 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530519.1 protein_id gnl|my_center|LOCUS_18010 141570 141043 gene locus_tag LOCUS_18020 141570 141043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 142735 141731 gene locus_tag LOCUS_18030 142735 141731 CDS product TIGR04024 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902973.1 protein_id gnl|my_center|LOCUS_18030 143032 144990 gene locus_tag LOCUS_18040 143032 144990 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902952.1 protein_id gnl|my_center|LOCUS_18040 144994 145452 gene locus_tag LOCUS_18050 144994 145452 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902968.1 protein_id gnl|my_center|LOCUS_18050 146058 145513 gene locus_tag LOCUS_18060 146058 145513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 149420 146535 gene locus_tag LOCUS_18070 149420 146535 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877404.1 protein_id gnl|my_center|LOCUS_18070 151085 149607 gene locus_tag LOCUS_18080 151085 149607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 151945 151211 gene locus_tag LOCUS_18090 gene ribB 151945 151211 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903567.1 protein_id gnl|my_center|LOCUS_18090 152649 151942 gene locus_tag LOCUS_18100 152649 151942 CDS product DUF120 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289437.1 protein_id gnl|my_center|LOCUS_18100 153600 152788 gene locus_tag LOCUS_18110 153600 152788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 154715 153735 gene locus_tag LOCUS_18120 gene twy1 154715 153735 CDS product 4-demethylwyosine synthase TYW1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903569.1 protein_id gnl|my_center|LOCUS_18120 155102 154809 gene locus_tag LOCUS_18130 155102 154809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 155615 155196 gene locus_tag LOCUS_18140 155615 155196 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903023.1 protein_id gnl|my_center|LOCUS_18140 156376 155693 gene locus_tag LOCUS_18150 156376 155693 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902495.1 protein_id gnl|my_center|LOCUS_18150 157558 156464 gene locus_tag LOCUS_18160 157558 156464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903445.1 protein_id gnl|my_center|LOCUS_18160 159102 157555 gene locus_tag LOCUS_18170 gene glpK 159102 157555 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903446.1 protein_id gnl|my_center|LOCUS_18170 159470 161146 gene locus_tag LOCUS_18180 gene glpA 159470 161146 CDS product anaerobic glycerol-3-phosphate dehydrogenase subunit GlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903447.1 protein_id gnl|my_center|LOCUS_18180 161148 162500 gene locus_tag LOCUS_18190 gene glpB 161148 162500 CDS product glycerol-3-phosphate dehydrogenase subunit GlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903448.1 protein_id gnl|my_center|LOCUS_18190 162497 163834 gene locus_tag LOCUS_18200 162497 163834 CDS product anaerobic glycerol-3-phosphate dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903449.1 protein_id gnl|my_center|LOCUS_18200 163831 164997 gene locus_tag LOCUS_18210 163831 164997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 165086 167161 gene locus_tag LOCUS_18220 165086 167161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903117.1 protein_id gnl|my_center|LOCUS_18220 167983 167207 gene locus_tag LOCUS_18230 167983 167207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 169652 168066 gene locus_tag LOCUS_18240 gene serA 169652 168066 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903813.1 protein_id gnl|my_center|LOCUS_18240 169889 170620 gene locus_tag LOCUS_18250 gene hisA 169889 170620 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903708.1 protein_id gnl|my_center|LOCUS_18250 171376 170687 gene locus_tag LOCUS_18260 171376 170687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 171760 171626 gene locus_tag LOCUS_18270 171760 171626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 172292 172041 gene locus_tag LOCUS_18280 172292 172041 CDS product translation initiation factor eIF-1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892515.1 protein_id gnl|my_center|LOCUS_18280 173041 172463 gene locus_tag LOCUS_18290 173041 172463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 173507 173235 gene locus_tag LOCUS_18300 173507 173235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 174297 173572 gene locus_tag LOCUS_18310 174297 173572 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020634.1 protein_id gnl|my_center|LOCUS_18310 174413 174619 gene locus_tag LOCUS_18320 174413 174619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 175774 174665 gene locus_tag LOCUS_18330 175774 174665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 176868 175969 gene locus_tag LOCUS_18340 176868 175969 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903908.1 protein_id gnl|my_center|LOCUS_18340 177348 176914 gene locus_tag LOCUS_18350 177348 176914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 177928 177464 gene locus_tag LOCUS_18360 177928 177464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 178590 178036 gene locus_tag LOCUS_18370 178590 178036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902733.1 protein_id gnl|my_center|LOCUS_18370 179082 178600 gene locus_tag LOCUS_18380 179082 178600 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903920.1 protein_id gnl|my_center|LOCUS_18380 179244 181211 gene locus_tag LOCUS_18390 179244 181211 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903922.1 protein_id gnl|my_center|LOCUS_18390 181580 181371 gene locus_tag LOCUS_18400 181580 181371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 181790 182353 gene locus_tag LOCUS_18410 181790 182353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 182547 183461 gene locus_tag LOCUS_18420 182547 183461 CDS product LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122374.1 protein_id gnl|my_center|LOCUS_18420 184756 183629 gene locus_tag LOCUS_18430 gene solA 184756 183629 CDS product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259547.1 protein_id gnl|my_center|LOCUS_18430 185448 184978 gene locus_tag LOCUS_18440 185448 184978 CDS product Tfx family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496415.1 protein_id gnl|my_center|LOCUS_18440 186540 185656 gene locus_tag LOCUS_18450 186540 185656 CDS product TIGR01548 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903949.1 protein_id gnl|my_center|LOCUS_18450 187071 186637 gene locus_tag LOCUS_18460 187071 186637 CDS product UPF0146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903950.1 protein_id gnl|my_center|LOCUS_18460 187051 187632 gene locus_tag LOCUS_18470 187051 187632 CDS product archaemetzincin family Zn-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903951.1 protein_id gnl|my_center|LOCUS_18470 187714 188370 gene locus_tag LOCUS_18480 187714 188370 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249655.1 protein_id gnl|my_center|LOCUS_18480 188499 189371 gene locus_tag LOCUS_18490 188499 189371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 191173 189359 gene locus_tag LOCUS_18500 191173 189359 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903953.1 protein_id gnl|my_center|LOCUS_18500 191500 191177 gene locus_tag LOCUS_18510 191500 191177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903954.1 protein_id gnl|my_center|LOCUS_18510 192742 191555 gene locus_tag LOCUS_18520 192742 191555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 193275 192739 gene locus_tag LOCUS_18530 193275 192739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005553844.1 protein_id gnl|my_center|LOCUS_18530 193694 194215 gene locus_tag LOCUS_18540 193694 194215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 194344 195153 gene locus_tag LOCUS_18550 194344 195153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 195317 195937 gene locus_tag LOCUS_18560 195317 195937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 196014 196985 gene locus_tag LOCUS_18570 196014 196985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 197091 198263 gene locus_tag LOCUS_18580 197091 198263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 198480 199661 gene locus_tag LOCUS_18590 198480 199661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 200020 200313 gene locus_tag LOCUS_18600 200020 200313 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903955.1 protein_id gnl|my_center|LOCUS_18600 200372 200785 gene locus_tag LOCUS_18610 200372 200785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 201707 200796 gene locus_tag LOCUS_18620 201707 200796 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023442.1 protein_id gnl|my_center|LOCUS_18620 201868 202506 gene locus_tag LOCUS_18630 201868 202506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 202506 203165 gene locus_tag LOCUS_18640 202506 203165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 204107 203268 gene locus_tag LOCUS_18650 204107 203268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 206299 204413 gene locus_tag LOCUS_18660 206299 204413 CDS product PINc/VapC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903956.1 protein_id gnl|my_center|LOCUS_18660 207137 206358 gene locus_tag LOCUS_18670 207137 206358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 207230 207793 gene locus_tag LOCUS_18680 207230 207793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 208597 207797 gene locus_tag LOCUS_18690 208597 207797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 209286 209071 gene locus_tag LOCUS_18700 209286 209071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 209447 209283 gene locus_tag LOCUS_18710 209447 209283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 209696 209971 gene locus_tag LOCUS_18720 209696 209971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18720 210203 211840 gene locus_tag LOCUS_18730 gene hemAT 210203 211840 CDS product heme-containing aerotactic transducer HemAT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903098.1 protein_id gnl|my_center|LOCUS_18730 211894 213030 gene locus_tag LOCUS_18740 gene argE 211894 213030 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973005.1 protein_id gnl|my_center|LOCUS_18740 213423 213034 gene locus_tag LOCUS_18750 213423 213034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 213842 213486 gene locus_tag LOCUS_18760 213842 213486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 213983 214306 gene locus_tag LOCUS_18770 213983 214306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 214574 214335 gene locus_tag LOCUS_18780 214574 214335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 214790 216373 gene locus_tag LOCUS_18790 214790 216373 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903957.1 protein_id gnl|my_center|LOCUS_18790 216457 217203 gene locus_tag LOCUS_18800 216457 217203 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902346.1 protein_id gnl|my_center|LOCUS_18800 217276 217929 gene locus_tag LOCUS_18810 217276 217929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 218604 217996 gene locus_tag LOCUS_18820 218604 217996 CDS product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903713.1 protein_id gnl|my_center|LOCUS_18820 218775 219176 gene locus_tag LOCUS_18830 218775 219176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 219719 219204 gene locus_tag LOCUS_18840 219719 219204 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289478.1 protein_id gnl|my_center|LOCUS_18840 219802 220683 gene locus_tag LOCUS_18850 219802 220683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 221309 220716 gene locus_tag LOCUS_18860 gene hisB 221309 220716 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903709.1 protein_id gnl|my_center|LOCUS_18860 221576 221842 gene locus_tag LOCUS_18870 221576 221842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 221975 223504 gene locus_tag LOCUS_18880 221975 223504 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404995.1 protein_id gnl|my_center|LOCUS_18880 224040 223648 gene locus_tag LOCUS_18890 224040 223648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 225200 224040 gene locus_tag LOCUS_18900 225200 224040 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876428.1 protein_id gnl|my_center|LOCUS_18900 225895 225437 gene locus_tag LOCUS_18910 225895 225437 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289521.1 protein_id gnl|my_center|LOCUS_18910 226034 226492 gene locus_tag LOCUS_18920 226034 226492 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903884.1 protein_id gnl|my_center|LOCUS_18920 227094 226525 gene locus_tag LOCUS_18930 227094 226525 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903885.1 protein_id gnl|my_center|LOCUS_18930 227465 227097 gene locus_tag LOCUS_18940 227465 227097 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289522.1 protein_id gnl|my_center|LOCUS_18940 227615 229024 gene locus_tag LOCUS_18950 227615 229024 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289423.1 protein_id gnl|my_center|LOCUS_18950 229159 229548 gene locus_tag LOCUS_18960 229159 229548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 230427 229612 gene locus_tag LOCUS_18970 230427 229612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 230990 230526 gene locus_tag LOCUS_18980 230990 230526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 231724 232530 gene locus_tag LOCUS_18990 231724 232530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 232620 232943 gene locus_tag LOCUS_19000 232620 232943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 233010 233834 gene locus_tag LOCUS_19010 233010 233834 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903514.1 protein_id gnl|my_center|LOCUS_19010 234949 233891 gene locus_tag LOCUS_19020 234949 233891 CDS product DUF5787 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892531.1 protein_id gnl|my_center|LOCUS_19020 235102 236331 gene locus_tag LOCUS_19030 235102 236331 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903512.1 protein_id gnl|my_center|LOCUS_19030 236344 236730 gene locus_tag LOCUS_19040 236344 236730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903511.1 protein_id gnl|my_center|LOCUS_19040 236731 237300 gene locus_tag LOCUS_19050 236731 237300 CDS product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903510.1 protein_id gnl|my_center|LOCUS_19050 237303 237500 gene locus_tag LOCUS_19060 237303 237500 CDS product DNA-directed RNA polymerase subunit E'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903509.1 protein_id gnl|my_center|LOCUS_19060 237503 238135 gene locus_tag LOCUS_19070 237503 238135 CDS product DUF359 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289421.1 protein_id gnl|my_center|LOCUS_19070 238159 239007 gene locus_tag LOCUS_19080 238159 239007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 239868 239086 gene locus_tag LOCUS_19090 239868 239086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 240928 239897 gene locus_tag LOCUS_19100 240928 239897 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902730.1 protein_id gnl|my_center|LOCUS_19100 242317 241049 gene locus_tag LOCUS_19110 242317 241049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903588.1 protein_id gnl|my_center|LOCUS_19110 242472 243692 gene locus_tag LOCUS_19120 242472 243692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 244101 243709 gene locus_tag LOCUS_19130 244101 243709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 244021 244389 gene locus_tag LOCUS_19140 244021 244389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 245060 244437 gene locus_tag LOCUS_19150 245060 244437 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289442.1 protein_id gnl|my_center|LOCUS_19150 245210 245542 gene locus_tag LOCUS_19160 gene ahaH 245210 245542 CDS product ATP synthase archaeal subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903585.1 protein_id gnl|my_center|LOCUS_19160 245529 247766 gene locus_tag LOCUS_19170 245529 247766 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903584.1 protein_id gnl|my_center|LOCUS_19170 247773 248027 gene locus_tag LOCUS_19180 247773 248027 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289441.1 protein_id gnl|my_center|LOCUS_19180 248050 248631 gene locus_tag LOCUS_19190 248050 248631 CDS product V-type ATP synthase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903582.1 protein_id gnl|my_center|LOCUS_19190 248727 249695 gene locus_tag LOCUS_19200 248727 249695 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903581.1 protein_id gnl|my_center|LOCUS_19200 249692 250021 gene locus_tag LOCUS_19210 249692 250021 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903580.1 protein_id gnl|my_center|LOCUS_19210 250025 251788 gene locus_tag LOCUS_19220 250025 251788 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903579.1 protein_id gnl|my_center|LOCUS_19220 251791 253215 gene locus_tag LOCUS_19230 251791 253215 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903578.1 protein_id gnl|my_center|LOCUS_19230 253385 255001 gene locus_tag LOCUS_19240 253385 255001 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289110.1 protein_id gnl|my_center|LOCUS_19240 255126 256091 gene locus_tag LOCUS_19250 255126 256091 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902144.1 protein_id gnl|my_center|LOCUS_19250 256256 256630 gene locus_tag LOCUS_19260 256256 256630 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903290.1 protein_id gnl|my_center|LOCUS_19260 256630 257463 gene locus_tag LOCUS_19270 gene speB 256630 257463 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903289.1 protein_id gnl|my_center|LOCUS_19270 257650 257835 gene locus_tag LOCUS_19280 257650 257835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 258090 258218 gene locus_tag LOCUS_19290 258090 258218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 258312 259079 gene locus_tag LOCUS_19300 258312 259079 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903288.1 protein_id gnl|my_center|LOCUS_19300 259725 259102 gene locus_tag LOCUS_19310 259725 259102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 260032 261702 gene locus_tag LOCUS_19320 260032 261702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 261709 264183 gene locus_tag LOCUS_19330 261709 264183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 264261 265037 gene locus_tag LOCUS_19340 264261 265037 CDS product 4-phosphopantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902141.1 protein_id gnl|my_center|LOCUS_19340 265459 265052 gene locus_tag LOCUS_19350 265459 265052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 266183 265518 gene locus_tag LOCUS_19360 266183 265518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 266339 267019 gene locus_tag LOCUS_19370 266339 267019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 267146 267331 gene locus_tag LOCUS_19380 267146 267331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 267567 267863 gene locus_tag LOCUS_19390 267567 267863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 267958 268155 gene locus_tag LOCUS_19400 267958 268155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 268290 269042 gene locus_tag LOCUS_19410 268290 269042 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967667.1 protein_id gnl|my_center|LOCUS_19410 269177 270157 gene locus_tag LOCUS_19420 269177 270157 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903660.1 protein_id gnl|my_center|LOCUS_19420 270349 270849 gene locus_tag LOCUS_19430 270349 270849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 271212 272150 gene locus_tag LOCUS_19440 271212 272150 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289348.1 protein_id gnl|my_center|LOCUS_19440 272293 272970 gene locus_tag LOCUS_19450 gene upp 272293 272970 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903718.1 protein_id gnl|my_center|LOCUS_19450 274945 273104 gene locus_tag LOCUS_19460 274945 273104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 275215 276450 gene locus_tag LOCUS_19470 275215 276450 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867316.1 protein_id gnl|my_center|LOCUS_19470 277299 276595 gene locus_tag LOCUS_19480 277299 276595 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289483.1 protein_id gnl|my_center|LOCUS_19480 278052 277315 gene locus_tag LOCUS_19490 278052 277315 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903729.1 protein_id gnl|my_center|LOCUS_19490 278636 278049 gene locus_tag LOCUS_19500 278636 278049 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903728.1 protein_id gnl|my_center|LOCUS_19500 279039 282806 gene locus_tag LOCUS_19510 279039 282806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 283200 282865 gene locus_tag LOCUS_19520 283200 282865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902911.1 protein_id gnl|my_center|LOCUS_19520 283620 283288 gene locus_tag LOCUS_19530 283620 283288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 283666 284727 gene locus_tag LOCUS_19540 283666 284727 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902656.1 protein_id gnl|my_center|LOCUS_19540 284777 285604 gene locus_tag LOCUS_19550 284777 285604 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903351.1 protein_id gnl|my_center|LOCUS_19550 286215 285616 gene locus_tag LOCUS_19560 286215 285616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 287923 286379 gene locus_tag LOCUS_19570 287923 286379 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048142299.1 protein_id gnl|my_center|LOCUS_19570 288401 287973 gene locus_tag LOCUS_19580 288401 287973 CDS product DUF5807 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289520.1 protein_id gnl|my_center|LOCUS_19580 288864 289364 gene locus_tag LOCUS_19590 288864 289364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 289886 289446 gene locus_tag LOCUS_19600 289886 289446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902511.1 protein_id gnl|my_center|LOCUS_19600 290304 289903 gene locus_tag LOCUS_19610 290304 289903 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903878.1 protein_id gnl|my_center|LOCUS_19610 291207 290431 gene locus_tag LOCUS_19620 291207 290431 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902972.1 protein_id gnl|my_center|LOCUS_19620 291342 292070 gene locus_tag LOCUS_19630 291342 292070 CDS product TIGR02253 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249013.1 protein_id gnl|my_center|LOCUS_19630 292146 292772 gene locus_tag LOCUS_19640 292146 292772 CDS product TetR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902501.1 protein_id gnl|my_center|LOCUS_19640 292788 294125 gene locus_tag LOCUS_19650 292788 294125 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903876.1 protein_id gnl|my_center|LOCUS_19650 294991 294152 gene locus_tag LOCUS_19660 294991 294152 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810589.1 protein_id gnl|my_center|LOCUS_19660 295119 295397 gene locus_tag LOCUS_19670 295119 295397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 295544 296251 gene locus_tag LOCUS_19680 295544 296251 CDS product TetR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902501.1 protein_id gnl|my_center|LOCUS_19680 296291 297172 gene locus_tag LOCUS_19690 296291 297172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 297165 297506 gene locus_tag LOCUS_19700 297165 297506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 298106 297516 gene locus_tag LOCUS_19710 298106 297516 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903724.1 protein_id gnl|my_center|LOCUS_19710 298894 298187 gene locus_tag LOCUS_19720 298894 298187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 299547 300158 gene locus_tag LOCUS_19730 299547 300158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 300389 300255 gene locus_tag LOCUS_19740 300389 300255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 301752 300445 gene locus_tag LOCUS_19750 301752 300445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 302292 301840 gene locus_tag LOCUS_19760 302292 301840 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977989.1 protein_id gnl|my_center|LOCUS_19760 303865 302396 gene locus_tag LOCUS_19770 303865 302396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 306328 303866 gene locus_tag LOCUS_19780 306328 303866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 308697 306325 gene locus_tag LOCUS_19790 308697 306325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 310651 309431 gene locus_tag LOCUS_19800 310651 309431 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020239.1 protein_id gnl|my_center|LOCUS_19800 310957 312123 gene locus_tag LOCUS_19810 310957 312123 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404011.1 protein_id gnl|my_center|LOCUS_19810 312233 313006 gene locus_tag LOCUS_19820 312233 313006 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775994.1 protein_id gnl|my_center|LOCUS_19820 313130 313396 gene locus_tag LOCUS_19830 313130 313396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 314543 313536 gene locus_tag LOCUS_19840 314543 313536 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903696.1 protein_id gnl|my_center|LOCUS_19840 314698 315792 gene locus_tag LOCUS_19850 314698 315792 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392390.1 protein_id gnl|my_center|LOCUS_19850 316891 319095 gene locus_tag LOCUS_19860 gene mutL 316891 319095 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902072.1 protein_id gnl|my_center|LOCUS_19860 320430 319120 gene locus_tag LOCUS_19870 320430 319120 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947133.1 protein_id gnl|my_center|LOCUS_19870 320591 321715 gene locus_tag LOCUS_19880 gene rtcA 320591 321715 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289214.1 protein_id gnl|my_center|LOCUS_19880 321808 322761 gene locus_tag LOCUS_19890 gene kdgK1 321808 322761 CDS product bifunctional 2-dehydro-3-deoxygluconokinase/2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902071.1 protein_id gnl|my_center|LOCUS_19890 323015 323311 gene locus_tag LOCUS_19900 323015 323311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 324801 323368 gene locus_tag LOCUS_19910 324801 323368 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421525.1 protein_id gnl|my_center|LOCUS_19910 326032 324947 gene locus_tag LOCUS_19920 326032 324947 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289531.1 protein_id gnl|my_center|LOCUS_19920 326609 326214 gene locus_tag LOCUS_19930 326609 326214 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289270.1 protein_id gnl|my_center|LOCUS_19930 327444 326740 gene locus_tag LOCUS_19940 327444 326740 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902743.1 protein_id gnl|my_center|LOCUS_19940 327804 328067 gene locus_tag LOCUS_19950 327804 328067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289345.1 protein_id gnl|my_center|LOCUS_19950 328149 330287 gene locus_tag LOCUS_19960 328149 330287 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289344.1 protein_id gnl|my_center|LOCUS_19960 330746 330393 gene locus_tag LOCUS_19970 330746 330393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 331030 330743 gene locus_tag LOCUS_19980 331030 330743 CDS product Na(+)/H(+) antiporter subunit F1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228814.1 protein_id gnl|my_center|LOCUS_19980 331724 331023 gene locus_tag LOCUS_19990 331724 331023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 333394 331721 gene locus_tag LOCUS_20000 333394 331721 CDS product Na+/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942977.1 protein_id gnl|my_center|LOCUS_20000 333744 333391 gene locus_tag LOCUS_20010 333744 333391 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942978.1 protein_id gnl|my_center|LOCUS_20010 334208 333741 gene locus_tag LOCUS_20020 334208 333741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20020 336636 334270 gene locus_tag LOCUS_20030 336636 334270 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024445.1 protein_id gnl|my_center|LOCUS_20030 336786 337304 gene locus_tag LOCUS_20040 336786 337304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 338247 339908 gene locus_tag LOCUS_20050 338247 339908 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903101.1 protein_id gnl|my_center|LOCUS_20050 340701 339919 gene locus_tag LOCUS_20060 gene hpaI 340701 339919 CDS product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205448.1 protein_id gnl|my_center|LOCUS_20060 340858 341517 gene locus_tag LOCUS_20070 gene tenA 340858 341517 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666827.1 protein_id gnl|my_center|LOCUS_20070 341514 342284 gene locus_tag LOCUS_20080 341514 342284 CDS product TenA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993682.1 protein_id gnl|my_center|LOCUS_20080 342980 342321 gene locus_tag LOCUS_20090 342980 342321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 343195 344175 gene locus_tag LOCUS_20100 343195 344175 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902803.1 protein_id gnl|my_center|LOCUS_20100 344261 344334 gene locus_tag LOCUS_t00330 344261 344334 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 344653 345870 gene locus_tag LOCUS_20110 344653 345870 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903543.1 protein_id gnl|my_center|LOCUS_20110 345996 349638 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcttcaaccccacaagggttcgtctgaaac 350006 349746 gene locus_tag LOCUS_20120 gene cas2 350006 349746 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082343.1 protein_id gnl|my_center|LOCUS_20120 351000 350008 gene locus_tag LOCUS_20130 gene cas1b 351000 350008 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545291.1 protein_id gnl|my_center|LOCUS_20130 351552 351004 gene locus_tag LOCUS_20140 gene cas4 351552 351004 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546197.1 protein_id gnl|my_center|LOCUS_20140 354224 351549 gene locus_tag LOCUS_20150 354224 351549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 355032 354226 gene locus_tag LOCUS_20160 355032 354226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 356110 355037 gene locus_tag LOCUS_20170 gene cas7b 356110 355037 CDS product type I-B CRISPR-associated protein Cas7/Csh2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582996.1 protein_id gnl|my_center|LOCUS_20170 358268 356112 gene locus_tag LOCUS_20180 358268 356112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 359070 358255 gene locus_tag LOCUS_20190 gene cas6 359070 358255 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870746.1 protein_id gnl|my_center|LOCUS_20190 359925 359242 gene locus_tag LOCUS_20200 359925 359242 CDS product CDP-2,3-bis-(O-geranylgeranyl)-sn-glycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289436.1 protein_id gnl|my_center|LOCUS_20200 359924 360223 gene locus_tag LOCUS_20210 359924 360223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 360292 361149 gene locus_tag LOCUS_20220 360292 361149 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903562.1 protein_id gnl|my_center|LOCUS_20220 361189 361938 gene locus_tag LOCUS_20230 361189 361938 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903563.1 protein_id gnl|my_center|LOCUS_20230 362148 363428 gene locus_tag LOCUS_20240 362148 363428 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064208.1 protein_id gnl|my_center|LOCUS_20240 364472 363543 gene locus_tag LOCUS_20250 364472 363543 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903564.1 protein_id gnl|my_center|LOCUS_20250 365147 364620 gene locus_tag LOCUS_20260 365147 364620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 365349 365696 gene locus_tag LOCUS_20270 365349 365696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 367510 365837 gene locus_tag LOCUS_20280 367510 365837 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289376.1 protein_id gnl|my_center|LOCUS_20280 367957 367526 gene locus_tag LOCUS_20290 367957 367526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 368408 368055 gene locus_tag LOCUS_20300 368408 368055 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393652.1 protein_id gnl|my_center|LOCUS_20300 368689 368408 gene locus_tag LOCUS_20310 368689 368408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 368782 370098 gene locus_tag LOCUS_20320 368782 370098 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151112700.1 protein_id gnl|my_center|LOCUS_20320 370199 370474 gene locus_tag LOCUS_20330 370199 370474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 370476 370901 gene locus_tag LOCUS_20340 370476 370901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 370976 371338 gene locus_tag LOCUS_20350 370976 371338 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903929.1 protein_id gnl|my_center|LOCUS_20350 371767 371474 gene locus_tag LOCUS_20360 gene yciH 371767 371474 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903930.1 protein_id gnl|my_center|LOCUS_20360 374208 371812 gene locus_tag LOCUS_20370 374208 371812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 375209 374205 gene locus_tag LOCUS_20380 375209 374205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 376208 375216 gene locus_tag LOCUS_20390 376208 375216 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976721.1 protein_id gnl|my_center|LOCUS_20390 376566 376372 gene locus_tag LOCUS_20400 376566 376372 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289092.1 protein_id gnl|my_center|LOCUS_20400 377023 376682 gene locus_tag LOCUS_20410 377023 376682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 377083 377277 gene locus_tag LOCUS_20420 377083 377277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 378397 377345 gene locus_tag LOCUS_20430 gene mer 378397 377345 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871058.1 protein_id gnl|my_center|LOCUS_20430 379170 378394 gene locus_tag LOCUS_20440 379170 378394 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903932.1 protein_id gnl|my_center|LOCUS_20440 379582 381555 gene locus_tag LOCUS_20450 379582 381555 CDS product DUF460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903661.1 protein_id gnl|my_center|LOCUS_20450 381766 381587 gene locus_tag LOCUS_20460 381766 381587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 381898 382188 gene locus_tag LOCUS_20470 gene eif1A 381898 382188 CDS product translation initiation factor eIF-1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903658.1 protein_id gnl|my_center|LOCUS_20470 382348 383985 gene locus_tag LOCUS_20480 382348 383985 CDS product histidine kinase N-terminal 7TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289455.1 protein_id gnl|my_center|LOCUS_20480 385222 384110 gene locus_tag LOCUS_20490 385222 384110 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888750.1 protein_id gnl|my_center|LOCUS_20490 385860 385393 gene locus_tag LOCUS_20500 385860 385393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 387182 386004 gene locus_tag LOCUS_20510 387182 386004 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903808.1 protein_id gnl|my_center|LOCUS_20510 387411 388742 gene locus_tag LOCUS_20520 387411 388742 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903810.1 protein_id gnl|my_center|LOCUS_20520 388739 389941 gene locus_tag LOCUS_20530 gene metX 388739 389941 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289504.1 protein_id gnl|my_center|LOCUS_20530 390335 389970 gene locus_tag LOCUS_20540 390335 389970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 391176 390532 gene locus_tag LOCUS_20550 gene serB 391176 390532 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136360913.1 protein_id gnl|my_center|LOCUS_20550 391316 392779 gene locus_tag LOCUS_20560 391316 392779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 393315 392866 gene locus_tag LOCUS_20570 393315 392866 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902409.1 protein_id gnl|my_center|LOCUS_20570 394718 393489 gene locus_tag LOCUS_20580 394718 393489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 394855 396039 gene locus_tag LOCUS_20590 394855 396039 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902524.1 protein_id gnl|my_center|LOCUS_20590 396353 396766 gene locus_tag LOCUS_20600 gene fer2 396353 396766 CDS product ferredoxin Fer2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903707.1 protein_id gnl|my_center|LOCUS_20600 396904 397935 gene locus_tag LOCUS_20610 396904 397935 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289477.1 protein_id gnl|my_center|LOCUS_20610 398713 398249 gene locus_tag LOCUS_20620 gene lrp 398713 398249 CDS product HTH-type transcriptional regulator Lrp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903541.1 protein_id gnl|my_center|LOCUS_20620 398840 400195 gene locus_tag LOCUS_20630 gene glnA 398840 400195 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013060929.1 protein_id gnl|my_center|LOCUS_20630 400719 400240 gene locus_tag LOCUS_20640 400719 400240 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903120.1 protein_id gnl|my_center|LOCUS_20640 401835 400813 gene locus_tag LOCUS_20650 401835 400813 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289630.1 protein_id gnl|my_center|LOCUS_20650 401946 402740 gene locus_tag LOCUS_20660 401946 402740 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896244.1 protein_id gnl|my_center|LOCUS_20660 402847 403512 gene locus_tag LOCUS_20670 gene hisH 402847 403512 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903536.1 protein_id gnl|my_center|LOCUS_20670 403683 405227 gene locus_tag LOCUS_20680 403683 405227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 405334 405816 gene locus_tag LOCUS_20690 405334 405816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 406092 407549 gene locus_tag LOCUS_20700 406092 407549 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256148.1 protein_id gnl|my_center|LOCUS_20700 407539 408657 gene locus_tag LOCUS_20710 407539 408657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 408654 410144 gene locus_tag LOCUS_20720 408654 410144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 410529 410173 gene locus_tag LOCUS_20730 410529 410173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289430.1 protein_id gnl|my_center|LOCUS_20730 410646 411761 gene locus_tag LOCUS_20740 410646 411761 CDS product tRNA (guanine(26)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903537.1 protein_id gnl|my_center|LOCUS_20740 411855 413174 gene locus_tag LOCUS_20750 411855 413174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 414491 413193 gene locus_tag LOCUS_20760 414491 413193 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095727.1 protein_id gnl|my_center|LOCUS_20760 414788 415849 gene locus_tag LOCUS_20770 414788 415849 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267697.1 protein_id gnl|my_center|LOCUS_20770 417208 415916 gene locus_tag LOCUS_20780 417208 415916 CDS product TIGR00341 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289527.1 protein_id gnl|my_center|LOCUS_20780 417530 418876 gene locus_tag LOCUS_20790 417530 418876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 419378 418959 gene locus_tag LOCUS_20800 419378 418959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 420233 420562 gene locus_tag LOCUS_20810 420233 420562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 420701 421369 gene locus_tag LOCUS_20820 gene npdG 420701 421369 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903948.1 protein_id gnl|my_center|LOCUS_20820 421770 421468 gene locus_tag LOCUS_20830 gene trxA 421770 421468 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903943.1 protein_id gnl|my_center|LOCUS_20830 421900 422061 gene locus_tag LOCUS_20840 421900 422061 CDS product preprotein translocase subunit Sec61beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903942.1 protein_id gnl|my_center|LOCUS_20840 422437 422721 gene locus_tag LOCUS_20850 422437 422721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 423506 422772 gene locus_tag LOCUS_20860 423506 422772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 423735 423980 gene locus_tag LOCUS_20870 423735 423980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 425290 424031 gene locus_tag LOCUS_20880 gene prf1 425290 424031 CDS product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289438.1 protein_id gnl|my_center|LOCUS_20880 425370 426251 gene locus_tag LOCUS_20890 425370 426251 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903571.1 protein_id gnl|my_center|LOCUS_20890 426562 427086 gene locus_tag LOCUS_20900 426562 427086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 429008 427221 gene locus_tag LOCUS_20910 gene argS 429008 427221 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064797.1 protein_id gnl|my_center|LOCUS_20910 429788 429054 gene locus_tag LOCUS_20920 429788 429054 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903097.1 protein_id gnl|my_center|LOCUS_20920 429907 430284 gene locus_tag LOCUS_20930 429907 430284 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902731.1 protein_id gnl|my_center|LOCUS_20930 430320 431222 gene locus_tag LOCUS_20940 430320 431222 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404256.1 protein_id gnl|my_center|LOCUS_20940 432237 431242 gene locus_tag LOCUS_20950 432237 431242 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289444.1 protein_id gnl|my_center|LOCUS_20950 432541 434430 gene locus_tag LOCUS_20960 432541 434430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 434543 436414 gene locus_tag LOCUS_20970 434543 436414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 436608 437711 gene locus_tag LOCUS_20980 436608 437711 CDS product DUF373 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903593.1 protein_id gnl|my_center|LOCUS_20980 438585 437743 gene locus_tag LOCUS_20990 438585 437743 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903592.1 protein_id gnl|my_center|LOCUS_20990 439699 438746 gene locus_tag LOCUS_21000 439699 438746 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903590.1 protein_id gnl|my_center|LOCUS_21000 440487 439696 gene locus_tag LOCUS_21010 440487 439696 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903589.1 protein_id gnl|my_center|LOCUS_21010 440663 441124 gene locus_tag LOCUS_21020 440663 441124 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289446.1 protein_id gnl|my_center|LOCUS_21020 444518 441594 gene locus_tag LOCUS_21030 444518 441594 CDS product oligosaccharyl transferase, archaeosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902766.1 protein_id gnl|my_center|LOCUS_21030 444714 445673 gene locus_tag LOCUS_21040 gene aglG 444714 445673 CDS product glucosyl-dolichyl phosphate glucuronosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289272.1 protein_id