COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence1 source 1..5851320 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 97..1392 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070424.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 gene dnaA CDS 1472..2512 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070425.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 gene dnaN CDS 2910..4007 product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070426.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 gene recF CDS 4084..6429 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070427.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 gene gyrB CDS 6612..7283 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS complement(7386..8126) product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869282.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 gene pxpA CDS complement(8227..9156) product 5-oxoprolinase subunit PxpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912709.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 gene pxpC CDS complement(9153..9872) product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266314.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 gene pxpB CDS 10019..11086 product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070429.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS complement(11151..13220) product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070430.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 gene glyS CDS complement(13232..14137) product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070431.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 gene glyQ CDS 14317..14901 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070432.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS complement(15218..18472) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070433.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS complement(18840..19277) product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070434.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS complement(19325..19594) product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070435.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 gene tusA CDS complement(19746..20213) product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262324.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 gene ybaK CDS complement(20210..20740) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705267.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS complement(20918..22081) product acetyl-CoA C-acyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070436.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 gene fadA CDS complement(22100..24253) product fatty acid oxidation complex subunit alpha FadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070437.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 gene fadB CDS 24503..25822 product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070438.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 gene pepQ CDS 25981..26595 product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070439.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS 26789..28207 product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070440.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS 28309..28836 product menaquinone-dependent protoporphyrinogen IX dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070441.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 gene hemG CDS complement(29253..29561) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070442.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS 29760..30299 product menaquinone-dependent protoporphyrinogen IX dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070443.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 gene hemG CDS 30839..31360 product spermidine N1-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422431.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 gene speG CDS complement(31708..33150) product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070444.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS complement(33496..34905) product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070445.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 gene trkA CDS complement(34915..36192) product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070446.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 gene rsmB CDS complement(36194..37168) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070447.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 gene fmt CDS complement(37176..37688) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070448.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 gene def CDS 37870..38973 product LysM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070449.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS 39171..40190 product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925584.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 gene dprA CDS 40193..40666 product DUF494 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070451.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS complement(41012..42784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS 42925..43488 product topoisomerase DNA-binding C4 zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070452.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS 43526..44083 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070453.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS 44147..45067 product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070454.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 gene hemF CDS 45501..46325 product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070456.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 gene aroE CDS 46322..46585 product DUF1488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704275.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(46598..47152) product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070458.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 rRNA 47721..49263 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 rRNA 49600..52501 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 rRNA 52658..52760 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 CDS complement(53238..54254) product IS110-like element IS1111A family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041952483.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS complement(54697..54888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00430 rRNA 55710..57252 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00040 rRNA 57590..60491 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00050 rRNA 60647..60749 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00060 CDS 60902..61150 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS 61639..64071 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074320.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS complement(64416..64841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS complement(64826..65836) product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478256.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS complement(65836..66693) product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462768.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 gene motA CDS complement(66709..67431) product lateral flagellar system RNA polymerase sigma factor LafS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462772.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 gene lafS CDS complement(67443..67901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS complement(67916..69046) product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478082.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS complement(69036..69362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(69331..69711) product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462778.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 gene fliS CDS complement(69730..71088) product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462779.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 gene fliD CDS complement(71411..72217) product lateral flagellin LafA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462780.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 gene lafA CDS complement(72629..73672) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS complement(73687..74604) product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266799.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 gene flgL CDS complement(74682..76046) product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481537.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 gene flgK CDS complement(76103..76555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS complement(76555..77688) product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463987.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(77780..78442) product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106240.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 gene flgH CDS complement(78478..79263) product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481471.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 gene flgG CDS complement(79311..80045) product flagellar basal body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464045.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS complement(80057..81247) product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463978.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 gene flgE CDS complement(81288..81998) product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463939.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 gene flgD CDS complement(81999..82418) product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464013.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 gene flgC CDS complement(82427..82777) product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463947.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 gene flgB CDS 82927..83613 product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106239.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 gene flgA CDS 83718..84002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS 84013..84462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS complement(84466..84882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS complement(84892..86223) product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086458.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 gene fliI CDS complement(86216..86986) product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478070.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 gene fliH CDS complement(87090..88103) product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478340.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS complement(88194..89900) product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106531.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 gene fliF CDS complement(89988..90326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS complement(90365..91666) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478291.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS complement(91656..92567) product flagellar protein MotY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104269.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 gene motY CDS 92995..93195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS 93380..94045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 94128..94484 product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462794.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 gene fliN CDS 94477..95214 product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462793.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 gene fliP CDS 95400..95669 product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462792.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 gene fliQ CDS 95759..96451 product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462790.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 gene fliR CDS 96448..97581 product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462787.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 gene flhB CDS 97593..99674 product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478396.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 gene flhA CDS complement(99749..100741) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074319.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS complement(100897..102702) product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074318.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS complement(102851..104227) product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074316.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 gene hemN CDS complement(104477..104944) product DUF2489 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074315.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(105016..105552) product Der GTPase-activating protein YihI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074314.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 gene yihI CDS complement(107020..107640) product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074258.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS 107810..108490 product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074259.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 gene yihA CDS complement(109290..112040) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074260.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 gene polA CDS 112453..113106 product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074261.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 gene elbB CDS complement(113142..113981) product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074262.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 gene glpG CDS complement(114020..114328) product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074263.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 gene glpE CDS complement(114427..115452) product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074264.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 gene tdh CDS complement(115548..116741) product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074265.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS complement(117040..117696) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074266.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS 118184..119302 product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074267.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 gene waaA CDS complement(120176..120958) product 3-deoxy-D-manno-octulosonic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074268.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS complement(121046..121933) product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974013.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 gene rfbD CDS complement(121926..122483) product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036472525.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 gene rfbC CDS 122602..123639 product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074269.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS 123755..124822 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS complement(124874..125680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS complement(125736..126641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS 127074..128144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS 128141..128533 product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859527.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS complement(128570..129523) product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707885.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 gene rfaD CDS complement(129586..130593) product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868996.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS 130791..132230 product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073527.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 gene hldE CDS 132352..132831 product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074274.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 gene coaD CDS 132842..134335 product capsule assembly Wzi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074275.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS complement(134382..135197) product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074312.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 gene mutM CDS complement(135249..135662) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS complement(135875..136861) product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074310.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 gene moaA CDS complement(136883..138682) product bifunctional molybdopterin-guanine dinucleotide biosynthesis adaptor protein MobB/molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074309.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS complement(138698..139288) product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074308.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 gene mobA CDS complement(139272..139991) product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074307.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS complement(139995..140702) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074306.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS complement(140797..141609) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074305.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS 141885..143267 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074304.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS 143269..145386 product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074303.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS complement(146486..147142) product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074301.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS complement(147440..148798) product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074299.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS 149193..151328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS 151351..152703 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074298.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS 152744..153367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS 153387..153944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS 153944..154714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS 154715..154936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS 155231..156409 product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074297.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS 156486..156764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS 156940..157638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(158038..158991) product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074294.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS complement(159192..160547) product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074290.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 gene gorA CDS complement(160771..161307) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074289.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS complement(161446..162222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074288.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS 162503..164545 product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074287.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 gene prlC CDS 164755..165285 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074286.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS complement(165325..165975) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074285.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS complement(166001..166900) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814625.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS 167152..167847 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074284.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS complement(167981..168739) product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074283.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS 169172..170329 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074282.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS 170339..173488 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074281.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS 173854..174273 product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094122848.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS 174299..175009 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065739343.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS complement(175026..178112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS complement(178140..179156) product ABC transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704435.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS complement(179373..180989) product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005484923.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS complement(181217..182380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS 182640..185021 product acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071198.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS 185846..186415 product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074256.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS 186483..187493 product DUF3137 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074255.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS 187494..188264 product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074254.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS complement(188261..189607) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263736.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS 189835..190728 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263754.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS 190768..191145 product DUF4440 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957955.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS 191199..191582 product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112985.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS complement(191655..192497) product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074253.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 gene rlmJ CDS complement(192573..193820) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070839.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS complement(194012..196309) product decaheme c-type cytochrome MtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071901.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 gene mtrC CDS 196594..197343 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074252.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS 197577..198593 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS 198625..198798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS 198823..199398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS complement(199522..200400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS complement(200470..202434) product HAMP domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074229.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS complement(202548..203858) product two-component system sensor histidine kinase EnvZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074228.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 gene envZ CDS complement(203914..204639) product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074227.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 gene ompR CDS complement(206459..206950) product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260985.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 gene greB CDS 207427..209220 product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142055.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS 209351..211693 product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074225.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS 211988..214039 product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074224.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS complement(214357..214869) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074223.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS complement(214948..215733) product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074222.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 gene bioH CDS 216022..216534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS complement(216537..218999) product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838916.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS 219334..219912 product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074215.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 gene nfuA CDS complement(220029..221366) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074213.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS 221541..222449 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074212.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS complement(222498..223538) product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037036.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS complement(223601..224449) product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881719.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(224611..227982) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488898.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS complement(228007..228582) product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037040.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS complement(228651..230756) product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162435.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS complement(230796..231158) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806565.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS complement(231155..231469) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS complement(231769..232464) product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074211.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS complement(232534..233448) product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074210.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 gene cyoE CDS complement(233530..234513) product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074209.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS complement(234513..235058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074208.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS complement(235257..236093) product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074207.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS 236378..236596 product DUF2909 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482739.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS complement(236776..237651) product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074205.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS complement(237648..238217) product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074204.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS complement(238220..239848) product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074203.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 gene ctaD CDS complement(239858..240979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS complement(241412..241924) product SulA-like leucine-rich domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074201.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS complement(241957..242574) product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074200.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 gene lexA CDS 242629..242838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS 242831..245266 product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074199.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 gene plsB CDS 245307..246563 product tryptophan permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074198.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 gene mtr CDS 246632..247279 product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932617.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 gene bluB CDS complement(247291..248169) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263711.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS 248524..248856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263713.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS 248849..250072 product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263714.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS complement(250156..251361) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943270.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS complement(251527..251940) product globin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928811.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS 252131..252937 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074197.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS 253425..255446 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073445.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS complement(255569..258700) product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074441.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS complement(258693..258857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS complement(258868..260538) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074442.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS complement(260561..261073) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS complement(261335..261778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220591441.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS complement(262001..262438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS complement(262631..263134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS 263549..264112 product NapC/NirT family cytochrome c CymA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074189.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 gene cymA CDS 264366..265289 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263610.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS 265501..267687 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263609.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS 267747..268469 product siderophore ferric iron reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480319.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS 268457..269224 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263608.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS 269218..270219 product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263607.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS 270219..272222 product Fe(3+)-hydroxamate ABC transporter permease FhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263606.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 gene fhuB CDS complement(272272..272556) product DUF1145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074186.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS complement(272633..273214) product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074185.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 gene rsmD CDS 273485..275203 product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074184.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 gene ftsY CDS 275252..275947 product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074183.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 gene ftsE CDS 275986..276951 product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074182.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 gene ftsX CDS 277315..278175 product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074181.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 gene rpoH CDS complement(278278..279702) product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074179.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 gene menE CDS complement(279716..280783) product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074178.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 gene menC CDS complement(280780..281514) product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074177.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 gene menH CDS complement(281562..283271) product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074176.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 gene menD CDS complement(283908..284069) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS 284276..284974 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS 284989..286998 product MtrB/PioB family decaheme-associated outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071630.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS 287022..289538 product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071631.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS 289553..290230 product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071632.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 gene dmsB CDS 290276..290935 product molecular chaperone TorD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071633.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS complement(291042..291479) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074172.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS 291833..293050 product L-methionine/branched-chain amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074171.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 gene yjeH CDS 293231..294055 product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074169.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS complement(294104..294556) product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074168.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS complement(294699..295217) product DUF2780 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074167.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS 295400..296125 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074166.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS 296200..297618 product DUF4145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074165.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS 297739..299016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265931.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS complement(299040..299399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074164.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS complement(299588..300550) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074162.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS 300658..301860 product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074161.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS complement(302077..302838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS complement(302817..303053) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS 303381..303905 product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074160.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS 304352..305944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS 305945..306304 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074158.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS complement(306316..307032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS 307292..308620 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074152.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS 308617..310074 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074151.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS 310262..310822 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS 310875..311333 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074149.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(311355..311819) product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074146.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 gene trmL CDS 311989..312954 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072387.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS complement(313205..314101) product YjjW family glycine radical enzyme activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172966557.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS complement(314073..315626) product YjjI family glycine radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072385.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS complement(315931..317451) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074108.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS 317730..319541 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074107.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS 319665..321173 product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551119.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS 321308..321802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS complement(321815..323860) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS 324020..324823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS 324926..325906 product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458694.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS complement(326000..326917) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260906.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS 327186..328706 product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072956.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS 328734..329087 product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073430.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS 329563..330807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS 330993..332117 product outer membrane beta barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071616.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS complement(332314..333183) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314318.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS 333257..333988 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS complement(334307..335686) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074106.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS complement(335686..336369) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074105.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS 336616..337104 product Spy/CpxP family protein refolding chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925933.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS 337211..338080 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074103.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 rRNA 338800..340342 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00070 rRNA 340679..343580 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00080 rRNA 343737..343839 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00090 CDS complement(344262..344456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02880 rRNA 345312..346854 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00100 rRNA 347191..350092 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00110 rRNA 350249..350351 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00120 CDS 350658..350897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS complement(350992..351336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS complement(351521..353755) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074011.