gnl|my_center|LOCUS_21040 445741 446034 gene locus_tag LOCUS_21050 445741 446034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 446036 446272 gene locus_tag LOCUS_21060 446036 446272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 446410 447750 gene locus_tag LOCUS_21070 446410 447750 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049985681.1 protein_id gnl|my_center|LOCUS_21070 448134 448418 gene locus_tag LOCUS_21080 448134 448418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 448856 448608 gene locus_tag LOCUS_21090 448856 448608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 449247 448897 gene locus_tag LOCUS_21100 449247 448897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 449528 449244 gene locus_tag LOCUS_21110 449528 449244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 450483 449650 gene locus_tag LOCUS_21120 450483 449650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 450409 451395 gene locus_tag LOCUS_21130 450409 451395 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901996.1 protein_id gnl|my_center|LOCUS_21130 451491 452444 gene locus_tag LOCUS_21140 451491 452444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 452711 452559 gene locus_tag LOCUS_21150 452711 452559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 452985 453929 gene locus_tag LOCUS_21160 452985 453929 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902523.1 protein_id gnl|my_center|LOCUS_21160 455030 453924 gene locus_tag LOCUS_21170 455030 453924 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_21170 456272 455178 gene locus_tag LOCUS_21180 456272 455178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 456997 456299 gene locus_tag LOCUS_21190 456997 456299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 457624 457196 gene locus_tag LOCUS_21200 457624 457196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 >Feature sequence29 1569 388 gene locus_tag LOCUS_21210 1569 388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 1758 2969 gene locus_tag LOCUS_21220 1758 2969 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573847.1 protein_id gnl|my_center|LOCUS_21220 3300 3061 gene locus_tag LOCUS_21230 3300 3061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 3826 3569 gene locus_tag LOCUS_21240 3826 3569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 4390 3860 gene locus_tag LOCUS_21250 4390 3860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 4494 5345 gene locus_tag LOCUS_21260 4494 5345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 5738 5523 gene locus_tag LOCUS_21270 5738 5523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 6520 5963 gene locus_tag LOCUS_21280 6520 5963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 6780 8738 gene locus_tag LOCUS_21290 6780 8738 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903521.1 protein_id gnl|my_center|LOCUS_21290 9296 9586 gene locus_tag LOCUS_21300 9296 9586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 9790 10782 gene locus_tag LOCUS_21310 9790 10782 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582705.1 protein_id gnl|my_center|LOCUS_21310 10856 11410 gene locus_tag LOCUS_21320 10856 11410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 11411 12907 gene locus_tag LOCUS_21330 11411 12907 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903081.1 protein_id gnl|my_center|LOCUS_21330 12958 14049 gene locus_tag LOCUS_21340 12958 14049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 15240 14080 gene locus_tag LOCUS_21350 15240 14080 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087142.1 protein_id gnl|my_center|LOCUS_21350 15384 15647 gene locus_tag LOCUS_21360 15384 15647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 16694 15678 gene locus_tag LOCUS_21370 16694 15678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 16987 18210 gene locus_tag LOCUS_21380 16987 18210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 20307 18268 gene locus_tag LOCUS_21390 20307 18268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 22354 20750 gene locus_tag LOCUS_21400 22354 20750 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005575582.1 protein_id gnl|my_center|LOCUS_21400 23444 22521 gene locus_tag LOCUS_21410 23444 22521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 25064 23556 gene locus_tag LOCUS_21420 25064 23556 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878099.1 protein_id gnl|my_center|LOCUS_21420 25237 26160 gene locus_tag LOCUS_21430 25237 26160 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249955.1 protein_id gnl|my_center|LOCUS_21430 27561 26200 gene locus_tag LOCUS_21440 27561 26200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 28634 27558 gene locus_tag LOCUS_21450 28634 27558 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020209.1 protein_id gnl|my_center|LOCUS_21450 28834 29121 gene locus_tag LOCUS_21460 28834 29121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 29102 29509 gene locus_tag LOCUS_21470 29102 29509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 31415 29610 gene locus_tag LOCUS_21480 gene infB 31415 29610 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903469.1 protein_id gnl|my_center|LOCUS_21480 31611 31856 gene locus_tag LOCUS_21490 31611 31856 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903468.1 protein_id gnl|my_center|LOCUS_21490 31861 32319 gene locus_tag LOCUS_21500 31861 32319 CDS product NOB1 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289414.1 protein_id gnl|my_center|LOCUS_21500 33513 32359 gene locus_tag LOCUS_21510 33513 32359 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903466.1 protein_id gnl|my_center|LOCUS_21510 34872 33568 gene locus_tag LOCUS_21520 34872 33568 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903465.1 protein_id gnl|my_center|LOCUS_21520 35064 35537 gene locus_tag LOCUS_21530 35064 35537 CDS product DUF5812 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903463.1 protein_id gnl|my_center|LOCUS_21530 36000 35584 gene locus_tag LOCUS_21540 36000 35584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 36107 37015 gene locus_tag LOCUS_21550 gene secF 36107 37015 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903462.1 protein_id gnl|my_center|LOCUS_21550 37015 38646 gene locus_tag LOCUS_21560 37015 38646 CDS product preprotein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903461.1 protein_id gnl|my_center|LOCUS_21560 39576 38725 gene locus_tag LOCUS_21570 39576 38725 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404555.1 protein_id gnl|my_center|LOCUS_21570 40585 39914 gene locus_tag LOCUS_21580 gene rnhB 40585 39914 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903458.1 protein_id gnl|my_center|LOCUS_21580 41191 40643 gene locus_tag LOCUS_21590 41191 40643 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187509681.1 protein_id gnl|my_center|LOCUS_21590 42610 41276 gene locus_tag LOCUS_21600 42610 41276 CDS product tRNA pseudouridine(54/55) synthase Pus10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903457.1 protein_id gnl|my_center|LOCUS_21600 43255 42668 gene locus_tag LOCUS_21610 43255 42668 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902159.1 protein_id gnl|my_center|LOCUS_21610 43775 43257 gene locus_tag LOCUS_21620 43775 43257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902158.1 protein_id gnl|my_center|LOCUS_21620 45022 43886 gene locus_tag LOCUS_21630 45022 43886 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902157.1 protein_id gnl|my_center|LOCUS_21630 45169 45339 gene locus_tag LOCUS_21640 45169 45339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 46558 45377 gene locus_tag LOCUS_21650 46558 45377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 47514 46627 gene locus_tag LOCUS_21660 47514 46627 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902154.1 protein_id gnl|my_center|LOCUS_21660 47667 47894 gene locus_tag LOCUS_21670 47667 47894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 47881 48291 gene locus_tag LOCUS_21680 47881 48291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 48776 48312 gene locus_tag LOCUS_21690 48776 48312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 48924 50018 gene locus_tag LOCUS_21700 48924 50018 CDS product tubulin/FtsZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902152.1 protein_id gnl|my_center|LOCUS_21700 50566 51447 gene locus_tag LOCUS_21710 50566 51447 CDS product coiled-coil protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902245.1 protein_id gnl|my_center|LOCUS_21710 51625 52620 gene locus_tag LOCUS_21720 51625 52620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 52750 54030 gene locus_tag LOCUS_21730 52750 54030 CDS product DUF373 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902244.1 protein_id gnl|my_center|LOCUS_21730 54081 54809 gene locus_tag LOCUS_21740 54081 54809 CDS product diphthine--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902243.1 protein_id gnl|my_center|LOCUS_21740 55014 54838 gene locus_tag LOCUS_21750 55014 54838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 55180 56244 gene locus_tag LOCUS_21760 55180 56244 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048096340.1 protein_id gnl|my_center|LOCUS_21760 57415 56447 gene locus_tag LOCUS_21770 57415 56447 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902937.1 protein_id gnl|my_center|LOCUS_21770 57504 58082 gene locus_tag LOCUS_21780 gene cyaB 57504 58082 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902939.1 protein_id gnl|my_center|LOCUS_21780 58208 59413 gene locus_tag LOCUS_21790 58208 59413 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902940.1 protein_id gnl|my_center|LOCUS_21790 60192 59500 gene locus_tag LOCUS_21800 60192 59500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 61708 60326 gene locus_tag LOCUS_21810 61708 60326 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903048.1 protein_id gnl|my_center|LOCUS_21810 61868 63046 gene locus_tag LOCUS_21820 61868 63046 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902941.1 protein_id gnl|my_center|LOCUS_21820 63137 63754 gene locus_tag LOCUS_21830 63137 63754 CDS product DUF5804 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289303.1 protein_id gnl|my_center|LOCUS_21830 63963 63763 gene locus_tag LOCUS_21840 63963 63763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 64061 65539 gene locus_tag LOCUS_21850 64061 65539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 65625 65990 gene locus_tag LOCUS_21860 65625 65990 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903966.1 protein_id gnl|my_center|LOCUS_21860 66130 66681 gene locus_tag LOCUS_21870 66130 66681 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136361009.1 protein_id gnl|my_center|LOCUS_21870 66678 67625 gene locus_tag LOCUS_21880 66678 67625 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903987.1 protein_id gnl|my_center|LOCUS_21880 67692 69416 gene locus_tag LOCUS_21890 67692 69416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 69505 71190 gene locus_tag LOCUS_21900 69505 71190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 71379 72641 gene locus_tag LOCUS_21910 gene tuf 71379 72641 CDS product translation elongation factor EF-1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903986.1 protein_id gnl|my_center|LOCUS_21910 72642 72950 gene locus_tag LOCUS_21920 gene rpsJ 72642 72950 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903985.1 protein_id gnl|my_center|LOCUS_21920 73072 73722 gene locus_tag LOCUS_21930 73072 73722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 73952 73737 gene locus_tag LOCUS_21940 73952 73737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 74013 74084 gene locus_tag LOCUS_t00340 74013 74084 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 74374 74646 gene locus_tag LOCUS_21950 74374 74646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 75103 74762 gene locus_tag LOCUS_21960 75103 74762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 75846 76163 gene locus_tag LOCUS_21970 75846 76163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 76686 78248 gene locus_tag LOCUS_21980 76686 78248 CDS product DUF790 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890489.1 protein_id gnl|my_center|LOCUS_21980 79065 78328 gene locus_tag LOCUS_21990 79065 78328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 80503 79163 gene locus_tag LOCUS_22000 80503 79163 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903796.1 protein_id gnl|my_center|LOCUS_22000 80689 81660 gene locus_tag LOCUS_22010 gene mdh 80689 81660 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903765.1 protein_id gnl|my_center|LOCUS_22010 82258 81677 gene locus_tag LOCUS_22020 82258 81677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902326.1 protein_id gnl|my_center|LOCUS_22020 83166 82258 gene locus_tag LOCUS_22030 83166 82258 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902327.1 protein_id gnl|my_center|LOCUS_22030 83323 84057 gene locus_tag LOCUS_22040 83323 84057 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902328.1 protein_id gnl|my_center|LOCUS_22040 84173 85549 gene locus_tag LOCUS_22050 84173 85549 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902279.1 protein_id gnl|my_center|LOCUS_22050 85635 87071 gene locus_tag LOCUS_22060 85635 87071 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112543.1 protein_id gnl|my_center|LOCUS_22060 87161 88006 gene locus_tag LOCUS_22070 87161 88006 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289160.1 protein_id gnl|my_center|LOCUS_22070 88074 88826 gene locus_tag LOCUS_22080 88074 88826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 88927 89118 gene locus_tag LOCUS_22090 88927 89118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 90116 89145 gene locus_tag LOCUS_22100 90116 89145 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902295.1 protein_id gnl|my_center|LOCUS_22100 91451 90342 gene locus_tag LOCUS_22110 gene wecB 91451 90342 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582948.1 protein_id gnl|my_center|LOCUS_22110 92191 91799 gene locus_tag LOCUS_22120 92191 91799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 92870 92289 gene locus_tag LOCUS_22130 92870 92289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 93496 93152 gene locus_tag LOCUS_22140 93496 93152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 93900 93571 gene locus_tag LOCUS_22150 93900 93571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 95133 94042 gene locus_tag LOCUS_22160 95133 94042 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902811.1 protein_id gnl|my_center|LOCUS_22160 95579 95259 gene locus_tag LOCUS_22170 95579 95259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 96937 95576 gene locus_tag LOCUS_22180 gene nrfD 96937 95576 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902582.1 protein_id gnl|my_center|LOCUS_22180 98556 96934 gene locus_tag LOCUS_22190 98556 96934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 99410 98730 gene locus_tag LOCUS_22200 99410 98730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 99546 99773 gene locus_tag LOCUS_22210 99546 99773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 99827 100060 gene locus_tag LOCUS_22220 99827 100060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 100133 100402 gene locus_tag LOCUS_22230 100133 100402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 101338 100445 gene locus_tag LOCUS_22240 101338 100445 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889174.1 protein_id gnl|my_center|LOCUS_22240 101510 102601 gene locus_tag LOCUS_22250 gene nirK 101510 102601 CDS product copper-containing nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225006.1 protein_id gnl|my_center|LOCUS_22250 102697 103338 gene locus_tag LOCUS_22260 102697 103338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 105527 104547 gene locus_tag LOCUS_22270 105527 104547 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902188.1 protein_id gnl|my_center|LOCUS_22270 106067 106345 gene locus_tag LOCUS_22280 gene gatC 106067 106345 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289242.1 protein_id gnl|my_center|LOCUS_22280 106347 107627 gene locus_tag LOCUS_22290 gene gatA 106347 107627 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902611.1 protein_id gnl|my_center|LOCUS_22290 107734 108144 gene locus_tag LOCUS_22300 107734 108144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 108544 108194 gene locus_tag LOCUS_22310 108544 108194 CDS product transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902769.1 protein_id gnl|my_center|LOCUS_22310 109387 108617 gene locus_tag LOCUS_22320 109387 108617 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328055.1 protein_id gnl|my_center|LOCUS_22320 111031 109451 gene locus_tag LOCUS_22330 111031 109451 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902770.1 protein_id gnl|my_center|LOCUS_22330 112140 111028 gene locus_tag LOCUS_22340 112140 111028 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289275.1 protein_id gnl|my_center|LOCUS_22340 113084 112137 gene locus_tag LOCUS_22350 113084 112137 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902772.1 protein_id gnl|my_center|LOCUS_22350 113957 113178 gene locus_tag LOCUS_22360 113957 113178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 115330 113954 gene locus_tag LOCUS_22370 115330 113954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 116667 115357 gene locus_tag LOCUS_22380 116667 115357 CDS product Tat pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902557.1 protein_id gnl|my_center|LOCUS_22380 117781 116888 gene locus_tag LOCUS_22390 117781 116888 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902774.1 protein_id gnl|my_center|LOCUS_22390 117925 118686 gene locus_tag LOCUS_22400 117925 118686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 118803 120302 gene locus_tag LOCUS_22410 gene crtD 118803 120302 CDS product C-3',4' desaturase CrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142868.1 protein_id gnl|my_center|LOCUS_22410 120695 121654 gene locus_tag LOCUS_22420 120695 121654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 123516 121672 gene locus_tag LOCUS_22430 gene menD 123516 121672 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902775.1 protein_id gnl|my_center|LOCUS_22430 124868 123513 gene locus_tag LOCUS_22440 124868 123513 CDS product isochorismate synthase MenF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902776.1 protein_id gnl|my_center|LOCUS_22440 125542 124901 gene locus_tag LOCUS_22450 125542 124901 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902777.1 protein_id gnl|my_center|LOCUS_22450 126007 126306 gene locus_tag LOCUS_22460 126007 126306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 126455 126685 gene locus_tag LOCUS_22470 126455 126685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902778.1 protein_id gnl|my_center|LOCUS_22470 126875 126693 gene locus_tag LOCUS_22480 126875 126693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 127013 127765 gene locus_tag LOCUS_22490 127013 127765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 127762 129126 gene locus_tag LOCUS_22500 127762 129126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 129189 130025 gene locus_tag LOCUS_22510 gene hisF 129189 130025 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902602.1 protein_id gnl|my_center|LOCUS_22510 130127 130960 gene locus_tag LOCUS_22520 130127 130960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 131240 131398 gene locus_tag LOCUS_22530 131240 131398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 131622 132407 gene locus_tag LOCUS_22540 131622 132407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 132449 132925 gene locus_tag LOCUS_22550 132449 132925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 133165 134115 gene locus_tag LOCUS_22560 133165 134115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 134415 134131 gene locus_tag LOCUS_22570 134415 134131 CDS product DNA-directed RNA polymerase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902601.1 protein_id gnl|my_center|LOCUS_22570 134581 136437 gene locus_tag LOCUS_22580 134581 136437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 136815 137579 gene locus_tag LOCUS_22590 136815 137579 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029799.1 protein_id gnl|my_center|LOCUS_22590 137569 138825 gene locus_tag LOCUS_22600 137569 138825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 138822 140048 gene locus_tag LOCUS_22610 138822 140048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 140734 140102 gene locus_tag LOCUS_22620 140734 140102 CDS product METTL5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902599.1 protein_id gnl|my_center|LOCUS_22620 140941 141111 gene locus_tag LOCUS_22630 140941 141111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 142207 141185 gene locus_tag LOCUS_22640 142207 141185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 143210 142305 gene locus_tag LOCUS_22650 143210 142305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 143367 144416 gene locus_tag LOCUS_22660 gene dph2 143367 144416 CDS product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902598.1 protein_id gnl|my_center|LOCUS_22660 144745 145365 gene locus_tag LOCUS_22670 144745 145365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 145398 146228 gene locus_tag LOCUS_22680 145398 146228 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892496.1 protein_id gnl|my_center|LOCUS_22680 146309 148609 gene locus_tag LOCUS_22690 146309 148609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 148878 149813 gene locus_tag LOCUS_22700 148878 149813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902593.1 protein_id gnl|my_center|LOCUS_22700 150543 149821 gene locus_tag LOCUS_22710 150543 149821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 150613 150978 gene locus_tag LOCUS_22720 150613 150978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 152250 151204 gene locus_tag LOCUS_22730 152250 151204 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902588.1 protein_id gnl|my_center|LOCUS_22730 152632 152240 gene locus_tag LOCUS_22740 152632 152240 CDS product DUF5805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289235.1 protein_id gnl|my_center|LOCUS_22740 153745 152867 gene locus_tag LOCUS_22750 153745 152867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 >Feature sequence30 407 706 gene locus_tag LOCUS_22760 407 706 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890479.1 protein_id gnl|my_center|LOCUS_22760 1204 887 gene locus_tag LOCUS_22770 1204 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 1358 1738 gene locus_tag LOCUS_22780 1358 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 2001 1774 gene locus_tag LOCUS_22790 2001 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 3030 5303 gene locus_tag LOCUS_22800 3030 5303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 6453 5338 gene locus_tag LOCUS_22810 6453 5338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 6575 7333 gene locus_tag LOCUS_22820 6575 7333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070807669.1 protein_id gnl|my_center|LOCUS_22820 9119 7476 gene locus_tag LOCUS_22830 9119 7476 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056105.1 protein_id gnl|my_center|LOCUS_22830 9784 9119 gene locus_tag LOCUS_22840 9784 9119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 11123 9858 gene locus_tag LOCUS_22850 11123 9858 CDS product DNA double-strand break repair nuclease NurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056882.1 protein_id gnl|my_center|LOCUS_22850 13834 11123 gene locus_tag LOCUS_22860 13834 11123 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055983.1 protein_id gnl|my_center|LOCUS_22860 15348 13831 gene locus_tag LOCUS_22870 15348 13831 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055915.1 protein_id gnl|my_center|LOCUS_22870 15567 20630 gene locus_tag LOCUS_22880 15567 20630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 21911 20664 gene locus_tag LOCUS_22890 21911 20664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 22266 22688 gene locus_tag LOCUS_22900 22266 22688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 25876 23336 gene locus_tag LOCUS_22910 25876 23336 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776588.1 protein_id gnl|my_center|LOCUS_22910 26218 26838 gene locus_tag LOCUS_22920 26218 26838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 27458 27844 gene locus_tag LOCUS_22930 27458 27844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 27841 28149 gene locus_tag LOCUS_22940 27841 28149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 29038 28262 gene locus_tag LOCUS_22950 29038 28262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 >Feature sequence31 1141 2955 gene locus_tag LOCUS_22960 gene glmS 1141 2955 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901947.1 protein_id gnl|my_center|LOCUS_22960 4468 3359 gene locus_tag LOCUS_22970 4468 3359 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901949.1 protein_id gnl|my_center|LOCUS_22970 5384 5665 gene locus_tag LOCUS_22980 5384 5665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 6703 5693 gene locus_tag LOCUS_22990 6703 5693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 8331 6700 gene locus_tag LOCUS_23000 8331 6700 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005575582.1 protein_id gnl|my_center|LOCUS_23000 8597 9730 gene locus_tag LOCUS_23010 8597 9730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 11663 9825 gene locus_tag LOCUS_23020 11663 9825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 12146 13390 gene locus_tag LOCUS_23030 12146 13390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 13585 15336 gene locus_tag LOCUS_23040 13585 15336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 15387 15839 gene locus_tag LOCUS_23050 15387 15839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 15991 16530 gene locus_tag LOCUS_23060 15991 16530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 16527 16790 gene locus_tag LOCUS_23070 16527 16790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 16827 17279 gene locus_tag LOCUS_23080 16827 17279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 17949 17317 gene locus_tag LOCUS_23090 17949 17317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 20222 18057 gene locus_tag LOCUS_23100 20222 18057 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941639.1 protein_id gnl|my_center|LOCUS_23100 20342 21706 gene locus_tag LOCUS_23110 20342 21706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 21712 22749 gene locus_tag LOCUS_23120 21712 22749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 22759 24051 gene locus_tag LOCUS_23130 22759 24051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 24300 25004 gene locus_tag LOCUS_23140 24300 25004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 25078 26088 gene locus_tag LOCUS_23150 25078 26088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 26092 27102 gene locus_tag LOCUS_23160 26092 27102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 27266 28273 gene locus_tag LOCUS_23170 27266 28273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 28276 29310 gene locus_tag LOCUS_23180 28276 29310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 29319 29867 gene locus_tag LOCUS_23190 29319 29867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 32197 29924 gene locus_tag LOCUS_23200 32197 29924 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903073.1 protein_id gnl|my_center|LOCUS_23200 32712 33836 gene locus_tag LOCUS_23210 32712 33836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 38812 39105 gene locus_tag LOCUS_23220 38812 39105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 39102 39770 gene locus_tag LOCUS_23230 39102 39770 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941648.1 protein_id gnl|my_center|LOCUS_23230 39843 40868 gene locus_tag LOCUS_23240 39843 40868 CDS product phage late control D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941649.1 protein_id gnl|my_center|LOCUS_23240 40865 41611 gene locus_tag LOCUS_23250 40865 41611 CDS product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941650.1 protein_id gnl|my_center|LOCUS_23250 41880 42305 gene locus_tag LOCUS_23260 41880 42305 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941652.1 protein_id gnl|my_center|LOCUS_23260 42426 45608 gene locus_tag LOCUS_23270 42426 45608 CDS product putative baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941653.1 protein_id gnl|my_center|LOCUS_23270 45608 47548 gene locus_tag LOCUS_23280 45608 47548 CDS product putative baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226664.1 protein_id gnl|my_center|LOCUS_23280 47551 49692 gene locus_tag LOCUS_23290 47551 49692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 51750 49849 gene locus_tag LOCUS_23300 51750 49849 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289321.1 protein_id gnl|my_center|LOCUS_23300 51882 53624 gene locus_tag LOCUS_23310 51882 53624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 53740 53916 gene locus_tag LOCUS_23320 53740 53916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 54901 53948 gene locus_tag LOCUS_23330 54901 53948 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902144.1 protein_id gnl|my_center|LOCUS_23330 55667 56266 gene locus_tag LOCUS_23340 55667 56266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 58274 56508 gene locus_tag LOCUS_23350 58274 56508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 59549 58611 gene locus_tag LOCUS_23360 59549 58611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 59950 60387 gene locus_tag LOCUS_23370 59950 60387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 61603 60416 gene locus_tag LOCUS_23380 61603 60416 CDS product 3-dehydroquinate synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902185.1 protein_id gnl|my_center|LOCUS_23380 61764 62348 gene locus_tag LOCUS_23390 61764 62348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 62470 63879 gene locus_tag LOCUS_23400 62470 63879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 64710 63892 gene locus_tag LOCUS_23410 64710 63892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 65056 64766 gene locus_tag LOCUS_23420 65056 64766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 65153 65830 gene locus_tag LOCUS_23430 gene yjjG 65153 65830 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978805.1 protein_id gnl|my_center|LOCUS_23430 66209 65862 gene locus_tag LOCUS_23440 66209 65862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 67297 66338 gene locus_tag LOCUS_23450 67297 66338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 69493 67298 gene locus_tag LOCUS_23460 gene lonB 69493 67298 CDS product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902178.1 protein_id gnl|my_center|LOCUS_23460 69778 70296 gene locus_tag LOCUS_23470 69778 70296 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902177.1 protein_id gnl|my_center|LOCUS_23470 70410 71237 gene locus_tag LOCUS_23480 70410 71237 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289134.1 protein_id gnl|my_center|LOCUS_23480 71671 71312 gene locus_tag LOCUS_23490 71671 71312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 73431 71854 gene locus_tag LOCUS_23500 gene thsA 73431 71854 CDS product thermosome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892611.1 protein_id gnl|my_center|LOCUS_23500 73588 74418 gene locus_tag LOCUS_23510 73588 74418 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902174.1 protein_id gnl|my_center|LOCUS_23510 >Feature sequence32 454 104 gene locus_tag LOCUS_23520 454 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 1998 1741 gene locus_tag LOCUS_23530 1998 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 3638 2223 gene locus_tag LOCUS_23540 3638 2223 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902984.1 protein_id gnl|my_center|LOCUS_23540 5422 3740 gene locus_tag LOCUS_23550 5422 3740 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902982.1 protein_id gnl|my_center|LOCUS_23550 5912 5451 gene locus_tag LOCUS_23560 5912 5451 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902983.1 protein_id gnl|my_center|LOCUS_23560 6276 6025 gene locus_tag LOCUS_23570 6276 6025 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902985.1 protein_id gnl|my_center|LOCUS_23570 6459 6899 gene locus_tag LOCUS_23580 6459 6899 CDS product DUF2178 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902306.1 protein_id gnl|my_center|LOCUS_23580 6896 7105 gene locus_tag LOCUS_23590 6896 7105 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902305.1 protein_id gnl|my_center|LOCUS_23590 7302 7802 gene locus_tag LOCUS_23600 7302 7802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 8135 9652 gene locus_tag LOCUS_23610 gene cysS 8135 9652 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902789.1 protein_id gnl|my_center|LOCUS_23610 9819 10502 gene locus_tag LOCUS_23620 9819 10502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 11081 10524 gene locus_tag LOCUS_23630 11081 10524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 12244 11204 gene locus_tag LOCUS_23640 12244 11204 CDS product presenilin family intramembrane aspartyl protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902990.1 protein_id gnl|my_center|LOCUS_23640 12622 12371 gene locus_tag LOCUS_23650 12622 12371 CDS product H/ACA ribonucleoprotein complex subunit GAR1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902991.1 protein_id gnl|my_center|LOCUS_23650 12903 12622 gene locus_tag LOCUS_23660 gene srp19 12903 12622 CDS product signal recognition particle subunit SRP19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902992.1 protein_id gnl|my_center|LOCUS_23660 14243 12990 gene locus_tag LOCUS_23670 14243 12990 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002391812.1 protein_id gnl|my_center|LOCUS_23670 14304 15404 gene locus_tag LOCUS_23680 gene btuC 14304 15404 CDS product vitamin B12 ABC transporter permease BtuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902994.1 protein_id gnl|my_center|LOCUS_23680 15401 16909 gene locus_tag LOCUS_23690 15401 16909 CDS product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902995.1 protein_id gnl|my_center|LOCUS_23690 17164 17892 gene locus_tag LOCUS_23700 17164 17892 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289098.1 protein_id gnl|my_center|LOCUS_23700 17889 18587 gene locus_tag LOCUS_23710 17889 18587 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020355.1 protein_id gnl|my_center|LOCUS_23710 18693 20579 gene locus_tag LOCUS_23720 gene gatE 18693 20579 CDS product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902981.1 protein_id gnl|my_center|LOCUS_23720 20680 21336 gene locus_tag LOCUS_23730 20680 21336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 21508 22773 gene locus_tag LOCUS_23740 21508 22773 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289252.1 protein_id gnl|my_center|LOCUS_23740 22794 23615 gene locus_tag LOCUS_23750 22794 23615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 24275 23616 gene locus_tag LOCUS_23760 24275 23616 CDS product TrmJ/YjtD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289315.1 protein_id gnl|my_center|LOCUS_23760 25411 24716 gene locus_tag LOCUS_23770 25411 24716 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478741.1 protein_id gnl|my_center|LOCUS_23770 26099 27358 gene locus_tag LOCUS_23780 gene orc4 26099 27358 CDS product DNA replication protein Orc4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006183330.1 protein_id gnl|my_center|LOCUS_23780 27504 28664 gene locus_tag LOCUS_23790 27504 28664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 28737 29930 gene locus_tag LOCUS_23800 28737 29930 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289314.1 protein_id gnl|my_center|LOCUS_23800 30145 30843 gene locus_tag LOCUS_23810 30145 30843 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902974.1 protein_id gnl|my_center|LOCUS_23810 31194 31003 gene locus_tag LOCUS_23820 31194 31003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 32513 31353 gene locus_tag LOCUS_23830 32513 31353 CDS product tubulin/FtsZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289408.1 protein_id gnl|my_center|LOCUS_23830 32862 34604 gene locus_tag LOCUS_23840 32862 34604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 34735 35652 gene locus_tag LOCUS_23850 34735 35652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 35794 37206 gene locus_tag LOCUS_23860 35794 37206 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289312.1 protein_id gnl|my_center|LOCUS_23860 37354 37683 gene locus_tag LOCUS_23870 37354 37683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 38675 37707 gene locus_tag LOCUS_23880 38675 37707 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690405.1 protein_id gnl|my_center|LOCUS_23880 38711 38920 gene locus_tag LOCUS_23890 38711 38920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 40311 39238 gene locus_tag LOCUS_23900 40311 39238 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776452.1 protein_id gnl|my_center|LOCUS_23900 41609 40428 gene locus_tag LOCUS_23910 gene ugpC 41609 40428 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583259.1 protein_id gnl|my_center|LOCUS_23910 42679 41612 gene locus_tag LOCUS_23920 42679 41612 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314872.1 protein_id gnl|my_center|LOCUS_23920 43728 42679 gene locus_tag LOCUS_23930 43728 42679 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013848.1 protein_id gnl|my_center|LOCUS_23930 45163 43718 gene locus_tag LOCUS_23940 45163 43718 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401256.1 protein_id gnl|my_center|LOCUS_23940 46489 45416 gene locus_tag LOCUS_23950 gene trmB 46489 45416 CDS product transcriptional regulator TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892507.1 protein_id gnl|my_center|LOCUS_23950 46684 47673 gene locus_tag LOCUS_23960 46684 47673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 47772 48203 gene locus_tag LOCUS_23970 47772 48203 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903120.1 protein_id gnl|my_center|LOCUS_23970 48647 48237 gene locus_tag LOCUS_23980 48647 48237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 48779 49033 gene locus_tag LOCUS_23990 48779 49033 CDS product DUF5816 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903052.1 protein_id gnl|my_center|LOCUS_23990 49113 49436 gene locus_tag LOCUS_24000 49113 49436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 50685 49480 gene locus_tag LOCUS_24010 50685 49480 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481009.1 protein_id gnl|my_center|LOCUS_24010 50867 51067 gene locus_tag LOCUS_24020 50867 51067 CDS product dodecin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289329.1 protein_id gnl|my_center|LOCUS_24020 51869 51381 gene locus_tag LOCUS_24030 51869 51381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 53312 52029 gene locus_tag LOCUS_24040 gene hisD 53312 52029 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903049.1 protein_id gnl|my_center|LOCUS_24040 53571 53350 gene locus_tag LOCUS_24050 53571 53350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 53756 54448 gene locus_tag LOCUS_24060 53756 54448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902457.1 protein_id gnl|my_center|LOCUS_24060 >Feature sequence33 144 548 gene locus_tag LOCUS_24070 144 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24070 584 1210 gene locus_tag LOCUS_24080 584 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24080 >Feature sequence34 705 427 gene locus_tag LOCUS_24090 705 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 2007 1117 gene locus_tag LOCUS_24100 2007 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 3069 2146 gene locus_tag LOCUS_24110 3069 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 3931 3272 gene locus_tag LOCUS_24120 3931 3272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 4191 3931 gene locus_tag LOCUS_24130 4191 3931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 4390 4686 gene locus_tag LOCUS_24140 4390 4686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 4951 6567 gene locus_tag LOCUS_24150 4951 6567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 6868 7575 gene locus_tag LOCUS_24160 6868 7575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 7579 9822 gene locus_tag LOCUS_24170 gene hel308 7579 9822 CDS product ATP-dependent DNA helicase Hel308 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876445.1 protein_id gnl|my_center|LOCUS_24170 10579 9833 gene locus_tag LOCUS_24180 10579 9833 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070739.1 protein_id gnl|my_center|LOCUS_24180 13548 10576 gene locus_tag LOCUS_24190 13548 10576 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087773.1 protein_id gnl|my_center|LOCUS_24190 14874 13552 gene locus_tag LOCUS_24200 14874 13552 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083500625.1 protein_id gnl|my_center|LOCUS_24200 15389 14871 gene locus_tag LOCUS_24210 15389 14871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 >Feature sequence35 950 81 gene locus_tag LOCUS_24220 gene surE 950 81 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902899.1 protein_id gnl|my_center|LOCUS_24220 1183 2088 gene locus_tag LOCUS_24230 1183 2088 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902489.1 protein_id gnl|my_center|LOCUS_24230 4547 2904 gene locus_tag LOCUS_24240 4547 2904 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088826.1 protein_id gnl|my_center|LOCUS_24240 5367 4819 gene locus_tag LOCUS_24250 5367 4819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 5551 6672 gene locus_tag LOCUS_24260 5551 6672 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228615.1 protein_id gnl|my_center|LOCUS_24260 6771 7022 gene locus_tag LOCUS_24270 6771 7022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 7089 7232 gene locus_tag LOCUS_24280 7089 7232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 8348 7296 gene locus_tag LOCUS_24290 gene yesR 8348 7296 CDS product rhamnogalacturonyl hydrolase YesR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243366.1 protein_id gnl|my_center|LOCUS_24290 8687 8505 gene locus_tag LOCUS_24300 8687 8505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 8704 9501 gene locus_tag LOCUS_24310 8704 9501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 10324 10593 gene locus_tag LOCUS_24320 10324 10593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 11117 12190 gene locus_tag LOCUS_24330 11117 12190 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902635.1 protein_id gnl|my_center|LOCUS_24330 12243 13829 gene locus_tag LOCUS_24340 12243 13829 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902634.1 protein_id gnl|my_center|LOCUS_24340 13822 14955 gene locus_tag LOCUS_24350 13822 14955 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902633.1 protein_id gnl|my_center|LOCUS_24350 14952 15965 gene locus_tag LOCUS_24360 14952 15965 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902632.1 protein_id gnl|my_center|LOCUS_24360 16196 17164 gene locus_tag LOCUS_24370 16196 17164 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690405.1 protein_id gnl|my_center|LOCUS_24370 17242 18360 gene locus_tag LOCUS_24380 17242 18360 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050459751.1 protein_id gnl|my_center|LOCUS_24380 18879 18436 gene locus_tag LOCUS_24390 18879 18436 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903209.1 protein_id gnl|my_center|LOCUS_24390 18973 20913 gene locus_tag LOCUS_24400 18973 20913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 20910 21665 gene locus_tag LOCUS_24410 20910 21665 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902476.1 protein_id gnl|my_center|LOCUS_24410 21668 22534 gene locus_tag LOCUS_24420 21668 22534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 22567 23265 gene locus_tag LOCUS_24430 22567 23265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 23886 23302 gene locus_tag LOCUS_24440 23886 23302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 24035 24709 gene locus_tag LOCUS_24450 24035 24709 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902066.1 protein_id gnl|my_center|LOCUS_24450 24706 25557 gene locus_tag LOCUS_24460 24706 25557 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070807659.1 protein_id gnl|my_center|LOCUS_24460 25670 27580 gene locus_tag LOCUS_24470 25670 27580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 27871 28926 gene locus_tag LOCUS_24480 27871 28926 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815914.1 protein_id gnl|my_center|LOCUS_24480 28933 29811 gene locus_tag LOCUS_24490 28933 29811 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191802.1 protein_id gnl|my_center|LOCUS_24490 29804 30631 gene locus_tag LOCUS_24500 29804 30631 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815918.1 protein_id gnl|my_center|LOCUS_24500 30631 31653 gene locus_tag LOCUS_24510 30631 31653 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398424.1 protein_id gnl|my_center|LOCUS_24510 32220 33338 gene locus_tag LOCUS_24520 32220 33338 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731336.1 protein_id gnl|my_center|LOCUS_24520 33402 34262 gene locus_tag LOCUS_24530 33402 34262 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191802.1 protein_id gnl|my_center|LOCUS_24530 34269 35183 gene locus_tag LOCUS_24540 34269 35183 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903367.1 protein_id gnl|my_center|LOCUS_24540 35269 36312 gene locus_tag LOCUS_24550 35269 36312 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761838.1 protein_id gnl|my_center|LOCUS_24550 37115 36621 gene locus_tag LOCUS_24560 37115 36621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 37381 37112 gene locus_tag LOCUS_24570 37381 37112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 38502 37810 gene locus_tag LOCUS_24580 38502 37810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 39111 38533 gene locus_tag LOCUS_24590 39111 38533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 40135 39230 gene locus_tag LOCUS_24600 40135 39230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 41323 40142 gene locus_tag LOCUS_24610 gene arsB 41323 40142 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826560.1 protein_id gnl|my_center|LOCUS_24610 41827 41408 gene locus_tag LOCUS_24620 41827 41408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 42129 42220 gene locus_tag LOCUS_t00350 42129 42220 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 42995 42711 gene locus_tag LOCUS_24630 42995 42711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 44291 43773 gene locus_tag LOCUS_24640 44291 43773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 44995 45741 gene locus_tag LOCUS_24650 44995 45741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 45748 45891 gene locus_tag LOCUS_24660 45748 45891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 47557 46082 gene locus_tag LOCUS_24670 47557 46082 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222413.1 protein_id gnl|my_center|LOCUS_24670 48503 47799 gene locus_tag LOCUS_24680 48503 47799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 49083 48613 gene locus_tag LOCUS_24690 49083 48613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 49208 49735 gene locus_tag LOCUS_24700 49208 49735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 50412 49732 gene locus_tag LOCUS_24710 50412 49732 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024137.1 protein_id gnl|my_center|LOCUS_24710 50469 51209 gene locus_tag LOCUS_24720 50469 51209 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021446.1 protein_id gnl|my_center|LOCUS_24720 51206 51883 gene locus_tag LOCUS_24730 51206 51883 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065118.1 protein_id gnl|my_center|LOCUS_24730 54262 51920 gene locus_tag LOCUS_24740 54262 51920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 54729 54259 gene locus_tag LOCUS_24750 54729 54259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 56077 54806 gene locus_tag LOCUS_24760 56077 54806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 56414 57118 gene locus_tag LOCUS_24770 56414 57118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 57883 57332 gene locus_tag LOCUS_24780 57883 57332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 58463 58002 gene locus_tag LOCUS_24790 58463 58002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 58878 58456 gene locus_tag LOCUS_24800 58878 58456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 59660 59025 gene locus_tag LOCUS_24810 59660 59025 CDS product IS6-like element ISH29 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289758.1 protein_id gnl|my_center|LOCUS_24810 >Feature sequence36 <1 766 gene locus_tag LOCUS_24820 <1 766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012289518.1:acyl-CoA dehydrogenase family protein 895 1686 gene locus_tag LOCUS_24830 895 1686 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904162.1 protein_id gnl|my_center|LOCUS_24830 3899 1917 gene locus_tag LOCUS_24840 3899 1917 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135662706.1 protein_id gnl|my_center|LOCUS_24840 5605 6366 gene locus_tag LOCUS_24850 5605 6366 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043677442.1 protein_id gnl|my_center|LOCUS_24850 7543 6575 gene locus_tag LOCUS_24860 7543 6575 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183315.1 protein_id gnl|my_center|LOCUS_24860 7705 8223 gene locus_tag LOCUS_24870 7705 8223 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289404.1 protein_id gnl|my_center|LOCUS_24870 8422 8997 gene locus_tag LOCUS_24880 8422 8997 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289404.1 protein_id gnl|my_center|LOCUS_24880 9074 10027 gene locus_tag LOCUS_24890 9074 10027 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902312.1 protein_id gnl|my_center|LOCUS_24890 10139 10477 gene locus_tag LOCUS_24900 10139 10477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903405.1 protein_id gnl|my_center|LOCUS_24900 10697 10782 gene locus_tag LOCUS_t00360 10697 10782 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 11111 11569 gene locus_tag LOCUS_24910 11111 11569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 12563 11790 gene locus_tag LOCUS_24920 12563 11790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 12683 15397 gene locus_tag LOCUS_24930 gene leuS 12683 15397 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903650.1 protein_id gnl|my_center|LOCUS_24930 15533 15853 gene locus_tag LOCUS_24940 15533 15853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 15911 16510 gene locus_tag LOCUS_24950 15911 16510 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902461.1 protein_id gnl|my_center|LOCUS_24950 16870 16586 gene locus_tag LOCUS_24960 16870 16586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 17980 16949 gene locus_tag LOCUS_24970 17980 16949 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902535.1 protein_id gnl|my_center|LOCUS_24970 19211 18111 gene locus_tag LOCUS_24980 19211 18111 CDS product ATP-NAD kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902533.1 protein_id gnl|my_center|LOCUS_24980 19337 19462 gene locus_tag LOCUS_24990 19337 19462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 19629 20963 gene locus_tag LOCUS_25000 19629 20963 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902096.1 protein_id gnl|my_center|LOCUS_25000 21226 21032 gene locus_tag LOCUS_25010 21226 21032 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289092.1 protein_id gnl|my_center|LOCUS_25010 21411 21875 gene locus_tag LOCUS_25020 21411 21875 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250161.1 protein_id gnl|my_center|LOCUS_25020 22239 23723 gene locus_tag LOCUS_25030 22239 23723 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404786.1 protein_id gnl|my_center|LOCUS_25030 23720 26161 gene locus_tag LOCUS_25040 23720 26161 CDS product DUF2309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404785.1 protein_id gnl|my_center|LOCUS_25040 26924 26223 gene locus_tag LOCUS_25050 26924 26223 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892495.1 protein_id gnl|my_center|LOCUS_25050 27076 28092 gene locus_tag LOCUS_25060 27076 28092 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289230.1 protein_id gnl|my_center|LOCUS_25060 29295 28192 gene locus_tag LOCUS_25070 29295 28192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 30334 29537 gene locus_tag LOCUS_25080 30334 29537 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304632.1 protein_id gnl|my_center|LOCUS_25080 31395 30331 gene locus_tag LOCUS_25090 31395 30331 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090885.1 protein_id gnl|my_center|LOCUS_25090 32682 31486 gene locus_tag LOCUS_25100 32682 31486 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903606.1 protein_id gnl|my_center|LOCUS_25100 33098 33325 gene locus_tag LOCUS_25110 33098 33325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 33450 33959 gene locus_tag LOCUS_25120 33450 33959 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902023.1 protein_id gnl|my_center|LOCUS_25120 34281 35156 gene locus_tag LOCUS_25130 34281 35156 CDS product RimK family alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902022.1 protein_id gnl|my_center|LOCUS_25130 37220 35328 gene locus_tag LOCUS_25140 37220 35328 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903390.1 protein_id gnl|my_center|LOCUS_25140 37989 37372 gene locus_tag LOCUS_25150 37989 37372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 38123 38458 gene locus_tag LOCUS_25160 38123 38458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903389.1 protein_id gnl|my_center|LOCUS_25160 38510 39253 gene locus_tag LOCUS_25170 gene ric 38510 39253 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073961.1 protein_id gnl|my_center|LOCUS_25170 39355 39618 gene locus_tag LOCUS_25180 39355 39618 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289475.1 protein_id gnl|my_center|LOCUS_25180 39619 40056 gene locus_tag LOCUS_25190 39619 40056 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903693.1 protein_id gnl|my_center|LOCUS_25190 42500 40068 gene locus_tag LOCUS_25200 42500 40068 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903005.1 protein_id gnl|my_center|LOCUS_25200 43204 42839 gene locus_tag LOCUS_25210 43204 42839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 43485 44300 gene locus_tag LOCUS_25220 43485 44300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 45145 44414 gene locus_tag LOCUS_25230 45145 44414 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892625.1 protein_id gnl|my_center|LOCUS_25230 45631 45200 gene locus_tag LOCUS_25240 45631 45200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 45667 46779 gene locus_tag LOCUS_25250 45667 46779 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890422.1 protein_id gnl|my_center|LOCUS_25250 46783 48093 gene locus_tag LOCUS_25260 46783 48093 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890424.1 protein_id gnl|my_center|LOCUS_25260 48968 49264 gene locus_tag LOCUS_25270 48968 49264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 49331 50236 gene locus_tag LOCUS_25280 49331 50236 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902504.1 protein_id gnl|my_center|LOCUS_25280 50780 53242 gene locus_tag LOCUS_25290 50780 53242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 54866 53250 gene locus_tag LOCUS_25300 54866 53250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 55206 58631 gene locus_tag LOCUS_25310 55206 58631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 >Feature sequence37 1326 100 gene locus_tag LOCUS_25320 1326 100 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011319592.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25320 1222 1416 gene locus_tag LOCUS_25330 1222 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 1825 3129 gene locus_tag LOCUS_25340 1825 3129 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097941129.1 protein_id gnl|my_center|LOCUS_25340 3139 4023 gene locus_tag LOCUS_25350 3139 4023 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039248.1 protein_id gnl|my_center|LOCUS_25350 4020 5084 gene locus_tag LOCUS_25360 4020 5084 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727510.1 protein_id gnl|my_center|LOCUS_25360 5081 5818 gene locus_tag LOCUS_25370 5081 5818 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727509.1 protein_id gnl|my_center|LOCUS_25370 5815 6558 gene locus_tag LOCUS_25380 5815 6558 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727508.1 protein_id gnl|my_center|LOCUS_25380 6594 7100 gene locus_tag LOCUS_25390 6594 7100 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902980.1 protein_id gnl|my_center|LOCUS_25390 7944 7117 gene locus_tag LOCUS_25400 7944 7117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 8294 8022 gene locus_tag LOCUS_25410 8294 8022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 >Feature sequence38 2051 156 gene locus_tag LOCUS_25420 2051 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 2356 3060 gene locus_tag LOCUS_25430 2356 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 4053 3154 gene locus_tag LOCUS_25440 4053 3154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 4496 5845 gene locus_tag LOCUS_25450 4496 5845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 5893 6195 gene locus_tag LOCUS_25460 5893 6195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 7450 6545 gene locus_tag LOCUS_25470 7450 6545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 7944 7729 gene locus_tag LOCUS_25480 7944 7729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 8263 8631 gene locus_tag LOCUS_25490 8263 8631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 8628 8861 gene locus_tag LOCUS_25500 8628 8861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 9099 9467 gene locus_tag LOCUS_25510 9099 9467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 9464 9970 gene locus_tag LOCUS_25520 9464 9970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 11473 10052 gene locus_tag LOCUS_25530 11473 10052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 13699 11477 gene locus_tag LOCUS_25540 13699 11477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 15213 13696 gene locus_tag LOCUS_25550 15213 13696 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256148.1 protein_id gnl|my_center|LOCUS_25550 15437 17197 gene locus_tag LOCUS_25560 gene hemAT 15437 17197 CDS product heme-containing aerotactic transducer HemAT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903098.1 protein_id gnl|my_center|LOCUS_25560 17285 18061 gene locus_tag LOCUS_25570 17285 18061 CDS product DICT sensory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902515.1 protein_id gnl|my_center|LOCUS_25570 18208 20658 gene locus_tag LOCUS_25580 18208 20658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 20803 21429 gene locus_tag LOCUS_25590 20803 21429 CDS product IS607-like element ISTko2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250792.1 protein_id gnl|my_center|LOCUS_25590 21422 23143 gene locus_tag LOCUS_25600 21422 23143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 24508 23726 gene locus_tag LOCUS_25610 24508 23726 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902307.1 protein_id gnl|my_center|LOCUS_25610 25073 24684 gene locus_tag LOCUS_25620 25073 24684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 26670 25240 gene locus_tag LOCUS_25630 gene sufB 26670 25240 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902348.1 protein_id gnl|my_center|LOCUS_25630 26809 27312 gene locus_tag LOCUS_25640 26809 27312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 27416 27856 gene locus_tag LOCUS_25650 27416 27856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 28135 29316 gene locus_tag LOCUS_25660 28135 29316 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081422761.1 protein_id gnl|my_center|LOCUS_25660 >Feature sequence39 297 962 gene locus_tag LOCUS_25670 297 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 1069 1404 gene locus_tag LOCUS_25680 1069 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 3403 1559 gene locus_tag LOCUS_25690 3403 1559 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869365.1 protein_id gnl|my_center|LOCUS_25690 4456 3494 gene locus_tag LOCUS_25700 4456 3494 CDS product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870653.1 protein_id gnl|my_center|LOCUS_25700 4752 4456 gene locus_tag LOCUS_25710 4752 4456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 6814 4817 gene locus_tag LOCUS_25720 6814 4817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 6920 8218 gene locus_tag LOCUS_25730 6920 8218 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103021002.1 protein_id gnl|my_center|LOCUS_25730 8955 8305 gene locus_tag LOCUS_25740 8955 8305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 9041 10711 gene locus_tag LOCUS_25750 9041 10711 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902435.1 protein_id gnl|my_center|LOCUS_25750 10990 10763 gene locus_tag LOCUS_25760 10990 10763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 11412 10993 gene locus_tag LOCUS_25770 11412 10993 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903622.1 protein_id gnl|my_center|LOCUS_25770 11528 11695 gene locus_tag LOCUS_25780 11528 11695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 12505 11765 gene locus_tag LOCUS_25790 12505 11765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 12601 12840 gene locus_tag LOCUS_25800 12601 12840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 12916 14157 gene locus_tag LOCUS_25810 12916 14157 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807816.1 protein_id gnl|my_center|LOCUS_25810 14176 17445 gene locus_tag LOCUS_25820 gene ileS 14176 17445 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903625.1 protein_id gnl|my_center|LOCUS_25820 18989 17442 gene locus_tag LOCUS_25830 18989 17442 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903305.1 protein_id gnl|my_center|LOCUS_25830 19216 18986 gene locus_tag LOCUS_25840 19216 18986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 19390 20379 gene locus_tag LOCUS_25850 19390 20379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 20563 21987 gene locus_tag LOCUS_25860 gene dnaG 20563 21987 CDS product DNA primase DnaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289379.1 protein_id gnl|my_center|LOCUS_25860 23322 21991 gene locus_tag LOCUS_25870 23322 21991 CDS product TIGR00297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289378.1 protein_id gnl|my_center|LOCUS_25870 23482 24087 gene locus_tag LOCUS_25880 23482 24087 CDS product undecaprenyl diphosphate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289377.1 protein_id gnl|my_center|LOCUS_25880 24195 24944 gene locus_tag LOCUS_25890 24195 24944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 25940 24972 gene locus_tag LOCUS_25900 gene uppS 25940 24972 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903300.1 protein_id gnl|my_center|LOCUS_25900 26084 26521 gene locus_tag LOCUS_25910 26084 26521 CDS product DUF5778 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903299.1 protein_id gnl|my_center|LOCUS_25910 26536 27189 gene locus_tag LOCUS_25920 26536 27189 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903297.1 protein_id gnl|my_center|LOCUS_25920 27186 28514 gene locus_tag LOCUS_25930 gene hemA 27186 28514 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903296.1 protein_id gnl|my_center|LOCUS_25930 28755 29045 gene locus_tag LOCUS_25940 28755 29045 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903295.1 protein_id gnl|my_center|LOCUS_25940 29118 29498 gene locus_tag LOCUS_25950 29118 29498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 29560 30207 gene locus_tag LOCUS_25960 29560 30207 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903294.1 protein_id gnl|my_center|LOCUS_25960 30666 30232 gene locus_tag LOCUS_25970 30666 30232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 30820 31887 gene locus_tag LOCUS_25980 30820 31887 CDS product mRNA surveillance protein pelota inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903099.1 protein_id gnl|my_center|LOCUS_25980 32039 33211 gene locus_tag LOCUS_25990 32039 33211 CDS product tubulin/FtsZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289408.1 protein_id gnl|my_center|LOCUS_25990 33245 34522 gene locus_tag LOCUS_26000 33245 34522 CDS product tubulin/FtsZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289408.1 protein_id gnl|my_center|LOCUS_26000 34519 34860 gene locus_tag LOCUS_26010 34519 34860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 35778 34936 gene locus_tag LOCUS_26020 35778 34936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 36149 35904 gene locus_tag LOCUS_26030 36149 35904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 37140 36277 gene locus_tag LOCUS_26040 gene truA 37140 36277 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903475.1 protein_id gnl|my_center|LOCUS_26040 37485 38438 gene locus_tag LOCUS_26050 37485 38438 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527657.1 protein_id gnl|my_center|LOCUS_26050 39433 38474 gene locus_tag LOCUS_26060 39433 38474 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529597.1 protein_id gnl|my_center|LOCUS_26060 39590 41077 gene locus_tag LOCUS_26070 39590 41077 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902969.1 protein_id gnl|my_center|LOCUS_26070 41117 42610 gene locus_tag LOCUS_26080 41117 42610 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838397.1 protein_id gnl|my_center|LOCUS_26080 42814 43173 gene locus_tag LOCUS_26090 42814 43173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 43802 43206 gene locus_tag LOCUS_26100 43802 43206 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903532.1 protein_id gnl|my_center|LOCUS_26100 44457 43891 gene locus_tag LOCUS_26110 44457 43891 CDS product DUF99 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903531.1 protein_id gnl|my_center|LOCUS_26110 44633 44457 gene locus_tag LOCUS_26120 44633 44457 CDS product DUF5786 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903530.1 protein_id gnl|my_center|LOCUS_26120 44752 45363 gene locus_tag LOCUS_26130 44752 45363 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903529.1 protein_id gnl|my_center|LOCUS_26130 46342 45599 gene locus_tag LOCUS_26140 46342 45599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 46749 46600 gene locus_tag LOCUS_26150 46749 46600 CDS product 50S ribosomal protein L40e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903526.1 protein_id gnl|my_center|LOCUS_26150 47331 46828 gene locus_tag LOCUS_26160 47331 46828 CDS product DUF367 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289427.1 protein_id gnl|my_center|LOCUS_26160 47510 47728 gene locus_tag LOCUS_26170 47510 47728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 47938 48261 gene locus_tag LOCUS_26180 47938 48261 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903524.1 protein_id gnl|my_center|LOCUS_26180 48335 49252 gene locus_tag LOCUS_26190 48335 49252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 50528 49335 gene locus_tag LOCUS_26200 50528 49335 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890422.1 protein_id gnl|my_center|LOCUS_26200 50703 51254 gene locus_tag LOCUS_26210 50703 51254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 51506 51736 gene locus_tag LOCUS_26220 51506 51736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 51896 53419 gene locus_tag LOCUS_26230 51896 53419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 55457 53817 gene locus_tag LOCUS_26240 gene betL 55457 53817 CDS product BCCT family glycine betaine transporter BetL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731943.1 protein_id gnl|my_center|LOCUS_26240 55591 55914 gene locus_tag LOCUS_26250 55591 55914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 55985 56431 gene locus_tag LOCUS_26260 55985 56431 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289398.1 protein_id gnl|my_center|LOCUS_26260 57742 56807 gene locus_tag LOCUS_26270 57742 56807 CDS product DUF6293 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892517.1 protein_id gnl|my_center|LOCUS_26270 58690 58064 gene locus_tag LOCUS_26280 58690 58064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 59393 58848 gene locus_tag LOCUS_26290 59393 58848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 59626 60513 gene locus_tag LOCUS_26300 59626 60513 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530304.1 protein_id gnl|my_center|LOCUS_26300 >Feature sequence40 1008 1586 gene locus_tag LOCUS_26310 1008 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 1583 2662 gene locus_tag LOCUS_26320 1583 2662 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876812.1 protein_id gnl|my_center|LOCUS_26320 2693 3679 gene locus_tag LOCUS_26330 2693 3679 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141858.1 protein_id gnl|my_center|LOCUS_26330 3672 5075 gene locus_tag LOCUS_26340 3672 5075 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868281.1 protein_id gnl|my_center|LOCUS_26340 5068 6150 gene locus_tag LOCUS_26350 5068 6150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 6147 7190 gene locus_tag LOCUS_26360 6147 7190 CDS product DUF354 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024333.1 protein_id gnl|my_center|LOCUS_26360 7187 8119 gene locus_tag LOCUS_26370 gene wecB 7187 8119 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582948.1 protein_id gnl|my_center|LOCUS_26370 8125 9186 gene locus_tag LOCUS_26380 8125 9186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 10617 9943 gene locus_tag LOCUS_26390 10617 9943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 11251 11451 gene locus_tag LOCUS_26400 11251 11451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 13170 11680 gene locus_tag LOCUS_26410 13170 11680 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021083.1 protein_id gnl|my_center|LOCUS_26410 14327 13167 gene locus_tag LOCUS_26420 14327 13167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 14415 16133 gene locus_tag LOCUS_26430 14415 16133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 17356 16292 gene locus_tag LOCUS_26440 17356 16292 CDS product DUF1616 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065996.1 protein_id gnl|my_center|LOCUS_26440 19477 17522 gene locus_tag LOCUS_26450 19477 17522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 19764 21227 gene locus_tag LOCUS_26460 19764 21227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 21224 21817 gene locus_tag LOCUS_26470 21224 21817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 21814 22701 gene locus_tag LOCUS_26480 21814 22701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 23740 22733 gene locus_tag LOCUS_26490 23740 22733 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250797.1 protein_id gnl|my_center|LOCUS_26490 24685 23747 gene locus_tag LOCUS_26500 24685 23747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 25034 24747 gene locus_tag LOCUS_26510 25034 24747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 27032 25239 gene locus_tag LOCUS_26520 gene glmS 27032 25239 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901947.1 protein_id gnl|my_center|LOCUS_26520 28138 27032 gene locus_tag LOCUS_26530 28138 27032 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901948.1 protein_id gnl|my_center|LOCUS_26530 28751 30847 gene locus_tag LOCUS_26540 28751 30847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942102.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26540 31311 32420 gene locus_tag LOCUS_26550 31311 32420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 34111 32417 gene locus_tag LOCUS_26560 34111 32417 CDS product histidine kinase N-terminal 7TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289455.1 protein_id gnl|my_center|LOCUS_26560 35471 34302 gene locus_tag LOCUS_26570 35471 34302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 37171 35603 gene locus_tag LOCUS_26580 37171 35603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 38466 37168 gene locus_tag LOCUS_26590 38466 37168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 38626 39516 gene locus_tag LOCUS_26600 38626 39516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 39576 40709 gene locus_tag LOCUS_26610 39576 40709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 42101 40710 gene locus_tag LOCUS_26620 42101 40710 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219771063.1 protein_id gnl|my_center|LOCUS_26620 43201 42092 gene locus_tag LOCUS_26630 43201 42092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 43569 43198 gene locus_tag LOCUS_26640 43569 43198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 44633 43566 gene locus_tag LOCUS_26650 44633 43566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 45199 46074 gene locus_tag LOCUS_26660 45199 46074 CDS product putative RNA uridine N3 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903233.1 protein_id gnl|my_center|LOCUS_26660 46079 47098 gene locus_tag LOCUS_26670 46079 47098 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903234.1 protein_id gnl|my_center|LOCUS_26670 47102 47854 gene locus_tag LOCUS_26680 gene rpl4p 47102 47854 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903235.1 protein_id gnl|my_center|LOCUS_26680 47851 48105 gene locus_tag LOCUS_26690 47851 48105 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903236.1 protein_id gnl|my_center|LOCUS_26690 48108 48830 gene locus_tag LOCUS_26700 48108 48830 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903237.1 protein_id gnl|my_center|LOCUS_26700 48827 49249 gene locus_tag LOCUS_26710 48827 49249 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903238.1 protein_id gnl|my_center|LOCUS_26710 49257 49763 gene locus_tag LOCUS_26720 49257 49763 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903239.1 protein_id gnl|my_center|LOCUS_26720 49763 50728 gene locus_tag LOCUS_26730 49763 50728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 50728 50934 gene locus_tag LOCUS_26740 gene rpmC 50728 50934 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903241.1 protein_id gnl|my_center|LOCUS_26740 50956 51456 gene locus_tag LOCUS_26750 50956 51456 CDS product ribonuclease P protein component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903242.1 protein_id gnl|my_center|LOCUS_26750 51447 51890 gene locus_tag LOCUS_26760 51447 51890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 51890 52288 gene locus_tag LOCUS_26770 51890 52288 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903244.1 protein_id gnl|my_center|LOCUS_26770 52291 52647 gene locus_tag LOCUS_26780 gene rplX 52291 52647 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903245.1 protein_id gnl|my_center|LOCUS_26780 52644 53348 gene locus_tag LOCUS_26790 52644 53348 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903246.1 protein_id gnl|my_center|LOCUS_26790 53345 53884 gene locus_tag LOCUS_26800 53345 53884 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903247.1 protein_id gnl|my_center|LOCUS_26800 53877 54065 gene locus_tag LOCUS_26810 53877 54065 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903248.1 protein_id gnl|my_center|LOCUS_26810 54067 54459 gene locus_tag LOCUS_26820 54067 54459 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903249.1 protein_id gnl|my_center|LOCUS_26820 54462 54995 gene locus_tag LOCUS_26830 54462 54995 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903250.1 protein_id gnl|my_center|LOCUS_26830 54999 55721 gene locus_tag LOCUS_26840 54999 55721 CDS product 50S ribosomal protein L32e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903251.1 protein_id gnl|my_center|LOCUS_26840 55718 56167 gene locus_tag LOCUS_26850 55718 56167 CDS product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903252.1 protein_id gnl|my_center|LOCUS_26850 56167 56715 gene locus_tag LOCUS_26860 56167 56715 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903253.1 protein_id gnl|my_center|LOCUS_26860 56712 57374 gene locus_tag LOCUS_26870 56712 57374 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903254.1 protein_id gnl|my_center|LOCUS_26870 57371 57838 gene locus_tag LOCUS_26880 57371 57838 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_117363797.1 protein_id gnl|my_center|LOCUS_26880 57841 58320 gene locus_tag LOCUS_26890 57841 58320 CDS product uL15m family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903256.1 protein_id gnl|my_center|LOCUS_26890 58323 59813 gene locus_tag LOCUS_26900 gene secY 58323 59813 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903257.1 protein_id gnl|my_center|LOCUS_26900 60488 60231 gene locus_tag LOCUS_26910 60488 60231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 60654 62225 gene locus_tag LOCUS_26920 60654 62225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 64721 62250 gene locus_tag LOCUS_26930 64721 62250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 65758 64718 gene locus_tag LOCUS_26940 65758 64718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 66142 66432 gene locus_tag LOCUS_26950 66142 66432 CDS product amphi-Trp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903036.1 protein_id gnl|my_center|LOCUS_26950 66916 66446 gene locus_tag LOCUS_26960 66916 66446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903260.1 protein_id gnl|my_center|LOCUS_26960 66976 67611 gene locus_tag LOCUS_26970 66976 67611 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903261.1 protein_id gnl|my_center|LOCUS_26970 67779 68120 gene locus_tag LOCUS_26980 67779 68120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 72136 68213 gene locus_tag LOCUS_26990 72136 68213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 73092 72361 gene locus_tag LOCUS_27000 73092 72361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 73545 74492 gene locus_tag LOCUS_27010 73545 74492 CDS product EMC3/TMCO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903262.1 protein_id gnl|my_center|LOCUS_27010 74531 75106 gene locus_tag LOCUS_27020 74531 75106 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903263.1 protein_id gnl|my_center|LOCUS_27020 75110 76018 gene locus_tag LOCUS_27030 75110 76018 CDS product RNA-guided pseudouridylation complex pseudouridine synthase subunit Cbf5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289369.1 protein_id gnl|my_center|LOCUS_27030 76107 76178 gene locus_tag LOCUS_t00370 76107 76178 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 76404 76700 gene locus_tag LOCUS_27040 76404 76700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 76693 77658 gene locus_tag LOCUS_27050 76693 77658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 77781 78092 gene locus_tag LOCUS_27060 77781 78092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 78089 78586 gene locus_tag LOCUS_27070 78089 78586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 78583 78879 gene locus_tag LOCUS_27080 78583 78879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 78863 80872 gene locus_tag LOCUS_27090 78863 80872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 82427 81162 gene locus_tag LOCUS_27100 82427 81162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 83635 82736 gene locus_tag LOCUS_27110 83635 82736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 84159 83632 gene locus_tag LOCUS_27120 84159 83632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 84236 84706 gene locus_tag LOCUS_27130 84236 84706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 84756 85202 gene locus_tag LOCUS_27140 84756 85202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 85220 85468 gene locus_tag LOCUS_27150 85220 85468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 85465 85782 gene locus_tag LOCUS_27160 85465 85782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 85766 86290 gene locus_tag LOCUS_27170 85766 86290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 86297 86905 gene locus_tag LOCUS_27180 86297 86905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 86910 88460 gene locus_tag LOCUS_27190 86910 88460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 88457 88735 gene locus_tag LOCUS_27200 88457 88735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 88732 88977 gene locus_tag LOCUS_27210 88732 88977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 90114 92273 gene locus_tag LOCUS_27220 90114 92273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 92270 92641 gene locus_tag LOCUS_27230 92270 92641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 92638 93000 gene locus_tag LOCUS_27240 92638 93000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 92997 93365 gene locus_tag LOCUS_27250 92997 93365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 93786 93358 gene locus_tag LOCUS_27260 93786 93358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 94311 93817 gene locus_tag LOCUS_27270 94311 93817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 94411 94633 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 94734 95534 gene locus_tag LOCUS_27280 94734 95534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059055354.1 protein_id gnl|my_center|LOCUS_27280 95535 96077 gene locus_tag LOCUS_27290 95535 96077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 96269 96517 gene locus_tag LOCUS_27300 96269 96517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 97462 98049 gene locus_tag LOCUS_27310 97462 98049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 98132 99145 gene locus_tag LOCUS_27320 98132 99145 CDS product orc1/cdc6 family replication initiation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289552.1 protein_id gnl|my_center|LOCUS_27320 99287 99574 gene locus_tag LOCUS_27330 99287 99574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 99771 99577 gene locus_tag LOCUS_27340 99771 99577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 100101 99826 gene locus_tag LOCUS_27350 100101 99826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 100436 100197 gene locus_tag LOCUS_27360 100436 100197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 101165 101353 gene locus_tag LOCUS_27370 101165 101353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 101350 101643 gene locus_tag LOCUS_27380 101350 101643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 101640 102812 gene locus_tag LOCUS_27390 101640 102812 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902703.1 protein_id gnl|my_center|LOCUS_27390 102809 102994 gene locus_tag LOCUS_27400 102809 102994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 103127 103402 gene locus_tag LOCUS_27410 103127 103402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 103418 103786 gene locus_tag LOCUS_27420 103418 103786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 104422 103820 gene locus_tag LOCUS_27430 104422 103820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 105042 104419 gene locus_tag LOCUS_27440 105042 104419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27440 105342 105124 gene locus_tag LOCUS_27450 105342 105124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 106804 106010 gene locus_tag LOCUS_27460 106804 106010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 107260 107715 gene locus_tag LOCUS_27470 107260 107715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 108659 108252 gene locus_tag LOCUS_27480 108659 108252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 109488 109021 gene locus_tag LOCUS_27490 109488 109021 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289517.1 protein_id gnl|my_center|LOCUS_27490 111114 112130 gene locus_tag LOCUS_27500 111114 112130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 112159 114111 gene locus_tag LOCUS_27510 112159 114111 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133957058.1 protein_id gnl|my_center|LOCUS_27510 114377 115171 gene locus_tag LOCUS_27520 114377 115171 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255197.1 protein_id gnl|my_center|LOCUS_27520 116510 116184 gene locus_tag LOCUS_27530 116510 116184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 117025 116819 gene locus_tag LOCUS_27540 117025 116819 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903343.1 protein_id gnl|my_center|LOCUS_27540 117202 117471 gene locus_tag LOCUS_27550 117202 117471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903817.1 protein_id gnl|my_center|LOCUS_27550 >Feature sequence41 879 46 gene locus_tag LOCUS_27560 879 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 1542 1093 gene locus_tag LOCUS_27570 1542 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 1844 1539 gene locus_tag LOCUS_27580 1844 1539 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904211.1 protein_id gnl|my_center|LOCUS_27580 2989 2042 gene locus_tag LOCUS_27590 2989 2042 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902019.1 protein_id gnl|my_center|LOCUS_27590 3194 4207 gene locus_tag LOCUS_27600 3194 4207 CDS product type II glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902020.1 protein_id gnl|my_center|LOCUS_27600 4478 4879 gene locus_tag LOCUS_27610 4478 4879 