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS complement(353815..354459) product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005656008.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 gene dmsB CDS complement(354471..357110) product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071631.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS complement(357120..358817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS complement(358827..359687) product decaheme c-type cytochrome MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071900.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 gene mtrA CDS complement(360179..360808) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS 360943..361677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS 361838..362149 product type II toxin-antitoxin system antitoxin HipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262055.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 gene hipB CDS 362149..363477 product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262056.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS complement(363784..364368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS complement(364806..365357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS complement(365370..366038) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS complement(366121..366738) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071644.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS complement(366750..366938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS complement(366993..368378) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704946.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 gene dnaB CDS complement(368353..369132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS complement(369146..369385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS complement(369378..369656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS complement(369772..370587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS complement(370596..371918) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025385041.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS complement(371989..372852) product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073931.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS 373032..373745 product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073930.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 gene rph CDS 373852..374493 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073929.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 gene pyrE CDS complement(374554..375213) product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073928.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 gene folE CDS complement(375433..376116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03150 note possible pseudo, frameshifted CDS complement(376110..377405) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03160 note possible pseudo, frameshifted CDS complement(377896..378489) product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073926.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 gene slmA CDS complement(378628..379086) product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073925.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 gene dut CDS complement(379083..380327) product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073924.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 gene coaBC CDS 380465..381142 product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073923.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 gene radC CDS 381272..381508 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006079870.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 gene rpmB CDS 381515..381688 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006079871.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 gene rpmG CDS 381956..383299 product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925787.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 gene argA CDS complement(383358..384242) product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073920.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 gene rarD CDS complement(384412..384876) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073919.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS 385051..386883 product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073918.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 gene recQ CDS complement(386934..388688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS 389200..390771 product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073916.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 gene leuA CDS 390816..391919 product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073915.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 gene leuB CDS 391923..393323 product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073914.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 gene leuC CDS 393334..393939 product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073913.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 gene leuD CDS 394429..395802 product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073912.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS 395984..396490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS 396566..398059 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073911.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 gene glpK CDS complement(398139..398447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS 399038..399496 product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073909.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 gene mraZ CDS 399528..400469 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073908.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 gene rsmH CDS 400622..400849 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS 401091..402671 product peptidoglycan glycosyltransferase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073906.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS 402671..404149 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073905.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 gene murE CDS 404146..405513 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073904.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 gene murF CDS 405513..406595 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073903.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 gene mraY CDS 406695..407954 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073902.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 gene murD CDS 407947..409161 product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073901.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 gene ftsW CDS 409161..410258 product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073900.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 gene murG CDS 410260..411705 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073899.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 gene murC CDS 411855..412628 product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073898.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS 412628..413863 product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073897.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 gene ftsA CDS 413947..415119 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073896.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 gene ftsZ CDS 415285..416205 product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073895.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 gene lpxC CDS complement(416216..416584) product DciA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925786.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS 416696..417595 product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073893.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS 417656..420379 product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073892.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 gene secA rRNA 421122..422664 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00130 tRNA 422740..422816 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 tRNA 422946..423021 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 rRNA 423437..426338 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00140 rRNA 426494..426596 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00150 tRNA 426689..426764 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 rRNA 426788..426889 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00160 CDS complement(427272..427541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03540 rRNA 429291..430833 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00170 rRNA 431155..434056 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00180 rRNA 434212..434314 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00190 CDS complement(435138..435545) product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070770.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 gene mutT CDS complement(435549..435761) product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070771.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 gene yacG CDS complement(435847..436581) product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070772.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 gene zapD CDS complement(436590..437195) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070773.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 gene coaE CDS complement(437231..438142) product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070774.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS complement(438202..439473) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070775.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS complement(439573..441282) product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070776.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 gene pilB CDS complement(441361..441795) product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070777.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS complement(442716..443618) product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070778.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 gene nadC CDS complement(443688..443894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS 443971..444531 product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070779.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 gene ampD CDS 444550..445401 product beta-lactamase regulator AmpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070780.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 gene ampE CDS 445604..446374 product pyruvate dehydrogenase complex transcriptional repressor PdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070781.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 gene pdhR CDS 446487..449147 product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462566.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 gene aceE CDS 449161..451017 product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462571.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 gene aceF CDS 451176..452606 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070784.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene lpdA CDS 452805..457265 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070785.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS 457391..459604 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925601.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS 459799..462012 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925601.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS 462155..464206 product M13 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070787.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS complement(464309..464974) product hexitol phosphatase HxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070789.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 gene hxpB CDS 465388..467985 product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070790.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 gene acnB CDS complement(468161..468628) product Rsd/AlgQ family anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070791.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS 469122..470186 product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070792.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 gene hemE CDS complement(470249..471721) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704858.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS complement(471760..472512) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704857.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS complement(472593..473327) product spondin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478024.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS complement(473336..474037) product spondin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478233.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS 474390..476966 product cyclic di-GMP phosphodiesterase PdeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070793.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 gene pdeB CDS 477084..477887 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070794.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS complement(477961..479253) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070797.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 gene purD CDS complement(479506..481107) product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070798.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 gene purH CDS 481416..481895 product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070799.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 gene zntR CDS 481898..483271 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925813.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS 483704..485542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS 485978..487891 product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928446.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS complement(487980..489038) product DUF4382 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453776.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS complement(489293..490021) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073261.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS complement(490221..491165) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070865.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS 491263..492321 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704335.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS 492324..493913 product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070866.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS 493982..494434 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925817.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS 494985..495869 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070869.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS complement(495891..496841) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268653.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS complement(496838..497779) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105599.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS complement(498426..499451) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925751.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS complement(499845..500678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS 500910..501368 product periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073835.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS complement(501455..501667) product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073832.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS 501997..502755 product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073831.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 gene udp CDS 503087..503542 product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073829.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS 503615..504532 product stomatin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073828.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS 504529..505470 product stomatin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073827.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS complement(505563..508076) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS complement(508073..509104) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392003.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS 509480..509833 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262907.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS 510052..512223 product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070819.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 gene uvrD CDS 512322..513185 product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070820.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 gene ubiA CDS 513445..514002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS 514088..515170 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS 515289..515993 product DUF4336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837011.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS 516106..516660 product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073553.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 gene cyaB CDS 517349..517894 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS complement(518229..518807) product nucleoside triphosphate pyrophosphohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070825.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS complement(519010..520959) product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073927.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS complement(521064..522227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS complement(522284..523363) product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338705.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS 523525..525912 product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145665688.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS 526132..527658 product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426252.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 gene nhaC CDS complement(527736..528674) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070712.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS complement(528682..529326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS complement(529717..531240) product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070714.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS 531433..532029 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074097.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS 532177..533334 product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074098.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS 533437..534117 product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378111.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS 534129..534755 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_215270200.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS 534938..535723 product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277565.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 gene cysE CDS complement(535823..536626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS complement(536795..537562) product HTH-type transcriptional activator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074007.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 gene ilvY CDS 537855..539336 product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074006.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 gene ilvC CDS 539790..541529 product acetolactate synthase 2 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925791.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 gene ilvG CDS 541638..541865 product acetolactate synthase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368897.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 gene ilvM CDS 541964..542887 product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008807980.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS 543041..544891 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074002.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 gene ilvD CDS 544893..546467 product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074001.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 gene ilvA CDS 546731..547876 product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074000.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS complement(547982..549976) product TonB-dependent copper receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070958.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS complement(550114..551181) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205669729.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS 551123..551305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS 551345..551953 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035488.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS 552238..552864 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS complement(553030..554388) product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073996.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS complement(554678..555154) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073995.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS complement(555265..556023) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073994.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS complement(556157..557518) product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073993.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 gene creD CDS 557724..558569 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS complement(558655..558909) product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073988.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS complement(559150..562227) product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073987.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS complement(562240..563358) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073986.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS complement(563533..564147) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073985.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS 564431..566443 product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073984.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 gene rep CDS complement(566485..569121) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073983.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 tRNA 569368..569444 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 tRNA 569507..569582 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 tRNA 569620..569696 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA 569891..569967 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS complement(570384..572309) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073982.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS complement(572318..573025) product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073981.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS complement(573045..573644) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073980.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS complement(573644..575053) product type I protein secretion system protein AggA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073979.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 gene aggA CDS complement(575083..576465) product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073978.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS complement(576462..578636) product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073977.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS complement(578746..590373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS complement(590700..591167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS complement(591170..591646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS complement(591657..593144) product pilus assembly protein TadG-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531999.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS complement(593258..601432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS complement(601716..602885) product heme biosynthesis HemY N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073975.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS complement(602882..604066) product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073974.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS complement(604114..604857) product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073973.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS complement(604879..605808) product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073972.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 gene hemC CDS 606174..608432 product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073971.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS complement(608498..608827) product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073970.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 gene cyaY CDS 609270..610514 product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073968.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 gene lysA CDS 610614..611456 product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073967.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 gene dapF CDS 611453..612091 product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073966.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS 612137..613069 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925924.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 gene xerC CDS 613142..613858 product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073964.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS complement(613958..614674) product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073961.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 gene ric CDS complement(614868..615173) product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006083371.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 gene fis CDS complement(615192..616169) product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070754.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 gene dusB CDS complement(616311..617192) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070755.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 gene prmA CDS 617621..618352 product fumarate reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070756.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS 618495..619223 product fumarate reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070757.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS 619518..621518 product fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070758.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS 621515..622258 product fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070759.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS 622365..623273 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070762.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS complement(623557..624822) product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070765.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 gene rho CDS complement(625119..625445) product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070766.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 gene trxA CDS 625620..626927 product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070767.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 gene rhlB CDS 626928..627839 product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070768.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS 628105..628347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS 628299..631307 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039298.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS 631768..634458 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458992.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS complement(634530..635066) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070769.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS complement(635390..636406) product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073891.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 gene hemB CDS complement(636490..638319) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073890.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS complement(638348..639187) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073889.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS complement(639187..639720) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073888.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS complement(639776..640543) product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073887.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 gene tatC CDS complement(640547..640945) product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073886.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 gene tatB CDS complement(640952..641191) product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073885.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 gene tatA CDS complement(641255..642904) product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073884.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 gene ubiB CDS complement(642901..643536) product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073883.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS complement(643640..644395) product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073882.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 gene ubiE CDS complement(644663..645550) product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073881.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS complement(645791..647953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS complement(648251..648736) product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073880.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 gene rraA CDS 649067..649312 product YgjV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073879.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS 649428..650012 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073878.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS 650033..651085 product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073877.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS 651943..653118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS 654135..654725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS 654837..658022 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS 658382..659542 product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454985.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 659545..660351 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS complement(660413..661774) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655956.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 gene accC CDS complement(661890..662372) product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098992.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 gene accB CDS complement(662431..662886) product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478606.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 gene aroQ CDS complement(663089..663505) product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070856.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 gene arfB CDS 664076..664435 product STAS/SEC14 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070857.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS 664446..664646 product DUF3012 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172966574.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS 664795..665319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925815.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS 665555..666898 product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070860.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS 666919..668190 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070861.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS 668238..671483 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070862.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS 672049..677109 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS 677546..680374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS 680510..683179 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038525.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS 683435..684406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS 684547..685437 product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483061.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 gene mepA CDS complement(685468..687759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS complement(688026..688592) product protein tyrosine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070501.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS complement(688752..689213) product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073873.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS complement(689362..689802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS 689918..690973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113385.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS 691251..691826 product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073871.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS 692189..693130 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073870.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS 693368..693838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS complement(694802..696682) product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073865.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS complement(696767..697375) product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482817.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS 697556..700531 product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261971.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS 700578..701498 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073864.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS 701501..702751 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073863.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS 702790..703326 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073862.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS 703445..704428 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105063490.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS complement(704475..706532) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925780.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS complement(706710..707627) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073851.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS 707727..708827 product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073850.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS complement(708883..709479) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073853.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS 709675..711522 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925920.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS 711801..714083 product thiosulfate reductase PhsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073774.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 gene phsA CDS 714097..714669 product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073773.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS 714666..715634 product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073772.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 gene nrfD CDS complement(716201..717673) product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138832.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 gene ltrA CDS 718619..719392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS 719562..720557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS 720550..721557 product retron St85 family RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102522759.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS 722067..722471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05590 note possible pseudo, internal stop codon CDS 723506..723976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS complement(724120..725136) product putative sulfate/molybdate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925781.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS complement(725590..726993) product tetrathionate reductase family octaheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073841.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS complement(727037..728761) product DUF3373 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073840.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS complement(728971..729297) product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073839.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS 729860..731359 product anaerobic nitric oxide reductase flavorubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704147.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 gene norV CDS 731356..732501 product NADH:flavorubredoxin reductase NorW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047863521.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 gene norW CDS complement(732872..733591) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073838.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS 733848..734753 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481663.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS 734999..736207 product conjugal transfer protein TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039344.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS complement(736493..737284) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073771.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS complement(737329..737703) product met regulon transcriptional regulator MetJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073770.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 gene metJ CDS 737876..739036 product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925915.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 gene metB CDS 739059..741446 product bifunctional aspartate kinase/homoserine dehydrogenase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073768.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS 742237..743127 product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073767.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 gene metF CDS 743298..743681 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS 743698..744102 product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707472.