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902021.1 protein_id gnl|my_center|LOCUS_27610 5581 4952 gene locus_tag LOCUS_27620 5581 4952 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903340.1 protein_id gnl|my_center|LOCUS_27620 5650 6504 gene locus_tag LOCUS_27630 5650 6504 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021474.1 protein_id gnl|my_center|LOCUS_27630 6601 6945 gene locus_tag LOCUS_27640 6601 6945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 6994 7287 gene locus_tag LOCUS_27650 6994 7287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 7278 7487 gene locus_tag LOCUS_27660 7278 7487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 7969 7514 gene locus_tag LOCUS_27670 7969 7514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 8191 9270 gene locus_tag LOCUS_27680 8191 9270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 9348 10379 gene locus_tag LOCUS_27690 9348 10379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 10526 10948 gene locus_tag LOCUS_27700 10526 10948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 11024 12010 gene locus_tag LOCUS_27710 11024 12010 CDS product replication factor C small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903695.1 protein_id gnl|my_center|LOCUS_27710 12629 12048 gene locus_tag LOCUS_27720 12629 12048 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878134.1 protein_id gnl|my_center|LOCUS_27720 12916 12632 gene locus_tag LOCUS_27730 12916 12632 CDS product DUF211 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879046.1 protein_id gnl|my_center|LOCUS_27730 13028 14422 gene locus_tag LOCUS_27740 13028 14422 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483378.1 protein_id gnl|my_center|LOCUS_27740 15167 14442 gene locus_tag LOCUS_27750 15167 14442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 15405 15332 gene locus_tag LOCUS_t00380 15405 15332 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 16407 15619 gene locus_tag LOCUS_27760 16407 15619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 16524 17114 gene locus_tag LOCUS_27770 gene purO 16524 17114 CDS product IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903769.1 protein_id gnl|my_center|LOCUS_27770 17111 17554 gene locus_tag LOCUS_27780 17111 17554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 17629 18297 gene locus_tag LOCUS_27790 17629 18297 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903770.1 protein_id gnl|my_center|LOCUS_27790 18525 19037 gene locus_tag LOCUS_27800 18525 19037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27800 19075 19710 gene locus_tag LOCUS_27810 19075 19710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903785.1 protein_id gnl|my_center|LOCUS_27810 20105 19833 gene locus_tag LOCUS_27820 20105 19833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 20973 20140 gene locus_tag LOCUS_27830 gene thiM 20973 20140 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022683.1 protein_id gnl|my_center|LOCUS_27830 21635 20970 gene locus_tag LOCUS_27840 gene thiE 21635 20970 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106006557.1 protein_id gnl|my_center|LOCUS_27840 22277 21660 gene locus_tag LOCUS_27850 22277 21660 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267057.1 protein_id gnl|my_center|LOCUS_27850 24234 23017 gene locus_tag LOCUS_27860 24234 23017 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056637.1 protein_id gnl|my_center|LOCUS_27860 26327 24600 gene locus_tag LOCUS_27870 26327 24600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 28035 26317 gene locus_tag LOCUS_27880 28035 26317 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119621.1 protein_id gnl|my_center|LOCUS_27880 29333 28461 gene locus_tag LOCUS_27890 29333 28461 CDS product NmrA/HSCARG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142276.1 protein_id gnl|my_center|LOCUS_27890 30663 29401 gene locus_tag LOCUS_27900 gene ftsY 30663 29401 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903840.1 protein_id gnl|my_center|LOCUS_27900 31128 30685 gene locus_tag LOCUS_27910 31128 30685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 31301 31125 gene locus_tag LOCUS_27920 31301 31125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 31389 31700 gene locus_tag LOCUS_27930 31389 31700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 32550 31720 gene locus_tag LOCUS_27940 32550 31720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 33060 32647 gene locus_tag LOCUS_27950 33060 32647 CDS product RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903834.1 protein_id gnl|my_center|LOCUS_27950 33620 33057 gene locus_tag LOCUS_27960 33620 33057 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903833.1 protein_id gnl|my_center|LOCUS_27960 33813 34265 gene locus_tag LOCUS_27970 33813 34265 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903120.1 protein_id gnl|my_center|LOCUS_27970 34548 34925 gene locus_tag LOCUS_27980 34548 34925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256057.1 protein_id gnl|my_center|LOCUS_27980 35083 35157 gene locus_tag LOCUS_t00390 35083 35157 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 35581 35273 gene locus_tag LOCUS_27990 35581 35273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 35780 36751 gene locus_tag LOCUS_28000 35780 36751 CDS product TIGR03885 family FMN-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975020.1 protein_id gnl|my_center|LOCUS_28000 37644 36862 gene locus_tag LOCUS_28010 37644 36862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 38090 39043 gene locus_tag LOCUS_28020 38090 39043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 39167 40459 gene locus_tag LOCUS_28030 39167 40459 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903671.1 protein_id gnl|my_center|LOCUS_28030 40627 41310 gene locus_tag LOCUS_28040 40627 41310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 41664 42953 gene locus_tag LOCUS_28050 41664 42953 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903672.1 protein_id gnl|my_center|LOCUS_28050 42956 43663 gene locus_tag LOCUS_28060 gene rpiA 42956 43663 CDS product ribose 5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903689.1 protein_id gnl|my_center|LOCUS_28060 44096 43668 gene locus_tag LOCUS_28070 44096 43668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 44542 44093 gene locus_tag LOCUS_28080 44542 44093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 44764 45819 gene locus_tag LOCUS_28090 gene fni 44764 45819 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904022.1 protein_id gnl|my_center|LOCUS_28090 46105 45938 gene locus_tag LOCUS_28100 46105 45938 CDS product DUF1931 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903690.1 protein_id gnl|my_center|LOCUS_28100 46391 47149 gene locus_tag LOCUS_28110 gene larB 46391 47149 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020480.1 protein_id gnl|my_center|LOCUS_28110 47455 47733 gene locus_tag LOCUS_28120 47455 47733 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903691.1 protein_id gnl|my_center|LOCUS_28120 47842 48801 gene locus_tag LOCUS_28130 47842 48801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 48884 49393 gene locus_tag LOCUS_28140 48884 49393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 49466 50065 gene locus_tag LOCUS_28150 49466 50065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 50186 50875 gene locus_tag LOCUS_28160 50186 50875 CDS product DUF4013 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060986.1 protein_id gnl|my_center|LOCUS_28160 50973 53330 gene locus_tag LOCUS_28170 50973 53330 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903642.1 protein_id gnl|my_center|LOCUS_28170 53624 54742 gene locus_tag LOCUS_28180 53624 54742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 54839 55537 gene locus_tag LOCUS_28190 54839 55537 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903867.1 protein_id gnl|my_center|LOCUS_28190 56340 55690 gene locus_tag LOCUS_28200 56340 55690 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963951.1 protein_id gnl|my_center|LOCUS_28200 56938 56342 gene locus_tag LOCUS_28210 56938 56342 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903909.1 protein_id gnl|my_center|LOCUS_28210 57817 57014 gene locus_tag LOCUS_28220 gene suhB 57817 57014 CDS product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370312.1 protein_id gnl|my_center|LOCUS_28220 57883 58191 gene locus_tag LOCUS_28230 57883 58191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 60131 58254 gene locus_tag LOCUS_28240 60131 58254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 61572 60409 gene locus_tag LOCUS_28250 61572 60409 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903868.1 protein_id gnl|my_center|LOCUS_28250 62112 61597 gene locus_tag LOCUS_28260 62112 61597 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903443.1 protein_id gnl|my_center|LOCUS_28260 62353 62508 gene locus_tag LOCUS_28270 62353 62508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 62513 62797 gene locus_tag LOCUS_28280 62513 62797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 62883 63563 gene locus_tag LOCUS_28290 62883 63563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 63637 64683 gene locus_tag LOCUS_28300 63637 64683 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903535.1 protein_id gnl|my_center|LOCUS_28300 64726 65532 gene locus_tag LOCUS_28310 64726 65532 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903534.1 protein_id gnl|my_center|LOCUS_28310 65529 66647 gene locus_tag LOCUS_28320 gene phnE 65529 66647 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903533.1 protein_id gnl|my_center|LOCUS_28320 67470 66673 gene locus_tag LOCUS_28330 67470 66673 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903001.1 protein_id gnl|my_center|LOCUS_28330 67612 68388 gene locus_tag LOCUS_28340 67612 68388 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903641.1 protein_id gnl|my_center|LOCUS_28340 69623 68481 gene locus_tag LOCUS_28350 69623 68481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 69856 69668 gene locus_tag LOCUS_28360 69856 69668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 70036 70656 gene locus_tag LOCUS_28370 70036 70656 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227885.1 protein_id gnl|my_center|LOCUS_28370 70667 71284 gene locus_tag LOCUS_28380 70667 71284 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902402.1 protein_id gnl|my_center|LOCUS_28380 71284 71937 gene locus_tag LOCUS_28390 71284 71937 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049924277.1 protein_id gnl|my_center|LOCUS_28390 71957 72238 gene locus_tag LOCUS_28400 71957 72238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 72571 72248 gene locus_tag LOCUS_28410 72571 72248 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903863.1 protein_id gnl|my_center|LOCUS_28410 72789 73187 gene locus_tag LOCUS_28420 72789 73187 CDS product DCC1-like thiol-disulfide oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903865.1 protein_id gnl|my_center|LOCUS_28420 74378 73206 gene locus_tag LOCUS_28430 74378 73206 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405273.1 protein_id gnl|my_center|LOCUS_28430 74595 75614 gene locus_tag LOCUS_28440 gene hemB 74595 75614 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903732.1 protein_id gnl|my_center|LOCUS_28440 75999 77855 gene locus_tag LOCUS_28450 75999 77855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 78016 79362 gene locus_tag LOCUS_28460 78016 79362 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903735.1 protein_id gnl|my_center|LOCUS_28460 79408 80097 gene locus_tag LOCUS_28470 79408 80097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 80346 81485 gene locus_tag LOCUS_28480 gene hemC 80346 81485 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903738.1 protein_id gnl|my_center|LOCUS_28480 81500 82315 gene locus_tag LOCUS_28490 gene cobA 81500 82315 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903739.1 protein_id gnl|my_center|LOCUS_28490 82308 83051 gene locus_tag LOCUS_28500 82308 83051 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903740.1 protein_id gnl|my_center|LOCUS_28500 83148 83513 gene locus_tag LOCUS_28510 83148 83513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 83551 85050 gene locus_tag LOCUS_28520 83551 85050 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903741.1 protein_id gnl|my_center|LOCUS_28520 86541 85396 gene locus_tag LOCUS_28530 gene ftsZ 86541 85396 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902232.1 protein_id gnl|my_center|LOCUS_28530 88034 86700 gene locus_tag LOCUS_28540 88034 86700 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892484.1 protein_id gnl|my_center|LOCUS_28540 88240 90294 gene locus_tag LOCUS_28550 gene bat 88240 90294 CDS product bacterioopsin transcriptional activator Bat inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903066.1 protein_id gnl|my_center|LOCUS_28550 90411 91691 gene locus_tag LOCUS_28560 90411 91691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 92733 91792 gene locus_tag LOCUS_28570 92733 91792 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902234.1 protein_id gnl|my_center|LOCUS_28570 93302 92820 gene locus_tag LOCUS_28580 93302 92820 CDS product CopG family ribbon-helix-helix protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289104.1 protein_id gnl|my_center|LOCUS_28580 93406 94611 gene locus_tag LOCUS_28590 gene zinU 93406 94611 CDS product zinc metallochaperone ZinU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234625.1 protein_id gnl|my_center|LOCUS_28590 94612 95958 gene locus_tag LOCUS_28600 94612 95958 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062984.1 protein_id gnl|my_center|LOCUS_28600 96411 96082 gene locus_tag LOCUS_28610 96411 96082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 96549 97136 gene locus_tag LOCUS_28620 96549 97136 CDS product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903332.1 protein_id gnl|my_center|LOCUS_28620 97330 98766 gene locus_tag LOCUS_28630 97330 98766 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879446.1 protein_id gnl|my_center|LOCUS_28630 98865 99794 gene locus_tag LOCUS_28640 98865 99794 CDS product replication protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289447.1 protein_id gnl|my_center|LOCUS_28640 99796 100431 gene locus_tag LOCUS_28650 99796 100431 CDS product RPA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903600.1 protein_id gnl|my_center|LOCUS_28650 101779 100988 gene locus_tag LOCUS_28660 101779 100988 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391955.1 protein_id gnl|my_center|LOCUS_28660 102359 103504 gene locus_tag LOCUS_28670 102359 103504 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225693.1 protein_id gnl|my_center|LOCUS_28670 103677 105320 gene locus_tag LOCUS_28680 gene fadK 103677 105320 CDS product medium-chain fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302824.1 protein_id gnl|my_center|LOCUS_28680 105594 105830 gene locus_tag LOCUS_28690 105594 105830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 107056 106385 gene locus_tag LOCUS_28700 107056 106385 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049924277.1 protein_id gnl|my_center|LOCUS_28700 108042 107053 gene locus_tag LOCUS_28710 108042 107053 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412739.1 protein_id gnl|my_center|LOCUS_28710 108243 108656 gene locus_tag LOCUS_28720 108243 108656 CDS product ribbon-helix-helix protein, CopG family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903601.1 protein_id gnl|my_center|LOCUS_28720 109145 108690 gene locus_tag LOCUS_28730 109145 108690 CDS product DUF5814 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289448.1 protein_id gnl|my_center|LOCUS_28730 109477 109550 gene locus_tag LOCUS_t00400 109477 109550 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 109640 110011 gene locus_tag LOCUS_28740 109640 110011 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289449.1 protein_id gnl|my_center|LOCUS_28740 110099 111208 gene locus_tag LOCUS_28750 110099 111208 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903913.1 protein_id gnl|my_center|LOCUS_28750 111208 112095 gene locus_tag LOCUS_28760 111208 112095 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903907.1 protein_id gnl|my_center|LOCUS_28760 112186 113322 gene locus_tag LOCUS_28770 112186 113322 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903905.1 protein_id gnl|my_center|LOCUS_28770 113864 113346 gene locus_tag LOCUS_28780 113864 113346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 114031 116097 gene locus_tag LOCUS_28790 114031 116097 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289450.1 protein_id gnl|my_center|LOCUS_28790 116201 117847 gene locus_tag LOCUS_28800 116201 117847 CDS product DUF255 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289401.1 protein_id gnl|my_center|LOCUS_28800 117902 118747 gene locus_tag LOCUS_28810 117902 118747 CDS product TrmB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903396.1 protein_id gnl|my_center|LOCUS_28810 118927 121023 gene locus_tag LOCUS_28820 118927 121023 CDS product bacterio-opsin activator domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289108.1 protein_id gnl|my_center|LOCUS_28820 122177 121410 gene locus_tag LOCUS_28830 122177 121410 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902016.1 protein_id gnl|my_center|LOCUS_28830 122413 122341 gene locus_tag LOCUS_t00410 122413 122341 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 122496 122750 gene locus_tag LOCUS_28840 122496 122750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 122864 123490 gene locus_tag LOCUS_28850 gene fxsA 122864 123490 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903399.1 protein_id gnl|my_center|LOCUS_28850 123559 123632 gene locus_tag LOCUS_t00420 123559 123632 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 123789 124304 gene locus_tag LOCUS_28860 123789 124304 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902040.1 protein_id gnl|my_center|LOCUS_28860 124516 124734 gene locus_tag LOCUS_28870 124516 124734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 124754 125266 gene locus_tag LOCUS_28880 124754 125266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 125436 128960 gene locus_tag LOCUS_28890 125436 128960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 129043 130227 gene locus_tag LOCUS_28900 gene cofG 129043 130227 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase subunit CofG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892527.1 protein_id gnl|my_center|LOCUS_28900 130359 131774 gene locus_tag LOCUS_28910 130359 131774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 132914 131802 gene locus_tag LOCUS_28920 132914 131802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 133963 132911 gene locus_tag LOCUS_28930 133963 132911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 135590 134214 gene locus_tag LOCUS_28940 gene serS 135590 134214 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903523.1 protein_id gnl|my_center|LOCUS_28940 135720 136214 gene locus_tag LOCUS_28950 135720 136214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 136299 137792 gene locus_tag LOCUS_28960 136299 137792 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902502.1 protein_id gnl|my_center|LOCUS_28960 137857 140457 gene locus_tag LOCUS_28970 137857 140457 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903632.1 protein_id gnl|my_center|LOCUS_28970 140555 141016 gene locus_tag LOCUS_28980 140555 141016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 141233 144301 gene locus_tag LOCUS_28990 141233 144301 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903811.1 protein_id gnl|my_center|LOCUS_28990 145777 145148 gene locus_tag LOCUS_29000 145777 145148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 146433 145891 gene locus_tag LOCUS_29010 146433 145891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 147506 146646 gene locus_tag LOCUS_29020 147506 146646 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731494.1 protein_id gnl|my_center|LOCUS_29020 148130 147624 gene locus_tag LOCUS_29030 148130 147624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 149064 148294 gene locus_tag LOCUS_29040 149064 148294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 149118 149261 gene locus_tag LOCUS_29050 149118 149261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 151104 149419 gene locus_tag LOCUS_29060 151104 149419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 151315 152715 gene locus_tag LOCUS_29070 151315 152715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 152712 153344 gene locus_tag LOCUS_29080 152712 153344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 154236 153529 gene locus_tag LOCUS_29090 154236 153529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 155185 154613 gene locus_tag LOCUS_29100 155185 154613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 155306 155611 gene locus_tag LOCUS_29110 155306 155611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 156189 155740 gene locus_tag LOCUS_29120 156189 155740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 156502 157302 gene locus_tag LOCUS_29130 156502 157302 CDS product SWIM zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904217.1 protein_id gnl|my_center|LOCUS_29130 157343 158071 gene locus_tag LOCUS_29140 157343 158071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 158666 158983 gene locus_tag LOCUS_29150 158666 158983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 159033 159539 gene locus_tag LOCUS_29160 159033 159539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 160940 159684 gene locus_tag LOCUS_29170 160940 159684 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901978.1 protein_id gnl|my_center|LOCUS_29170 161685 161612 gene locus_tag LOCUS_t00430 161685 161612 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 162001 162447 gene locus_tag LOCUS_29180 162001 162447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 162846 162772 gene locus_tag LOCUS_t00440 162846 162772 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 162908 163399 gene locus_tag LOCUS_29190 162908 163399 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902040.1 protein_id gnl|my_center|LOCUS_29190 163472 165418 gene locus_tag LOCUS_29200 163472 165418 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902041.1 protein_id gnl|my_center|LOCUS_29200 166299 165565 gene locus_tag LOCUS_29210 166299 165565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 166883 166539 gene locus_tag LOCUS_29220 166883 166539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 167094 168311 gene locus_tag LOCUS_29230 167094 168311 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403144.1 protein_id gnl|my_center|LOCUS_29230 170734 168404 gene locus_tag LOCUS_29240 gene ppsA 170734 168404 CDS product pyruvate, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902200.1 protein_id gnl|my_center|LOCUS_29240 170958 171173 gene locus_tag LOCUS_29250 170958 171173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 171346 171696 gene locus_tag LOCUS_29260 171346 171696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 172680 171781 gene locus_tag LOCUS_29270 172680 171781 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902202.1 protein_id gnl|my_center|LOCUS_29270 172862 173587 gene locus_tag LOCUS_29280 172862 173587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 174035 173607 gene locus_tag LOCUS_29290 174035 173607 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289398.1 protein_id gnl|my_center|LOCUS_29290 175260 174085 gene locus_tag LOCUS_29300 175260 174085 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902524.1 protein_id gnl|my_center|LOCUS_29300 176856 175423 gene locus_tag LOCUS_29310 176856 175423 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902502.1 protein_id gnl|my_center|LOCUS_29310 178595 177117 gene locus_tag LOCUS_29320 gene thiC 178595 177117 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902492.1 protein_id gnl|my_center|LOCUS_29320 178844 179497 gene locus_tag LOCUS_29330 178844 179497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 179667 180365 gene locus_tag LOCUS_29340 179667 180365 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902203.1 protein_id gnl|my_center|LOCUS_29340 180872 180528 gene locus_tag LOCUS_29350 180872 180528 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289310.1 protein_id gnl|my_center|LOCUS_29350 182095 180953 gene locus_tag LOCUS_29360 182095 180953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 183097 182261 gene locus_tag LOCUS_29370 gene dapD 183097 182261 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946623.1 protein_id gnl|my_center|LOCUS_29370 183861 183094 gene locus_tag LOCUS_29380 gene dapB 183861 183094 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496490.1 protein_id gnl|my_center|LOCUS_29380 184799 183858 gene locus_tag LOCUS_29390 gene dapA 184799 183858 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024349.1 protein_id gnl|my_center|LOCUS_29390 185189 185977 gene locus_tag LOCUS_29400 185189 185977 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289100.1 protein_id gnl|my_center|LOCUS_29400 187410 186349 gene locus_tag LOCUS_29410 187410 186349 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531254.1 protein_id gnl|my_center|LOCUS_29410 188424 187522 gene locus_tag LOCUS_29420 188424 187522 CDS product DUF5784 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289319.1 protein_id gnl|my_center|LOCUS_29420 188683 188850 gene locus_tag LOCUS_29430 188683 188850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 189976 188948 gene locus_tag LOCUS_29440 189976 188948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 190052 190294 gene locus_tag LOCUS_29450 190052 190294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289513.1 protein_id gnl|my_center|LOCUS_29450 190727 192544 gene locus_tag LOCUS_29460 190727 192544 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289512.1 protein_id gnl|my_center|LOCUS_29460 193927 192731 gene locus_tag LOCUS_29470 193927 192731 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903851.1 protein_id gnl|my_center|LOCUS_29470 195029 193920 gene locus_tag LOCUS_29480 195029 193920 CDS product 60S ribosomal export protein NMD3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903850.1 protein_id gnl|my_center|LOCUS_29480 195395 196288 gene locus_tag LOCUS_29490 gene htpX 195395 196288 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022098.1 protein_id gnl|my_center|LOCUS_29490 196548 196369 gene locus_tag LOCUS_29500 196548 196369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 196469 196729 gene locus_tag LOCUS_29510 196469 196729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 198028 196937 gene locus_tag LOCUS_29520 gene priL 198028 196937 CDS product DNA primase regulatory subunit PriL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903675.1 protein_id gnl|my_center|LOCUS_29520 198635 198099 gene locus_tag LOCUS_29530 198635 198099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 199518 198703 gene locus_tag LOCUS_29540 199518 198703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 200031 200933 gene locus_tag LOCUS_29550 200031 200933 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768991.1 protein_id gnl|my_center|LOCUS_29550 201253 200930 gene locus_tag LOCUS_29560 201253 200930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 202024 201344 gene locus_tag LOCUS_29570 202024 201344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 202899 202156 gene locus_tag LOCUS_29580 202899 202156 CDS product DNA polymerase sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903677.1 protein_id gnl|my_center|LOCUS_29580 203701 203237 gene locus_tag LOCUS_29590 gene lrp 203701 203237 CDS product HTH-type transcriptional regulator Lrp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903541.1 protein_id gnl|my_center|LOCUS_29590 204638 204252 gene locus_tag LOCUS_29600 204638 204252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 204977 205855 gene locus_tag LOCUS_29610 204977 205855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 206043 205867 gene locus_tag LOCUS_29620 206043 205867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 206637 206173 gene locus_tag LOCUS_29630 206637 206173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 207071 206649 gene locus_tag LOCUS_29640 207071 206649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 207401 207216 gene locus_tag LOCUS_29650 207401 207216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 207641 207411 gene locus_tag LOCUS_29660 207641 207411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 207892 208614 gene locus_tag LOCUS_29670 207892 208614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 208810 211074 gene locus_tag LOCUS_29680 208810 211074 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082373898.1 protein_id gnl|my_center|LOCUS_29680 211481 211837 gene locus_tag LOCUS_29690 211481 211837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 212268 212579 gene locus_tag LOCUS_29700 212268 212579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 212794 212582 gene locus_tag LOCUS_29710 212794 212582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 214590 212794 gene locus_tag LOCUS_29720 214590 212794 CDS product b(o/a)3-type cytochrome-c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903627.1 protein_id gnl|my_center|LOCUS_29720 215380 214583 gene locus_tag LOCUS_29730 215380 214583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 215622 215377 gene locus_tag LOCUS_29740 215622 215377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 215722 215928 gene locus_tag LOCUS_29750 215722 215928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 215935 218430 gene locus_tag LOCUS_29760 215935 218430 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903632.1 protein_id gnl|my_center|LOCUS_29760 218740 218513 gene locus_tag LOCUS_29770 218740 218513 CDS product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015098.1 protein_id gnl|my_center|LOCUS_29770 218830 219123 gene locus_tag LOCUS_29780 218830 219123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 219846 219166 gene locus_tag LOCUS_29790 gene purQ 219846 219166 CDS product phosphoribosylformylglycinamidine synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903428.1 protein_id gnl|my_center|LOCUS_29790 220184 219906 gene locus_tag LOCUS_29800 gene purS 220184 219906 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903429.1 protein_id gnl|my_center|LOCUS_29800 221477 220209 gene locus_tag LOCUS_29810 221477 220209 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258647.1 protein_id gnl|my_center|LOCUS_29810 221702 222145 gene locus_tag LOCUS_29820 221702 222145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 223040 222156 gene locus_tag LOCUS_29830 223040 222156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 223510 224871 gene locus_tag LOCUS_29840 gene zinU 223510 224871 CDS product zinc metallochaperone ZinU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234625.1 protein_id gnl|my_center|LOCUS_29840 224892 225107 gene locus_tag LOCUS_29850 224892 225107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 225840 225253 gene locus_tag LOCUS_29860 225840 225253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 226032 226982 gene locus_tag LOCUS_29870 226032 226982 CDS product formyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903430.1 protein_id gnl|my_center|LOCUS_29870 227136 227357 gene locus_tag LOCUS_29880 227136 227357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 227945 227733 gene locus_tag LOCUS_29890 227945 227733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 229180 228116 gene locus_tag LOCUS_29900 229180 228116 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289411.1 protein_id gnl|my_center|LOCUS_29900 229513 232110 gene locus_tag LOCUS_29910 gene basT 229513 232110 CDS product chemotaxis signal transducer protein BasT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289396.1 protein_id gnl|my_center|LOCUS_29910 233399 232134 gene locus_tag LOCUS_29920 233399 232134 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083825.1 protein_id gnl|my_center|LOCUS_29920 233528 234910 gene locus_tag LOCUS_29930 gene cofH 233528 234910 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase subunit CofH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903422.1 protein_id gnl|my_center|LOCUS_29930 235346 235489 gene locus_tag LOCUS_29940 235346 235489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 235903 236661 gene locus_tag LOCUS_29950 235903 236661 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820134.1 protein_id gnl|my_center|LOCUS_29950 239049 236863 gene locus_tag LOCUS_29960 239049 236863 CDS product elongation factor EF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903990.1 protein_id gnl|my_center|LOCUS_29960 239339 240094 gene locus_tag LOCUS_29970 239339 240094 CDS product DUF5781 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903991.1 protein_id gnl|my_center|LOCUS_29970 240260 240454 gene locus_tag LOCUS_29980 240260 240454 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289092.1 protein_id gnl|my_center|LOCUS_29980 242507 240669 gene locus_tag LOCUS_29990 242507 240669 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903116.1 protein_id gnl|my_center|LOCUS_29990 243186 242578 gene locus_tag LOCUS_30000 243186 242578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 243328 244758 gene locus_tag LOCUS_30010 243328 244758 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289154.1 protein_id gnl|my_center|LOCUS_30010 245156 244812 gene locus_tag LOCUS_30020 245156 244812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 246713 245163 gene locus_tag LOCUS_30030 246713 245163 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903114.1 protein_id gnl|my_center|LOCUS_30030 247020 248246 gene locus_tag LOCUS_30040 247020 248246 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056637.1 protein_id gnl|my_center|LOCUS_30040 248633 248358 gene locus_tag LOCUS_30050 248633 248358 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890479.1 protein_id gnl|my_center|LOCUS_30050 248827 249552 gene locus_tag LOCUS_30060 248827 249552 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903683.1 protein_id gnl|my_center|LOCUS_30060 249643 250740 gene locus_tag LOCUS_30070 249643 250740 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903903.1 protein_id gnl|my_center|LOCUS_30070 251180 251794 gene locus_tag LOCUS_30080 251180 251794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902048.1 protein_id gnl|my_center|LOCUS_30080 252941 252198 gene locus_tag LOCUS_30090 gene azf 252941 252198 CDS product NAD-dependent glucose-6-phosphate dehydrogenase Azf inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289099.1 protein_id gnl|my_center|LOCUS_30090 253069 253425 gene locus_tag LOCUS_30100 253069 253425 CDS product dihydroneopterin aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902044.1 protein_id gnl|my_center|LOCUS_30100 253735 254163 gene locus_tag LOCUS_30110 253735 254163 CDS product DUF5790 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902043.1 protein_id gnl|my_center|LOCUS_30110 254280 255284 gene locus_tag LOCUS_30120 254280 255284 CDS product TIGR04024 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902973.1 protein_id gnl|my_center|LOCUS_30120 256731 255454 gene locus_tag LOCUS_30130 256731 255454 CDS product DNA double-strand break repair nuclease NurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903386.1 protein_id gnl|my_center|LOCUS_30130 256858 257112 gene locus_tag LOCUS_30140 256858 257112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903384.1 protein_id gnl|my_center|LOCUS_30140 257174 258730 gene locus_tag LOCUS_30150 gene gpmI 257174 258730 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903383.1 protein_id gnl|my_center|LOCUS_30150 258810 260552 gene locus_tag LOCUS_30160 258810 260552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 260673 261959 gene locus_tag LOCUS_30170 260673 261959 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903810.1 protein_id gnl|my_center|LOCUS_30170 262050 262439 gene locus_tag LOCUS_30180 262050 262439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 262782 263309 gene locus_tag LOCUS_30190 262782 263309 CDS product DUF5813 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903410.1 protein_id gnl|my_center|LOCUS_30190 263642 263412 gene locus_tag LOCUS_30200 263642 263412 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289406.1 protein_id gnl|my_center|LOCUS_30200 263786 264493 gene locus_tag LOCUS_30210 263786 264493 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289405.1 protein_id gnl|my_center|LOCUS_30210 264493 264723 gene locus_tag LOCUS_30220 264493 264723 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903411.1 protein_id gnl|my_center|LOCUS_30220 265365 264769 gene locus_tag LOCUS_30230 gene tmk 265365 264769 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903416.1 protein_id gnl|my_center|LOCUS_30230 265467 266375 gene locus_tag LOCUS_30240 265467 266375 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892525.1 protein_id gnl|my_center|LOCUS_30240 266603 267781 gene locus_tag LOCUS_30250 266603 267781 CDS product tubulin/FtsZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289408.1 protein_id gnl|my_center|LOCUS_30250 267870 268508 gene locus_tag LOCUS_30260 gene cofC 267870 268508 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903420.1 protein_id gnl|my_center|LOCUS_30260 269512 268574 gene locus_tag LOCUS_30270 269512 268574 CDS product Vms1/Ankzf1 family peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289389.1 protein_id gnl|my_center|LOCUS_30270 269943 269530 gene locus_tag LOCUS_30280 269943 269530 CDS product DUF5802 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289390.1 protein_id gnl|my_center|LOCUS_30280 270207 271022 gene locus_tag LOCUS_30290 270207 271022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 271093 271746 gene locus_tag LOCUS_30300 271093 271746 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903348.1 protein_id gnl|my_center|LOCUS_30300 272049 271849 gene locus_tag LOCUS_30310 272049 271849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903365.1 protein_id gnl|my_center|LOCUS_30310 272326 272865 gene locus_tag LOCUS_30320 272326 272865 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903364.1 protein_id gnl|my_center|LOCUS_30320 273012 273431 gene locus_tag LOCUS_30330 273012 273431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 273683 273444 gene locus_tag LOCUS_30340 273683 273444 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903129.1 protein_id gnl|my_center|LOCUS_30340 275659 274034 gene locus_tag LOCUS_30350 275659 274034 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903114.1 protein_id gnl|my_center|LOCUS_30350 275824 276303 gene locus_tag LOCUS_30360 275824 276303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 277637 276384 gene locus_tag LOCUS_30370 277637 276384 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903362.1 protein_id gnl|my_center|LOCUS_30370 277830 278921 gene locus_tag LOCUS_30380 277830 278921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 278918 280570 gene locus_tag LOCUS_30390 278918 280570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 280567 281277 gene locus_tag LOCUS_30400 280567 281277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 281274 282656 gene locus_tag LOCUS_30410 281274 282656 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902121.1 protein_id gnl|my_center|LOCUS_30410 282653 284071 gene locus_tag LOCUS_30420 282653 284071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 285068 284103 gene locus_tag LOCUS_30430 285068 284103 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902122.1 protein_id gnl|my_center|LOCUS_30430 285546 286550 gene locus_tag LOCUS_30440 gene hemE 285546 286550 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143865.1 protein_id gnl|my_center|LOCUS_30440 287083 286601 gene locus_tag LOCUS_30450 287083 286601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904189.1 protein_id gnl|my_center|LOCUS_30450 287608 287084 gene locus_tag LOCUS_30460 287608 287084 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904190.1 protein_id gnl|my_center|LOCUS_30460 288791 287730 gene locus_tag LOCUS_30470 gene hemH 288791 287730 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391364.1 protein_id gnl|my_center|LOCUS_30470 290232 288928 gene locus_tag LOCUS_30480 gene hemG 290232 288928 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140945.1 protein_id gnl|my_center|LOCUS_30480 290678 290262 gene locus_tag LOCUS_30490 290678 290262 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289398.1 protein_id gnl|my_center|LOCUS_30490 291634 290861 gene locus_tag LOCUS_30500 291634 290861 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902459.1 protein_id gnl|my_center|LOCUS_30500 292641 291631 gene locus_tag LOCUS_30510 292641 291631 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902458.1 protein_id gnl|my_center|LOCUS_30510 292769 293725 gene locus_tag LOCUS_30520 292769 293725 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030964.1 protein_id gnl|my_center|LOCUS_30520 293777 293977 gene locus_tag LOCUS_30530 293777 293977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 295023 293899 gene locus_tag LOCUS_30540 295023 293899 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902856.1 protein_id gnl|my_center|LOCUS_30540 295172 295603 gene locus_tag LOCUS_30550 295172 295603 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289398.1 protein_id gnl|my_center|LOCUS_30550 295736 296731 gene locus_tag LOCUS_30560 295736 296731 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289230.1 protein_id gnl|my_center|LOCUS_30560 296728 297567 gene locus_tag LOCUS_30570 296728 297567 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968971.1 protein_id gnl|my_center|LOCUS_30570 298617 297640 gene locus_tag LOCUS_30580 298617 297640 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398688.1 protein_id gnl|my_center|LOCUS_30580 299801 298692 gene locus_tag LOCUS_30590 299801 298692 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384035.1 protein_id gnl|my_center|LOCUS_30590 299933 300394 gene locus_tag LOCUS_30600 299933 300394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 301040 300375 gene locus_tag LOCUS_30610 301040 300375 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902491.1 protein_id gnl|my_center|LOCUS_30610 301168 301617 gene locus_tag LOCUS_30620 301168 301617 CDS product deoxycytidine triphosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838163.1 protein_id gnl|my_center|LOCUS_30620 301896 303755 gene locus_tag LOCUS_30630 301896 303755 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858956.1 protein_id gnl|my_center|LOCUS_30630 305035 303752 gene locus_tag LOCUS_30640 305035 303752 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809990.1 protein_id gnl|my_center|LOCUS_30640 306991 305372 gene locus_tag LOCUS_30650 306991 305372 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902970.1 protein_id gnl|my_center|LOCUS_30650 307382 308008 gene locus_tag LOCUS_30660 307382 308008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 308111 308689 gene locus_tag LOCUS_30670 308111 308689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 308698 309888 gene locus_tag LOCUS_30680 308698 309888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 311260 309893 gene locus_tag LOCUS_30690 311260 309893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 311462 311854 gene locus_tag LOCUS_30700 311462 311854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 311949 313091 gene locus_tag LOCUS_30710 311949 313091 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289424.1 protein_id gnl|my_center|LOCUS_30710 314417 313278 gene locus_tag LOCUS_30720 314417 313278 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902861.1 protein_id gnl|my_center|LOCUS_30720 316951 314732 gene locus_tag LOCUS_30730 316951 314732 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064637.1 protein_id gnl|my_center|LOCUS_30730 318043 316961 gene locus_tag LOCUS_30740 318043 316961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 >Feature sequence42 725 90 gene locus_tag LOCUS_30750 725 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 950 1378 gene locus_tag LOCUS_30760 950 1378 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903993.1 protein_id gnl|my_center|LOCUS_30760 1381 1989 gene locus_tag LOCUS_30770 1381 1989 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903992.1 protein_id gnl|my_center|LOCUS_30770 3723 2305 gene locus_tag LOCUS_30780 gene cyoE 3723 2305 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902456.1 protein_id gnl|my_center|LOCUS_30780 4149 3823 gene locus_tag LOCUS_30790 4149 3823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902467.1 protein_id gnl|my_center|LOCUS_30790 4650 4237 gene locus_tag LOCUS_30800 4650 4237 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902240.1 protein_id gnl|my_center|LOCUS_30800 4742 5851 gene locus_tag LOCUS_30810 4742 5851 CDS product trans-acting enoyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903604.1 protein_id gnl|my_center|LOCUS_30810 6809 5925 gene locus_tag LOCUS_30820 6809 5925 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902239.1 protein_id gnl|my_center|LOCUS_30820 7488 6802 gene locus_tag LOCUS_30830 7488 6802 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902238.1 protein_id gnl|my_center|LOCUS_30830 9131 7485 gene locus_tag LOCUS_30840 gene pabB 9131 7485 CDS product aminodeoxychorismate synthase, component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902237.1 protein_id gnl|my_center|LOCUS_30840 9865 9227 gene locus_tag LOCUS_30850 9865 9227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 10787 9984 gene locus_tag LOCUS_30860 10787 9984 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902235.1 protein_id gnl|my_center|LOCUS_30860 11052 10915 gene locus_tag LOCUS_30870 11052 10915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 11163 11717 gene locus_tag LOCUS_30880 11163 11717 CDS product GMP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902125.1 protein_id gnl|my_center|LOCUS_30880 13360 12068 gene locus_tag LOCUS_30890 13360 12068 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459437.1 protein_id gnl|my_center|LOCUS_30890 13768 13556 gene locus_tag LOCUS_30900 13768 13556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 14998 13982 gene locus_tag LOCUS_30910 14998 13982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 15348 15788 gene locus_tag LOCUS_30920 15348 15788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 15864 18695 gene locus_tag LOCUS_30930 15864 18695 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902906.1 protein_id gnl|my_center|LOCUS_30930 18715 20781 gene locus_tag LOCUS_30940 18715 20781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 20934 21323 gene locus_tag LOCUS_30950 20934 21323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 21383 22885 gene locus_tag LOCUS_30960 21383 22885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 25587 22981 gene locus_tag LOCUS_30970 25587 22981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 26045 26662 gene locus_tag LOCUS_30980 26045 26662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 26813 28075 gene locus_tag LOCUS_30990 26813 28075 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289252.1 protein_id gnl|my_center|LOCUS_30990 28072 28935 gene locus_tag LOCUS_31000 gene cheF1 28072 28935 CDS product chemotaxis protein CheF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902684.1 protein_id gnl|my_center|LOCUS_31000 29130 28936 gene locus_tag LOCUS_31010 29130 28936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 29310 29612 gene locus_tag LOCUS_31020 29310 29612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902209.1 protein_id gnl|my_center|LOCUS_31020 29742 33329 gene locus_tag LOCUS_31030 gene smc 29742 33329 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902208.1 protein_id gnl|my_center|LOCUS_31030 33322 34365 gene locus_tag LOCUS_31040 33322 34365 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902207.1 protein_id gnl|my_center|LOCUS_31040 34438 34815 gene locus_tag LOCUS_31050 34438 34815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 36127 35354 gene locus_tag LOCUS_31060 36127 35354 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391918.1 protein_id gnl|my_center|LOCUS_31060 36275 37471 gene locus_tag LOCUS_31070 36275 37471 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230129.1 protein_id gnl|my_center|LOCUS_31070 37471 38454 gene locus_tag LOCUS_31080 37471 38454 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223562.1 protein_id gnl|my_center|LOCUS_31080 39431 38481 gene locus_tag LOCUS_31090 39431 38481 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289328.1 protein_id gnl|my_center|LOCUS_31090 40038 41348 gene locus_tag LOCUS_31100 40038 41348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 41586 42533 gene locus_tag LOCUS_31110 41586 42533 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237985.1 protein_id gnl|my_center|LOCUS_31110 42530 43411 gene locus_tag LOCUS_31120 42530 43411 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531924.1 protein_id gnl|my_center|LOCUS_31120 43458 44534 gene locus_tag LOCUS_31130 gene ugpC 43458 44534 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972908.1 protein_id gnl|my_center|LOCUS_31130 44587 45969 gene locus_tag LOCUS_31140 44587 45969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 46520 45966 gene locus_tag LOCUS_31150 46520 45966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 48011 46527 gene locus_tag LOCUS_31160 48011 46527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 49436 48249 gene locus_tag LOCUS_31170 49436 48249 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006824761.1 protein_id gnl|my_center|LOCUS_31170 49968 49693 gene locus_tag LOCUS_31180 49968 49693 CDS product MTH865 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060916.1 protein_id gnl|my_center|LOCUS_31180 51050 50070 gene locus_tag LOCUS_31190 51050 50070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 51296 52897 gene locus_tag LOCUS_31200 51296 52897 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902970.1 protein_id gnl|my_center|LOCUS_31200 52941 53678 gene locus_tag LOCUS_31210 52941 53678 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902470.1 protein_id gnl|my_center|LOCUS_31210 53971 54912 gene locus_tag LOCUS_31220 53971 54912 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902170.1 protein_id gnl|my_center|LOCUS_31220 56440 55190 gene locus_tag LOCUS_31230 56440 55190 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229261.1 protein_id gnl|my_center|LOCUS_31230 56612 58168 gene locus_tag LOCUS_31240 56612 58168 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902970.1 protein_id gnl|my_center|LOCUS_31240 59089 59006 gene locus_tag LOCUS_t00450 59089 59006 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 59876 59130 gene locus_tag LOCUS_31250 59876 59130 CDS product DUF2064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902885.1 protein_id gnl|my_center|LOCUS_31250 59971 60195 gene locus_tag LOCUS_31260 59971 60195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 60957 60247 gene locus_tag LOCUS_31270 60957 60247 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902887.1 protein_id gnl|my_center|LOCUS_31270 61286 60987 gene locus_tag LOCUS_31280 61286 60987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 62372 61296 gene locus_tag LOCUS_31290 62372 61296 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902811.1 protein_id gnl|my_center|LOCUS_31290 62751 62422 gene locus_tag LOCUS_31300 62751 62422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289331.1 protein_id gnl|my_center|LOCUS_31300 62865 63236 gene locus_tag LOCUS_31310 62865 63236 CDS product DUF5783 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289487.1 protein_id gnl|my_center|LOCUS_31310 64601 63243 gene locus_tag LOCUS_31320 64601 63243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 65926 65543 gene locus_tag LOCUS_31330 65926 65543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 66141 67196 gene locus_tag LOCUS_31340 66141 67196 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020262.1 protein_id gnl|my_center|LOCUS_31340 67249 68016 gene locus_tag LOCUS_31350 67249 68016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 68013 68525 gene locus_tag LOCUS_31360 68013 68525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 68592 70517 gene locus_tag LOCUS_31370 68592 70517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 70514 72244 gene locus_tag LOCUS_31380 70514 72244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 72319 73449 gene locus_tag LOCUS_31390 72319 73449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 73427 73930 gene locus_tag LOCUS_31400 73427 73930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 73924 74937 gene locus_tag LOCUS_31410 73924 74937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 75009 78263 gene locus_tag LOCUS_31420 75009 78263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 78406 79371 gene locus_tag LOCUS_31430 gene cbiG 78406 79371 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903134.1 protein_id gnl|my_center|LOCUS_31430 79368 80267 gene locus_tag LOCUS_31440 79368 80267 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903135.1 protein_id gnl|my_center|LOCUS_31440 80285 81331 gene locus_tag LOCUS_31450 gene cobJ 80285 81331 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903136.1 protein_id gnl|my_center|LOCUS_31450 81362 81628 gene locus_tag LOCUS_31460 81362 81628 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903137.1 protein_id gnl|my_center|LOCUS_31460 81625 82392 gene locus_tag LOCUS_31470 81625 82392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903138.1 protein_id gnl|my_center|LOCUS_31470 82448 83677 gene locus_tag LOCUS_31480 82448 83677 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289353.1 protein_id gnl|my_center|LOCUS_31480 83753 84127 gene locus_tag LOCUS_31490 83753 84127 CDS product DUF3209 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903140.1 protein_id gnl|my_center|LOCUS_31490 84127 85437 gene locus_tag LOCUS_31500 84127 85437 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903141.1 protein_id gnl|my_center|LOCUS_31500 86616 85471 gene locus_tag LOCUS_31510 86616 85471 CDS product DR2241 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902784.1 protein_id gnl|my_center|LOCUS_31510 87515 86619 gene locus_tag LOCUS_31520 87515 86619 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902785.1 protein_id gnl|my_center|LOCUS_31520 88007 87654 gene locus_tag LOCUS_31530 88007 87654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 88207 90414 gene locus_tag LOCUS_31540 88207 90414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 90516 91199 gene locus_tag LOCUS_31550 gene nth 90516 91199 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902399.1 protein_id gnl|my_center|LOCUS_31550 91286 91528 gene locus_tag LOCUS_31560 91286 91528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 92401 91580 gene locus_tag LOCUS_31570 92401 91580 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157849919.1 protein_id gnl|my_center|LOCUS_31570 93789 92479 gene locus_tag LOCUS_31580 93789 92479 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902386.1 protein_id gnl|my_center|LOCUS_31580 94127 93882 gene locus_tag LOCUS_31590 94127 93882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 94011 94337 gene locus_tag LOCUS_31600 94011 94337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 94348 94563 gene locus_tag LOCUS_31610 94348 94563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 95319 94591 gene locus_tag LOCUS_31620 95319 94591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289326.1 protein_id gnl|my_center|LOCUS_31620 95581 95727 gene locus_tag LOCUS_31630 95581 95727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 96178 96453 gene locus_tag LOCUS_31640 96178 96453 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289582.1 protein_id gnl|my_center|LOCUS_31640 96581 97873 gene locus_tag LOCUS_31650 96581 97873 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136361690.1 protein_id gnl|my_center|LOCUS_31650 97954 98304 gene locus_tag LOCUS_31660 97954 98304 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136360906.1 protein_id gnl|my_center|LOCUS_31660 98304 98600 gene locus_tag LOCUS_31670 98304 98600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 98787 99137 gene locus_tag LOCUS_31680 98787 99137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 100549 99194 gene locus_tag LOCUS_31690 gene purD 100549 99194 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902946.1 protein_id gnl|my_center|LOCUS_31690 101820 100663 gene locus_tag LOCUS_31700 101820 100663 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289129.1 protein_id gnl|my_center|LOCUS_31700 102362 103939 gene locus_tag LOCUS_31710 gene htr8 102362 103939 CDS product chemotaxis signal transducer protein Htr8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903109.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31710 104136 105293 gene locus_tag LOCUS_31720 gene coaBC 104136 105293 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902383.1 protein_id gnl|my_center|LOCUS_31720 105519 106121 gene locus_tag LOCUS_31730 105519 106121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005553844.1 protein_id gnl|my_center|LOCUS_31730 106263 106832 gene locus_tag LOCUS_31740 gene hpt 106263 106832 CDS product hypoxanthine/guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902373.1 protein_id gnl|my_center|LOCUS_31740 106988 108625 gene locus_tag LOCUS_31750 106988 108625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 108638 109588 gene locus_tag LOCUS_31760 108638 109588 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016361.1 protein_id gnl|my_center|LOCUS_31760 109585 110691 gene locus_tag LOCUS_31770 gene gsiD 109585 110691 CDS product glutathione ABC transporter permease GsiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524243.1 protein_id gnl|my_center|LOCUS_31770 110691 111830 gene locus_tag LOCUS_31780 110691 111830 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081442.1 protein_id gnl|my_center|LOCUS_31780 111827 113113 gene locus_tag LOCUS_31790 111827 113113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 113229 113684 gene locus_tag LOCUS_31800 113229 113684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 113887 114627 gene locus_tag LOCUS_31810 113887 114627 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289098.1 protein_id gnl|my_center|LOCUS_31810 116021 114798 gene locus_tag LOCUS_31820 116021 114798 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065859.1 protein_id gnl|my_center|LOCUS_31820 116848 116018 gene locus_tag LOCUS_31830 116848 116018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 117053 117472 gene locus_tag LOCUS_31840 117053 117472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 117540 118850 gene locus_tag LOCUS_31850 gene hmgA 117540 118850 CDS product hydroxymethylglutaryl-CoA reductase (NADPH) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903374.1 protein_id gnl|my_center|LOCUS_31850 119585 118926 gene locus_tag LOCUS_31860 119585 118926 CDS product HVO_0476 family zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902018.1 protein_id gnl|my_center|LOCUS_31860 >Feature sequence43 1598 291 gene locus_tag LOCUS_31870 1598 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 2189 1941 gene locus_tag LOCUS_31880 2189 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 2583 4148 gene locus_tag LOCUS_31890 2583 4148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 5915 4563 gene locus_tag LOCUS_31900 5915 4563 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259421.1 protein_id gnl|my_center|LOCUS_31900 6351 6088 gene locus_tag LOCUS_31910 6351 6088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 6963 6355 gene locus_tag LOCUS_31920 6963 6355 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890414.1 protein_id gnl|my_center|LOCUS_31920 7210 6965 gene locus_tag LOCUS_31930 7210 6965 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890415.1 protein_id gnl|my_center|LOCUS_31930 7446 8648 gene locus_tag LOCUS_31940 7446 8648 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890416.1 protein_id gnl|my_center|LOCUS_31940 8669 9226 gene locus_tag LOCUS_31950 8669 9226 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890417.1 protein_id gnl|my_center|LOCUS_31950 9229 9687 gene locus_tag LOCUS_31960 9229 9687 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890418.1 protein_id gnl|my_center|LOCUS_31960 9740 10810 gene locus_tag LOCUS_31970 gene gap 9740 10810 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976871.1 protein_id gnl|my_center|LOCUS_31970 10854 12074 gene locus_tag LOCUS_31980 gene pgk 10854 12074 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064339.1 protein_id gnl|my_center|LOCUS_31980 14065 12515 gene locus_tag LOCUS_31990 14065 12515 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289376.1 protein_id gnl|my_center|LOCUS_31990 14216 15088 gene locus_tag LOCUS_32000 14216 15088 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545088.1 protein_id gnl|my_center|LOCUS_32000 15382 15089 gene locus_tag LOCUS_32010 15382 15089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 15749 16180 gene locus_tag LOCUS_32020 15749 16180 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289398.1 protein_id gnl|my_center|LOCUS_32020 16221 16643 gene locus_tag LOCUS_32030 16221 16643 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496534.1 protein_id gnl|my_center|LOCUS_32030 16719 17138 gene locus_tag LOCUS_32040 16719 17138 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289521.1 protein_id gnl|my_center|LOCUS_32040 17222 18043 gene locus_tag LOCUS_32050 17222 18043 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061282.1 protein_id gnl|my_center|LOCUS_32050 18399 18055 gene locus_tag LOCUS_32060 18399 18055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 20039 18714 gene locus_tag LOCUS_32070 20039 18714 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903721.1 protein_id gnl|my_center|LOCUS_32070 20666 20253 gene locus_tag LOCUS_32080 20666 20253 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289398.1 protein_id gnl|my_center|LOCUS_32080 21263 20820 gene locus_tag LOCUS_32090 21263 20820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 21620 21372 gene locus_tag LOCUS_32100 21620 21372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 22467 22030 gene locus_tag LOCUS_32110 22467 22030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 22924 24252 gene locus_tag LOCUS_32120 22924 24252 CDS product TIGR00341 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289527.1 protein_id gnl|my_center|LOCUS_32120 >Feature sequence44 3287 30 gene locus_tag LOCUS_32130 3287 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 3487 4725 gene locus_tag LOCUS_32140 3487 4725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 4880 5380 gene locus_tag LOCUS_32150 4880 5380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 6630 5389 gene locus_tag LOCUS_32160 6630 5389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 7916 6858 gene locus_tag LOCUS_32170 7916 6858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 8695 8030 gene locus_tag LOCUS_32180 8695 8030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 9693 8695 gene locus_tag LOCUS_32190 9693 8695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904135.1 protein_id gnl|my_center|LOCUS_32190 9776 9991 gene locus_tag LOCUS_32200 9776 9991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 10966 10139 gene locus_tag LOCUS_32210 10966 10139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 11300 10959 gene locus_tag LOCUS_32220 11300 10959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 12259 11297 gene locus_tag LOCUS_32230 12259 11297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 12861 12262 gene locus_tag LOCUS_32240 12861 12262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 13468 13887 gene locus_tag LOCUS_32250 13468 13887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 15245 14043 gene locus_tag LOCUS_32260 gene nifS 15245 14043 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583089.1 protein_id gnl|my_center|LOCUS_32260 15646 15242 gene locus_tag LOCUS_32270 15646 15242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 17699 15639 gene locus_tag LOCUS_32280 gene dndD 17699 15639 CDS product DNA sulfur modification protein DndD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109923.1 protein_id gnl|my_center|LOCUS_32280 19201 17696 gene locus_tag LOCUS_32290 gene dndC 19201 17696 CDS product DNA phosphorothioation system sulfurtransferase DndC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109921.1 protein_id gnl|my_center|LOCUS_32290 19398 21587 gene locus_tag LOCUS_32300 19398 21587 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779460.1 protein_id gnl|my_center|LOCUS_32300 21682 21876 gene locus_tag LOCUS_32310 21682 21876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 21878 23863 gene locus_tag LOCUS_32320 21878 23863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 23863 24321 gene locus_tag LOCUS_32330 23863 24321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 24781 24353 gene locus_tag LOCUS_32340 24781 24353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 24915 25310 gene locus_tag LOCUS_32350 24915 25310 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642555.1 protein_id gnl|my_center|LOCUS_32350 25436 25194 gene locus_tag LOCUS_32360 25436 25194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 >Feature sequence45 212 724 gene locus_tag LOCUS_32370 212 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 1343 738 gene locus_tag LOCUS_32380 1343 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 1570 2241 gene locus_tag LOCUS_32390 1570 2241 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065619.1 protein_id gnl|my_center|LOCUS_32390 2634 2263 gene locus_tag LOCUS_32400 2634 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 2843 3760 gene locus_tag LOCUS_32410 2843 3760 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080497.1 protein_id gnl|my_center|LOCUS_32410 3753 4538 gene locus_tag LOCUS_32420 3753 4538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 5295 6704 gene locus_tag LOCUS_32430 5295 6704 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890488.1 protein_id gnl|my_center|LOCUS_32430 6691 8043 gene locus_tag LOCUS_32440 6691 8043 CDS product DUF790 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890489.1 protein_id gnl|my_center|LOCUS_32440 11790 8128 gene locus_tag LOCUS_32450 11790 8128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 14971 11783 gene locus_tag LOCUS_32460 14971 11783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 15974 15129 gene locus_tag LOCUS_32470 15974 15129 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810982.1 protein_id gnl|my_center|LOCUS_32470 16543 15971 gene locus_tag LOCUS_32480 16543 15971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 16651 17370 gene locus_tag LOCUS_32490 16651 17370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 18631 17708 gene locus_tag LOCUS_32500 18631 17708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 19504 19977 gene locus_tag LOCUS_32510 19504 19977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 20194 20574 gene locus_tag LOCUS_32520 gene tnpA 20194 20574 CDS product IS200/IS605-like element ISH35 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904062.1 protein_id gnl|my_center|LOCUS_32520 20571 21848 gene locus_tag LOCUS_32530 20571 21848 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904192.1 protein_id gnl|my_center|LOCUS_32530 22075 22983 gene locus_tag LOCUS_32540 22075 22983 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289741.1 protein_id gnl|my_center|LOCUS_32540 22980 23825 gene locus_tag LOCUS_32550 22980 23825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 24416 23835 gene locus_tag LOCUS_32560 24416 23835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 24610 25569 gene locus_tag LOCUS_32570 24610 25569 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026837.1 protein_id gnl|my_center|LOCUS_32570 25566 26111 gene locus_tag LOCUS_32580 25566 26111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 >Feature sequence46 517 1071 gene locus_tag LOCUS_32590 517 1071 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880943.1 protein_id gnl|my_center|LOCUS_32590 1580 1425 gene locus_tag LOCUS_32600 1580 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 1676 3562 gene locus_tag LOCUS_32610 1676 3562 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640291.1 protein_id gnl|my_center|LOCUS_32610 3573 3932 gene locus_tag LOCUS_32620 3573 3932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 3938 5056 gene locus_tag LOCUS_32630 3938 5056 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460067.1 protein_id gnl|my_center|LOCUS_32630 5053 5439 gene locus_tag LOCUS_32640 5053 5439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 5436 6605 gene locus_tag LOCUS_32650 5436 6605 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460067.1 protein_id gnl|my_center|LOCUS_32650 8227 6899 gene locus_tag LOCUS_32660 8227 6899 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339635.1 protein_id gnl|my_center|LOCUS_32660 9604 8600 gene locus_tag LOCUS_32670 9604 8600 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284240.1 protein_id gnl|my_center|LOCUS_32670 10942 9680 gene locus_tag LOCUS_32680 10942 9680 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901978.1 protein_id gnl|my_center|LOCUS_32680 >Feature sequence47 1698 226 gene locus_tag LOCUS_32690 1698 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 >Feature sequence48 1253 96 gene locus_tag LOCUS_32700 1253 96 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903212.1 protein_id gnl|my_center|LOCUS_32700 1351 1665 gene locus_tag LOCUS_32710 1351 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 1824 2585 gene locus_tag LOCUS_32720 1824 2585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 2675 3457 gene locus_tag LOCUS_32730 2675 3457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 4138 3566 gene locus_tag LOCUS_32740 4138 3566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 4242 4805 gene locus_tag LOCUS_32750 4242 4805 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902490.1 protein_id gnl|my_center|LOCUS_32750 5400 4954 gene locus_tag LOCUS_32760 5400 4954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 6636 5548 gene locus_tag LOCUS_32770 6636 5548 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902659.1 protein_id gnl|my_center|LOCUS_32770 6761 7288 gene locus_tag LOCUS_32780 6761 7288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 8616 7378 gene locus_tag LOCUS_32790 8616 7378 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902792.1 protein_id gnl|my_center|LOCUS_32790 9796 8714 gene locus_tag LOCUS_32800 9796 8714 CDS product Brp/Blh family beta-carotene 15,15'-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289439.1 protein_id gnl|my_center|LOCUS_32800 10568 9786 gene locus_tag LOCUS_32810 gene crtY 10568 9786 CDS product lycopene beta-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289440.1 protein_id gnl|my_center|LOCUS_32810 10813 11667 gene locus_tag LOCUS_32820 10813 11667 CDS product bacteriorhodopsin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405484.1 protein_id gnl|my_center|LOCUS_32820 12265 11921 gene locus_tag LOCUS_32830 12265 11921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 13326 12283 gene locus_tag LOCUS_32840 13326 12283 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902794.1 protein_id gnl|my_center|LOCUS_32840 13960 13328 gene locus_tag LOCUS_32850 13960 13328 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902795.1 protein_id gnl|my_center|LOCUS_32850 14130 14735 gene locus_tag LOCUS_32860 14130 14735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 16163 14763 gene locus_tag LOCUS_32870 16163 14763 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406951.1 protein_id gnl|my_center|LOCUS_32870 16334 17341 gene locus_tag LOCUS_32880 16334 17341 CDS product TIGR04024 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902973.1 protein_id gnl|my_center|LOCUS_32880 18549 17428 gene locus_tag LOCUS_32890 18549 17428 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902330.1 protein_id gnl|my_center|LOCUS_32890 19067 18657 gene locus_tag LOCUS_32900 19067 18657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 19200 20297 gene locus_tag LOCUS_32910 19200 20297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 20303 20659 gene locus_tag LOCUS_32920 20303 20659 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730101.1 protein_id gnl|my_center|LOCUS_32920 20715 21647 gene locus_tag LOCUS_32930 20715 21647 CDS product 16S ribosomal RNA methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902839.1 protein_id gnl|my_center|LOCUS_32930 21721 22932 gene locus_tag LOCUS_32940 21721 22932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 24033 23059 gene locus_tag LOCUS_32950 24033 23059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902219.1 protein_id gnl|my_center|LOCUS_32950 24489 24175 gene locus_tag LOCUS_32960 24489 24175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 24608 24895 gene locus_tag LOCUS_32970 24608 24895 CDS product DUF5789 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289142.1 protein_id gnl|my_center|LOCUS_32970 24902 25600 gene locus_tag LOCUS_32980 24902 25600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 26300 25605 gene locus_tag LOCUS_32990 26300 25605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 27103 26336 gene locus_tag LOCUS_33000 27103 26336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 27855 27100 gene locus_tag LOCUS_33010 27855 27100 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391616.1 protein_id gnl|my_center|LOCUS_33010 28831 27914 gene locus_tag LOCUS_33020 28831 27914 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943338.1 protein_id gnl|my_center|LOCUS_33020 29182 30114 gene locus_tag LOCUS_33030 29182 30114 CDS product sulfide-dependent adenosine diphosphate thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903946.1 protein_id gnl|my_center|LOCUS_33030 30462 31238 gene locus_tag LOCUS_33040 30462 31238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 31795 31457 gene locus_tag LOCUS_33050 31795 31457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 33212 31911 gene locus_tag LOCUS_33060 gene nreA 33212 31911 CDS product DNA repair protein NreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289141.1 protein_id gnl|my_center|LOCUS_33060 33345 35192 gene locus_tag LOCUS_33070 33345 35192 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289426.1 protein_id gnl|my_center|LOCUS_33070 35747 35490 gene locus_tag LOCUS_33080 35747 35490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 35885 36070 gene locus_tag LOCUS_33090 35885 36070 CDS product zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902845.1 protein_id gnl|my_center|LOCUS_33090 36079 36345 gene locus_tag LOCUS_33100 36079 36345 CDS product elongation factor 1-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289285.1 protein_id gnl|my_center|LOCUS_33100 36482 37795 gene locus_tag LOCUS_33110 36482 37795 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270475.1 protein_id gnl|my_center|LOCUS_33110 38431 37994 gene locus_tag LOCUS_33120 38431 37994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 39248 38586 gene locus_tag LOCUS_33130 39248 38586 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964695.1 protein_id gnl|my_center|LOCUS_33130 39455 40447 gene locus_tag LOCUS_33140 39455 40447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 41530 40487 gene locus_tag LOCUS_33150 41530 40487 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903058.1 protein_id gnl|my_center|LOCUS_33150 42177 41719 gene locus_tag LOCUS_33160 42177 41719 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289332.1 protein_id gnl|my_center|LOCUS_33160 42348 42824 gene locus_tag LOCUS_33170 42348 42824 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892508.1 protein_id gnl|my_center|LOCUS_33170 42923 44098 gene locus_tag LOCUS_33180 gene priS 42923 44098 CDS product DNA primase small subunit PriS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289337.1 protein_id gnl|my_center|LOCUS_33180 44095 45054 gene locus_tag LOCUS_33190 44095 45054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903072.1 protein_id gnl|my_center|LOCUS_33190 45136 45624 gene locus_tag LOCUS_33200 45136 45624 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902865.1 protein_id gnl|my_center|LOCUS_33200 48120 45853 gene locus_tag LOCUS_33210 48120 45853 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903073.1 protein_id gnl|my_center|LOCUS_33210 48362 48117 gene locus_tag LOCUS_33220 48362 48117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 48544 49317 gene locus_tag LOCUS_33230 48544 49317 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289338.1 protein_id gnl|my_center|LOCUS_33230 49555 49355 gene locus_tag LOCUS_33240 49555 49355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 50499 49687 gene locus_tag LOCUS_33250 gene panB 50499 49687 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903078.1 protein_id gnl|my_center|LOCUS_33250 50630 50863 gene locus_tag LOCUS_33260 50630 50863 CDS product DUF5822 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289339.1 protein_id gnl|my_center|LOCUS_33260 51471 50878 gene locus_tag LOCUS_33270 51471 50878 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289340.1 protein_id gnl|my_center|LOCUS_33270 52198 51506 gene locus_tag LOCUS_33280 52198 51506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 52310 53680 gene locus_tag LOCUS_33290 gene nrfD 52310 53680 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228899.1 protein_id gnl|my_center|LOCUS_33290 54872 53739 gene locus_tag LOCUS_33300 54872 53739 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903082.1 protein_id gnl|my_center|LOCUS_33300 55202 57961 gene locus_tag LOCUS_33310 55202 57961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 58192 60174 gene locus_tag LOCUS_33320 58192 60174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 60328 61665 gene locus_tag LOCUS_33330 gene hmgB 60328 61665 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903175.1 protein_id gnl|my_center|LOCUS_33330 61759 62559 gene locus_tag LOCUS_33340 gene pyrF 61759 62559 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903220.1 protein_id gnl|my_center|LOCUS_33340 63778 62606 gene locus_tag LOCUS_33350 63778 62606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 65814 63910 gene locus_tag LOCUS_33360 65814 63910 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064996.1 protein_id gnl|my_center|LOCUS_33360 65952 66449 gene locus_tag LOCUS_33370 65952 66449 CDS product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902543.1 protein_id gnl|my_center|LOCUS_33370 66446 66877 gene locus_tag LOCUS_33380 66446 66877 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902542.1 protein_id gnl|my_center|LOCUS_33380 67196 68566 gene locus_tag LOCUS_33390 67196 68566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 68754 68599 gene locus_tag LOCUS_33400 68754 68599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 68988 70724 gene locus_tag LOCUS_33410 gene ilvD 68988 70724 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839606.1 protein_id gnl|my_center|LOCUS_33410 71370 70741 gene locus_tag LOCUS_33420 71370 70741 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902576.1 protein_id gnl|my_center|LOCUS_33420 71525 71854 gene locus_tag LOCUS_33430 71525 71854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 73835 71967 gene locus_tag LOCUS_33440 73835 71967 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877065.1 protein_id gnl|my_center|LOCUS_33440 74266 75216 gene locus_tag LOCUS_33450 74266 75216 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903163.1 protein_id gnl|my_center|LOCUS_33450 75213 76028 gene locus_tag LOCUS_33460 75213 76028 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903162.1 protein_id gnl|my_center|LOCUS_33460 76110 78200 gene locus_tag LOCUS_33470 76110 78200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 78401 78326 gene locus_tag LOCUS_t00460 78401 78326 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence49 94 276 gene locus_tag LOCUS_33480 94 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 1259 1041 gene locus_tag LOCUS_33490 1259 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 1592 1831 gene locus_tag LOCUS_33500 1592 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 2073 1828 gene locus_tag LOCUS_33510 2073 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 2558 2154 gene locus_tag LOCUS_33520 2558 2154 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289078.1 protein_id gnl|my_center|LOCUS_33520 2887 2591 gene locus_tag LOCUS_33530 2887 2591 CDS product DUF6516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901977.1 protein_id gnl|my_center|LOCUS_33530 3214 3416 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcatacagcggcactccgg >Feature sequence50 911 27 gene locus_tag LOCUS_33540 911 27 CDS product IS1595-like element ISH4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890474.1 protein_id gnl|my_center|LOCUS_33540 >Feature sequence51 1176 724 gene locus_tag LOCUS_33550 1176 724 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902933.1 protein_id gnl|my_center|LOCUS_33550 1423 1232 gene locus_tag LOCUS_33560 1423 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 1738 1562 gene locus_tag LOCUS_33570 1738 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 2504 1824 gene locus_tag LOCUS_33580 2504 1824 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902372.1 protein_id gnl|my_center|LOCUS_33580 2646 3104 gene locus_tag LOCUS_33590 2646 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 4182 3178 gene locus_tag LOCUS_33600 4182 3178 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135662722.1 protein_id gnl|my_center|LOCUS_33600 4521 5585 gene locus_tag LOCUS_33610 gene nirK 4521 5585 CDS product copper-containing nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225006.1 protein_id gnl|my_center|LOCUS_33610 5627 6223 gene locus_tag LOCUS_33620 5627 6223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 6482 6174 gene locus_tag LOCUS_33630 6482 6174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 6481 7944 gene locus_tag LOCUS_33640 gene cyoE 6481 7944 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902456.1 protein_id gnl|my_center|LOCUS_33640 8356 9123 gene locus_tag LOCUS_33650 8356 9123 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902066.1 protein_id gnl|my_center|LOCUS_33650 9125 9658 gene locus_tag LOCUS_33660 9125 9658 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289107.1 protein_id gnl|my_center|LOCUS_33660 9718 10380 gene locus_tag LOCUS_33670 9718 10380 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902064.1 protein_id gnl|my_center|LOCUS_33670 10506 10655 gene locus_tag LOCUS_33680 10506 10655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 10660 11202 gene locus_tag LOCUS_33690 10660 11202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 11204 13003 gene locus_tag LOCUS_33700 11204 13003 CDS product b(o/a)3-type cytochrome-c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903627.1 protein_id gnl|my_center|LOCUS_33700 13065 13778 gene locus_tag LOCUS_33710 13065 13778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 13911 16400 gene locus_tag LOCUS_33720 13911 16400 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903632.1 protein_id gnl|my_center|LOCUS_33720 16576 16944 gene locus_tag LOCUS_33730 16576 16944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 17134 18312 gene locus_tag LOCUS_33740 17134 18312 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023935.1 protein_id gnl|my_center|LOCUS_33740 18312 19739 gene locus_tag LOCUS_33750 18312 19739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 20773 19775 gene locus_tag LOCUS_33760 20773 19775 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902989.1 protein_id gnl|my_center|LOCUS_33760 21057 20842 gene locus_tag LOCUS_33770 21057 20842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 22007 21585 gene locus_tag LOCUS_33780 22007 21585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 22125 22904 gene locus_tag LOCUS_33790 gene trpC 22125 22904 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902180.1 protein_id gnl|my_center|LOCUS_33790 22937 24202 gene locus_tag LOCUS_33800 gene trpB 22937 24202 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902181.1 protein_id gnl|my_center|LOCUS_33800 24199 25149 gene locus_tag LOCUS_33810 gene trpA 24199 25149 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902182.1 protein_id gnl|my_center|LOCUS_33810 25174 25971 gene