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS 744186..744401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS complement(744443..744865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS 745054..745875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS 745918..746787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS complement(746865..747914) product linear amide C-N hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263555.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS 748015..748935 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937616.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS complement(748951..749358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS complement(749578..749958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS 750115..751242 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112621.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS complement(751834..752787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS complement(753308..755155) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073749.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS complement(755409..756440) product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073748.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS complement(756547..756855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073747.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS complement(756952..759774) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073746.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 gene uvrA CDS complement(760028..760474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS 760701..762068 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073745.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS 762146..762874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS 763181..764161 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263006.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS complement(764227..766515) product OmcA/MtrC family decaheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818149.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS complement(766791..767684) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071812.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS 767656..767835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS 768239..768733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS 768937..769281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS 769294..769983 product cytochrome c nitrite reductase Fe-S protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220273.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 gene nrfC CDS 769980..770921 product cytochrome c nitrite reductase subunit NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074173.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 gene nrfD CDS 770944..771234 product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072671.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS complement(771490..772014) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS complement(772081..775092) product M9 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070964.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 775580..776545 product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070965.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS 777008..777445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071011.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS complement(777535..778560) product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071012.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS complement(778639..779805) product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071013.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 gene galK CDS complement(780142..781566) product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087134.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS complement(781628..784807) product beta-galactosidase LacZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080135.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 gene lacZ CDS complement(784869..785840) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837916.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS complement(785927..787552) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071014.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS complement(787691..789535) product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071015.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS complement(789611..789934) product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071016.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS 790237..790815 product FxsA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071017.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS complement(790833..792665) product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070916.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS 792960..793304 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070917.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS 793470..794129 product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070918.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS complement(794469..795497) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073642.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS complement(796038..797096) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073642.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS 797636..798472 product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073641.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 gene tcdA CDS 798639..799871 product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705507.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 gene pepT CDS complement(799890..801521) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073640.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 801754..802362 product superinfection exclusion B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073639.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 tRNA 803183..803267 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS 803453..803770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS 804106..804306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS 804267..805046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS complement(805165..806661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS 806951..808387 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS 808404..808958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS 809213..809446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS complement(809462..809671) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS complement(809689..810024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS complement(810107..810535) product DUF2787 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073635.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS complement(810625..810957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS complement(811202..813256) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073633.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS complement(813249..814178) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073632.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS 814398..814874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS complement(815121..815786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS 816245..817408 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS 817551..820322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS complement(820387..821139) product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261220.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS 821364..822191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS 822903..823235 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS 823459..823947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS complement(824022..824894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS complement(825145..825987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS complement(826340..826720) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS complement(827012..828490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS 828865..829101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS 829274..829600 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS complement(829782..830915) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073624.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS complement(831308..831553) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(831962..832207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS complement(832641..832832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS complement(833142..833924) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS complement(833981..835756) product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073628.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS complement(835766..836380) product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073626.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS complement(836389..836991) product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000040021.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS 837274..838032 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS 838332..838508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS complement(838574..839737) product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071117.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS complement(839883..841553) product FapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071119.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS complement(841770..842810) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071121.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS 843162..843590 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166845236.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS 843574..844746 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943169.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS 844751..847222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS complement(847239..848591) product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071122.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS complement(848684..849637) product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071123.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 gene gshB CDS complement(849997..850725) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071124.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 gene rsmE CDS complement(850732..851481) product endonuclease EndA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071125.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 gene endA CDS 851871..852023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS complement(852311..853483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071127.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS complement(853693..854604) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071129.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS 854721..859280 product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071130.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS 859540..860934 product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962905.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 gene rimK CDS 861170..862543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181712483.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS 862540..862965 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS 862952..864607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS complement(864690..864950) product DUF5062 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072217.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS 865330..865986 product Qnr family pentapeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261921.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS 866125..866439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS 866487..867296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06830 note possible pseudo, frameshifted CDS complement(867362..867790) product nitrate reductase cytochrome c-type subunit NapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071135.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 gene napB CDS complement(867787..868644) product quinol dehydrogenase ferredoxin subunit NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925622.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 gene napH CDS complement(868656..869390) product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071137.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 gene napG CDS complement(869454..871934) product nitrate reductase catalytic subunit NapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071138.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 gene napA CDS complement(872019..872297) product chaperone NapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071139.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS 872774..873130 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS 873163..873795 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS 873792..875999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS complement(876040..877152) product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925824.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS complement(877152..879644) product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071146.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS complement(879637..880305) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071147.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS 880565..881323 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039197.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS 881946..883418 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028024693.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS complement(883440..883853) product group II truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526443.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS complement(884767..885126) product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331456.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS complement(885328..886308) product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071151.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 gene ygfZ CDS complement(886720..887949) product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071152.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 gene serA CDS 888192..888794 product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071153.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS 889058..889723 product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071154.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS 890196..892850 product extracellular exonuclease ExeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071320.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 gene exeM CDS 893334..894560 product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423541.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS 894647..895357 product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707410.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 gene deoD CDS 895705..896142 product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071322.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS 896330..896578 product YgjV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071323.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS 897146..898612 product catalase KatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071324.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 gene katB CDS complement(898682..899257) product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071325.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS 899970..901169 product aromatic amino acid transport family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925832.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS 901416..903572 product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071328.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS 904102..904407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS complement(905093..905845) product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071331.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS complement(905920..906627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071332.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS complement(906882..908237) product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071333.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS 908719..909273 product DUF3087 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071687.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS 909411..910226 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978021.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS complement(910322..910591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS complement(910725..911012) product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104358.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS 911278..911913 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707260.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS complement(911969..912916) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245546.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS 913092..914549 product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772831.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 gene gabD CDS 914601..915881 product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464684.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 gene gabT CDS 916144..916716 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706248.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS 916720..917217 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205378591.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS 917352..918140 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108644.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 gene lgt CDS complement(918224..919228) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS 919719..921170 product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356995.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS complement(921280..921981) product oxidative stress defense protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073780.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS complement(922094..923203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS 923666..924313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS 924442..925890 product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073577.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 gene mpl CDS 925923..926585 product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073576.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS 926627..927157 product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073575.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 gene hpt CDS 927354..928337 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073574.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS 928334..929110 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073573.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS 929180..929560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS complement(929760..930092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS complement(930093..930578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071158.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS complement(931015..931860) product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071159.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 gene panC CDS complement(931984..932778) product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071160.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 gene panB CDS complement(932864..933358) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071161.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 gene folK CDS complement(933358..934650) product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086024044.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS complement(934874..935752) product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925826.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 gene gluQRS CDS complement(935904..936347) product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007644947.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 gene dksA CDS complement(936507..937220) product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071164.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 gene sfsA CDS 937408..938685 product aminopeptidase PepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071165.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 gene pepB CDS 938979..940004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS 940408..940719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS 940716..941747 product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263714.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS complement(941843..942448) product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070956.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 gene thpR CDS 942873..945446 product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070959.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 gene hrpB CDS 945501..947894 product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070960.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 gene mrcB CDS complement(948421..949893) product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138832.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 gene ltrA CDS 950931..952139 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071942.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS complement(952205..952903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS complement(953111..953641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS complement(953745..954926) product FlxA-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930692.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS complement(955288..957477) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081570352.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS 957738..958448 product DUF3581 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073732.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS 959113..960462 product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071148.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS 960754..964428 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073731.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS 964428..965081 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037422308.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS 965083..966303 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073729.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS 966291..967145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073728.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS 967611..968876 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073727.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS complement(968974..969741) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198755.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS 969898..970164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS complement(970407..971789) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943381.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS complement(971786..973810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS 974261..976048 product fumarate reductase flavoprotein subunit FccA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071245.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 gene fccA CDS complement(976274..977083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07720 note possible pseudo, frameshifted CDS complement(977131..977445) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS complement(977723..978715) product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073720.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS 978996..979136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS 979153..981324 product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073719.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS complement(981693..982412) product two-component system response regulator ArcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007644695.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 gene arcA CDS 982990..983448 product DUF3293 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073718.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS 984174..985523 product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073717.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 gene lysC CDS 985576..986682 product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073716.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS complement(986797..990651) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS complement(990855..991316) product transcriptional regulator AsnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073571.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 gene asnC CDS complement(991435..992112) product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073570.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 gene rluA CDS 992320..994503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS 994959..995213 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS complement(995511..995816) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071248.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS complement(995926..996468) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071247.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS complement(996443..996853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071246.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS 997073..998062 product lactate dehydrogenase LdhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071244.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 gene ldhA CDS 998160..998897 product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922137.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS 999032..999775 product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071239.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS 1000408..1000977 product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071237.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 gene ahpC CDS 1001152..1002729 product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071236.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 gene ahpF CDS 1002884..1004011 product membrane-associated sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819461.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS complement(1004150..1004344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071249.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS complement(1004472..1005860) product cytochrome c biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071250.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS complement(1006204..1006629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS 1007013..1007462 product hydroperoxide resistance transcriptional regulator OhrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071252.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 gene ohrR CDS 1007529..1008704 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071253.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS 1008820..1009992 product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071255.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 gene chrA CDS complement(1010086..1010907) product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706755.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS 1011459..1012421 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925631.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 gene prfB CDS 1012514..1014016 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071261.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 gene lysS CDS 1014358..1016814 product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073256.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS 1016831..1017472 product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530477.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS complement(1017733..1018359) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964094.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS 1018655..1019446 product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437039.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 gene nagB CDS 1019707..1021032 product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459306.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 gene brnQ CDS 1021182..1023329 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039372.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS 1023600..1024280 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS complement(1024703..1025944) product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957478.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 gene hmpA CDS complement(1026116..1026415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS 1026697..1028304 product nitric oxide reductase transcriptional regulator NorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001155015.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 gene norR CDS 1028343..1028483 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS 1028618..1030540 product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073569.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS 1030746..1031120 product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073568.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS complement(1032253..1033431) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073564.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS complement(1033560..1034366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS complement(1034375..1035541) product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073563.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS 1035760..1036686 product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261720.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS 1036848..1038812 product TRAP transporter fused permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261721.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS 1039083..1039373 product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261920.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS 1039757..1041367 product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262867.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS 1041835..1042707 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS complement(1043078..1044253) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816945.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS complement(1044911..1045348) product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073562.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS complement(1045445..1046659) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073561.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS 1046862..1047479 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095305.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS complement(1047560..1048603) product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071182.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS complement(1048729..1049679) product bifunctional helix-turn-helix transcriptional regulator/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071196.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS complement(1050011..1050601) product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071197.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 gene yjjX CDS 1051264..1052556 product HAAAP family serine/threonine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071199.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS 1052660..1054027 product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705996.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS complement(1054097..1054540) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071200.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS 1054705..1055118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS complement(1055238..1055582) product META domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071203.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS 1055747..1055947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071204.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS complement(1055971..1056918) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071205.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS complement(1057151..1058116) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071205.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS 1058306..1058875 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925627.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS 1058927..1059394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS complement(1059403..1060404) product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073496.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS complement(1060600..1061754) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071209.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 gene metK CDS 1062195..1064189 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071210.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 gene tkt CDS 1064545..1065567 product erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071211.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 gene epd CDS 1065742..1066917 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071212.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS 1067138..1068202 product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071213.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 gene fba CDS 1068443..1069183 product DUF481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071214.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS 1069398..1070171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS 1070164..1070688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS 1071115..1072500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071222.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS complement(1072544..1074745) product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071223.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS complement(1074908..1075510) product TatD family nuclease-associated radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071224.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS complement(1075647..1078829) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(1078829..1080049) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS complement(1080536..1081756) product ATP-dependent RNA helicase SrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071227.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 gene srmB CDS complement(1081866..1082552) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071228.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS 1083083..1084414 product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925629.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 gene brnQ CDS 1084522..1085439 product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071230.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 gene xerD CDS 1086415..1087152 product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071231.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 gene dsbC CDS 1087346..1089070 product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071232.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 gene recJ CDS complement(1089795..1090634) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496764.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS 1090784..1091473 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387744.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS 1091631..1091963 product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261999.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS 1092265..1092435 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS complement(1092553..1093221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08660 note possible pseudo, internal stop codon, frameshifted CDS complement(1093326..1093652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08670 note possible pseudo, internal stop codon, frameshifted CDS complement(1094436..1094621) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS complement(1094624..1094752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS complement(1095532..1095771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS 1096031..1096285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS complement(1096622..1097725) product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133040744.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS complement(1097991..1098632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179027262.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS complement(1098951..1099232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS complement(1099730..1099879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261681.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS complement(1100185..1100718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS complement(1100793..1101185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS complement(1101954..1102610) product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071382.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 gene rpiA CDS 1102874..1103839 product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071383.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS 1104013..1104681 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071676.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS complement(1104715..1105602) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071304.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS 1105706..1106212 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS 1106216..1106923 product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071306.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS complement(1106937..1107365) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071100.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS 1107561..1109333 product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071101.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS 1109659..1110225 product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071102.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS complement(1110299..1110511) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS complement(1110760..1113432) product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071313.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 gene pepN CDS complement(1113623..1114228) product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172966546.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 gene lpoB CDS complement(1114241..1115608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071315.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS complement(1115605..1116105) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071316.