locus_tag LOCUS_33820 25174 25971 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902183.1 protein_id gnl|my_center|LOCUS_33820 26857 26144 gene locus_tag LOCUS_33830 26857 26144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 27246 29417 gene locus_tag LOCUS_33840 27246 29417 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838171.1 protein_id gnl|my_center|LOCUS_33840 31672 29450 gene locus_tag LOCUS_33850 31672 29450 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838171.1 protein_id gnl|my_center|LOCUS_33850 32400 31975 gene locus_tag LOCUS_33860 32400 31975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 32562 33935 gene locus_tag LOCUS_33870 gene truD 32562 33935 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902134.1 protein_id gnl|my_center|LOCUS_33870 34620 33997 gene locus_tag LOCUS_33880 34620 33997 CDS product 30S ribosomal protein S3ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902549.1 protein_id gnl|my_center|LOCUS_33880 34987 34613 gene locus_tag LOCUS_33890 34987 34613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 36234 34984 gene locus_tag LOCUS_33900 36234 34984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902551.1 protein_id gnl|my_center|LOCUS_33900 36703 36245 gene locus_tag LOCUS_33910 36703 36245 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902552.1 protein_id gnl|my_center|LOCUS_33910 37225 37551 gene locus_tag LOCUS_33920 37225 37551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 38057 38128 gene locus_tag LOCUS_t00470 38057 38128 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 38631 38984 gene locus_tag LOCUS_33930 38631 38984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 38977 39324 gene locus_tag LOCUS_33940 38977 39324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 >Feature sequence52 692 453 gene locus_tag LOCUS_33950 692 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 1166 696 gene locus_tag LOCUS_33960 1166 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 2194 4059 gene locus_tag LOCUS_33970 2194 4059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 4112 4825 gene locus_tag LOCUS_33980 4112 4825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 5246 5172 gene locus_tag LOCUS_t00480 5246 5172 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 5369 5941 gene locus_tag LOCUS_33990 5369 5941 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289117.1 protein_id gnl|my_center|LOCUS_33990 6147 6326 gene locus_tag LOCUS_34000 6147 6326 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902100.1 protein_id gnl|my_center|LOCUS_34000 6329 7516 gene locus_tag LOCUS_34010 gene ftsZ 6329 7516 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289116.1 protein_id gnl|my_center|LOCUS_34010 7945 8481 gene locus_tag LOCUS_34020 7945 8481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 9518 8559 gene locus_tag LOCUS_34030 9518 8559 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902098.1 protein_id gnl|my_center|LOCUS_34030 10315 9593 gene locus_tag LOCUS_34040 10315 9593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902323.1 protein_id gnl|my_center|LOCUS_34040 10481 11140 gene locus_tag LOCUS_34050 10481 11140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289115.1 protein_id gnl|my_center|LOCUS_34050 11952 11161 gene locus_tag LOCUS_34060 11952 11161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 12940 11945 gene locus_tag LOCUS_34070 12940 11945 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258911.1 protein_id gnl|my_center|LOCUS_34070 13945 13142 gene locus_tag LOCUS_34080 13945 13142 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289114.1 protein_id gnl|my_center|LOCUS_34080 14384 14013 gene locus_tag LOCUS_34090 14384 14013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 15409 14534 gene locus_tag LOCUS_34100 15409 14534 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902092.1 protein_id gnl|my_center|LOCUS_34100 16307 15474 gene locus_tag LOCUS_34110 16307 15474 CDS product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902091.1 protein_id gnl|my_center|LOCUS_34110 16524 17435 gene locus_tag LOCUS_34120 16524 17435 CDS product serine/threonine-protein kinase RIO2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902089.1 protein_id gnl|my_center|LOCUS_34120 17752 17549 gene locus_tag LOCUS_34130 17752 17549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 17742 18974 gene locus_tag LOCUS_34140 17742 18974 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903121.1 protein_id gnl|my_center|LOCUS_34140 20032 19400 gene locus_tag LOCUS_34150 20032 19400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904053.1 protein_id gnl|my_center|LOCUS_34150 21620 20331 gene locus_tag LOCUS_34160 21620 20331 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938066.1 protein_id gnl|my_center|LOCUS_34160 23212 21971 gene locus_tag LOCUS_34170 23212 21971 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243008.1 protein_id gnl|my_center|LOCUS_34170 23575 24336 gene locus_tag LOCUS_34180 23575 24336 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082558.1 protein_id gnl|my_center|LOCUS_34180 24466 24900 gene locus_tag LOCUS_34190 24466 24900 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903120.1 protein_id gnl|my_center|LOCUS_34190 24951 26249 gene locus_tag LOCUS_34200 gene hisD 24951 26249 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975852.1 protein_id gnl|my_center|LOCUS_34200 26819 28474 gene locus_tag LOCUS_34210 26819 28474 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877458.1 protein_id gnl|my_center|LOCUS_34210 28536 29108 gene locus_tag LOCUS_34220 28536 29108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 29318 30520 gene locus_tag LOCUS_34230 29318 30520 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870021.1 protein_id gnl|my_center|LOCUS_34230 30633 31742 gene locus_tag LOCUS_34240 30633 31742 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728652.1 protein_id gnl|my_center|LOCUS_34240 31854 33350 gene locus_tag LOCUS_34250 31854 33350 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920973.1 protein_id gnl|my_center|LOCUS_34250 36299 34026 gene locus_tag LOCUS_34260 36299 34026 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903183.1 protein_id gnl|my_center|LOCUS_34260 36812 37915 gene locus_tag LOCUS_34270 36812 37915 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930220.1 protein_id gnl|my_center|LOCUS_34270 37962 38168 gene locus_tag LOCUS_34280 37962 38168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 38243 39427 gene locus_tag LOCUS_34290 38243 39427 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229596.1 protein_id gnl|my_center|LOCUS_34290 41126 39486 gene locus_tag LOCUS_34300 41126 39486 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869775.1 protein_id gnl|my_center|LOCUS_34300 41503 41192 gene locus_tag LOCUS_34310 41503 41192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389227.1 protein_id gnl|my_center|LOCUS_34310 42852 41500 gene locus_tag LOCUS_34320 42852 41500 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389228.1 protein_id gnl|my_center|LOCUS_34320 42851 43996 gene locus_tag LOCUS_34330 42851 43996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 44022 44660 gene locus_tag LOCUS_34340 44022 44660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 45510 44713 gene locus_tag LOCUS_34350 45510 44713 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903597.1 protein_id gnl|my_center|LOCUS_34350 45672 46805 gene locus_tag LOCUS_34360 45672 46805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 46914 48938 gene locus_tag LOCUS_34370 46914 48938 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815961.1 protein_id gnl|my_center|LOCUS_34370 50217 49000 gene locus_tag LOCUS_34380 50217 49000 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902283.1 protein_id gnl|my_center|LOCUS_34380 51391 50282 gene locus_tag LOCUS_34390 51391 50282 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930220.1 protein_id gnl|my_center|LOCUS_34390 52341 51538 gene locus_tag LOCUS_34400 52341 51538 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730560.1 protein_id gnl|my_center|LOCUS_34400 53054 54361 gene locus_tag LOCUS_34410 53054 54361 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110217.1 protein_id gnl|my_center|LOCUS_34410 54529 55044 gene locus_tag LOCUS_34420 54529 55044 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902980.1 protein_id gnl|my_center|LOCUS_34420 55138 55923 gene locus_tag LOCUS_34430 55138 55923 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903597.1 protein_id gnl|my_center|LOCUS_34430 55920 56270 gene locus_tag LOCUS_34440 55920 56270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 56273 57094 gene locus_tag LOCUS_34450 56273 57094 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929384.1 protein_id gnl|my_center|LOCUS_34450 57192 57425 gene locus_tag LOCUS_34460 57192 57425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 57489 58709 gene locus_tag LOCUS_34470 gene thrC 57489 58709 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061193.1 protein_id gnl|my_center|LOCUS_34470 60590 59247 gene locus_tag LOCUS_34480 60590 59247 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339635.1 protein_id gnl|my_center|LOCUS_34480 61289 60840 gene locus_tag LOCUS_34490 61289 60840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 63738 62071 gene locus_tag LOCUS_34500 63738 62071 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926032.1 protein_id gnl|my_center|LOCUS_34500 64072 64983 gene locus_tag LOCUS_34510 64072 64983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 65291 65773 gene locus_tag LOCUS_34520 65291 65773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 66591 65770 gene locus_tag LOCUS_34530 66591 65770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 68497 66683 gene locus_tag LOCUS_34540 68497 66683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 68628 69743 gene locus_tag LOCUS_34550 68628 69743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 70744 69815 gene locus_tag LOCUS_34560 70744 69815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 72236 70845 gene locus_tag LOCUS_34570 72236 70845 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523062.1 protein_id gnl|my_center|LOCUS_34570 72507 72229 gene locus_tag LOCUS_34580 72507 72229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 73126 72605 gene locus_tag LOCUS_34590 73126 72605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 >Feature sequence53 618 271 gene locus_tag LOCUS_34600 618 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 1191 706 gene locus_tag LOCUS_34610 1191 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 2156 1425 gene locus_tag LOCUS_34620 2156 1425 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030586.1 protein_id gnl|my_center|LOCUS_34620 2396 2944 gene locus_tag LOCUS_34630 2396 2944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 3028 3495 gene locus_tag LOCUS_34640 3028 3495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030585.1 protein_id gnl|my_center|LOCUS_34640 4204 3503 gene locus_tag LOCUS_34650 4204 3503 CDS product DUF2270 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240630.1 protein_id gnl|my_center|LOCUS_34650 4309 4680 gene locus_tag LOCUS_34660 4309 4680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 5448 5861 gene locus_tag LOCUS_34670 5448 5861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 5861 6124 gene locus_tag LOCUS_34680 5861 6124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 6229 6933 gene locus_tag LOCUS_34690 6229 6933 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902066.1 protein_id gnl|my_center|LOCUS_34690 6934 7515 gene locus_tag LOCUS_34700 6934 7515 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289107.1 protein_id gnl|my_center|LOCUS_34700 7519 8166 gene locus_tag LOCUS_34710 7519 8166 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902064.1 protein_id gnl|my_center|LOCUS_34710 8606 10102 gene locus_tag LOCUS_34720 8606 10102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 10099 11016 gene locus_tag LOCUS_34730 10099 11016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 11291 12670 gene locus_tag LOCUS_34740 11291 12670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 13623 12754 gene locus_tag LOCUS_34750 13623 12754 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013060664.1 protein_id gnl|my_center|LOCUS_34750 14637 14083 gene locus_tag LOCUS_34760 14637 14083 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880943.1 protein_id gnl|my_center|LOCUS_34760 16731 14704 gene locus_tag LOCUS_34770 16731 14704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 16945 17382 gene locus_tag LOCUS_34780 gene trxA 16945 17382 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890427.1 protein_id gnl|my_center|LOCUS_34780 18571 17402 gene locus_tag LOCUS_34790 18571 17402 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890420.1 protein_id gnl|my_center|LOCUS_34790 19057 18596 gene locus_tag LOCUS_34800 19057 18596 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890418.1 protein_id gnl|my_center|LOCUS_34800 19616 19059 gene locus_tag LOCUS_34810 19616 19059 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890417.1 protein_id gnl|my_center|LOCUS_34810 20830 19637 gene locus_tag LOCUS_34820 20830 19637 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890416.1 protein_id gnl|my_center|LOCUS_34820 21086 21331 gene locus_tag LOCUS_34830 21086 21331 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890415.1 protein_id gnl|my_center|LOCUS_34830 21333 21905 gene locus_tag LOCUS_34840 21333 21905 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890414.1 protein_id gnl|my_center|LOCUS_34840 21946 22134 gene locus_tag LOCUS_34850 21946 22134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 22408 23658 gene locus_tag LOCUS_34860 22408 23658 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978370.1 protein_id gnl|my_center|LOCUS_34860 23746 24498 gene locus_tag LOCUS_34870 23746 24498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 >Feature sequence54 1178 903 gene locus_tag LOCUS_34880 1178 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34880 1672 1932 gene locus_tag LOCUS_34890 1672 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 2049 3068 gene locus_tag LOCUS_34900 2049 3068 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903345.1 protein_id gnl|my_center|LOCUS_34900 3094 4137 gene locus_tag LOCUS_34910 3094 4137 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903344.1 protein_id gnl|my_center|LOCUS_34910 4709 4206 gene locus_tag LOCUS_34920 4709 4206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 5650 4706 gene locus_tag LOCUS_34930 5650 4706 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904097.1 protein_id gnl|my_center|LOCUS_34930 7446 7045 gene locus_tag LOCUS_34940 7446 7045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 7963 7670 gene locus_tag LOCUS_34950 7963 7670 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903037.1 protein_id gnl|my_center|LOCUS_34950 8093 9397 gene locus_tag LOCUS_34960 8093 9397 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403144.1 protein_id gnl|my_center|LOCUS_34960 10799 9621 gene locus_tag LOCUS_34970 10799 9621 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090525.1 protein_id gnl|my_center|LOCUS_34970 12003 10801 gene locus_tag LOCUS_34980 12003 10801 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090523.1 protein_id gnl|my_center|LOCUS_34980 13717 12179 gene locus_tag LOCUS_34990 13717 12179 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282029.1 protein_id gnl|my_center|LOCUS_34990 13997 14581 gene locus_tag LOCUS_35000 13997 14581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 14586 16439 gene locus_tag LOCUS_35010 14586 16439 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135662706.1 protein_id gnl|my_center|LOCUS_35010 16971 16486 gene locus_tag LOCUS_35020 16971 16486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 17751 17038 gene locus_tag LOCUS_35030 17751 17038 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877942.1 protein_id gnl|my_center|LOCUS_35030 20031 18487 gene locus_tag LOCUS_35040 20031 18487 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902970.1 protein_id gnl|my_center|LOCUS_35040 20895 20122 gene locus_tag LOCUS_35050 20895 20122 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530251.1 protein_id gnl|my_center|LOCUS_35050 21749 20892 gene locus_tag LOCUS_35060 gene potB 21749 20892 CDS product spermidine/putrescine ABC transporter permease PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457403.1 protein_id gnl|my_center|LOCUS_35060 22798 21746 gene locus_tag LOCUS_35070 22798 21746 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728946.1 protein_id gnl|my_center|LOCUS_35070 23883 22804 gene locus_tag LOCUS_35080 23883 22804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 24156 25238 gene locus_tag LOCUS_35090 24156 25238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 26104 25313 gene locus_tag LOCUS_35100 gene paaG 26104 25313 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206400.1 protein_id gnl|my_center|LOCUS_35100 27439 26189 gene locus_tag LOCUS_35110 27439 26189 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229261.1 protein_id gnl|my_center|LOCUS_35110 28542 27523 gene locus_tag LOCUS_35120 28542 27523 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728259.1 protein_id gnl|my_center|LOCUS_35120 28870 29859 gene locus_tag LOCUS_35130 28870 29859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 29989 31191 gene locus_tag LOCUS_35140 29989 31191 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230129.1 protein_id gnl|my_center|LOCUS_35140 32454 31315 gene locus_tag LOCUS_35150 32454 31315 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889453.1 protein_id gnl|my_center|LOCUS_35150 32569 33816 gene locus_tag LOCUS_35160 32569 33816 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893439.1 protein_id gnl|my_center|LOCUS_35160 35491 33965 gene locus_tag LOCUS_35170 35491 33965 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086603.1 protein_id gnl|my_center|LOCUS_35170 36657 35581 gene locus_tag LOCUS_35180 36657 35581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 37109 36654 gene locus_tag LOCUS_35190 37109 36654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 37266 38360 gene locus_tag LOCUS_35200 37266 38360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 39218 38445 gene locus_tag LOCUS_35210 39218 38445 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902972.1 protein_id gnl|my_center|LOCUS_35210 40382 39390 gene locus_tag LOCUS_35220 40382 39390 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258336.1 protein_id gnl|my_center|LOCUS_35220 42129 40432 gene locus_tag LOCUS_35230 42129 40432 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534776.1 protein_id gnl|my_center|LOCUS_35230 42272 43057 gene locus_tag LOCUS_35240 gene fabG 42272 43057 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815632.1 protein_id gnl|my_center|LOCUS_35240 43268 44212 gene locus_tag LOCUS_35250 43268 44212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 45463 44288 gene locus_tag LOCUS_35260 45463 44288 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813988.1 protein_id gnl|my_center|LOCUS_35260 46327 45539 gene locus_tag LOCUS_35270 46327 45539 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256011.1 protein_id gnl|my_center|LOCUS_35270 46444 47442 gene locus_tag LOCUS_35280 46444 47442 CDS product TIGR04024 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902973.1 protein_id gnl|my_center|LOCUS_35280 47581 48807 gene locus_tag LOCUS_35290 47581 48807 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089117.1 protein_id gnl|my_center|LOCUS_35290 50405 48828 gene locus_tag LOCUS_35300 50405 48828 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086603.1 protein_id gnl|my_center|LOCUS_35300 50937 50560 gene locus_tag LOCUS_35310 50937 50560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 52034 50937 gene locus_tag LOCUS_35320 52034 50937 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256300.1 protein_id gnl|my_center|LOCUS_35320 52471 52142 gene locus_tag LOCUS_35330 52471 52142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 52430 53341 gene locus_tag LOCUS_35340 52430 53341 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475530.1 protein_id gnl|my_center|LOCUS_35340 53489 54562 gene locus_tag LOCUS_35350 53489 54562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 54726 55892 gene locus_tag LOCUS_35360 54726 55892 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877710.1 protein_id gnl|my_center|LOCUS_35360 56115 57482 gene locus_tag LOCUS_35370 56115 57482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 57560 59182 gene locus_tag LOCUS_35380 gene acsA 57560 59182 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399030.1 protein_id gnl|my_center|LOCUS_35380 59260 59847 gene locus_tag LOCUS_35390 59260 59847 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921301.1 protein_id gnl|my_center|LOCUS_35390 61185 60028 gene locus_tag LOCUS_35400 61185 60028 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876428.1 protein_id gnl|my_center|LOCUS_35400 61601 61182 gene locus_tag LOCUS_35410 61601 61182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 62593 61598 gene locus_tag LOCUS_35420 62593 61598 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868484.1 protein_id gnl|my_center|LOCUS_35420 63148 64317 gene locus_tag LOCUS_35430 63148 64317 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228126.1 protein_id gnl|my_center|LOCUS_35430 64994 65998 gene locus_tag LOCUS_35440 64994 65998 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112998.1 protein_id gnl|my_center|LOCUS_35440 65995 66960 gene locus_tag LOCUS_35450 65995 66960 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949162.1 protein_id gnl|my_center|LOCUS_35450 67058 68509 gene locus_tag LOCUS_35460 67058 68509 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903647.1 protein_id gnl|my_center|LOCUS_35460 68600 69676 gene locus_tag LOCUS_35470 gene bdhA 68600 69676 CDS product (R,R)-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645827.1 protein_id gnl|my_center|LOCUS_35470 71151 69748 gene locus_tag LOCUS_35480 gene lpdA 71151 69748 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903648.1 protein_id gnl|my_center|LOCUS_35480 71314 72174 gene locus_tag LOCUS_35490 71314 72174 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731488.1 protein_id gnl|my_center|LOCUS_35490 73738 72212 gene locus_tag LOCUS_35500 gene fadD5 73738 72212 CDS product fatty-acid--CoA ligase FadD5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726688.1 protein_id gnl|my_center|LOCUS_35500 73963 74793 gene locus_tag LOCUS_35510 73963 74793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 76418 74847 gene locus_tag LOCUS_35520 76418 74847 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282029.1 protein_id gnl|my_center|LOCUS_35520 >Feature sequence55 258 572 gene locus_tag LOCUS_35530 258 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 1223 648 gene locus_tag LOCUS_35540 1223 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35540 3155 1614 gene locus_tag LOCUS_35550 3155 1614 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902678.1 protein_id gnl|my_center|LOCUS_35550 4655 4293 gene locus_tag LOCUS_35560 4655 4293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 4862 4668 gene locus_tag LOCUS_35570 4862 4668 CDS product heavy metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707532.1 protein_id gnl|my_center|LOCUS_35570 4997 5599 gene locus_tag LOCUS_35580 4997 5599 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289287.1 protein_id gnl|my_center|LOCUS_35580 5703 7985 gene locus_tag LOCUS_35590 5703 7985 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083057.1 protein_id gnl|my_center|LOCUS_35590 8150 9517 gene locus_tag LOCUS_35600 8150 9517 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414924.1 protein_id gnl|my_center|LOCUS_35600 >Feature sequence56 277 921 gene locus_tag LOCUS_35610 277 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 1582 2127 gene locus_tag LOCUS_35620 1582 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 2139 2612 gene locus_tag LOCUS_35630 2139 2612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 2635 3345 gene locus_tag LOCUS_35640 2635 3345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 3400 3828 gene locus_tag LOCUS_35650 3400 3828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 >Feature sequence57 299 1675 gene locus_tag LOCUS_35660 299 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 2026 1820 gene locus_tag LOCUS_35670 2026 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 >Feature sequence58 1935 34 gene locus_tag LOCUS_35680 1935 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 2233 2781 gene locus_tag LOCUS_35690 2233 2781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 2807 3916 gene locus_tag LOCUS_35700 2807 3916 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814808.1 protein_id gnl|my_center|LOCUS_35700 3938 6274 gene locus_tag LOCUS_35710 3938 6274 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814805.1 protein_id gnl|my_center|LOCUS_35710 6271 7569 gene locus_tag LOCUS_35720 6271 7569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 8085 8312 gene locus_tag LOCUS_35730 8085 8312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 8679 8846 gene locus_tag LOCUS_35740 8679 8846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 9767 8856 gene locus_tag LOCUS_35750 9767 8856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 9986 10831 gene locus_tag LOCUS_35760 9986 10831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 11270 11530 gene locus_tag LOCUS_35770 11270 11530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 >Feature sequence59 245 1495 gene locus_tag LOCUS_35780 245 1495 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903672.1 protein_id gnl|my_center|LOCUS_35780 1742 2440 gene locus_tag LOCUS_35790 1742 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902751.1 protein_id gnl|my_center|LOCUS_35790 2651 3871 gene locus_tag LOCUS_35800 2651 3871 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050459751.1 protein_id gnl|my_center|LOCUS_35800 4147 3887 gene locus_tag LOCUS_35810 4147 3887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 4274 4501 gene locus_tag LOCUS_35820 4274 4501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 4704 6353 gene locus_tag LOCUS_35830 4704 6353 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938119.1 protein_id gnl|my_center|LOCUS_35830 7879 6818 gene locus_tag LOCUS_35840 gene trmB 7879 6818 CDS product transcriptional regulator TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892507.1 protein_id gnl|my_center|LOCUS_35840 10252 8198 gene locus_tag LOCUS_35850 10252 8198 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796108.1 protein_id gnl|my_center|LOCUS_35850 10190 10417 gene locus_tag LOCUS_35860 10190 10417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 10729 12024 gene locus_tag LOCUS_35870 10729 12024 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053697.1 protein_id gnl|my_center|LOCUS_35870 12028 13020 gene locus_tag LOCUS_35880 12028 13020 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582885.1 protein_id gnl|my_center|LOCUS_35880 13023 13853 gene locus_tag LOCUS_35890 13023 13853 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037349.1 protein_id gnl|my_center|LOCUS_35890 14001 15155 gene locus_tag LOCUS_35900 14001 15155 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904134.1 protein_id gnl|my_center|LOCUS_35900 16105 17115 gene locus_tag LOCUS_35910 16105 17115 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459825.1 protein_id gnl|my_center|LOCUS_35910 17661 17236 gene locus_tag LOCUS_35920 17661 17236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 19504 17855 gene locus_tag LOCUS_35930 19504 17855 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813682.1 protein_id gnl|my_center|LOCUS_35930 21066 19735 gene locus_tag LOCUS_35940 21066 19735 CDS product Tat pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902557.1 protein_id gnl|my_center|LOCUS_35940 23001 21076 gene locus_tag LOCUS_35950 23001 21076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 23203 24327 gene locus_tag LOCUS_35960 gene pdhA 23203 24327 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197535910.1 protein_id gnl|my_center|LOCUS_35960 >Feature sequence60 1001 213 gene locus_tag LOCUS_35970 1001 213 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901972.1 protein_id gnl|my_center|LOCUS_35970 >Feature sequence61 >Feature sequence62 1810 158 gene locus_tag LOCUS_35980 1810 158 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879349.1 protein_id gnl|my_center|LOCUS_35980 1991 2464 gene locus_tag LOCUS_35990 1991 2464 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229257.1 protein_id gnl|my_center|LOCUS_35990 2605 3612 gene locus_tag LOCUS_36000 2605 3612 CDS product TIGR04024 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902973.1 protein_id gnl|my_center|LOCUS_36000 4436 3660 gene locus_tag LOCUS_36010 gene fabG 4436 3660 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566240.1 protein_id gnl|my_center|LOCUS_36010 4659 6752 gene locus_tag LOCUS_36020 4659 6752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36020 6773 8440 gene locus_tag LOCUS_36030 6773 8440 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385784.1 protein_id gnl|my_center|LOCUS_36030 8447 9457 gene locus_tag LOCUS_36040 8447 9457 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728353.1 protein_id gnl|my_center|LOCUS_36040 9569 9979 gene locus_tag LOCUS_36050 9569 9979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 >Feature sequence63 235 1233 gene locus_tag LOCUS_36060 235 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 >Feature sequence64 2376 994 gene locus_tag LOCUS_36070 2376 994 CDS product TIGR00341 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289527.1 protein_id gnl|my_center|LOCUS_36070 2921 2514 gene locus_tag LOCUS_36080 2921 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 3085 3708 gene locus_tag LOCUS_36090 3085 3708 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867364.1 protein_id gnl|my_center|LOCUS_36090 4341 3862 gene locus_tag LOCUS_36100 4341 3862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 4599 5492 gene locus_tag LOCUS_36110 4599 5492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 5995 5585 gene locus_tag LOCUS_36120 5995 5585 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289398.1 protein_id gnl|my_center|LOCUS_36120 6669 6064 gene locus_tag LOCUS_36130 6669 6064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902733.1 protein_id gnl|my_center|LOCUS_36130 6768 8087 gene locus_tag LOCUS_36140 6768 8087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 8279 10006 gene locus_tag LOCUS_36150 8279 10006 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001985392.1 protein_id gnl|my_center|LOCUS_36150 10588 10178 gene locus_tag LOCUS_36160 10588 10178 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903120.1 protein_id gnl|my_center|LOCUS_36160 11322 11576 gene locus_tag LOCUS_36170 11322 11576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 >Feature sequence65 2175 1558 gene locus_tag LOCUS_36180 2175 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 >Feature sequence66 79 405 gene locus_tag LOCUS_36190 79 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 536 1144 gene locus_tag LOCUS_36200 536 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 1518 1198 gene locus_tag LOCUS_36210 1518 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 2544 1702 gene locus_tag LOCUS_36220 2544 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 3637 2621 gene locus_tag LOCUS_36230 3637 2621 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902703.1 protein_id gnl|my_center|LOCUS_36230 4238 4026 gene locus_tag LOCUS_36240 4238 4026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 5489 4476 gene locus_tag LOCUS_36250 5489 4476 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809024.1 protein_id gnl|my_center|LOCUS_36250 5631 6401 gene locus_tag LOCUS_36260 5631 6401 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809706.1 protein_id gnl|my_center|LOCUS_36260 6410 6760 gene locus_tag LOCUS_36270 6410 6760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 6894 6718 gene locus_tag LOCUS_36280 6894 6718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 7408 7986 gene locus_tag LOCUS_36290 7408 7986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 9785 8016 gene locus_tag LOCUS_36300 9785 8016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 11028 9913 gene locus_tag LOCUS_36310 11028 9913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 12927 11290 gene locus_tag LOCUS_36320 12927 11290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251151.1 protein_id gnl|my_center|LOCUS_36320 15619 13022 gene locus_tag LOCUS_36330 15619 13022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 17251 15629 gene locus_tag LOCUS_36340 17251 15629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 17484 18134 gene locus_tag LOCUS_36350 17484 18134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 19297 18125 gene locus_tag LOCUS_36360 19297 18125 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404011.1 protein_id gnl|my_center|LOCUS_36360 19418 19969 gene locus_tag LOCUS_36370 gene rdgB 19418 19969 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903503.1 protein_id gnl|my_center|LOCUS_36370 20185 20568 gene locus_tag LOCUS_36380 20185 20568 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024224.1 protein_id gnl|my_center|LOCUS_36380 20576 21439 gene locus_tag LOCUS_36390 20576 21439 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289730.1 protein_id gnl|my_center|LOCUS_36390 21949 21470 gene locus_tag LOCUS_36400 21949 21470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289420.1 protein_id gnl|my_center|LOCUS_36400 23231 22128 gene locus_tag LOCUS_36410 23231 22128 CDS product putative sulfate/molybdate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057197.1 protein_id gnl|my_center|LOCUS_36410 23403 24443 gene locus_tag LOCUS_36420 23403 24443 CDS product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289639.1 protein_id gnl|my_center|LOCUS_36420 24482 25021 gene locus_tag LOCUS_36430 24482 25021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 25078 25890 gene locus_tag LOCUS_36440 25078 25890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 26390 27184 gene locus_tag LOCUS_36450 26390 27184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 27177 27452 gene locus_tag LOCUS_36460 27177 27452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 27400 28023 gene locus_tag LOCUS_36470 27400 28023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 28085 29161 gene locus_tag LOCUS_36480 28085 29161 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061304.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36480 29158 30246 gene locus_tag LOCUS_36490 29158 30246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36490 30392 31414 gene locus_tag LOCUS_36500 30392 31414 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061304.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36500 31414 31737 gene locus_tag LOCUS_36510 31414 31737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36510 31797 32126 gene locus_tag LOCUS_36520 31797 32126 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537521.1 protein_id gnl|my_center|LOCUS_36520 32205 33626 gene locus_tag LOCUS_36530 32205 33626 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404986.1 protein_id gnl|my_center|LOCUS_36530 33623 34357 gene locus_tag LOCUS_36540 33623 34357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 35244 34507 gene locus_tag LOCUS_36550 35244 34507 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404987.1 protein_id gnl|my_center|LOCUS_36550 37613 35376 gene locus_tag LOCUS_36560 37613 35376 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404998.1 protein_id gnl|my_center|LOCUS_36560 37681 37977 gene locus_tag LOCUS_36570 37681 37977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 38024 40750 gene locus_tag LOCUS_36580 gene mutS 38024 40750 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902076.1 protein_id gnl|my_center|LOCUS_36580 40977 41774 gene locus_tag LOCUS_36590 40977 41774 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902972.1 protein_id gnl|my_center|LOCUS_36590 42031 42504 gene locus_tag LOCUS_36600 42031 42504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 44152 42578 gene locus_tag LOCUS_36610 44152 42578 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902970.1 protein_id gnl|my_center|LOCUS_36610 44797 44249 gene locus_tag LOCUS_36620 44797 44249 CDS product tRNA (cytidine(56)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289218.1 protein_id gnl|my_center|LOCUS_36620 45185 44838 gene locus_tag LOCUS_36630 45185 44838 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903020.1 protein_id gnl|my_center|LOCUS_36630 45442 46659 gene locus_tag LOCUS_36640 45442 46659 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256328.1 protein_id gnl|my_center|LOCUS_36640 47385 48302 gene locus_tag LOCUS_36650 47385 48302 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902476.1 protein_id gnl|my_center|LOCUS_36650 48299 50233 gene locus_tag LOCUS_36660 48299 50233 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902477.1 protein_id gnl|my_center|LOCUS_36660 50223 51392 gene locus_tag LOCUS_36670 50223 51392 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892491.1 protein_id gnl|my_center|LOCUS_36670 51471 51881 gene locus_tag LOCUS_36680 51471 51881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 52912 51887 gene locus_tag LOCUS_36690 52912 51887 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021005.1 protein_id gnl|my_center|LOCUS_36690 53843 53010 gene locus_tag LOCUS_36700 53843 53010 CDS product pantoate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902142.1 protein_id gnl|my_center|LOCUS_36700 54135 54959 gene locus_tag LOCUS_36710 54135 54959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 55379 55011 gene locus_tag LOCUS_36720 55379 55011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 55673 55891 gene locus_tag LOCUS_36730 55673 55891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 57278 55974 gene locus_tag LOCUS_36740 gene aspS 57278 55974 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021688.1 protein_id gnl|my_center|LOCUS_36740 57745 57458 gene locus_tag LOCUS_36750 57745 57458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 57779 58576 gene locus_tag LOCUS_36760 gene cobB 57779 58576 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846381.1 protein_id gnl|my_center|LOCUS_36760 58678 59421 gene locus_tag LOCUS_36770 58678 59421 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903575.1 protein_id gnl|my_center|LOCUS_36770 59443 59844 gene locus_tag LOCUS_36780 59443 59844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36780 60376 59984 gene locus_tag LOCUS_36790 60376 59984 CDS product DUF5811 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903470.1 protein_id gnl|my_center|LOCUS_36790 60915 60484 gene locus_tag LOCUS_36800 60915 60484 CDS product pyruvoyl-dependent arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903471.1 protein_id gnl|my_center|LOCUS_36800 61768 62622 gene locus_tag LOCUS_36810 61768 62622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 63869 62637 gene locus_tag LOCUS_36820 63869 62637 CDS product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903472.1 protein_id gnl|my_center|LOCUS_36820 65771 63960 gene locus_tag LOCUS_36830 gene pepF 65771 63960 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289415.1 protein_id gnl|my_center|LOCUS_36830 68953 65990 gene locus_tag LOCUS_36840 gene uvrA 68953 65990 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903972.1 protein_id gnl|my_center|LOCUS_36840 70183 69212 gene locus_tag LOCUS_36850 70183 69212 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289434.1 protein_id gnl|my_center|LOCUS_36850 70335 71711 gene locus_tag LOCUS_36860 70335 71711 CDS product tRNA(Ile)(2)-agmatinylcytidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903554.1 protein_id gnl|my_center|LOCUS_36860 71826 73034 gene locus_tag LOCUS_36870 71826 73034 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405030.1 protein_id gnl|my_center|LOCUS_36870 73187 73384 gene locus_tag LOCUS_36880 73187 73384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 75166 73490 gene locus_tag LOCUS_36890 75166 73490 CDS product bifunctional N(6)-L-threonylcarbamoyladenine synthase/serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903505.1 protein_id gnl|my_center|LOCUS_36890 75408 75274 gene locus_tag LOCUS_36900 75408 75274 CDS product 30S ribosomal protein S27ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903506.1 protein_id gnl|my_center|LOCUS_36900 75730 75410 gene locus_tag LOCUS_36910 75730 75410 CDS product 30S ribosomal protein S24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903507.1 protein_id gnl|my_center|LOCUS_36910 75908 77143 gene locus_tag LOCUS_36920 75908 77143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 77146 77964 gene locus_tag LOCUS_36930 77146 77964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 79009 77933 gene locus_tag LOCUS_36940 79009 77933 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825317.1 protein_id gnl|my_center|LOCUS_36940 79121 79414 gene locus_tag LOCUS_36950 79121 79414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 80396 79968 gene locus_tag LOCUS_36960 80396 79968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 80529 81605 gene locus_tag LOCUS_36970 80529 81605 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259465.1 protein_id gnl|my_center|LOCUS_36970 82414 81626 gene locus_tag LOCUS_36980 gene dph5 82414 81626 CDS product diphthine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289280.1 protein_id gnl|my_center|LOCUS_36980 82574 83260 gene locus_tag LOCUS_36990 82574 83260 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289175.1 protein_id gnl|my_center|LOCUS_36990 83393 84361 gene locus_tag LOCUS_37000 83393 84361 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904123.1 protein_id gnl|my_center|LOCUS_37000 84395 85132 gene locus_tag LOCUS_37010 84395 85132 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904122.1 protein_id gnl|my_center|LOCUS_37010 85129 86151 gene locus_tag LOCUS_37020 85129 86151 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904121.1 protein_id gnl|my_center|LOCUS_37020 86916 86470 gene locus_tag LOCUS_37030 86916 86470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 87579 87106 gene locus_tag LOCUS_37040 87579 87106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 87706 88458 gene locus_tag LOCUS_37050 87706 88458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 89154 88492 gene locus_tag LOCUS_37060 89154 88492 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289405.1 protein_id gnl|my_center|LOCUS_37060 89307 90764 gene locus_tag LOCUS_37070 89307 90764 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903558.1 protein_id gnl|my_center|LOCUS_37070 90849 91094 gene locus_tag LOCUS_37080 90849 91094 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903557.1 protein_id gnl|my_center|LOCUS_37080 92492 91194 gene locus_tag LOCUS_37090 92492 91194 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903984.1 protein_id gnl|my_center|LOCUS_37090 93751 94230 gene locus_tag LOCUS_37100 93751 94230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 94541 94317 gene locus_tag LOCUS_37110 94541 94317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 94819 95322 gene locus_tag LOCUS_37120 94819 95322 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903982.1 protein_id gnl|my_center|LOCUS_37120 95670 97190 gene locus_tag LOCUS_37130 95670 97190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 97333 97923 gene locus_tag LOCUS_37140 97333 97923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 99785 97941 gene locus_tag LOCUS_37150 99785 97941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 100061 100423 gene locus_tag LOCUS_37160 gene sepF 100061 100423 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903980.1 protein_id gnl|my_center|LOCUS_37160 101305 100415 gene locus_tag LOCUS_37170 101305 100415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 102143 101424 gene locus_tag LOCUS_37180 102143 101424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 104399 102174 gene locus_tag LOCUS_37190 104399 102174 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406602.1 protein_id gnl|my_center|LOCUS_37190 105300 104401 gene locus_tag LOCUS_37200 105300 104401 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990759.1 protein_id gnl|my_center|LOCUS_37200 106249 106150 gene locus_tag LOCUS_t00490 106249 106150 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 107809 106244 gene locus_tag LOCUS_37210 107809 106244 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990685.1 protein_id gnl|my_center|LOCUS_37210 109363 107843 gene locus_tag LOCUS_37220 109363 107843 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022987.1 protein_id gnl|my_center|LOCUS_37220 109882 110535 gene locus_tag LOCUS_37230 109882 110535 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903087.1 protein_id gnl|my_center|LOCUS_37230 110736 113249 gene locus_tag LOCUS_37240 gene htr6 110736 113249 CDS product chemotaxis signal transducer protein Htr6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902553.1 protein_id gnl|my_center|LOCUS_37240 113745 113308 gene locus_tag LOCUS_37250 113745 113308 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289522.1 protein_id gnl|my_center|LOCUS_37250 115102 113846 gene locus_tag LOCUS_37260 115102 113846 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403144.1 protein_id gnl|my_center|LOCUS_37260 115262 115636 gene locus_tag LOCUS_37270 gene gloA 115262 115636 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143550.1 protein_id gnl|my_center|LOCUS_37270 116879 115680 gene locus_tag LOCUS_37280 116879 115680 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114201.1 protein_id gnl|my_center|LOCUS_37280 117130 118170 gene locus_tag LOCUS_37290 117130 118170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 118222 120321 gene locus_tag LOCUS_37300 118222 120321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 121762 120449 gene locus_tag LOCUS_37310 121762 120449 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901978.1 protein_id gnl|my_center|LOCUS_37310 122030 123178 gene locus_tag LOCUS_37320 gene citZ 122030 123178 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903548.1 protein_id gnl|my_center|LOCUS_37320 123570 123259 gene locus_tag LOCUS_37330 123570 123259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903206.1 protein_id gnl|my_center|LOCUS_37330 124628 123567 gene locus_tag LOCUS_37340 124628 123567 CDS product PGF-CTERM sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903207.1 protein_id gnl|my_center|LOCUS_37340 124746 125150 gene locus_tag LOCUS_37350 124746 125150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 125416 126627 gene locus_tag LOCUS_37360 gene ilvA 125416 126627 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903546.1 protein_id gnl|my_center|LOCUS_37360 127390 126707 gene locus_tag LOCUS_37370 127390 126707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 128442 127387 gene locus_tag LOCUS_37380 128442 127387 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903775.1 protein_id gnl|my_center|LOCUS_37380 129329 128439 gene locus_tag LOCUS_37390 129329 128439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 129472 129852 gene locus_tag LOCUS_37400 129472 129852 CDS product Rid family detoxifying hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903545.1 protein_id gnl|my_center|LOCUS_37400 129868 130122 gene locus_tag LOCUS_37410 129868 130122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 130150 130231 gene locus_tag LOCUS_t00500 130150 130231 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 130344 131567 gene locus_tag LOCUS_37420 130344 131567 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289074.1 protein_id gnl|my_center|LOCUS_37420 131638 132393 gene locus_tag LOCUS_37430 131638 132393 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902474.1 protein_id gnl|my_center|LOCUS_37430 132596 134260 gene locus_tag LOCUS_37440 gene thsB 132596 134260 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136361694.1 protein_id gnl|my_center|LOCUS_37440 135434 134427 gene locus_tag LOCUS_37450 135434 134427 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902489.1 protein_id gnl|my_center|LOCUS_37450 136808 136380 gene locus_tag LOCUS_37460 136808 136380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 137261 136902 gene locus_tag LOCUS_37470 137261 136902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 138295 137363 gene locus_tag LOCUS_37480 gene rnz 138295 137363 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903662.1 protein_id gnl|my_center|LOCUS_37480 138540 139685 gene locus_tag LOCUS_37490 138540 139685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 139725 140729 gene locus_tag LOCUS_37500 139725 140729 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903663.1 protein_id gnl|my_center|LOCUS_37500 140735 141160 gene locus_tag LOCUS_37510 140735 141160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 141267 142934 gene locus_tag LOCUS_37520 141267 142934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 142931 143641 gene locus_tag LOCUS_37530 gene sop2 142931 143641 CDS product sensory rhodopsin II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903286.1 protein_id gnl|my_center|LOCUS_37530 144105 144545 gene locus_tag LOCUS_37540 144105 144545 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903814.1 protein_id gnl|my_center|LOCUS_37540 145869 144787 gene locus_tag LOCUS_37550 145869 144787 CDS product TIGR01177 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289469.1 protein_id gnl|my_center|LOCUS_37550 146106 146666 gene locus_tag LOCUS_37560 146106 146666 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903666.1 protein_id gnl|my_center|LOCUS_37560 146815 147813 gene locus_tag LOCUS_37570 146815 147813 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242752.1 protein_id gnl|my_center|LOCUS_37570 148138 148638 gene locus_tag LOCUS_37580 148138 148638 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230481.1 protein_id gnl|my_center|LOCUS_37580 148733 149209 gene locus_tag LOCUS_37590 148733 149209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 149339 149956 gene locus_tag LOCUS_37600 gene engB 149339 149956 CDS product GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903933.1 protein_id gnl|my_center|LOCUS_37600 150192 151991 gene locus_tag LOCUS_37610 150192 151991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 152222 153259 gene locus_tag LOCUS_37620 152222 153259 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903753.1 protein_id gnl|my_center|LOCUS_37620 153256 154785 gene locus_tag LOCUS_37630 153256 154785 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903752.1 protein_id gnl|my_center|LOCUS_37630 154782 156056 gene locus_tag LOCUS_37640 154782 156056 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903751.1 protein_id gnl|my_center|LOCUS_37640 156053 157405 gene locus_tag LOCUS_37650 156053 157405 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903750.1 protein_id gnl|my_center|LOCUS_37650 157408 157824 gene locus_tag LOCUS_37660 157408 157824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 157907 158362 gene locus_tag LOCUS_37670 157907 158362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 158452 159234 gene locus_tag LOCUS_37680 gene rnz 158452 159234 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398681.1 protein_id gnl|my_center|LOCUS_37680 159730 159254 gene locus_tag LOCUS_37690 159730 159254 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902608.1 protein_id gnl|my_center|LOCUS_37690 160283 159756 gene locus_tag LOCUS_37700 160283 159756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 161303 160284 gene locus_tag LOCUS_37710 161303 160284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 161755 161321 gene locus_tag LOCUS_37720 161755 161321 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903106.1 protein_id gnl|my_center|LOCUS_37720 162197 161820 gene locus_tag LOCUS_37730 162197 161820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 163354 162221 gene locus_tag LOCUS_37740 163354 162221 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918144.1 protein_id gnl|my_center|LOCUS_37740 163722 163411 gene locus_tag LOCUS_37750 163722 163411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 165346 163868 gene locus_tag LOCUS_37760 165346 163868 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421525.1 protein_id gnl|my_center|LOCUS_37760 165505 165873 gene locus_tag LOCUS_37770 165505 165873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37770 165953 166375 gene locus_tag LOCUS_37780 165953 166375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 166762 168708 gene locus_tag LOCUS_37790 166762 168708 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902014.1 protein_id gnl|my_center|LOCUS_37790 168899 169558 gene locus_tag LOCUS_37800 168899 169558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 169719 169937 gene locus_tag LOCUS_37810 169719 169937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37810 170151 171410 gene locus_tag LOCUS_37820 170151 171410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903882.1 protein_id gnl|my_center|LOCUS_37820 171517 171897 gene locus_tag LOCUS_37830 171517 171897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 171894 172469 gene locus_tag LOCUS_37840 171894 172469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890451.1 protein_id gnl|my_center|LOCUS_37840 173298 172597 gene locus_tag LOCUS_37850 173298 172597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 173546 174919 gene locus_tag LOCUS_37860 173546 174919 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289743.1 protein_id gnl|my_center|LOCUS_37860 175512 174949 gene locus_tag LOCUS_37870 175512 174949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 175705 176127 gene locus_tag LOCUS_37880 175705 176127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37880 176954 176139 gene locus_tag LOCUS_37890 176954 176139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 177174 177521 gene locus_tag LOCUS_37900 177174 177521 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892503.1 protein_id gnl|my_center|LOCUS_37900 177518 177895 gene locus_tag LOCUS_37910 177518 177895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 177882 178166 gene locus_tag LOCUS_37920 177882 178166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37920 178605 179237 gene locus_tag LOCUS_37930 178605 179237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 179940 181520 gene locus_tag LOCUS_37940 179940 181520 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525361.1 protein_id gnl|my_center|LOCUS_37940 182217 181465 gene locus_tag LOCUS_37950 182217 181465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37950 185454 182542 gene locus_tag LOCUS_37960 185454 182542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37960 186430 185639 gene locus_tag LOCUS_37970 186430 185639 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484565.1 protein_id gnl|my_center|LOCUS_37970 186800 189541 gene locus_tag LOCUS_37980 gene valS 186800 189541 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060895.1 protein_id gnl|my_center|LOCUS_37980 190471 191286 gene locus_tag LOCUS_37990 190471 191286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 192193 191510 gene locus_tag LOCUS_38000 192193 191510 CDS product DUF1405 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903310.1 protein_id gnl|my_center|LOCUS_38000 193859 192264 gene locus_tag LOCUS_38010 193859 192264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 194123 195031 gene locus_tag LOCUS_38020 gene pdxS 194123 195031 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903311.1 protein_id gnl|my_center|LOCUS_38020 195942 195592 gene locus_tag LOCUS_38030 195942 195592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 196825 195944 gene locus_tag LOCUS_38040 196825 195944 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903313.1 protein_id gnl|my_center|LOCUS_38040 200026 196931 gene locus_tag LOCUS_38050 200026 196931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 200302 201642 gene locus_tag LOCUS_38060 200302 201642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060 201937 203211 gene locus_tag LOCUS_38070 201937 203211 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089186.1 protein_id gnl|my_center|LOCUS_38070 204520 203255 gene locus_tag LOCUS_38080 204520 203255 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403144.1 protein_id gnl|my_center|LOCUS_38080 205229 204606 gene locus_tag LOCUS_38090 205229 204606 CDS product DUF6149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903316.1 protein_id gnl|my_center|LOCUS_38090 205483 206721 gene locus_tag LOCUS_38100 205483 206721 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903320.1 protein_id gnl|my_center|LOCUS_38100 206867 208225 gene locus_tag LOCUS_38110 gene nrfD 206867 208225 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228899.1 protein_id gnl|my_center|LOCUS_38110 208945 208259 gene locus_tag LOCUS_38120 208945 208259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 209102 208953 gene locus_tag LOCUS_38130 209102 208953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38130 209667 210869 gene locus_tag LOCUS_38140 209667 210869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 211357 210866 gene locus_tag LOCUS_38150 211357 210866 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902687.1 protein_id gnl|my_center|LOCUS_38150 >Feature sequence67 235 1329 gene locus_tag LOCUS_38160 235 1329 CDS product IS66-like element ISH10 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890436.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38160 1390 1683 gene locus_tag LOCUS_38170 1390 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 2041 3285 gene locus_tag LOCUS_38180 2041 3285 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459437.1 protein_id gnl|my_center|LOCUS_38180 4142 3657 gene locus_tag LOCUS_38190 4142 3657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 5440 4223 gene locus_tag LOCUS_38200 5440 4223 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903212.1 protein_id gnl|my_center|LOCUS_38200 6319 5633 gene locus_tag LOCUS_38210 6319 5633 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526170.1 protein_id gnl|my_center|LOCUS_38210 6396 7049 gene locus_tag LOCUS_38220 6396 7049 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064925.1 protein_id gnl|my_center|LOCUS_38220 7321 7791 gene locus_tag LOCUS_38230 7321 7791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 7838 8296 gene locus_tag LOCUS_38240 7838 8296 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903106.1 protein_id gnl|my_center|LOCUS_38240 8474 8346 gene locus_tag LOCUS_38250 8474 8346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 9592 8480 gene locus_tag LOCUS_38260 9592 8480 CDS product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904127.1 protein_id gnl|my_center|LOCUS_38260 10883 9729 gene locus_tag LOCUS_38270 10883 9729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 11864 11103 gene locus_tag LOCUS_38280 11864 11103 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902328.1 protein_id gnl|my_center|LOCUS_38280 12212 11964 gene locus_tag LOCUS_38290 12212 11964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38290 12310 13560 gene locus_tag LOCUS_38300 12310 13560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 13635 14285 gene locus_tag LOCUS_38310 13635 14285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38310 17182 14369 gene locus_tag LOCUS_38320 17182 14369 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392406.1 protein_id gnl|my_center|LOCUS_38320 17690 17884 gene locus_tag LOCUS_38330 17690 17884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38330 17937 18389 gene locus_tag LOCUS_38340 17937 18389 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289398.1 protein_id gnl|my_center|LOCUS_38340 18394 18843 gene locus_tag LOCUS_38350 18394 18843 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546753.1 protein_id gnl|my_center|LOCUS_38350 19003 19458 gene locus_tag LOCUS_38360 19003 19458 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289398.1 protein_id gnl|my_center|LOCUS_38360 20890 19802 gene locus_tag LOCUS_38370 20890 19802 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036621.1 protein_id gnl|my_center|LOCUS_38370 22473 20887 gene locus_tag LOCUS_38380 22473 20887 CDS product succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898989.1 protein_id gnl|my_center|LOCUS_38380 22686 23075 gene locus_tag LOCUS_38390 22686 23075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 23426 23851 gene locus_tag LOCUS_38400 23426 23851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 23928 24311 gene locus_tag LOCUS_38410 23928 24311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38410 25204 24323 gene locus_tag LOCUS_38420 25204 24323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 25340 25552 gene locus_tag LOCUS_38430 25340 25552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 25732 27150 gene locus_tag LOCUS_38440 25732 27150 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093094.1 protein_id gnl|my_center|LOCUS_38440 28611 27208 gene locus_tag LOCUS_38450 gene pfkC 28611 27208 CDS product ADP-specific phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867645.1 protein_id gnl|my_center|LOCUS_38450 29554 28676 gene locus_tag LOCUS_38460 29554 28676 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089826111.1 protein_id gnl|my_center|LOCUS_38460 31313 30141 gene locus_tag LOCUS_38470 31313 30141 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902524.1 protein_id gnl|my_center|LOCUS_38470 31602 32507 gene locus_tag LOCUS_38480 31602 32507 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289150.1 protein_id gnl|my_center|LOCUS_38480 >Feature sequence68 136 1380 gene locus_tag LOCUS_38490 136 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 1776 1600 gene locus_tag LOCUS_38500 1776 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 >Feature sequence69 155 1414 gene locus_tag LOCUS_38510 155 1414 CDS product IS4-like element ISH32 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289608.1 protein_id gnl|my_center|LOCUS_38510 >Feature sequence70 315 76 gene locus_tag LOCUS_38520 315 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 421 1233 gene locus_tag LOCUS_38530 421 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38530 1851 1687 gene locus_tag LOCUS_38540 1851 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 2133 1861 gene locus_tag LOCUS_38550 2133 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 3083 2622 gene locus_tag LOCUS_38560 3083 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 5056 3086 gene locus_tag LOCUS_38570 5056 3086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 5237 5046 gene locus_tag LOCUS_38580 5237 5046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 7228 5240 gene locus_tag LOCUS_38590 7228 5240 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779460.1 protein_id gnl|my_center|LOCUS_38590 8351 7230 gene locus_tag LOCUS_38600 8351 7230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 9450 8458 gene locus_tag LOCUS_38610 9450 8458 CDS product IS5-like element ISH11 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903158.1 protein_id gnl|my_center|LOCUS_38610 9613 9855 gene locus_tag LOCUS_38620 9613 9855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 9965 10489 gene locus_tag LOCUS_38630 9965 10489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38630 10499 10918 gene locus_tag LOCUS_38640 10499 10918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 11713 11267 gene locus_tag LOCUS_38650 11713 11267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 11841 12071 gene locus_tag LOCUS_38660 11841 12071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 12282 13403 gene locus_tag LOCUS_38670 12282 13403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 15384 13576 gene locus_tag LOCUS_38680 15384 13576 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136361500.1 protein_id gnl|my_center|LOCUS_38680 15744 16928 gene locus_tag LOCUS_38690 15744 16928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 17492 18364 gene locus_tag LOCUS_38700 17492 18364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 19397 18384 gene locus_tag LOCUS_38710 19397 18384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 21014 19575 gene locus_tag LOCUS_38720 21014 19575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 21457 21011 gene locus_tag LOCUS_38730 21457 21011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 21939 21454 gene locus_tag LOCUS_38740 21939 21454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 22297 23031 gene locus_tag LOCUS_38750 22297 23031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 23246 23055 gene locus_tag LOCUS_38760 23246 23055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 23368 24156 gene locus_tag LOCUS_38770 23368 24156 CDS product DUF429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080615.1 protein_id gnl|my_center|LOCUS_38770 24594 24205 gene locus_tag LOCUS_38780 24594 24205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 25916 25551 gene locus_tag LOCUS_38790 25916 25551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38790 26150 25998 gene locus_tag LOCUS_38800 26150 25998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38800 >Feature sequence71 482 1678 gene locus_tag LOCUS_38810 482 1678 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404011.1 protein_id gnl|my_center|LOCUS_38810 1980 3491 gene locus_tag LOCUS_38820 1980 3491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 3820 5250 gene locus_tag LOCUS_38830 3820 5250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38830 5341 5532 gene locus_tag LOCUS_38840 5341 5532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 5600 5902 gene locus_tag LOCUS_38850 5600 5902 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888922.1 protein_id gnl|my_center|LOCUS_38850 5988 6461 gene locus_tag LOCUS_38860 5988 6461 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902796.1 protein_id gnl|my_center|LOCUS_38860 7629 6535 gene locus_tag LOCUS_38870 7629 6535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 9683 7995 gene locus_tag LOCUS_38880 9683 7995 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090330.1 protein_id gnl|my_center|LOCUS_38880 9866 10657 gene locus_tag LOCUS_38890 9866 10657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 11052 10714 gene locus_tag LOCUS_38900 11052 10714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38900 12934 11123 gene locus_tag LOCUS_38910 gene ligA 12934 11123 CDS product ATP-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902619.1 protein_id gnl|my_center|LOCUS_38910 14063 13098 gene locus_tag LOCUS_38920 14063 13098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 14651 14073 gene locus_tag LOCUS_38930 14651 14073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 14769 16322 gene locus_tag LOCUS_38940 14769 16322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 16588 17580 gene locus_tag LOCUS_38950 gene cofD 16588 17580 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903040.1 protein_id gnl|my_center|LOCUS_38950 17582 18334 gene locus_tag LOCUS_38960 17582 18334 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289327.1 protein_id gnl|my_center|LOCUS_38960 18359 18733 gene locus_tag LOCUS_38970 18359 18733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289346.1 protein_id gnl|my_center|LOCUS_38970 19000 18737 gene locus_tag LOCUS_38980 19000 18737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 19181 19005 gene locus_tag LOCUS_38990 19181 19005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38990 19325 20941 gene locus_tag LOCUS_39000 19325 20941 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903224.1 protein_id gnl|my_center|LOCUS_39000 21202 21507 gene locus_tag LOCUS_39010 21202 21507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 22198 21542 gene locus_tag LOCUS_39020 22198 21542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 22284 23273 gene locus_tag LOCUS_39030 22284 23273 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689435.1 protein_id gnl|my_center|LOCUS_39030 23789 23289 gene locus_tag LOCUS_39040 23789 23289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 24746 23814 gene locus_tag LOCUS_39050 gene mch 24746 23814 CDS product methenyltetrahydromethanopterin cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903231.1 protein_id gnl|my_center|LOCUS_39050 25204 24995 gene locus_tag LOCUS_39060 25204 24995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 26028 25255 gene locus_tag LOCUS_39070 gene radB 26028 25255 CDS product DNA repair and recombination protein RadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903214.1 protein_id gnl|my_center|LOCUS_39070 26141 26899 gene locus_tag LOCUS_39080 26141 26899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 26901 27638 gene locus_tag LOCUS_39090 gene udk 26901 27638 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289294.1 protein_id gnl|my_center|LOCUS_39090 28031 27693 gene locus_tag LOCUS_39100 gene pth2 28031 27693 CDS product peptidyl-tRNA hydrolase Pth2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902135.1 protein_id gnl|my_center|LOCUS_39100 28099 28731 gene locus_tag LOCUS_39110 28099 28731 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479991.1 protein_id gnl|my_center|LOCUS_39110 28813 29415 gene locus_tag LOCUS_39120 gene dcd 28813 29415 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902137.1 protein_id gnl|my_center|LOCUS_39120 29533 30198 gene locus_tag LOCUS_39130 29533 30198 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762300.1 protein_id gnl|my_center|LOCUS_39130 30686 30420 gene locus_tag LOCUS_39140 30686 30420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39140 30808 31305 gene locus_tag LOCUS_39150 30808 31305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 31577 32245 gene locus_tag LOCUS_39160 31577 32245 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902596.1 protein_id gnl|my_center|LOCUS_39160 32466 33113 gene locus_tag LOCUS_39170 32466 33113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 34317 33166 gene locus_tag LOCUS_39180 34317 33166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39180 35271 34432 gene locus_tag LOCUS_39190 35271 34432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902935.1 protein_id gnl|my_center|LOCUS_39190 36020 35532 gene locus_tag LOCUS_39200 gene pyrI 36020 35532 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289641.1 protein_id gnl|my_center|LOCUS_39200 36948 36013 gene locus_tag LOCUS_39210 gene pyrB 36948 36013 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289640.1 protein_id gnl|my_center|LOCUS_39210 37096 37722 gene locus_tag LOCUS_39220 37096 37722 CDS product RAD55 family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878668.1 protein_id gnl|my_center|LOCUS_39220 39339 37723 gene locus_tag LOCUS_39230 39339 37723 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869171.1 protein_id gnl|my_center|LOCUS_39230 41690 39456 gene locus_tag LOCUS_39240 41690 39456 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903142.1 protein_id gnl|my_center|LOCUS_39240 41725 45618 gene locus_tag LOCUS_39250 gene cobN 41725 45618 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289354.1 protein_id gnl|my_center|LOCUS_39250 45679 46446 gene locus_tag LOCUS_39260 45679 46446 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903144.1 protein_id gnl|my_center|LOCUS_39260 46443 47246 gene locus_tag LOCUS_39270 46443 47246 CDS product cobalt-precorrin-7 (C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903145.1 protein_id gnl|my_center|LOCUS_39270 47495 48829 gene locus_tag LOCUS_39280 gene trkA 47495 48829 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404994.1 protein_id gnl|my_center|LOCUS_39280 49795 48875 gene locus_tag LOCUS_39290 49795 48875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 50387 49938 gene locus_tag LOCUS_39300 50387 49938 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526466.1 protein_id gnl|my_center|LOCUS_39300 50504 53278 gene locus_tag LOCUS_39310 gene ppc 50504 53278 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259010.1 protein_id gnl|my_center|LOCUS_39310 53343 53428 gene locus_tag LOCUS_t00510 53343 53428 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 53587 54978 gene locus_tag LOCUS_39320 53587 54978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 55050 55223 gene locus_tag LOCUS_39330 55050 55223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39330 55401 55736 gene locus_tag LOCUS_39340 55401 55736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39340 55816 58707 gene locus_tag LOCUS_39350 55816 58707 CDS product bacterio-opsin activator domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289108.1 protein_id gnl|my_center|LOCUS_39350 58697 58975 gene locus_tag LOCUS_39360 58697 58975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 58978 60285 gene locus_tag LOCUS_39370 gene gdhB 58978 60285 CDS product glutamate dehydrogenase GdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902074.1 protein_id gnl|my_center|LOCUS_39370 60301 60750 gene locus_tag LOCUS_39380 60301 60750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 60925 62457 gene locus_tag LOCUS_39390 60925 62457 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876362.1 protein_id gnl|my_center|LOCUS_39390 63075 62542 gene locus_tag LOCUS_39400 63075 62542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 63352 63146 gene locus_tag LOCUS_39410 63352 63146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39410 63529 64239 gene locus_tag LOCUS_39420 63529 64239 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903559.1 protein_id gnl|my_center|LOCUS_39420 64469 64918 gene locus_tag LOCUS_39430 gene mamA 64469 64918 CDS product methylaspartate mutase subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903701.1 protein_id gnl|my_center|LOCUS_39430 65414 65031 gene locus_tag LOCUS_39440 gene mce 65414 65031 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289162.1 protein_id gnl|my_center|LOCUS_39440 65536 65850 gene locus_tag LOCUS_39450 65536 65850 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903818.1 protein_id gnl|my_center|LOCUS_39450 66032 65862 gene locus_tag LOCUS_39460 66032 65862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 66096 66602 gene locus_tag LOCUS_39470 66096 66602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39470 68303 66621 gene locus_tag LOCUS_39480 68303 66621 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289163.1 protein_id gnl|my_center|LOCUS_39480 69052 68402 gene locus_tag LOCUS_39490 69052 68402 CDS product orotate phosphoribosyltransferase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902287.1 protein_id gnl|my_center|LOCUS_39490 69158 70450 gene locus_tag LOCUS_39500 69158 70450 CDS product HAD hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902285.1 protein_id gnl|my_center|LOCUS_39500 71087 70509 gene locus_tag LOCUS_39510 71087 70509 CDS product DUF2150 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903173.1 protein_id gnl|my_center|LOCUS_39510 72064 71162 gene locus_tag LOCUS_39520 72064 71162 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903172.1 protein_id gnl|my_center|LOCUS_39520 72846 74531 gene locus_tag LOCUS_39530 72846 74531 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729028.1 protein_id gnl|my_center|LOCUS_39530 74923 75333 gene locus_tag LOCUS_39540 74923 75333 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228953.1 protein_id gnl|my_center|LOCUS_39540 75947 75660 gene locus_tag LOCUS_39550 75947 75660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 76186 76761 gene locus_tag LOCUS_39560 76186 76761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 76829 78772 gene locus_tag LOCUS_39570 76829 78772 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135662706.1 protein_id gnl|my_center|LOCUS_39570 79380 80279 gene locus_tag LOCUS_39580 79380 80279 CDS product thiamine-phosphate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902138.1 protein_id gnl|my_center|LOCUS_39580 80309 81001 gene locus_tag LOCUS_39590 80309 81001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39590 81170 81574 gene locus_tag LOCUS_39600 81170 81574 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890426.1 protein_id gnl|my_center|LOCUS_39600 81912 81631 gene locus_tag LOCUS_39610 81912 81631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903776.1 protein_id gnl|my_center|LOCUS_39610 82236 82595 gene locus_tag LOCUS_39620 gene trxA 82236 82595 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890427.1 protein_id gnl|my_center|LOCUS_39620 82977 83426 gene locus_tag LOCUS_39630 82977 83426 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903120.1 protein_id gnl|my_center|LOCUS_39630 83523 84470 gene locus_tag LOCUS_39640 83523 84470 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902901.1 protein_id gnl|my_center|LOCUS_39640 85733 85059 gene locus_tag LOCUS_39650 85733 85059 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289139.1 protein_id gnl|my_center|LOCUS_39650 86803 87042 gene locus_tag LOCUS_39660 86803 87042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660 87039 87392 gene locus_tag LOCUS_39670 87039 87392 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393652.1 protein_id gnl|my_center|LOCUS_39670 88006 87689 gene locus_tag LOCUS_39680 88006 87689 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902900.1 protein_id gnl|my_center|LOCUS_39680 88358 88927 gene locus_tag LOCUS_39690 88358 88927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39690 88924 89181 gene locus_tag LOCUS_39700 88924 89181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39700 90436 89480 gene locus_tag LOCUS_39710 90436 89480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39710 90476 91108 gene locus_tag LOCUS_39720 90476 91108 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902596.1 protein_id gnl|my_center|LOCUS_39720 91172 93373 gene locus_tag LOCUS_39730 91172 93373 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903073.1 protein_id gnl|my_center|LOCUS_39730 93509 95419 gene locus_tag LOCUS_39740 93509 95419 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403165.1 protein_id gnl|my_center|LOCUS_39740 96683 95445 gene locus_tag LOCUS_39750 96683 95445 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902283.1 protein_id gnl|my_center|LOCUS_39750 97818 96751 gene locus_tag LOCUS_39760 97818 96751 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902286.1 protein_id gnl|my_center|LOCUS_39760 98458 98000 gene locus_tag LOCUS_39770 98458 98000 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977989.1 protein_id gnl|my_center|LOCUS_39770 99234 98584 gene locus_tag LOCUS_39780 gene eda 99234 98584 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583017.1 protein_id gnl|my_center|LOCUS_39780 100578 99280 gene locus_tag LOCUS_39790 100578 99280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39790 101185 100646 gene locus_tag LOCUS_39800 101185 100646 CDS product multiprotein-bridging factor 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903083.1 protein_id gnl|my_center|LOCUS_39800 101301 101385 gene locus_tag LOCUS_t00520 101301 101385 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 101878 102441 gene locus_tag LOCUS_39810 101878 102441 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903089.1 protein_id gnl|my_center|LOCUS_39810 102513 103292 gene locus_tag LOCUS_39820 102513 103292 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902620.1 protein_id gnl|my_center|LOCUS_39820 103323 103625 gene locus_tag LOCUS_39830 103323 103625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39830 103833 103585 gene locus_tag LOCUS_39840 gene gvpM 103833 103585 CDS product gas vesicle protein GvpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890529.1 protein_id gnl|my_center|LOCUS_39840 104729 103830 gene locus_tag LOCUS_39850 gene gvpL 104729 103830 CDS product gas vesicle protein GvpL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289626.1 protein_id gnl|my_center|LOCUS_39850 105070 104726 gene locus_tag LOCUS_39860 105070 104726 CDS product gas vesicle protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904100.1 protein_id gnl|my_center|LOCUS_39860 105749 105072 gene locus_tag LOCUS_39870 105749 105072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39870 106712 105816 gene locus_tag LOCUS_39880 106712 105816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39880 107325 106705 gene locus_tag LOCUS_39890 107325 106705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39890 107579 107325 gene locus_tag LOCUS_39900 gene gvpG 107579 107325 CDS product gas vesicle protein GvpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289627.1 protein_id gnl|my_center|LOCUS_39900 108205 107582 gene locus_tag LOCUS_39910 gene gvpF 108205 107582 CDS product gas vesicle protein GvpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890522.1 protein_id gnl|my_center|LOCUS_39910 108779 108360 gene locus_tag LOCUS_39920 108779 108360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39920 108895 109221 gene locus_tag LOCUS_39930 108895 109221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39930 109228 110259 gene locus_tag LOCUS_39940 gene gvpN 109228 110259 CDS product gas vesicle protein GvpN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904110.1 protein_id gnl|my_center|LOCUS_39940 110287 110841 gene locus_tag LOCUS_39950 110287 110841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39950 111045 111389 gene locus_tag LOCUS_39960 111045 111389 CDS product CHY zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405189.1 protein_id gnl|my_center|LOCUS_39960 111920 114676 gene locus_tag LOCUS_39970 gene mutS 111920 114676 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902083.1 protein_id gnl|my_center|LOCUS_39970 115162 114698 gene locus_tag LOCUS_39980 115162 114698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39980 116038 115244 gene locus_tag LOCUS_39990 gene nucS 116038 115244 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250849.1 protein_id gnl|my_center|LOCUS_39990 116103 116657 gene locus_tag LOCUS_40000 116103 116657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40000 117661 117173 gene locus_tag LOCUS_40010 117661 117173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40010 117976 119907 gene locus_tag LOCUS_40020 117976 119907 CDS product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902249.1 protein_id gnl|my_center|LOCUS_40020 120132 121175 gene locus_tag LOCUS_40030 120132 121175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40030 122281 121475 gene locus_tag LOCUS_40040 122281 121475 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106179.1 protein_id gnl|my_center|LOCUS_40040 123206 122274 gene locus_tag LOCUS_40050 123206 122274 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530250.1 protein_id gnl|my_center|LOCUS_40050 124363 123209 gene locus_tag LOCUS_40060 124363 123209 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086326.1 protein_id gnl|my_center|LOCUS_40060 125542 124385 gene locus_tag LOCUS_40070 125542 124385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40070 126843 125986 gene locus_tag LOCUS_40080 126843 125986 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902247.1 protein_id gnl|my_center|LOCUS_40080 127764 127351 gene locus_tag LOCUS_40090 127764 127351 CDS product DUF371 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902246.1 protein_id gnl|my_center|LOCUS_40090 129170 127827 gene locus_tag LOCUS_40100 129170 127827 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902151.1 protein_id gnl|my_center|LOCUS_40100 129610 129374 gene locus_tag LOCUS_40110 129610 129374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 130185 129652 gene locus_tag LOCUS_40120 130185 129652 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902148.1 protein_id gnl|my_center|LOCUS_40120 130387 130746 gene locus_tag LOCUS_40130 130387 130746 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902147.1 protein_id gnl|my_center|LOCUS_40130 131360 130740 gene locus_tag LOCUS_40140 131360 130740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902146.1 protein_id gnl|my_center|LOCUS_40140 132042 131449 gene locus_tag LOCUS_40150 gene rnhA 132042 131449 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902145.1 protein_id gnl|my_center|LOCUS_40150 132205 133167 gene locus_tag LOCUS_40160 132205 133167 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902144.1 protein_id