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 gene def CDS complement(1116179..1116391) product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071317.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS complement(1116400..1117371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071318.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS 1117538..1118323 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071319.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 gene fkpA CDS complement(1118435..1119763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS 1119958..1120332 product YacL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073714.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS complement(1120414..1121043) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073713.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS complement(1121123..1122826) product nitrate/nitrite two-component system sensor histidine kinase NarQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073712.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 gene narQ CDS 1123076..1124476 product ammonia-forming nitrite reductase cytochrome c552 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073711.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 gene nrfA CDS 1124721..1125206 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482882.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS complement(1125242..1125784) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071067.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 1126074..1126412 product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071066.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS 1126424..1127674 product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071065.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS 1127755..1128096 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071064.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS 1128226..1129392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071063.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS complement(1129486..1130778) product DUF4785 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071846.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS complement(1130788..1131645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071847.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS 1132345..1133400 product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071062.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 gene aroG CDS complement(1133520..1133696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071061.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS 1134070..1135839 product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071060.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS 1136006..1136278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071059.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS complement(1136327..1136530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071058.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS complement(1137094..1137633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS 1137777..1138361 product DUF5610 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071055.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS 1138488..1139237 product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071054.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS 1139313..1139909 product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071053.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS 1140165..1141172 product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071051.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS 1141357..1142958 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071050.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS 1143023..1144051 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071049.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS 1144212..1145243 product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071047.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS complement(1145323..1145784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS complement(1145950..1146420) product transcriptional regulator ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071072.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 gene argR CDS 1146777..1147712 product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071073.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 gene mdh CDS complement(1147812..1148783) product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925908.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 gene ispB CDS 1149028..1149366 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073451.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 gene rplU CDS 1149382..1149636 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007650346.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 gene rpmA CDS 1149778..1150950 product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073450.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 gene cgtA CDS 1151010..1151771 product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073449.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS 1151771..1152250 product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073448.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS 1152285..1152767 product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073447.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 gene folA CDS 1152859..1153248 product DUF3718 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073446.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS complement(1153431..1155458) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073445.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS complement(1155696..1156520) product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073444.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS complement(1156540..1156920) product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073443.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 gene apaG CDS complement(1157011..1157829) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073442.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 gene rsmA CDS complement(1157841..1158827) product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073441.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 gene pdxA CDS complement(1158833..1160137) product peptidylprolyl isomerase SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073440.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 gene surA CDS complement(1160263..1162587) product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073439.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 gene lptD CDS 1162747..1163760 product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073438.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS 1163757..1164437 product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073437.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS 1164522..1165301 product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073436.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 gene djlA CDS 1165349..1165978 product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073435.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS 1166005..1166976 product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073434.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS 1167103..1167351 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS complement(1167500..1168675) product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073423.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 gene purT CDS 1168960..1169352 product DUF3302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422416.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS 1169354..1170490 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263258.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS complement(1170578..1171117) product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073415.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS 1171290..1171565 product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073414.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS complement(1171615..1172892) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073413.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS complement(1172932..1173645) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073412.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS complement(1173645..1174073) product DUF3019 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925905.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS complement(1174073..1174954) product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073410.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS complement(1175135..1175986) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144410.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS 1176144..1177319 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705166.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS 1177386..1179629 product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338854.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS 1179631..1180734 product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338853.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS complement(1180838..1182052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS complement(1182042..1182389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS complement(1182461..1185214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS 1185426..1185938 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263568.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS complement(1185955..1186422) product YcxB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073407.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS 1186647..1186982 product DUF1971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262311.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS 1187242..1187490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS complement(1187593..1188018) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073406.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS complement(1188072..1188692) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073405.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS 1188830..1189462 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073404.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS 1189466..1190167 product 16S rRNA pseudouridine(516) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073403.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS 1190489..1191454 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071812.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS 1191635..1193632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS 1194196..1194822 product GPR1/FUN34/YaaH family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460258.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS complement(1194929..1196461) product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071688.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS 1196768..1197331 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477738.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS complement(1197407..1197562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS 1197623..1201414 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS complement(1201511..1202095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS complement(1202073..1202882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09770 note possible pseudo, frameshifted CDS 1202945..1204090 product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899934.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 gene amrS CDS complement(1204261..1204692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS complement(1205395..1208316) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073282.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS complement(1208332..1208802) product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073281.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS complement(1209384..1209686) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS complement(1209854..1210129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS complement(1210130..1210510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS complement(1210955..1211092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS complement(1211783..1212403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS complement(1212555..1213274) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948823.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS complement(1213556..1214452) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477202.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS 1214600..1215205 product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071985.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS complement(1215317..1215520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS complement(1216147..1216767) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528837.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS 1217433..1217711 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS 1217941..1218540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS complement(1218628..1220136) product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071577.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 gene pepA CDS 1220357..1221469 product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071578.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 gene lptF CDS 1221466..1222524 product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071579.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 gene lptG CDS 1222639..1222953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS 1223001..1223810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09980 note possible pseudo, frameshifted CDS complement(1223947..1224471) product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071580.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS complement(1224556..1224810) product DUF2960 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071581.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS complement(1224865..1225353) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071583.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS complement(1225395..1226885) product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925648.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS 1227214..1227840 product YqiJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071585.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS 1227933..1229735 product flotillin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071586.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS complement(1229818..1230444) product DUF2913 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071589.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS complement(1230464..1231771) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071592.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS 1232264..1233547 product EAL domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029301722.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS complement(1233636..1235423) product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071595.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS 1235683..1236894 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037154163.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS 1236976..1237752 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071596.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS 1238249..1239466 product metallopeptidase MdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107426.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 gene mdpA CDS 1240102..1242693 product glycosyl hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704912.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS 1242838..1244538 product PKD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819976.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS complement(1244609..1245079) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071597.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS 1245371..1250365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS complement(1250439..1250807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS complement(1250879..1252339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS complement(1252424..1252915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS complement(1253029..1253469) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389196.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS 1253674..1254105 product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095485158.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS complement(1254144..1254623) product hotdog fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229705.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS 1254893..1255819 product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071604.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS complement(1255883..1256230) product DUF3634 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073241.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS 1256399..1256587 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS complement(1256644..1257363) product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073341.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS complement(1257486..1258991) product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704254.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS complement(1259084..1260415) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073338.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS 1260636..1262147 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073337.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS complement(1262225..1263451) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070556.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS 1263885..1265516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS complement(1266181..1267488) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071485.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS 1267744..1268298 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071486.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS 1268893..1269654 product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071487.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS 1269660..1271009 product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071488.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS 1271255..1272355 product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071489.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS 1272500..1273600 product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071489.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS 1273726..1274862 product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071490.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 gene potA CDS 1274872..1275777 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071491.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS 1275774..1276598 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071492.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS 1276675..1277961 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071493.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS 1278265..1278684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS 1278878..1279855 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071997.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 tRNA complement(1280635..1280711) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS complement(1280994..1282823) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071499.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 gene rpoD CDS complement(1282948..1284675) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071500.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 gene dnaG CDS complement(1284779..1285222) product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071501.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS complement(1285229..1285444) product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006080725.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 gene rpsU CDS 1285738..1286751 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071502.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 gene tsaD CDS complement(1286873..1288072) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS complement(1288200..1288799) product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071503.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 gene plsY CDS 1289093..1289446 product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071504.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 gene folB CDS 1289447..1289947 product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071505.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 gene folK CDS 1289992..1290792 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071506.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS 1291196..1292104 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071507.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS 1292301..1293206 product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705230.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS complement(1293600..1293866) product Lpp/OprI family alanine-zipper lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071508.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS complement(1294087..1295340) product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071509.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS 1295571..1297199 product ExeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071510.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS 1297199..1298200 product general secretion pathway protein GspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071511.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS complement(1298283..1299530) product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721316.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 gene nhaD CDS 1300075..1300275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS complement(1300482..1301771) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071513.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 gene hemL CDS complement(1302223..1302630) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS complement(1302635..1303012) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071030.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS complement(1303012..1304238) product sulfite oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071029.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS complement(1304241..1304573) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS complement(1304950..1305654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS complement(1305960..1307630) product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071515.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS 1307755..1308639 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071516.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS 1308757..1309131 product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071517.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 gene erpA CDS complement(1309217..1309792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925841.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS complement(1309834..1310205) product DUF2750 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071519.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS complement(1310402..1311103) product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071520.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 gene aqpZ CDS complement(1311256..1312668) product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463736.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS complement(1312794..1315265) product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071522.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS complement(1315353..1318121) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458992.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS 1318482..1320632 product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071523.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS complement(1320696..1321811) product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071524.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS complement(1321917..1323350) product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071525.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS 1323488..1324684 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071526.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 gene tyrS CDS complement(1325357..1326991) product oligopeptide:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035686.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(1327090..1327572) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071528.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS complement(1327576..1328205) product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071529.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS complement(1328202..1328591) product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071530.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS complement(1328676..1329659) product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071531.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS complement(1329764..1330456) product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071532.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS 1330938..1331918 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070523.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS 1332083..1332280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS 1332719..1333801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS complement(1335003..1335500) product MarR family transcriptional regulator CosR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005494763.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 gene cosR CDS complement(1335648..1336352) product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070887.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS complement(1336374..1337591) product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969412.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS complement(1337849..1339549) product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477133.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 gene betA CDS complement(1339559..1341022) product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477313.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 gene betB CDS complement(1341013..1341618) product transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199591.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 gene betI CDS complement(1342013..1343422) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071533.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS complement(1343429..1347877) product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071534.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 gene gltB CDS 1348400..1349308 product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071535.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS 1349498..1349863 product Hpt domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071536.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS complement(1349960..1350550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS 1351014..1351184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS 1351870..1352739 product hydrogen peroxide-inducible genes transcriptional activator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071537.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 gene oxyR CDS complement(1352787..1353860) product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071538.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS complement(1353981..1354712) product DNA mismatch repair endonuclease MutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071539.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 gene mutH CDS 1355344..1355868 product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071540.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 gene rppH CDS 1355944..1358169 product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071541.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 gene ptsP CDS 1358281..1359036 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071542.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS 1359212..1360063 product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250353.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS 1360388..1361569 product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071545.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 gene nhaA CDS 1361594..1361977 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071546.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS 1361977..1362888 product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071547.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 gene nhaR CDS 1362956..1363207 product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071548.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS complement(1363657..1365270) product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071550.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 gene nadB CDS 1365471..1366049 product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071551.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 gene rpoE CDS 1366101..1366715 product sigma-E factor negative regulatory protein RseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071552.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS 1366748..1367680 product MucB/RseB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071553.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS 1367750..1368205 product SoxR reducing system RseC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071554.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS 1368432..1370222 product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071555.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 gene lepA CDS 1370377..1371294 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071556.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 gene lepB CDS 1371296..1371973 product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071557.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 gene rnc CDS 1371970..1372977 product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071558.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 gene era CDS 1373091..1373819 product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071559.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 gene recO CDS 1374036..1374773 product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071560.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 gene pdxJ CDS 1374855..1375253 product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071561.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 gene acpS CDS complement(1376592..1377854) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071341.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS 1377971..1378651 product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071342.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS 1378783..1379082 product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071343.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS 1379331..1379867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS 1379867..1381231 product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403751.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS 1381334..1382425 product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 gene dctP CDS 1382602..1383111 product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071345.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 gene luxS CDS 1383569..1384909 product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071347.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS 1384909..1386108 product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071348.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS 1386101..1386895 product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071349.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS 1386895..1387527 product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071350.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS 1387533..1388141 product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071351.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 gene nqrE CDS 1388187..1389434 product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071352.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 gene nqrF CDS 1389585..1390601 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071353.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS 1390728..1390952 product (Na+)-NQR maturation NqrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071354.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 gene nqrM CDS 1391089..1392099 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998604.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS 1392317..1392787 product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071355.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 gene bfr CDS 1392797..1393264 product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071356.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 gene bfr CDS 1393480..1395480 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707746.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS 1395857..1396309 product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058266.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS 1396330..1396596 product DksA/TraR family C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112314.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS 1396787..1397917 product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074449.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS 1398094..1398945 product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074448.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 gene fghA CDS 1399364..1400329 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071357.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 gene dinB CDS complement(1400435..1401895) product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071358.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS 1402183..1403715 product peptidase M17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071359.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS 1405668..1406957 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071361.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS 1407136..1408254 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071362.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 gene proB CDS 1408312..1409586 product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071363.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS complement(1409782..1410090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS 1410483..1411223 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(1411241..1412263) product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815910.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS 1412633..1413175 product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071562.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS complement(1413256..1414539) product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071563.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS complement(1414768..1415556) product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071564.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 gene ccsA CDS 1415900..1417318 product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071565.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene ffh CDS 1417834..1418085 product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071566.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 gene rpsP CDS 1418106..1418636 product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071567.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 gene rimM CDS 1418652..1419398 product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071568.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 gene trmD CDS 1419434..1419787 product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006080791.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 gene rplS CDS 1420278..1421144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS 1421420..1422511 product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071569.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS 1422609..1423748 product bifunctional chorismate mutase/prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071570.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 gene tyrA CDS 1424036..1425694 product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071571.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 gene hcp CDS 1425816..1426919 product hybrid-cluster NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071572.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS complement(1427520..1429508) product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071575.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS complement(1430699..1431073) product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073280.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 gene raiA CDS 1431374..1432042 product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073279.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS complement(1432134..1432595) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073278.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS 1432825..1433103 product trp operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073277.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 gene trpR CDS complement(1433114..1433500) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073276.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS complement(1433677..1434294) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073275.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 gene slyD CDS 1435013..1437478 product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073273.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 gene thrA CDS 1437564..1438499 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073272.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 gene thrB CDS 1438556..1439836 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073271.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 gene thrC CDS 1440127..1440402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS complement(1440429..1441280) product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171345.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 gene nfo CDS 1441448..1443496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS 1443514..1443675 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS 1443675..1444772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS 1445040..1445579 product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073378.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS complement(1445658..1445843) product DUF3545 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073377.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS complement(1446083..1447720) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073376.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 gene pgi CDS complement(1447735..1448691) product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073375.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 gene tal CDS complement(1449074..1450174) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925751.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS complement(1450418..1452784) product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073372.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS 1453211..1454650 product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262527.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS 1454772..1455548 product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005487639.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 gene yaaA CDS complement(1456013..1456450) product PACE efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167512737.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS 1456590..1457495 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263936.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS complement(1458242..1459645) product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073369.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS 1459781..1460077 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006084975.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS complement(1460203..1460469) product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073368.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 gene rpsT CDS 1460743..1462275 product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073367.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 gene murJ CDS 1462466..1463401 product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073366.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 gene ribF CDS 1463417..1466257 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073365.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 gene ileS CDS 1466401..1466931 product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073364.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 gene lspA CDS 1466936..1467358 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073363.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 gene fkpB CDS 1467362..1468309 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073362.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 gene ispH CDS 1468550..1469116 product type IV pilus modification protein PilV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925904.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 gene pilV CDS 1469130..1470113 product PilW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073360.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS 1470123..1470554 product pilus assembly PilX N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073359.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS 1470557..1474060 product PilC/PilY family type IV pilus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073358.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS 1474073..1474477 product type IV pilin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073357.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS 1474474..1474791 product TapY2 family type IVa secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073356.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS complement(1474885..1475400) product GspH/FimT family pseudopilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073355.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS complement(1475552..1476061) product GspH/FimT family pseudopilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073354.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS 1476317..1476655 product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073353.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 gene glnB CDS complement(1476743..1477756) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073351.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS 1478191..1480815 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073350.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS 1480927..1482453 product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073349.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS complement(1482616..1483335) product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073348.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS 1484271..1486937 product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073347.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS 1487192..1488058 product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073346.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS 1488061..1489194 product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073344.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 gene nagA CDS 1489312..1490448 product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073343.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS 1490696..1492003 product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073342.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 tRNA complement(1492602..1492677) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 tRNA complement(1492763..1492838) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 tRNA complement(1493806..1493881) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 tRNA complement(1493889..1493964) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS 1494382..1494930 product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073239.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS 1494980..1495570 product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073238.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS complement(1495649..1495927) product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073237.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS complement(1495930..1496877) product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073236.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 gene mutY CDS 1497283..1497999 product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073235.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 gene trmB CDS 1498090..1498413 product YggL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073234.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS 1498413..1499327 product glutaminase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073233.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 gene glsB CDS 1499608..1500441 product YggN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073232.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS 1500807..1501748 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073231.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS complement(1502615..1504459) product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073230.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS complement(1504649..1505785) product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073228.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 gene hemW CDS complement(1505886..1506488) product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073227.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 gene rdgB CDS complement(1506654..1507088) product DUF4426 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073226.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS complement(1507240..1507545) product DUF167 family protein YggU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073225.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 gene yggU CDS complement(1507549..1508097) product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073224.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS complement(1508168..1508986) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073223.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 gene proC CDS complement(1509126..1509854) product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073222.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS 1509858..1510895 product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073221.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS 1510919..1512031 product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073220.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS 1512199..1513302 product outer membrane beta barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071616.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS complement(1513731..1514153) product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073217.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 gene ruvX CDS complement(1514256..1514816) product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073216.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS complement(1514881..1515210) product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073215.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 gene yciH CDS complement(1515369..1515686) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS 1515882..1516442 product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073213.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS 1516638..1517087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS complement(1517084..1517983) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462429.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS 1518067..1518483 product PACE efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462438.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS 1518687..1519256 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073209.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS 1519406..1520248 product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073210.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS complement(1520854..1521663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12510 note possible pseudo, frameshifted CDS complement(1521711..1522025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS complement(1522133..1522765) product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073212.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS 1523163..1524173 product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073208.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 gene ltaE CDS complement(1524231..1525037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS complement(1525117..1526748) product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037727.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS complement(1526776..1528224) product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037727.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS 1528649..1530121 product glycine betaine transporter OpuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230127.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 gene opuD CDS complement(1530176..1530982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS complement(1531043..1531228) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071673.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS complement(1531344..1532645) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706404.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS complement(1533092..1533454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071674.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS 1534115..1535209 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943335.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS 1535296..1538415 product efflux RND transporter permease subunit VmeQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479247.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 gene vmeQ CDS 1538546..1538713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS 1538685..1540610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS complement(1540935..1542083) product L-threonine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071675.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 gene yiaY CDS complement(1542297..1544177) product methyl-accepting chemotaxis protein Mlp37 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672477.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 gene mlp37 CDS 1544303..1545472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS 1545802..1547973 product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071677.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 gene malQ CDS 1547985..1550342 product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925658.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 gene glgB CDS 1550329..1552467 product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071679.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 gene glgX CDS 1552457..1554997 product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071680.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS 1555154..1556422 product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071681.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 gene glgC CDS 1556501..1558231 product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925847.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS complement(1558325..1558825) product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005486498.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS 1559197..1563480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS complement(1565080..1565565) product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071732.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS 1565835..1566374 product YfaZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071735.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS 1566969..1568639 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071737.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS complement(1568730..1571882) product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071738.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS 1572162..1572491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS complement(1572503..1573831) product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071740.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS complement(1575757..1576584) product OST-HTH/LOTUS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102935.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS 1579426..1579743 product N(4)-acetylcytidine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478088.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 gene yqfB CDS complement(1579770..1580438) product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071741.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS complement(1580515..1581186) product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071744.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS 1581531..1583354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS complement(1583456..1586431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS 1586654..1587379 product DUF599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073551.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS 1587741..1589102 product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071183.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS 1589103..1590347 product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071184.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS 1590347..1591129 product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071185.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS 1591131..1591754 product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071186.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS 1591764..1592372 product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071187.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 gene nqrE CDS 1592460..1593677 product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071188.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 gene nqrF CDS 1594253..1595743 product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263860.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS complement(1595854..1596048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS 1596397..1597608 product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456528.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS 1597810..1599138 product ammonia-forming nitrite reductase cytochrome c552 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101783.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 gene nrfA CDS 1599400..1600692 product coproporphyrinogen III oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074137.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS complement(1600871..1602049) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS 1602610..1603383 product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717059.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS 1603395..1603850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS complement(1603927..1605219) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144045444.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS complement(1605216..1605920) product response regulator transcription factor BfmR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076440.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 gene bfmR CDS complement(1605923..1606264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS complement(1606322..1607194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS 1607871..1608362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS 1608554..1609033 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS complement(1609149..1610594) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS complement(1610587..1611273) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082360.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS 1611464..1612753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS 1612911..1614749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS 1615188..1616426 product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114854.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 gene kynU CDS 1616930..1618306 product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958644.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS 1618470..1618721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS 1618964..1619317 product group 1 truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947457.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS 1619564..1620493 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071019.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS 1620793..1622775 product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072007.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS 1623119..1624672 product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072009.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 gene gndA CDS complement(1624770..1626449) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263346.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS 1626977..1627462 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615134.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS complement(1627969..1628691) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261975.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS complement(1628863..1631151) product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261974.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS 1631442..1631873 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS 1632026..1633402 product leucine-rich repeat-containing protein kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073737.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS complement(1633719..1634531) product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072012.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS 1634937..1635824 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072013.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS 1635975..1636853 product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072014.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 gene tesB CDS 1636912..1637310 product YbaY family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072015.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS 1637505..1637912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS 1638067..1638558 product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071822.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS 1639138..1639821 product outer membrane protein OmpW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925667.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 gene ompW CDS complement(1639890..1640675) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071824.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS 1640885..1642768 product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421488.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS 1642772..1643488 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262866.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS complement(1643601..1645178) product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262867.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS 1645573..1646532 product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071826.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 gene metA CDS 1647378..1648568 product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071827.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS 1648631..1650136 product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071828.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS 1650543..1651700 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071829.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS 1651770..1652543 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071830.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS 1652543..1653670 product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071831.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS 1653754..1654674 product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071832.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 gene mmsB CDS 1654679..1655437 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071833.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS 1655627..1655872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071834.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS 1655912..1657957 product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071835.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS complement(1657998..1658381) product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071836.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS 1658596..1660905 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071837.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS 1661417..1661725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS 1662108..1663703 product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071838.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS 1664007..1664579 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263727.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS complement(1664645..1666006) product leucyl aminopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387899.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS complement(1666163..1666558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS 1666809..1667474 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463438.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS 1667526..1668407 product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070710.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 gene prpB CDS 1668613..1669737 product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070709.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 gene prpC CDS 1669817..1672438 product Fe/S-dependent 2-methylisocitrate dehydratase AcnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070708.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 gene acnD CDS 1672573..1673901 product 2-methylaconitate cis-trans isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207520.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 gene prpF CDS 1674100..1674324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS 1674325..1675092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS 1675232..1676014 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258021.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS 1676076..1677281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS complement(1677312..1677992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS 1678344..1678946 product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000040021.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS 1678955..1679569 product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073626.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS 1679566..1679748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS 1679783..1680541 product outer membrane protein OmpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261438.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS 1680589..1682295 product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073628.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS complement(1682947..1683117) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS 1683322..1683501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS 1684050..1684499 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100451.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS 1684703..1685548 product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661957.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 gene kynA CDS 1685627..1686814 product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228728.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS 1686856..1687521 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS complement(1687508..1688245) product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813919.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS complement(1688391..1689134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS complement(1689181..1690032) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072010.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS 1690158..1690766 product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082103.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS complement(1690933..1691172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS complement(1691436..1692203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS 1692543..1692740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS 1692885..1693826 product pyrimidine-specific ribonucleoside hydrolase RihA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071106.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 gene rihA CDS 1693870..1694796 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071105.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 gene rbsK CDS complement(1694920..1695486) product DUF1415 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071856.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS complement(1695593..1696186) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071857.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS 1696497..1696979 product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071858.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS complement(1697161..1699308) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144873981.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS 1699492..1699896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS complement(1699982..1700797) product DUF2797 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071859.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS complement(1701050..1701550) product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071861.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS 1701722..1703980 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071862.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS 1704030..1705682 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071863.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 gene pstA CDS 1705759..1706577 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071864.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 gene pstB CDS 1706635..1707345 product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071865.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 gene phoU CDS 1707923..1709836 product choline BCCT transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130624425.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 gene betT CDS 1710930..1711664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS 1711683..1712165 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400653.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS complement(1712289..1712579) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221352.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS complement(1712569..1712817) product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213183.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS 1713602..1713952 product YajD family HNH nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071871.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS complement(1714035..1714274) product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071872.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS 1714584..1715750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262207.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS 1715944..1717233 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071873.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS 1717483..1718532 product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071874.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS 1718647..1719531 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071875.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS 1719638..1721422 product fatty acid CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071876.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS 1721426..1722502 product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071877.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS 1722564..1723025 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS complement(1723134..1723988) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881141.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS complement(1724084..1724410) product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814037.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS 1724814..1726535 product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071884.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS 1726818..1727642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS 1727766..1728599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS complement(1728999..1729403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS 1730198..1731136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS 1731243..1731626 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071885.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS 1731718..1732212 product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925670.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS 1732561..1733247 product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071887.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS complement(1733293..1733616) product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039406410.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS complement(1733635..1733937) product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071888.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS complement(1733934..1734578) product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071889.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS complement(1734697..1735614) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071890.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS complement(1735845..1736339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073254.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS 1736600..1737001 product thiol-disulfide oxidoreductase DCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228839.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS complement(1737085..1737996) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067128.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS complement(1737980..1738909) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973877.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS complement(1738942..1739805) product manganese/iron ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172901062.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS complement(1739798..1740691) product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242572.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS 1740679..1740825 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS complement(1741101..1742759) product putative pyridoxal-dependent aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071894.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 gene panP CDS complement(1742980..1744164) product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071895.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS complement(1744265..1745623) product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071896.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS complement(1745896..1746714) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104037.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS 1746995..1747540 product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063704.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS 1747738..1749396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS 1749724..1750653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS 1751656..1754595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS complement(1754688..1754810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS 1755079..1755666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS 1755707..1756240 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS 1756237..1759164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS 1759168..1759908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS 1759910..1761013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS complement(1761152..1762378) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762604.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS 1762873..1763610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS complement(1765334..1766482) product sugar diacid recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071897.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS complement(1766662..1767462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS complement(1767572..1768561) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105063490.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS complement(1768650..1769279) product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071898.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS complement(1769313..1769819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS complement(1770022..1772118) product MtrB/PioB family decaheme-associated outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071899.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS complement(1772133..1773134) product decaheme c-type cytochrome MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071900.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 gene mtrA CDS complement(1773246..1775270) product decaheme c-type cytochrome MtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071901.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 gene mtrC CDS complement(1775742..1777982) product decaheme c-type cytochrome OmcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071902.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 gene omcA CDS complement(1778603..1781044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS complement(1781668..1783827) product decaheme c-type cytochrome OmcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071902.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 gene omcA CDS complement(1783929..1785794) product decaheme c-type cytochrome MtrF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071903.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 gene mtrF CDS complement(1785929..1788055) product MtrB/PioB family decaheme-associated outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071904.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS complement(1788070..1789035) product DmsE family decaheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071905.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS 1789455..1789724 product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071906.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS 1789717..1792011 product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071907.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 gene feoB CDS 1792218..1793888 product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071908.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 gene glnS CDS complement(1794075..1794671) product Yip1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071909.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS 1795049..1795837 product tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071910.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS complement(1795887..1796621) product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071911.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS complement(1796631..1797125) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071912.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS 1797111..1797281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS 1797390..1798769 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071913.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 gene cysS CDS complement(1798901..1799761) product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071914.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 gene folD tRNA 1800395..1800471 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 tRNA 1800762..1800838 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 tRNA 1800847..1800922 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS 1801176..1802480 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071915.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 gene tig CDS 1802571..1803182 product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071916.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 gene clpP CDS 1803267..1804544 product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071917.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 gene clpX CDS 1804694..1807051 product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071918.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 gene lon CDS 1807320..1807592 product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006081127.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 gene hupB CDS 1807796..1809658 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071919.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 gene ppiD CDS 1809957..1812002 product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106463.