gnl|my_center|LOCUS_40160 134018 133653 gene locus_tag LOCUS_40170 134018 133653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40170 134752 134396 gene locus_tag LOCUS_40180 134752 134396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40180 134952 135746 gene locus_tag LOCUS_40190 134952 135746 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903494.1 protein_id gnl|my_center|LOCUS_40190 136563 135799 gene locus_tag LOCUS_40200 136563 135799 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479544.1 protein_id gnl|my_center|LOCUS_40200 137317 136607 gene locus_tag LOCUS_40210 137317 136607 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903495.1 protein_id gnl|my_center|LOCUS_40210 137378 138064 gene locus_tag LOCUS_40220 137378 138064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289417.1 protein_id gnl|my_center|LOCUS_40220 138309 138381 gene locus_tag LOCUS_t00530 138309 138381 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 138530 138602 gene locus_tag LOCUS_t00540 138530 138602 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 138745 139251 gene locus_tag LOCUS_40230 138745 139251 CDS product 6-pyruvoyl tetrahydropterin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904153.1 protein_id gnl|my_center|LOCUS_40230 139253 140068 gene locus_tag LOCUS_40240 139253 140068 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904152.1 protein_id gnl|my_center|LOCUS_40240 140165 140875 gene locus_tag LOCUS_40250 gene queC 140165 140875 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904151.1 protein_id gnl|my_center|LOCUS_40250 140945 141400 gene locus_tag LOCUS_40260 140945 141400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 142668 141442 gene locus_tag LOCUS_40270 142668 141442 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903607.1 protein_id gnl|my_center|LOCUS_40270 143494 142793 gene locus_tag LOCUS_40280 143494 142793 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289431.1 protein_id gnl|my_center|LOCUS_40280 144456 144013 gene locus_tag LOCUS_40290 144456 144013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 145009 144461 gene locus_tag LOCUS_40300 145009 144461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40300 145650 145973 gene locus_tag LOCUS_40310 145650 145973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 147573 146113 gene locus_tag LOCUS_40320 147573 146113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40320 148279 148890 gene locus_tag LOCUS_40330 148279 148890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40330 150363 149020 gene locus_tag LOCUS_40340 gene larC 150363 149020 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020481.1 protein_id gnl|my_center|LOCUS_40340 151051 153279 gene locus_tag LOCUS_40350 151051 153279 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903216.1 protein_id gnl|my_center|LOCUS_40350 154763 153834 gene locus_tag LOCUS_40360 154763 153834 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289364.1 protein_id gnl|my_center|LOCUS_40360 155514 155137 gene locus_tag LOCUS_40370 155514 155137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40370 156955 155630 gene locus_tag LOCUS_40380 156955 155630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 158232 156952 gene locus_tag LOCUS_40390 158232 156952 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144109.1 protein_id gnl|my_center|LOCUS_40390 159239 158235 gene locus_tag LOCUS_40400 159239 158235 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272652.1 protein_id gnl|my_center|LOCUS_40400 160225 159236 gene locus_tag LOCUS_40410 160225 159236 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368602.1 protein_id gnl|my_center|LOCUS_40410 161873 160308 gene locus_tag LOCUS_40420 161873 160308 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289523.1 protein_id gnl|my_center|LOCUS_40420 162049 162684 gene locus_tag LOCUS_40430 162049 162684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903184.1 protein_id gnl|my_center|LOCUS_40430 162773 163225 gene locus_tag LOCUS_40440 162773 163225 CDS product DUF2240 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903218.1 protein_id gnl|my_center|LOCUS_40440 163382 164965 gene locus_tag LOCUS_40450 gene hemAT 163382 164965 CDS product heme-containing aerotactic transducer HemAT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903098.1 protein_id gnl|my_center|LOCUS_40450 165200 166078 gene locus_tag LOCUS_40460 gene cheF2 165200 166078 CDS product chemotaxis protein CheF2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902685.1 protein_id gnl|my_center|LOCUS_40460 166231 166587 gene locus_tag LOCUS_40470 gene cheY 166231 166587 CDS product chemotaxis protein CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902692.1 protein_id gnl|my_center|LOCUS_40470 166597 167805 gene locus_tag LOCUS_40480 166597 167805 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902688.1 protein_id gnl|my_center|LOCUS_40480 168119 167889 gene locus_tag LOCUS_40490 168119 167889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40490 169003 168194 gene locus_tag LOCUS_40500 gene cheR 169003 168194 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289253.1 protein_id gnl|my_center|LOCUS_40500 169976 169182 gene locus_tag LOCUS_40510 169976 169182 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902800.1 protein_id gnl|my_center|LOCUS_40510 171170 170061 gene locus_tag LOCUS_40520 171170 170061 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902798.1 protein_id gnl|my_center|LOCUS_40520 171407 171997 gene locus_tag LOCUS_40530 171407 171997 CDS product 50S ribosomal protein L15e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902087.1 protein_id gnl|my_center|LOCUS_40530 172073 172507 gene locus_tag LOCUS_40540 172073 172507 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289398.1 protein_id gnl|my_center|LOCUS_40540 172620 174392 gene locus_tag LOCUS_40550 172620 174392 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902613.1 protein_id gnl|my_center|LOCUS_40550 174389 175027 gene locus_tag LOCUS_40560 174389 175027 CDS product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902614.1 protein_id gnl|my_center|LOCUS_40560 175108 176106 gene locus_tag LOCUS_40570 gene purM 175108 176106 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902615.1 protein_id gnl|my_center|LOCUS_40570 177324 176137 gene locus_tag LOCUS_40580 177324 176137 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903761.1 protein_id gnl|my_center|LOCUS_40580 177467 178465 gene locus_tag LOCUS_40590 177467 178465 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903760.1 protein_id gnl|my_center|LOCUS_40590 179053 178514 gene locus_tag LOCUS_40600 179053 178514 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008630908.1 protein_id gnl|my_center|LOCUS_40600 179582 179890 gene locus_tag LOCUS_40610 179582 179890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_40610 180129 180914 gene locus_tag LOCUS_40620 180129 180914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40620 181770 181225 gene locus_tag LOCUS_40630 gene dpsA 181770 181225 CDS product DNA starvation/stationary phase protection protein DpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903826.1 protein_id gnl|my_center|LOCUS_40630 181952 183442 gene locus_tag LOCUS_40640 181952 183442 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902663.1 protein_id gnl|my_center|LOCUS_40640 183779 184306 gene locus_tag LOCUS_40650 183779 184306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40650 184579 184382 gene locus_tag LOCUS_40660 184579 184382 CDS product DUF5800 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902336.1 protein_id gnl|my_center|LOCUS_40660 184734 185591 gene locus_tag LOCUS_40670 184734 185591 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902335.1 protein_id gnl|my_center|LOCUS_40670 185759 186625 gene locus_tag LOCUS_40680 185759 186625 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391606.1 protein_id gnl|my_center|LOCUS_40680 186628 188190 gene locus_tag LOCUS_40690 186628 188190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40690 188187 189869 gene locus_tag LOCUS_40700 188187 189869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 189955 190320 gene locus_tag LOCUS_40710 189955 190320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40710 190559 191671 gene locus_tag LOCUS_40720 190559 191671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40720 191706 192785 gene locus_tag LOCUS_40730 191706 192785 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311608.1 protein_id gnl|my_center|LOCUS_40730 192782 193627 gene locus_tag LOCUS_40740 192782 193627 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494210.1 protein_id gnl|my_center|LOCUS_40740 193624 194394 gene locus_tag LOCUS_40750 193624 194394 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528944.1 protein_id gnl|my_center|LOCUS_40750 195059 194388 gene locus_tag LOCUS_40760 gene phoU 195059 194388 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892486.1 protein_id gnl|my_center|LOCUS_40760 195398 199231 gene locus_tag LOCUS_40770 195398 199231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40770 199335 200591 gene locus_tag LOCUS_40780 gene mgtE 199335 200591 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412626.1 protein_id gnl|my_center|LOCUS_40780 201627 200938 gene locus_tag LOCUS_40790 201627 200938 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902309.1 protein_id gnl|my_center|LOCUS_40790 201884 203635 gene locus_tag LOCUS_40800 201884 203635 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902308.1 protein_id gnl|my_center|LOCUS_40800 203635 204498 gene locus_tag LOCUS_40810 203635 204498 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902307.1 protein_id gnl|my_center|LOCUS_40810 205268 204672 gene locus_tag LOCUS_40820 205268 204672 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902840.1 protein_id gnl|my_center|LOCUS_40820 205670 205314 gene locus_tag LOCUS_40830 205670 205314 CDS product RNA polymerase Rpb4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902841.1 protein_id gnl|my_center|LOCUS_40830 205986 205678 gene locus_tag LOCUS_40840 205986 205678 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902842.1 protein_id gnl|my_center|LOCUS_40840 206246 207391 gene locus_tag LOCUS_40850 206246 207391 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289424.1 protein_id gnl|my_center|LOCUS_40850 207866 207447 gene locus_tag LOCUS_40860 207866 207447 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476513.1 protein_id gnl|my_center|LOCUS_40860 208101 209819 gene locus_tag LOCUS_40870 208101 209819 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404996.1 protein_id gnl|my_center|LOCUS_40870 209812 211458 gene locus_tag LOCUS_40880 209812 211458 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023875.1 protein_id gnl|my_center|LOCUS_40880 212230 211508 gene locus_tag LOCUS_40890 212230 211508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40890 212421 214205 gene locus_tag LOCUS_40900 212421 214205 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404996.1 protein_id gnl|my_center|LOCUS_40900 214198 215898 gene locus_tag LOCUS_40910 214198 215898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40910 216417 215974 gene locus_tag LOCUS_40920 216417 215974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40920 216710 216489 gene locus_tag LOCUS_40930 216710 216489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40930 218510 216816 gene locus_tag LOCUS_40940 218510 216816 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404996.1 protein_id gnl|my_center|LOCUS_40940 220263 218503 gene locus_tag LOCUS_40950 220263 218503 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404996.1 protein_id gnl|my_center|LOCUS_40950 220872 220423 gene locus_tag LOCUS_40960 220872 220423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40960 221492 220890 gene locus_tag LOCUS_40970 221492 220890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40970 221857 222723 gene locus_tag LOCUS_40980 221857 222723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40980 222792 223457 gene locus_tag LOCUS_40990 222792 223457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40990 223857 223435 gene locus_tag LOCUS_41000 223857 223435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903219.1 protein_id gnl|my_center|LOCUS_41000 224559 224122 gene locus_tag LOCUS_41010 224559 224122 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902667.1 protein_id gnl|my_center|LOCUS_41010 225685 224579 gene locus_tag LOCUS_41020 225685 224579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41020 226500 225682 gene locus_tag LOCUS_41030 226500 225682 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890515.1 protein_id gnl|my_center|LOCUS_41030 226802 227851 gene locus_tag LOCUS_41040 gene cheB 226802 227851 CDS product protein-glutamate methylesterase CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902691.1 protein_id gnl|my_center|LOCUS_41040 227848 229824 gene locus_tag LOCUS_41050 gene cheA 227848 229824 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902690.1 protein_id gnl|my_center|LOCUS_41050 229865 230359 gene locus_tag LOCUS_41060 229865 230359 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425085.1 protein_id gnl|my_center|LOCUS_41060 231102 230401 gene locus_tag LOCUS_41070 231102 230401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41070 231814 231104 gene locus_tag LOCUS_41080 231814 231104 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250861.1 protein_id gnl|my_center|LOCUS_41080 231939 232622 gene locus_tag LOCUS_41090 231939 232622 CDS product protein sorting system archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289470.1 protein_id gnl|my_center|LOCUS_41090 232793 233767 gene locus_tag LOCUS_41100 232793 233767 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902123.1 protein_id gnl|my_center|LOCUS_41100 234167 233976 gene locus_tag LOCUS_41110 234167 233976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41110 234330 234512 gene locus_tag LOCUS_41120 234330 234512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41120 234512 234949 gene locus_tag LOCUS_41130 234512 234949 CDS product transcription elongation factor Spt5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902230.1 protein_id gnl|my_center|LOCUS_41130 235332 235045 gene locus_tag LOCUS_41140 235332 235045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41140 235451 236215 gene locus_tag LOCUS_41150 235451 236215 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892483.1 protein_id gnl|my_center|LOCUS_41150 237637 236537 gene locus_tag LOCUS_41160 237637 236537 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902827.1 protein_id gnl|my_center|LOCUS_41160 238988 237639 gene locus_tag LOCUS_41170 238988 237639 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902826.1 protein_id gnl|my_center|LOCUS_41170 239477 241777 gene locus_tag LOCUS_41180 239477 241777 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404998.1 protein_id gnl|my_center|LOCUS_41180 243070 241832 gene locus_tag LOCUS_41190 243070 241832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41190 243903 243136 gene locus_tag LOCUS_41200 243903 243136 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902825.1 protein_id gnl|my_center|LOCUS_41200 244886 243900 gene locus_tag LOCUS_41210 gene mvk 244886 243900 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902824.1 protein_id gnl|my_center|LOCUS_41210 244996 245580 gene locus_tag LOCUS_41220 244996 245580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903179.1 protein_id gnl|my_center|LOCUS_41220 245631 246341 gene locus_tag LOCUS_41230 245631 246341 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289362.1 protein_id gnl|my_center|LOCUS_41230 246343 246519 gene locus_tag LOCUS_41240 246343 246519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41240 246563 247951 gene locus_tag LOCUS_41250 gene aglM 246563 247951 CDS product UDP-glucose 6-dehydrogenase AglM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901982.1 protein_id gnl|my_center|LOCUS_41250 249148 247991 gene locus_tag LOCUS_41260 249148 247991 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090103.1 protein_id gnl|my_center|LOCUS_41260 250219 249605 gene locus_tag LOCUS_41270 250219 249605 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770403.1 protein_id gnl|my_center|LOCUS_41270 251625 250552 gene locus_tag LOCUS_41280 251625 250552 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978349.1 protein_id gnl|my_center|LOCUS_41280 252623 251622 gene locus_tag LOCUS_41290 252623 251622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902836.1 protein_id gnl|my_center|LOCUS_41290 252756 253616 gene locus_tag LOCUS_41300 252756 253616 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902823.1 protein_id gnl|my_center|LOCUS_41300 253649 254392 gene locus_tag LOCUS_41310 253649 254392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41310 254454 254915 gene locus_tag LOCUS_41320 254454 254915 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903120.1 protein_id gnl|my_center|LOCUS_41320 255316 254912 gene locus_tag LOCUS_41330 255316 254912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41330 256204 255452 gene locus_tag LOCUS_41340 256204 255452 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926101.1 protein_id gnl|my_center|LOCUS_41340 256489 256301 gene locus_tag LOCUS_41350 256489 256301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41350 257775 256642 gene locus_tag LOCUS_41360 257775 256642 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902224.1 protein_id gnl|my_center|LOCUS_41360 257924 258205 gene locus_tag LOCUS_41370 257924 258205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41370 258495 258259 gene locus_tag LOCUS_41380 258495 258259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41380 260247 259186 gene locus_tag LOCUS_41390 260247 259186 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531254.1 protein_id gnl|my_center|LOCUS_41390 260958 260374 gene locus_tag LOCUS_41400 260958 260374 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902314.1 protein_id gnl|my_center|LOCUS_41400 261104 262777 gene locus_tag LOCUS_41410 gene aor 261104 262777 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250017.1 protein_id gnl|my_center|LOCUS_41410 263033 263968 gene locus_tag LOCUS_41420 263033 263968 CDS product TIGR03854 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877740.1 protein_id gnl|my_center|LOCUS_41420 265258 264017 gene locus_tag LOCUS_41430 265258 264017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41430 266672 265728 gene locus_tag LOCUS_41440 266672 265728 CDS product DUF5794 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902715.1 protein_id gnl|my_center|LOCUS_41440 267111 267195 gene locus_tag LOCUS_t00550 267111 267195 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 268437 267361 gene locus_tag LOCUS_41450 268437 267361 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902223.1 protein_id gnl|my_center|LOCUS_41450 269764 268544 gene locus_tag LOCUS_41460 269764 268544 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405030.1 protein_id gnl|my_center|LOCUS_41460 270733 269936 gene locus_tag LOCUS_41470 270733 269936 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902222.1 protein_id gnl|my_center|LOCUS_41470 271789 270848 gene locus_tag LOCUS_41480 271789 270848 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902221.1 protein_id gnl|my_center|LOCUS_41480 271989 272429 gene locus_tag LOCUS_41490 271989 272429 CDS product DUF5788 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289143.1 protein_id gnl|my_center|LOCUS_41490 272429 274180 gene locus_tag LOCUS_41500 gene polX 272429 274180 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583948.1 protein_id gnl|my_center|LOCUS_41500 275172 274219 gene locus_tag LOCUS_41510 275172 274219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41510 276041 275169 gene locus_tag LOCUS_41520 276041 275169 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174479.1 protein_id gnl|my_center|LOCUS_41520 276130 277848 gene locus_tag LOCUS_41530 276130 277848 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902829.1 protein_id gnl|my_center|LOCUS_41530 278037 278768 gene locus_tag LOCUS_41540 278037 278768 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902530.1 protein_id gnl|my_center|LOCUS_41540 279621 278839 gene locus_tag LOCUS_41550 279621 278839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41550 280653 279952 gene locus_tag LOCUS_41560 280653 279952 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902621.1 protein_id gnl|my_center|LOCUS_41560 280881 281858 gene locus_tag LOCUS_41570 280881 281858 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902188.1 protein_id gnl|my_center|LOCUS_41570 282348 282590 gene locus_tag LOCUS_41580 282348 282590 CDS product UPF0058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902916.1 protein_id gnl|my_center|LOCUS_41580 283168 282695 gene locus_tag LOCUS_41590 283168 282695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41590 283313 284206 gene locus_tag LOCUS_41600 283313 284206 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902918.1 protein_id gnl|my_center|LOCUS_41600 285636 284416 gene locus_tag LOCUS_41610 285636 284416 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289069.1 protein_id gnl|my_center|LOCUS_41610 285780 286022 gene locus_tag LOCUS_41620 285780 286022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41620 286164 286445 gene locus_tag LOCUS_41630 286164 286445 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143981.1 protein_id gnl|my_center|LOCUS_41630 286789 286484 gene locus_tag LOCUS_41640 286789 286484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41640 287353 286817 gene locus_tag LOCUS_41650 287353 286817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41650 287455 288882 gene locus_tag LOCUS_41660 287455 288882 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289301.1 protein_id gnl|my_center|LOCUS_41660 288875 289405 gene locus_tag LOCUS_41670 gene moaC 288875 289405 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902923.1 protein_id gnl|my_center|LOCUS_41670 289926 290249 gene locus_tag LOCUS_41680 289926 290249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41680 290315 290713 gene locus_tag LOCUS_41690 290315 290713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41690 291490 290753 gene locus_tag LOCUS_41700 gene fabG 291490 290753 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099550.1 protein_id gnl|my_center|LOCUS_41700 293009 291600 gene locus_tag LOCUS_41710 293009 291600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41710 293557 293006 gene locus_tag LOCUS_41720 293557 293006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41720 294086 293601 gene locus_tag LOCUS_41730 294086 293601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41730 294429 294100 gene locus_tag LOCUS_41740 294429 294100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41740 294859 294623 gene locus_tag LOCUS_41750 294859 294623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41750 294747 295319 gene locus_tag LOCUS_41760 294747 295319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 295617 297002 gene locus_tag LOCUS_41770 295617 297002 CDS product phosphopentomutase/phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902636.1 protein_id gnl|my_center|LOCUS_41770 297107 297514 gene locus_tag LOCUS_41780 gene cdd 297107 297514 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902631.1 protein_id gnl|my_center|LOCUS_41780 299269 297560 gene locus_tag LOCUS_41790 299269 297560 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090028.1 protein_id gnl|my_center|LOCUS_41790 299669 299295 gene locus_tag LOCUS_41800 299669 299295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41800 299729 300553 gene locus_tag LOCUS_41810 299729 300553 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902630.1 protein_id gnl|my_center|LOCUS_41810 302015 300633 gene locus_tag LOCUS_41820 302015 300633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41820 302889 302125 gene locus_tag LOCUS_41830 302889 302125 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903009.1 protein_id gnl|my_center|LOCUS_41830 303703 302891 gene locus_tag LOCUS_41840 gene dacZ 303703 302891 CDS product diadenylate cyclase DacZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903010.1 protein_id gnl|my_center|LOCUS_41840 304625 304541 gene locus_tag LOCUS_t00560 304625 304541 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 305067 305375 gene locus_tag LOCUS_41850 305067 305375 CDS product transcription initiation factor IIB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903011.1 protein_id gnl|my_center|LOCUS_41850 306259 305777 gene locus_tag LOCUS_41860 306259 305777 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903012.1 protein_id gnl|my_center|LOCUS_41860 306394 308649 gene locus_tag LOCUS_41870 306394 308649 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903183.1 protein_id gnl|my_center|LOCUS_41870 308946 310337 gene locus_tag LOCUS_41880 308946 310337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41880 310952 310518 gene locus_tag LOCUS_41890 310952 310518 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809299.1 protein_id gnl|my_center|LOCUS_41890 >Feature sequence72 427 227 gene locus_tag LOCUS_41900 427 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41900 1510 932 gene locus_tag LOCUS_41910 1510 932 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890414.1 protein_id gnl|my_center|LOCUS_41910 1757 1512 gene locus_tag LOCUS_41920 1757 1512 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890415.1 protein_id gnl|my_center|LOCUS_41920 3196 3618 gene locus_tag LOCUS_41930 3196 3618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41930 3694 4113 gene locus_tag LOCUS_41940 3694 4113 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289521.1 protein_id gnl|my_center|LOCUS_41940 4308 4102 gene locus_tag LOCUS_41950 4308 4102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41950 4451 4690 gene locus_tag LOCUS_41960 4451 4690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41960 4725 5024 gene locus_tag LOCUS_41970 4725 5024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41970 5477 5115 gene locus_tag LOCUS_41980 5477 5115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41980 5783 5571 gene locus_tag LOCUS_41990 5783 5571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41990 8075 6693 gene locus_tag LOCUS_42000 8075 6693 CDS product TIGR00341 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289527.1 protein_id gnl|my_center|LOCUS_42000 8651 8256 gene locus_tag LOCUS_42010 8651 8256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42010 8746 9006 gene locus_tag LOCUS_42020 8746 9006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42020 10983 9112 gene locus_tag LOCUS_42030 10983 9112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42030 11055 11375 gene locus_tag LOCUS_42040 11055 11375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42040 11962 11504 gene locus_tag LOCUS_42050 11962 11504 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289398.1 protein_id gnl|my_center|LOCUS_42050 13177 12746 gene locus_tag LOCUS_42060 gene trxA 13177 12746 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890427.1 protein_id gnl|my_center|LOCUS_42060 14321 14596 gene locus_tag LOCUS_42070 14321 14596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42070 14641 15342 gene locus_tag LOCUS_42080 14641 15342 CDS product DUF2270 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240630.1 protein_id gnl|my_center|LOCUS_42080 15613 15371 gene locus_tag LOCUS_42090 15613 15371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42090 15783 16160 gene locus_tag LOCUS_42100 15783 16160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42100 16130 16675 gene locus_tag LOCUS_42110 16130 16675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42110 18185 17046 gene locus_tag LOCUS_42120 18185 17046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 18634 18236 gene locus_tag LOCUS_42130 18634 18236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42130 >Feature sequence73 1622 492 gene locus_tag LOCUS_42140 1622 492 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903688.1 protein_id gnl|my_center|LOCUS_42140 1730 2041 gene locus_tag LOCUS_42150 1730 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42150 4404 2344 gene locus_tag LOCUS_42160 4404 2344 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903687.1 protein_id gnl|my_center|LOCUS_42160 4619 4843 gene locus_tag LOCUS_42170 4619 4843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42170 5739 4966 gene locus_tag LOCUS_42180 5739 4966 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903268.1 protein_id gnl|my_center|LOCUS_42180 6815 5856 gene locus_tag LOCUS_42190 6815 5856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42190 6980 8068 gene locus_tag LOCUS_42200 6980 8068 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870574.1 protein_id gnl|my_center|LOCUS_42200 8061 9023 gene locus_tag LOCUS_42210 gene galE 8061 9023 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167827.1 protein_id gnl|my_center|LOCUS_42210 9149 9076 gene locus_tag LOCUS_t00570 9149 9076 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 9245 10720 gene locus_tag LOCUS_42220 gene cca 9245 10720 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902052.1 protein_id gnl|my_center|LOCUS_42220 11764 10739 gene locus_tag LOCUS_42230 11764 10739 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902051.1 protein_id gnl|my_center|LOCUS_42230 12197 11766 gene locus_tag LOCUS_42240 12197 11766 CDS product histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902050.1 protein_id gnl|my_center|LOCUS_42240 13743 12262 gene locus_tag LOCUS_42250 13743 12262 CDS product single-stranded DNA binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902049.1 protein_id gnl|my_center|LOCUS_42250 13997 14069 gene locus_tag LOCUS_t00580 13997 14069 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 15226 14468 gene locus_tag LOCUS_42260 15226 14468 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902169.1 protein_id gnl|my_center|LOCUS_42260 15502 15257 gene locus_tag LOCUS_42270 15502 15257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42270 16295 15504 gene locus_tag LOCUS_42280 16295 15504 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902932.1 protein_id gnl|my_center|LOCUS_42280 17215 16433 gene locus_tag LOCUS_42290 17215 16433 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902170.1 protein_id gnl|my_center|LOCUS_42290 17538 17257 gene locus_tag LOCUS_42300 17538 17257 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902171.1 protein_id gnl|my_center|LOCUS_42300 17702 18409 gene locus_tag LOCUS_42310 17702 18409 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289133.1 protein_id gnl|my_center|LOCUS_42310 18503 19402 gene locus_tag LOCUS_42320 18503 19402 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902173.1 protein_id gnl|my_center|LOCUS_42320 19460 20248 gene locus_tag LOCUS_42330 19460 20248 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903934.1 protein_id gnl|my_center|LOCUS_42330 20952 20296 gene locus_tag LOCUS_42340 20952 20296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42340 21842 20949 gene locus_tag LOCUS_42350 21842 20949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42350 23047 21971 gene locus_tag LOCUS_42360 gene carA 23047 21971 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903326.1 protein_id gnl|my_center|LOCUS_42360 23150 23563 gene locus_tag LOCUS_42370 23150 23563 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903327.1 protein_id gnl|my_center|LOCUS_42370 24135 23677 gene locus_tag LOCUS_42380 24135 23677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42380 24342 24902 gene locus_tag LOCUS_42390 24342 24902 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289385.1 protein_id gnl|my_center|LOCUS_42390 25047 25364 gene locus_tag LOCUS_42400 25047 25364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42400 25739 25398 gene locus_tag LOCUS_42410 25739 25398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42410 25935 26732 gene locus_tag LOCUS_42420 25935 26732 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405419.1 protein_id gnl|my_center|LOCUS_42420 26822 27382 gene locus_tag LOCUS_42430 26822 27382 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890417.1 protein_id gnl|my_center|LOCUS_42430 27471 27938 gene locus_tag LOCUS_42440 27471 27938 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890418.1 protein_id gnl|my_center|LOCUS_42440 29348 28218 gene locus_tag LOCUS_42450 29348 28218 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902607.1 protein_id gnl|my_center|LOCUS_42450 30058 29345 gene locus_tag LOCUS_42460 30058 29345 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289241.1 protein_id gnl|my_center|LOCUS_42460 32095 30155 gene locus_tag LOCUS_42470 gene dnaK 32095 30155 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902322.1 protein_id gnl|my_center|LOCUS_42470 33104 32193 gene locus_tag LOCUS_42480 33104 32193 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707531.1 protein_id gnl|my_center|LOCUS_42480 34682 33198 gene locus_tag LOCUS_42490 34682 33198 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022374.1 protein_id gnl|my_center|LOCUS_42490 34757 35887 gene locus_tag LOCUS_42500 34757 35887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42500 36761 35907 gene locus_tag LOCUS_42510 36761 35907 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902470.1 protein_id gnl|my_center|LOCUS_42510 36912 37472 gene locus_tag LOCUS_42520 36912 37472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136361096.1 protein_id gnl|my_center|LOCUS_42520 37670 38464 gene locus_tag LOCUS_42530 gene fba1 37670 38464 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902472.1 protein_id gnl|my_center|LOCUS_42530 38467 39333 gene locus_tag LOCUS_42540 38467 39333 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089826111.1 protein_id gnl|my_center|LOCUS_42540 39677 39429 gene locus_tag LOCUS_42550 39677 39429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42550 40954 39782 gene locus_tag LOCUS_42560 40954 39782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42560 41745 43535 gene locus_tag LOCUS_42570 41745 43535 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049952164.1 protein_id gnl|my_center|LOCUS_42570 43794 44144 gene locus_tag LOCUS_42580 43794 44144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42580 44936 44169 gene locus_tag LOCUS_42590 44936 44169 CDS product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903895.1 protein_id gnl|my_center|LOCUS_42590 45000 45989 gene locus_tag LOCUS_42600 45000 45989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903896.1 protein_id gnl|my_center|LOCUS_42600 46898 46050 gene locus_tag LOCUS_42610 46898 46050 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902268.1 protein_id gnl|my_center|LOCUS_42610 47286 46906 gene locus_tag LOCUS_42620 47286 46906 CDS product nascent polypeptide-associated complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902267.1 protein_id gnl|my_center|LOCUS_42620 47875 47393 gene locus_tag LOCUS_42630 47875 47393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902265.1 protein_id gnl|my_center|LOCUS_42630 48691 48014 gene locus_tag LOCUS_42640 48691 48014 CDS product TRIC cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902175.1 protein_id gnl|my_center|LOCUS_42640 48874 49047 gene locus_tag LOCUS_42650 48874 49047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42650 49684 49187 gene locus_tag LOCUS_42660 49684 49187 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902263.1 protein_id gnl|my_center|LOCUS_42660 51767 50400 gene locus_tag LOCUS_42670 51767 50400 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903112.1 protein_id gnl|my_center|LOCUS_42670 51980 54154 gene locus_tag LOCUS_42680 gene metG 51980 54154 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902197.1 protein_id gnl|my_center|LOCUS_42680 54571 54206 gene locus_tag LOCUS_42690 54571 54206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42690 56406 54646 gene locus_tag LOCUS_42700 gene pyk 56406 54646 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902196.1 protein_id gnl|my_center|LOCUS_42700 57127 57402 gene locus_tag LOCUS_42710 57127 57402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42710 57524 59650 gene locus_tag LOCUS_42720 57524 59650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42720 60929 60192 gene locus_tag LOCUS_42730 60929 60192 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903333.1 protein_id gnl|my_center|LOCUS_42730 61440 60922 gene locus_tag LOCUS_42740 61440 60922 CDS product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903332.1 protein_id gnl|my_center|LOCUS_42740 61555 62583 gene locus_tag LOCUS_42750 61555 62583 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903331.1 protein_id gnl|my_center|LOCUS_42750 63106 64605 gene locus_tag LOCUS_42760 gene guaB 63106 64605 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289261.1 protein_id gnl|my_center|LOCUS_42760 65294 64677 gene locus_tag LOCUS_42770 65294 64677 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903263.1 protein_id gnl|my_center|LOCUS_42770 65844 65365 gene locus_tag LOCUS_42780 65844 65365 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289517.1 protein_id gnl|my_center|LOCUS_42780 65956 66432 gene locus_tag LOCUS_42790 65956 66432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42790 68227 66464 gene locus_tag LOCUS_42800 68227 66464 CDS product YcaO-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892506.1 protein_id gnl|my_center|LOCUS_42800 >Feature sequence74 1561 221 gene locus_tag LOCUS_42810 1561 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42810 1749 1925 gene locus_tag LOCUS_42820 1749 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42820 2912 2376 gene locus_tag LOCUS_42830 2912 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42830 4219 3047 gene locus_tag LOCUS_42840 4219 3047 CDS product ISH3-like element ISH3B family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289545.1 protein_id gnl|my_center|LOCUS_42840 5057 4272 gene locus_tag LOCUS_42850 5057 4272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42850 >Feature sequence75 438 2477 gene locus_tag LOCUS_42860 438 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42860 >Feature sequence76 106 2979 gene locus_tag LOCUS_42870 106 2979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42870 3229 3384 gene locus_tag LOCUS_42880 3229 3384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42880 3389 4648 gene locus_tag LOCUS_42890 3389 4648 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459437.1 protein_id gnl|my_center|LOCUS_42890 4736 5620 gene locus_tag LOCUS_42900 4736 5620 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385042.1 protein_id gnl|my_center|LOCUS_42900 6885 5671 gene locus_tag LOCUS_42910 6885 5671 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289129.1 protein_id gnl|my_center|LOCUS_42910 7410 7051 gene locus_tag LOCUS_42920 7410 7051 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903744.1 protein_id gnl|my_center|LOCUS_42920 7869 7525 gene locus_tag LOCUS_42930 7869 7525 CDS product DUF5783 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289487.1 protein_id gnl|my_center|LOCUS_42930 8000 8383 gene locus_tag LOCUS_42940 8000 8383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42940 8733 8398 gene locus_tag LOCUS_42950 8733 8398 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902280.1 protein_id gnl|my_center|LOCUS_42950 8867 10273 gene locus_tag LOCUS_42960 8867 10273 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902279.1 protein_id gnl|my_center|LOCUS_42960 13000 10298 gene locus_tag LOCUS_42970 13000 10298 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902482.1 protein_id gnl|my_center|LOCUS_42970 14255 13080 gene locus_tag LOCUS_42980 14255 13080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42980 14395 14964 gene locus_tag LOCUS_42990 gene thpR 14395 14964 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879646.1 protein_id gnl|my_center|LOCUS_42990 15007 15237 gene locus_tag LOCUS_43000 15007 15237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43000 15240 15518 gene locus_tag LOCUS_43010 15240 15518 CDS product 50S ribosomal protein L31e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903843.1 protein_id gnl|my_center|LOCUS_43010 15521 16186 gene locus_tag LOCUS_43020 15521 16186 CDS product translation initiation factor IF-6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903842.1 protein_id gnl|my_center|LOCUS_43020 16315 17241 gene locus_tag LOCUS_43030 16315 17241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43030 18695 17301 gene locus_tag LOCUS_43040 18695 17301 CDS product signal recognition particle protein Srp54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903838.1 protein_id gnl|my_center|LOCUS_43040 19302 18850 gene locus_tag LOCUS_43050 19302 18850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901970.1 protein_id gnl|my_center|LOCUS_43050 19838 19302 gene locus_tag LOCUS_43060 19838 19302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43060 19946 20167 gene locus_tag LOCUS_43070 19946 20167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43070 20225 21682 gene locus_tag LOCUS_43080 20225 21682 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021657.1 protein_id gnl|my_center|LOCUS_43080 21747 22607 gene locus_tag LOCUS_43090 21747 22607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43090 23164 22652 gene locus_tag LOCUS_43100 23164 22652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43100 23981 23202 gene locus_tag LOCUS_43110 23981 23202 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903861.1 protein_id gnl|my_center|LOCUS_43110 24191 24472 gene locus_tag LOCUS_43120 24191 24472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43120 >Feature sequence77 1000 821 gene locus_tag LOCUS_43130 1000 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43130 1581 1447 gene locus_tag LOCUS_43140 1581 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43140 2382 1582 gene locus_tag LOCUS_43150 2382 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059055354.1 protein_id gnl|my_center|LOCUS_43150 2714 3199 gene locus_tag LOCUS_43160 2714 3199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43160 3227 3649 gene locus_tag LOCUS_43170 3227 3649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43170