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS complement(1813284..1814276) product IS110-like element IS1111A family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041952483.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS complement(1815748..1816179) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS complement(1816865..1817380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS complement(1818699..1818908) product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071920.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS complement(1819092..1820294) product trans-2-enoyl-CoA reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071921.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS complement(1820463..1821248) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071922.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS complement(1821223..1822236) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071923.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS complement(1822253..1823143) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071924.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS complement(1823130..1824161) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071925.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS complement(1824161..1825801) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071926.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS complement(1825887..1826957) product phage shock protein operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071927.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 gene pspF CDS 1827135..1827815 product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071928.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 gene pspA CDS 1827836..1828069 product envelope stress response membrane protein PspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071929.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 gene pspB CDS 1828140..1828538 product envelope stress response membrane protein PspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071930.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 gene pspC CDS 1828690..1830042 product YcjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071931.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS 1830070..1831188 product TIGR01620 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071932.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS 1831377..1832555 product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071933.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 gene megL CDS complement(1832656..1834047) product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081268.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS 1834446..1834763 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS complement(1835306..1835581) product late competence development ComFB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071935.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS complement(1835817..1836506) product DUF2057 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071937.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS complement(1836516..1837190) product primosomal replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172966552.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS complement(1837193..1837966) product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071939.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS complement(1837976..1840048) product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071940.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 gene dinG CDS 1840343..1842778 product DNA polymerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925854.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS 1842957..1844219 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071942.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS 1844843..1847554 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944144.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS 1847645..1849435 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS 1850105..1850887 product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071944.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS 1850887..1852242 product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071945.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS 1852242..1852766 product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071946.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS 1852780..1853184 product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071947.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS 1853186..1853806 product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071948.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS 1853806..1855068 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071949.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS complement(1855273..1855782) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071950.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS 1855903..1857750 product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071951.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS 1857979..1858257 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071952.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS 1858288..1858821 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071953.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS 1858889..1859122 product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071954.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS 1859169..1859561 product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071955.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS 1859900..1861870 product NERD domain-containing protein kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070844.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS complement(1862010..1862819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15200 note possible pseudo, frameshifted CDS complement(1862867..1863181) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS complement(1863366..1864253) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072765.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS 1864383..1865162 product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925727.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS complement(1865487..1867481) product flavohemoglobin expression-modulating QEGLA motif protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001133565.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS complement(1867465..1868502) product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143671.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 gene gshB CDS 1869263..1870243 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070523.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS 1870823..1871407 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940393.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS 1871414..1871794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS 1871831..1872406 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921658.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS 1872579..1872947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS complement(1873018..1873557) product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262936.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS 1873720..1874601 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072431.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS 1874730..1875845 product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072430.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS 1875835..1876923 product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072429.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS complement(1876988..1878037) product alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105384656.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS complement(1878034..1878552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS 1879007..1881034 product TonB-dependent receptor PqqU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063446029.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 gene pqqU CDS 1881051..1882196 product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390122.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS 1882445..1882660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS 1882925..1883899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS complement(1884835..1885332) product VF530 family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262954.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS complement(1885981..1887243) product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458682.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS complement(1887450..1888649) product HAMP domain-containing histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074069.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS complement(1888777..1889460) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074070.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS complement(1889509..1890048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS complement(1890429..1891313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS 1891451..1892158 product transcriptional regulator NanR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369707.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 gene nanR CDS 1892382..1895066 product sodium/solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119311.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS 1895103..1895816 product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005687966.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS 1895872..1896837 product N-acetylmannosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703465.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS 1896881..1897681 product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166981.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 gene nagB CDS complement(1898195..1899103) product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000736956.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS complement(1899121..1900257) product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073344.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 gene nagA CDS 1901034..1902014 product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275390.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS 1902027..1903223 product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036696.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS complement(1903265..1904551) product cyclically-permuted mutarotase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626951.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS complement(1904679..1907609) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944144.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS 1907992..1909137 product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072763.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS 1909134..1912190 product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072762.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS 1912682..1913998 product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072761.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS 1914264..1916870 product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040114033.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS complement(1916938..1918122) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS 1918314..1919093 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989910.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS 1919215..1919961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS complement(1920003..1920497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS complement(1920535..1921044) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072759.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS complement(1921130..1921588) product DUF3010 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072758.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS complement(1921691..1923028) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072757.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS 1923337..1924422 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104025753.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS 1924460..1925395 product patatin-like phospholipase RssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072756.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 gene rssA CDS complement(1925483..1926481) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707351.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS 1926586..1927065 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351946.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS 1927163..1927906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072755.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS 1928183..1930300 product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072754.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 gene nrdD CDS 1930398..1930871 product anaerobic ribonucleoside-triphosphate reductase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072753.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 gene nrdG CDS 1930986..1931342 product YibL family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072752.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS 1931644..1932261 product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072751.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 gene ribA CDS 1932332..1933144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925886.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS 1933288..1934022 product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969401.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS 1934036..1935754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS complement(1935850..1937205) product DUF3612 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074292.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS 1937585..1938100 product malate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074293.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS complement(1938205..1938573) product VF530 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072748.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS complement(1938703..1941126) product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073002.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS complement(1941706..1942107) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073001.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS complement(1942278..1942994) product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072997.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS complement(1943155..1944531) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072995.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS complement(1944781..1946232) product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762940.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 gene putP CDS complement(1946368..1947072) product DUF3379 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072994.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS complement(1947065..1947628) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072993.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS complement(1947748..1949439) product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072992.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS complement(1949433..1951346) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072991.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS complement(1951349..1952353) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072990.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS complement(1952347..1952871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS complement(1952871..1953800) product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072988.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS complement(1953801..1954757) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072987.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS 1955174..1956484 product acetyl-CoA C-acyltransferase FadI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072986.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 gene fadI CDS 1956489..1958615 product fatty acid oxidation complex subunit alpha FadJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072985.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 gene fadJ CDS 1958924..1959148 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS complement(1959267..1959386) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS complement(1959765..1960049) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS complement(1960196..1964479) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072981.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS complement(1964867..1967656) product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072980.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS 1967931..1968419 product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072979.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 gene sixA CDS complement(1968587..1969117) product endonuclease SmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072978.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 gene smrB CDS 1969280..1970224 product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072977.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 gene prmB CDS 1970294..1971478 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072976.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 gene aroC CDS 1971650..1972822 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072975.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS 1972895..1974034 product ATP-NAD kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072974.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS 1974115..1974384 product YfcL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072973.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS 1974381..1974932 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072972.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS 1974987..1975718 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS complement(1975866..1977899) product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072971.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS 1978012..1979223 product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925736.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 gene fabB CDS complement(1979399..1979812) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425026.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS 1980103..1980498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS 1980527..1980835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS 1980771..1981544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS 1981675..1983966 product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261974.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS complement(1984607..1985587) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070523.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS 1985865..1987028 product 4-phosphoerythronate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072969.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS 1987031..1988047 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072968.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS 1988249..1991056 product FimV/HubP family polar landmark protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072967.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS 1991204..1991989 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072966.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 gene truA CDS 1992063..1993340 product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072965.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 gene folC CDS 1993343..1994020 product cell division protein DedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157015.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 gene dedD CDS 1994133..1994621 product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072963.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS 1994721..1996235 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072962.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 gene purF CDS 1996339..1997259 product M14 family metallocarboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262976.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS complement(1997462..1997728) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS 1997905..1999878 product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072959.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS complement(1999875..2000783) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263892.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS complement(2000869..2001066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS 2001365..2002264 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS 2002316..2003962 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS 2004222..2005379 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072958.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS complement(2005519..2007048) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072957.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS 2007313..2008872 product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072956.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS 2008921..2010576 product aromatic amino acid lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072955.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS 2010649..2011050 product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072954.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS complement(2011197..2014340) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123110.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS complement(2014340..2015332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS 2015397..2015606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS 2015805..2016854 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457950.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS 2016866..2017888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS 2017848..2018309 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS complement(2018306..2019154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS complement(2019155..2019550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS complement(2019540..2019938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS complement(2019935..2020573) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050991313.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS complement(2020625..2021917) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263157.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS complement(2021910..2022587) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463721.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS complement(2022773..2024860) product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073464.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS complement(2025178..2025981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS complement(2026092..2026610) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS complement(2026616..2027146) product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071418.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS complement(2027242..2028189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS 2028820..2029758 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836264.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS 2029809..2030183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS complement(2030319..2031779) product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225335.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS 2032232..2033347 product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869721.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS 2033810..2034790 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074147.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS 2035347..2036387 product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142542.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS complement(2036690..2037520) product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263858.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS complement(2037605..2037811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS 2038345..2038692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS 2038818..2039909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS complement(2040758..2042077) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072953.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS 2042369..2043013 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072952.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS 2043464..2043994 product DUF1097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072946.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS 2044060..2045508 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479118.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS 2045735..2046433 product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104910.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS 2046433..2048769 product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037666.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS 2048824..2050050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS complement(2050101..2052119) product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113937.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS 2052314..2053363 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113935.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS complement(2053360..2055078) product long-chain-fatty-acid--CoA ligase FadD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091644.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 gene fadD2 CDS complement(2055424..2056230) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072940.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 gene xthA CDS complement(2056250..2056549) product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072939.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS complement(2056598..2057239) product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072938.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS complement(2057313..2058785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS complement(2059184..2060110) product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211331.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 gene focA CDS complement(2060617..2061468) product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125171.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 tRNA 2061692..2061783 product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS 2061904..2063343 product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706333.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 gene selA CDS 2063354..2065228 product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706334.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 gene selB CDS 2065931..2066413 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS 2066410..2068437 product hydrogenase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816729.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 gene hyfB CDS 2068437..2069390 product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005345231.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS 2069406..2070848 product hydrogenase 4 subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168281.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS 2070871..2071521 product hydrogenase 4 membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168280.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 gene hyfE CDS 2071528..2073108 product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816730.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS 2073121..2074896 product hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706329.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS 2074906..2075469 product hydrogenase 4 subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816732.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 gene hyfH CDS 2075456..2076292 product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706330.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS 2076295..2076780 product formate hydrogenlyase maturation HycH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706331.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS 2076830..2077288 product hydrogenase maturation peptidase HycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816735.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 gene hycI CDS 2077983..2078222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS 2078252..2080399 product formate dehydrogenase H subunit alpha, selenocysteine-containing inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706323.1 transl_table 11 codon_start 1 transl_except (pos:2078669..2078671,aa:Sec) note codon on position 140 is selenocysteine opal codon. locus_tag LOCUS_16980 CDS 2080623..2082740 product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706322.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS 2082819..2083667 product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706321.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 gene fdhD CDS complement(2083829..2084692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS 2084821..2086020 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546769.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS complement(2086177..2086590) product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072153.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 gene hypA CDS complement(2086733..2087788) product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072154.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 gene hypE CDS complement(2087837..2088964) product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072155.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 gene hypD CDS complement(2088975..2089214) product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072156.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS complement(2089214..2089969) product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072157.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 gene hypB CDS complement(2090121..2092469) product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925864.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 gene hypF CDS complement(2092649..2094565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS complement(2094818..2095228) product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380787.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 gene nikR CDS 2095470..2097023 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235700231.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS 2097014..2098000 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817828.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS 2098057..2098947 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261407.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS 2098940..2099161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS 2099154..2099921 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261406.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS 2099991..2100587 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061030497.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS complement(2100618..2100995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS 2101281..2103350 product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243690.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS complement(2103476..2103739) product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790504.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 gene yedF CDS complement(2103736..2104977) product selenium metabolism membrane protein YedE/FdhT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070516.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 gene yedE CDS complement(2105548..2106366) product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072929.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 gene trpA CDS complement(2106359..2107579) product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072928.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 gene trpB CDS complement(2107715..2109196) product bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072927.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 gene trpCF CDS complement(2109212..2110249) product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072926.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 gene trpD CDS complement(2110246..2110857) product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072925.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS complement(2110854..2112410) product anthranilate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072924.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS 2112921..2113787 product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072922.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS 2113869..2114489 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072921.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS 2114601..2115389 product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072920.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS 2115390..2116028 product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072919.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 gene scpB CDS 2116273..2117145 product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072841.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 gene rluB CDS 2117614..2117856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17320 note possible pseudo, internal stop codon CDS 2117956..2118543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17330 note possible pseudo, internal stop codon CDS complement(2118651..2119388) product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072839.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS 2119653..2122133 product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072838.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS 2122264..2123295 product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925731.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 gene sohB CDS complement(2123371..2123727) product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072089.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS complement(2123936..2124868) product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706065.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 gene dusC CDS 2125324..2125818 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072091.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS 2125977..2126813 product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072092.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS 2126813..2127559 product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072093.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS 2128043..2128411 product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072095.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS 2128624..2129169 product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072096.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 gene apt CDS 2129427..2132117 product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072097.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 gene dnaX CDS 2132208..2132537 product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460082.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS 2132557..2133156 product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072099.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 gene recR CDS 2133412..2135328 product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072100.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 gene htpG CDS 2135487..2136332 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072101.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS 2136519..2137163 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072102.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 gene adk CDS 2137289..2138284 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925680.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 gene hemH CDS 2138507..2139811 product inosine/guanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072104.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS complement(2139924..2141240) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072045.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS 2141457..2144000 product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073787.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS complement(2144092..2145429) product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072652.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 gene astB CDS 2145885..2148674 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072651.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 gene topA CDS complement(2149039..2149812) product flagellar motor control protein ZomB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072596.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 gene zomB CDS 2150039..2151013 product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072595.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 gene cysB CDS complement(2151091..2152467) product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072262.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS 2152793..2153809 product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072263.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 gene nagZ CDS 2153898..2154437 product alpha/beta hydrolase YcfP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072264.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 gene ycfP CDS 2154852..2155130 product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072265.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS complement(2155208..2156146) product peptidoglycan binding protein CsiV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072266.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS complement(2156148..2159621) product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072267.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 gene mfd CDS complement(2159696..2160289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072268.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS 2160387..2161619 product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072269.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS 2161792..2162502 product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925702.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 gene lolD CDS 2162499..2163758 product lipoprotein-releasing ABC transporter permease subunit LolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072271.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 gene lolE CDS complement(2163913..2164395) product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072737.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS 2164727..2166832 product ComEC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211321.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS 2166866..2168698 product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072735.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 gene msbA CDS 2168702..2169724 product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072734.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 gene lpxK CDS 2169714..2169893 product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072733.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS 2170148..2171707 product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925698.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS complement(2171803..2172633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS complement(2173137..2176211) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072022.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS complement(2176208..2179477) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072023.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS complement(2179491..2180618) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072024.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS 2180953..2181357 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS 2181512..2182393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS complement(2182471..2183763) product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072025.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS 2184196..2184570 product succinate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072026.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 gene sdhC CDS 2184564..2184911 product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072027.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 gene sdhD CDS 2184912..2186678 product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072028.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 gene sdhA CDS 2186689..2187396 product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072029.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS 2187618..2190440 product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072030.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 gene sucA CDS 2190471..2191661 product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072031.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 gene odhB CDS 2191775..2192941 product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072032.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 gene sucC CDS 2192941..2193813 product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007647520.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 gene sucD CDS complement(2193918..2195570) product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945835.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS 2195739..2196239 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072034.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS complement(2196312..2196743) product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072035.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 gene fur CDS 2197315..2198043 product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072036.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 gene cobB CDS 2198072..2198581 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072037.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS complement(2198622..2198837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS complement(2198933..2199226) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS complement(2199258..2199758) product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973716.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 gene sodN CDS complement(2200031..2200435) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS complement(2200691..2201095) product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034818.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS complement(2201109..2202089) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113465.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS complement(2202342..2202947) product serine protease inhibitor ecotin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072312.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 gene eco CDS 2203213..2205417 product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393409.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS 2205475..2207550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS 2207642..2208037 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS 2208193..2208396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS complement(2208474..2209886) product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072680.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 gene bioA CDS 2209997..2211061 product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072679.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 gene bioB CDS 2211083..2212249 product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072678.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS 2212322..2213089 product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072677.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 gene bioC CDS 2213138..2213827 product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072676.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 gene bioD CDS complement(2213862..2214887) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464323.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS 2215348..2216208 product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072672.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 gene htpX CDS 2216637..2216984 product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072671.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS 2217224..2218093 product MYG1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973334.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS 2218572..2220713 product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269142.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS 2220997..2221863 product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707178.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 gene cobA CDS 2222111..2223259 product glycosyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263569.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS 2223256..2223795 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS 2224062..2226701 product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463769.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 gene nirB CDS 2226729..2227082 product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099065.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 gene nirD CDS 2227104..2228570 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS 2228620..2230527 product bifunctional protein-serine/threonine kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965821.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS 2230690..2231889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071063.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS 2232187..2232948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS 2233151..2234353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS 2234573..2235205 product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072669.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS 2235235..2235696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS 2235710..2236123 product curli assembly protein CsgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421309.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS 2236125..2236973 product CsgG/HfaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421307.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS 2237194..2237544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS 2237551..2237994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS complement(2238131..2238550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS 2238850..2239206 product purine nucleoside phosphoramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072667.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 gene hinT CDS 2239222..2240259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS 2240391..2240780 product YcfL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072664.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS 2241148..2243328 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072660.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS 2243520..2243780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072659.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS 2243880..2244521 product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072658.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 gene pnuC CDS 2244545..2245570 product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072657.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS 2245706..2246308 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072655.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS 2246412..2246960 product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072654.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS complement(2247037..2247777) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082451.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS complement(2247873..2248502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS 2248576..2249085 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925883.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS 2249120..2249722 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072768.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS 2250018..2250473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072766.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS 2250610..2250999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS 2251288..2251974 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS 2251964..2253043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS 2253115..2254239 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005384341.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS 2254236..2255459 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228370.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS 2255539..2256795 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765923.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS 2257112..2258149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489206.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS complement(2258279..2258767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS complement(2259690..2260421) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119458.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS 2260570..2261163 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073335.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS 2261280..2261972 product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707332.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS complement(2262222..2262797) product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082850.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS complement(2262854..2263360) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207057.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS complement(2263365..2263514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS complement(2264776..2265315) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813206.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS complement(2265499..2266068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS 2266309..2266617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS complement(2267444..2267959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS 2268195..2268548 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS complement(2268730..2269197) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS complement(2269629..2270054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS 2271379..2272656 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS complement(2273265..2274566) product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262748.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS 2275054..2277894 product ExeM/NucH family extracellular endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071959.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS complement(2277985..2278305) product YdbL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072130.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS complement(2278335..2278535) product YnbE family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072131.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS complement(2278625..2282128) product YdbH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072132.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS complement(2282377..2282685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS complement(2282794..2283642) product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072706.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS 2284025..2285824 product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072705.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS complement(2285994..2286743) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073325.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS 2287218..2287748 product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263751.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS 2287799..2288668 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263750.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS 2288773..2289150 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS 2289137..2289373 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS 2289336..2289755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS complement(2289801..2290175) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462158.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS complement(2290231..2290464) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS complement(2290461..2290760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS 2290867..2291847 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262245.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS complement(2291926..2292558) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072123.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS 2292749..2293246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS 2293258..2293728 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119010463.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS 2293808..2294170 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS 2294265..2295194 product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967589.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS 2295516..2296364 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS complement(2296446..2297609) product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682145.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS complement(2297812..2299962) product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682151.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS complement(2300338..2302416) product bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073394.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS complement(2302784..2304964) product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203174.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS 2305652..2307232 product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073263.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS complement(2307292..2309040) product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072047.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 gene ggt CDS 2308922..2310349 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072048.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS complement(2310383..2311000) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072049.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS complement(2311153..2312193) product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072057.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 gene hppD CDS 2312409..2313302 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072059.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS 2313816..2314172 product DUF6508 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072064.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS complement(2314449..2315441) product diheme cytochrome c5 peroxidase CcpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072214.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 gene ccpA CDS complement(2315675..2315935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS 2316126..2316848 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001215772.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS complement(2316922..2317329) product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072069.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS 2317536..2318468 product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072070.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS complement(2318700..2318873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072074.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS 2319404..2320960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS 2321180..2322121 product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072079.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS complement(2322155..2322742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072080.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS complement(2322912..2323271) product DUF2750 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072081.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS 2323537..2324724 product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925859.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS 2324901..2325776 product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277248.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS 2325872..2326354 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072083.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS 2326460..2326678 product DUF3389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072085.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS complement(2326716..2327726) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529918.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS 2327894..2328565 product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925860.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS 2328921..2330687 product bifunctional UDP-sugar hydrolase/5'-nucleotidase UshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072087.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 gene ushA CDS 2331298..2333010 product bifunctional UDP-sugar hydrolase/5'-nucleotidase UshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072087.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 gene ushA CDS 2333329..2333769 product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072287.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS complement(2333957..2334451) product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072288.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 gene ilvN CDS complement(2334451..2336172) product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072289.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS complement(2336632..2337870) product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072290.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS complement(2338301..2339671) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072292.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS 2339829..2340437 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268298.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS complement(2340527..2341174) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461763.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS complement(2341277..2341936) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262281.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS 2342193..2343179 product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072295.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS complement(2343333..2344127) product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084693.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS complement(2344108..2345529) product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477226.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS 2345753..2346301 product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005486498.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS 2346484..2347863 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072221.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 gene yegD CDS 2347867..2348355 product CreA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072222.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS 2348832..2349149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS 2349151..2349639 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263862.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS 2349723..2350607 product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071483.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS complement(2350637..2351896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS complement(2352130..2354202) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072568.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 gene metG CDS 2354364..2355479 product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072567.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 gene apbC CDS 2355489..2356124 product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072566.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 gene udk CDS 2356244..2357074 product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072564.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 gene pabC CDS 2357071..2358078 product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072563.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 gene mltG CDS 2358075..2358707 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072562.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 gene tmk CDS 2358707..2359621 product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072561.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 gene holB CDS 2359629..2359955 product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072560.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS complement(2359895..2360065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS 2360222..2360854 product YchF/TatD family DNA exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072559.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS complement(2361054..2362487) product 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072558.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 gene rsmF CDS 2362668..2363894 product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072557.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS complement(2364009..2364458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS complement(2364717..2365625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925870.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS complement(2365926..2366240) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072235.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS 2366523..2367440 product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925699.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS complement(2367743..2368681) product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072540.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 gene ylqF CDS complement(2368835..2369674) product 2OG-Fe(II) oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072539.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS 2369976..2370884 product bifunctional methionine sulfoxide reductase B/A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072538.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS complement(2370943..2372499) product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482406.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS complement(2372631..2376113) product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072719.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 gene rne CDS 2376702..2377661 product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072718.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 gene rluC CDS 2377658..2378308 product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408320.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS complement(2378432..2379787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS complement(2380090..2380680) product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925884.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS 2381018..2381542 product 23S rRNA accumulation protein YceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072716.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 gene yceD CDS 2381560..2381730 product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072715.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 gene rpmF CDS 2381745..2382773 product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072714.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 gene plsX CDS 2382784..2383743 product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072713.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS 2383818..2384744 product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072712.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 gene fabD CDS 2384754..2385500 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072711.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 gene fabG CDS 2385769..2386002 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006081231.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 gene acpP CDS 2386172..2387410 product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072710.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 gene fabF CDS 2387624..2387992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072709.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS 2388098..2388577 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072708.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS 2388653..2389528 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072707.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS complement(2389612..2390502) product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072724.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 gene cdd CDS complement(2390600..2392012) product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072723.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 gene sbcB CDS 2392299..2393105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072722.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS 2393135..2393938 product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072721.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 gene rlmA CDS 2394237..2394443 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072720.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS complement(2394759..2395658) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071977.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS complement(2395655..2396491) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071978.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS complement(2396729..2397379) product DUF480 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071979.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS complement(2397511..2398347) product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071980.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS 2398748..2400661 product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071982.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 gene speA CDS 2400761..2401684 product S-adenosylmethionine decarboxylase SpeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071983.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS 2401708..2402640 product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263658.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 gene speB CDS 2402675..2403316 product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072804.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 gene pdxH CDS 2403563..2404138 product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072802.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS 2404263..2404616 product DUF3802 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072801.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS 2405101..2405472 product STAS/SEC14 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072800.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS 2405585..2406454 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS complement(2406549..2409194) product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072799.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS complement(2409391..2410695) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072148.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS complement(2410652..2410873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS 2411284..2412267 product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072149.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 gene pheS CDS 2412282..2414669 product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072150.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 gene pheT CDS 2414674..2414970 product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072151.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 gene ihfA CDS 2415154..2416089 product lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072152.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 gene lpxM CDS complement(2416206..2416577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458364.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS complement(2416588..2416899) product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458351.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS 2417057..2417983 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458320.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS complement(2418055..2419692) product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070804.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS complement(2419689..2419988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070803.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS 2420407..2422473 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074135.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS 2423439..2424455 product IS110-like element IS1111A family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041952483.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS 2425173..2425748 product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479970.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS complement(2426082..2427062) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070523.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS 2427277..2427972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS complement(2428407..2429534) product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024944314.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS 2429909..2430796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS complement(2430812..2431588) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477460.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS complement(2431760..2432542) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS complement(2432689..2433327) product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072134.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 gene hisIE CDS complement(2433391..2434164) product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072135.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 gene hisF CDS complement(2434154..2434927) product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072136.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 gene hisA CDS complement(2434924..2435640) product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072137.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 gene hisH CDS complement(2435637..2436704) product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072138.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 gene hisB CDS complement(2436774..2437826) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072139.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 gene hisC CDS complement(2437823..2439133) product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072140.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 gene hisD CDS complement(2439138..2440037) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925682.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 gene hisG CDS complement(2440844..2441188) product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368778.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS complement(2441192..2441950) product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368777.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS 2442253..2442633 product Rid family detoxifying hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705513.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS 2442746..2444020 product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071607.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS 2444125..2444769 product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005299461.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS 2444899..2446179 product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706654.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS 2446763..2448688 product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925684.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS 2448960..2454044 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS 2454060..2458832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS 2458850..2459686 product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002079012.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS 2459679..2460278 product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105137.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS 2460271..2461551 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS complement(2461700..2463001) product NADH-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301763.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 gene ndh CDS 2463283..2464257 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806971.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS 2464437..2465897 product ethanolamine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114906.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 gene eat CDS 2466062..2467429 product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947961.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS 2467519..2468964 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947960.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS 2469018..2470187 product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947959.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS 2470250..2470948 product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947958.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS 2471194..2471913 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072535.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 gene tsaB CDS 2471969..2472343 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS 2472336..2473046 product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072533.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS 2473193..2474023 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072532.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS 2474242..2475117 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072531.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS 2475310..2476983 product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072530.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 gene fadD CDS 2477068..2478186 product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925719.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 gene rnd CDS complement(2478263..2478520) product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007648439.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 gene minE CDS complement(2478523..2479332) product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072528.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 gene minD CDS complement(2479360..2480025) product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072527.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 gene minC CDS 2480147..2480428 product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072526.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS 2480446..2481474 product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479026.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS 2481634..2482074 product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072525.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS complement(2482139..2482669) product disulfide bond formation protein DsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072798.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 gene dsbB CDS complement(2482799..2484385) product sodium/proton antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072797.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 gene nhaB CDS 2484695..2485441 product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072796.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 gene fadR CDS complement(2485564..2489451) product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072176.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS complement(2489448..2491148) product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072177.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS 2491432..2492469 product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072178.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS complement(2492572..2494290) product NiFe hydrogenase assembly chaperone HyaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072159.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS complement(2494283..2494840) product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072160.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS complement(2494931..2495593) product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072161.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 gene cybH CDS complement(2495610..2497316) product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072162.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 gene hyaB CDS complement(2497320..2498456) product nickel-dependent hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072163.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 gene hyaA CDS 2498882..2499298 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072250.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS 2499956..2500582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20650 CDS 2500665..2501642 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071719.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS complement(2501963..2502175) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423776.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS complement(2503455..2505542) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS complement(2506000..2507295) product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477214.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS complement(2507288..2508544) product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105063403.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 gene codB CDS 2509037..2512924 product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072251.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 gene hrpA CDS 2513426..2513722 product chaperone NapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463501.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS 2513719..2516208 product periplasmic nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262391.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 gene napA CDS 2516221..2516676 product nitrate reductase cytochrome c-type subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744358.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS 2516694..2517284 product NapC/NirT family cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420448.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS 2517294..2517422 product TIGR02808 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420446.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS 2517611..2517925 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS 2517973..2518782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20780 note possible pseudo, frameshifted CDS complement(2518852..2519784) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263006.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS 2519931..2521676 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104696.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS 2521663..2522403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS complement(2522484..2523494) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072241.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS 2526123..2527787 product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072530.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 gene fadD CDS complement(2528233..2528883) product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106022.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS complement(2528874..2530913) product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925866.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 gene recD CDS complement(2530910..2534668) product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072201.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 gene recB CDS complement(2534668..2538240) product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072202.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 gene recC CDS complement(2538616..2539023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS complement(2538933..2539748) product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455166.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS 2540256..2540696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS 2540904..2542817 product copper resistance system multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114867.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS 2542880..2543608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS 2543735..2544133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS 2544330..2545103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS 2545151..2545309 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS complement(2545563..2547572) product DUF3488 and transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925867.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS complement(2547575..2548282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS complement(2548571..2549482) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072205.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS complement(2549565..2550332) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072112.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS complement(2550499..2552517) product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072113.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS complement(2552568..2554064) product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072114.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 gene rmuC CDS 2554345..2555370 product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072115.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 gene msrP CDS 2555435..2556067 product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072116.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 gene msrQ CDS 2556262..2557908 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205011.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS 2558121..2558615 product putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072520.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 CDS 2558633..2560474 product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072519.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS 2560474..2561055 product BsuPI-related putative proteinase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072518.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS complement(2561159..2562721) product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245617.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS complement(2562956..2564509) product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072517.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS complement(2564593..2565390) product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072516.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 gene gloB CDS 2565885..2566637 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072515.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS 2566641..2567537 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072514.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS complement(2567599..2568063) product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072513.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 gene rnhA CDS 2568131..2568856 product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072512.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 gene dnaQ CDS 2569132..2570322 product TIGR03503 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925880.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 tRNA 2570449..2570525 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA 2570594..2570670 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS 2571484..2573325 product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072494.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS complement(2573405..2575852) product acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072493.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 gene fadE CDS 2576098..2576883 product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072492.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS complement(2576954..2577721) product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072491.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS complement(2577949..2578353) product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925718.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS 2578643..2579281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS complement(2579419..2581140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS 2581324..2581815 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072489.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 gene def CDS complement(2581832..2583148) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459362.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS 2583522..2584049 product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990418.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS complement(2584064..2584744) product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072423.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS 2585104..2586069 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072422.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS 2586580..2588532 product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072421.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 gene thiC CDS 2588536..2590110 product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072420.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 gene thiE CDS 2590100..2590876 product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072419.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS 2590891..2591130 product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072418.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 gene thiS CDS 2591132..2591896 product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072417.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS 2591915..2593030 product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072416.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 gene thiH CDS 2593191..2593448 product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072415.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS 2593454..2594668 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS complement(2594690..2595577) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072413.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS complement(2595651..2596748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS complement(2596687..2598492) product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072412.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS complement(2598440..2599402) product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705412.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS complement(2599405..2600910) product inactive transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705413.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS complement(2600922..2601668) product RimK/LysX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460890.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS complement(2601747..2602739) product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072411.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 gene cmoB CDS complement(2602789..2603520) product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072410.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 gene cmoA CDS 2603721..2606468 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072409.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS 2606639..2608420 product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072408.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 gene aspS CDS 2608550..2609296 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072407.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS 2609300..2609821 product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072406.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 gene ruvC CDS 2609818..2610435 product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072405.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 gene ruvA CDS 2610472..2611488 product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072404.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 gene ruvB CDS complement(2611529..2612044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS 2612452..2612919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS 2613064..2613864 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS 2613875..2616958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS 2617066..2617485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS 2618158..2620689 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072403.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS complement(2620764..2621174) product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072117.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 gene gloA CDS complement(2621600..2622241) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072477.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 gene nth CDS complement(2622313..2623071) product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072476.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS complement(2623068..2623706) product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072475.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 gene rsxG CDS complement(2623722..2624774) product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072474.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 gene rsxD CDS complement(2624778..2627315) product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072473.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 gene rsxC CDS complement(2627309..2627878) product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072472.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 gene rsxB CDS complement(2627881..2628459) product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072471.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 gene rsxA CDS complement(2628571..2630475) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072470.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 tRNA complement(2630591..2630666) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA complement(2630696..2630771) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 tRNA complement(2630808..2630883) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 tRNA complement(2630909..2630984) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 tRNA complement(2631017..2631092) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 tRNA complement(2631143..2631218) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS 2632261..2634276 product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072469.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 gene uvrB CDS complement(2634331..2634942) product rhombosortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072468.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 gene rrtA CDS complement(2634939..2635634) product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072467.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 gene queC CDS 2635804..2636472 product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072466.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 gene queE CDS complement(2636531..2637595) product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337335.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 tRNA complement(2637793..2637877) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 tRNA complement(2637963..2638047) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 tRNA complement(2638196..2638280) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA complement(2638364..2638448) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS 2638573..2639091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21700 CDS 2639263..2639550 product DUF406 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072464.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS 2639720..2641912 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072463.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS complement(2641927..2642412) product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072462.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS complement(2642402..2642971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072461.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS complement(2643212..2645050) product M2 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072459.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS 2645247..2645885 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072458.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS 2645931..2648207 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072457.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS complement(2648488..2649927) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072456.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 gene pyk CDS complement(2650113..2650967) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072455.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS 2651277..2652749 product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072454.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 gene zwf CDS 2652762..2653460 product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072453.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 gene pgl CDS 2653470..2655296 product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072452.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 gene edd CDS 2655311..2655952 product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072451.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS 2656225..2657196 product CDF family Co(II)/Ni(II) efflux transporter DmeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477256.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 gene dmeF CDS 2657248..2657667 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072119.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS complement(2657721..2657915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS 2657885..2659516 product phosphoethanolamine--lipid A transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072121.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS 2659695..2660726 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072122.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS complement(2660853..2663546) product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072179.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS complement(2663708..2665471) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417791.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS 2665854..2667041 product knotted carbamoyltransferase YgeW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706019.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 gene ygeW CDS 2667117..2668325 product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110478.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 gene dpaL CDS 2668427..2669638 product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005301172.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS 2669813..2671216 product D-phenylhydantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264448.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 gene hyuA CDS 2671333..2672235 product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707754.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 gene arcC CDS 2672443..2674008 product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705394.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS 2674112..2677792 product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705395.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 gene nifJ CDS 2678006..2679271 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706908.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS complement(2679389..2680159) product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072111.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS complement(2680711..2681229) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22000 note possible pseudo, frameshifted CDS complement(2681246..2681461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS 2681785..2682102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS 2682220..2683068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS 2683186..2683542 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533874.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS 2683718..2684344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22050 CDS complement(2684478..2684642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS 2684840..2686390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS 2686799..2687755 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071997.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS complement(2688005..2689573) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS 2689766..2694541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS 2694674..2695483 product RecX family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263728.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS complement(2695559..2696041) product MarR family transcriptional regulator CosR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005494763.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 gene cosR CDS 2696604..2698391 product choline/carnitine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283925.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS complement(2698423..2699088) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070853.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS complement(2699233..2700945) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS 2701476..2702933 product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267258.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 gene xdhA CDS 2702926..2705292 product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114679.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 gene xdhB CDS 2705386..2706324 product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267256.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 gene xdhC CDS 2706406..2707785 product allantoinase AllB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223822.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 gene allB CDS 2707865..2708923 product allantoicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267251.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 gene alc CDS 2708935..2709435 product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030740.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 gene uraD CDS 2709446..2709787 product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057392.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 gene uraH CDS 2709839..2710372 product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193471.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS 2710457..2711743 product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201419799.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 gene guaD CDS 2711810..2713006 product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550272.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 CDS 2713225..2715399 product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113258.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS 2715552..2716178 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770041.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS 2716529..2717509 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070523.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS complement(2717745..2718194) product YtoQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229263.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS complement(2718371..2719369) product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255183.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 CDS complement(2719697..2720845) product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401700.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS complement(2720903..2721880) product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401697.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS 2722245..2723024 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191360.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS 2723094..2723537 product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383119.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS complement(2723596..2725215) product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057980.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 CDS 2725808..2727256 product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087209.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 CDS complement(2728443..2729564) product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481009.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS 2729933..2730772 product outer membrane protein OmpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102209.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS 2730994..2732232 product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465132.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS complement(2733483..2733953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS complement(2734237..2734479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22410 CDS 2735324..2735662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263938.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 CDS complement(2736540..2737451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS complement(2737617..2738021) product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101529.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS complement(2738060..2738704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS 2739466..2739921 product DUF3465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181711645.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS complement(2740258..2741850) product selenium-dependent molybdenum cofactor biosynthesis protein YqeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706024.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 gene yqeB CDS complement(2741874..2742881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS 2742999..2743595 product molybdenum cofactor cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817484.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 gene mocA CDS 2743992..2747108 product putative selenate reductase subunit YgfK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706027.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 gene ygfK CDS 2747118..2748446 product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906252.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 gene ssnA CDS 2748461..2750638 product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869185.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS 2750628..2751107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS 2751101..2751955 product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969635.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS 2752121..2753050 product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478824.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 gene pyrB CDS 2753053..2753511 product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455107.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 gene pyrI CDS 2753929..2754723 product molybdopterin-dependent oxidoreductase FAD-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572452.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 gene ygfM CDS 2754726..2757596 product molybdopterin-dependent oxidoreductase Mo/Fe-S-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583615.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS 2757777..2759189 product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868917.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS 2759375..2760652 product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295158.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 gene guaD CDS 2760933..2762306 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706033.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS 2762502..2763293 product outer membrane protein OmpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073830.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 tRNA complement(2764006..2764082) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 tRNA complement(2764102..2764178) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 tRNA complement(2764375..2764451) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 tRNA complement(2764470..2764546) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 tRNA complement(2764751..2764827) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 tRNA complement(2764830..2764906) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 tRNA complement(2764951..2765027) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 tRNA complement(2765073..2765149) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 CDS complement(2765463..2766839) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072297.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 CDS 2766872..2767483 product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072298.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS complement(2767551..2767853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22650 CDS complement(2767867..2768598) product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443912.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS 2769052..2770980 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072301.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 gene thrS CDS 2771104..2771526 product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072302.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 gene infC CDS 2771612..2771806 product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072303.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 gene rpmI CDS 2771825..2772184 product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006081652.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 gene rplT CDS complement(2772330..2773280) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072304.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 gene trxB CDS complement(2773418..2774533) product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072305.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 gene ald CDS 2774714..2775220 product leucine-responsive transcriptional regulator Lrp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007647640.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 gene lrp CDS 2775390..2777936 product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072306.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS 2778017..2778643 product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072307.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 gene lolA CDS 2778659..2779990 product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072308.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS 2779983..2780357 product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072309.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 gene crcB CDS 2780376..2781662 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072310.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 gene serS CDS complement(2782015..2782353) product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072361.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS complement(2782347..2782628) product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072360.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 gene tusB CDS complement(2782628..2782984) product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072359.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 gene tusC CDS complement(2782984..2783373) product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925875.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 gene tusD CDS complement(2783432..2784091) product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072357.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 CDS complement(2784296..2785198) product DNA-binding transcriptional activator PunR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072356.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 gene punR CDS 2785327..2786586 product purine nucleoside transporter PunC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072355.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 gene punC tRNA 2786729..2786819 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 CDS 2787259..2788113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS complement(2788247..2791465) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS complement(2791469..2792662) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS complement(2793122..2794111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS 2794469..2794843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS complement(2794848..2796101) product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074352.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 CDS complement(2796151..2796573) product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419177.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 gene umuD CDS 2796778..2797584 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001911722.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS 2797814..2798734 product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263293.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS complement(2798849..2801263) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073257.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 CDS complement(2801569..2804703) product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920248.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS complement(2804716..2806008) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946742.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS complement(2806008..2807384) product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087700.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS 2808571..2809416 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS 2809622..2811067 product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704801.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 gene aspA CDS complement(2811250..2812272) product sugar-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073504.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS 2812772..2815057 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS 2815346..2815954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS 2816185..2817336 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653894.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS complement(2817403..2819076) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS complement(2819586..2819771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS 2820267..2820656 product DUF1090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877297.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS complement(2820948..2821124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS complement(2821513..2821980) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986684.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS 2822129..2823247 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23100 CDS 2823259..2823567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS 2823582..2823782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS 2823752..2823937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS complement(2824132..2824308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23140 CDS complement(2824697..2825164) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986684.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS 2825313..2826431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS 2826443..2826751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23170 CDS 2826766..2826966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS 2826936..2827121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS complement(2828157..2829449) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706131.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS complement(2829625..2829927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS 2830161..2831756 product DUF3369 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072353.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS complement(2831771..2832247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072352.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS 2832509..2833936 product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072351.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 gene ccoN CDS 2833947..2834573 product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072350.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 gene ccoO CDS 2834588..2834755 product CcoQ/FixQ family Cbb3-type cytochrome c oxidase assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072349.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS 2834755..2835723 product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072348.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 gene ccoP CDS 2835833..2836312 product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072347.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS 2836541..2838832 product heavy metal translocating P-type ATPase metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072346.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS 2838829..2839023 product cbb3-type cytochrome oxidase assembly protein CcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072345.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 gene ccoS CDS 2839020..2839706 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072344.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS 2839762..2840511 product electron transport transcriptional regulator EtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072343.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 gene etrA CDS 2840682..2841620 product universal stress protein UspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072342.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 gene uspE CDS 2841714..2842664 product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925707.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 gene ttcA CDS complement(2842745..2843341) product DUF2987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072340.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 CDS complement(2843349..2844176) product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072339.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS 2844322..2845242 product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072338.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 CDS complement(2845310..2846506) product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072337.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 tRNA complement(2847108..2847193) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA complement(2847292..2847365) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 tRNA complement(2847463..2847538) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 CDS 2848305..2849480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS complement(2849577..2851016) product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072336.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 CDS 2851220..2852068 product DUF2989 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072335.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 CDS 2852279..2853289 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072334.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 gene gap CDS 2853516..2854196 product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706818.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS 2854551..2855021 product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071355.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 gene bfr CDS 2855023..2855505 product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071356.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 gene bfr CDS complement(2855577..2855933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS complement(2856098..2856490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS complement(2856682..2856957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026029251.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 CDS 2857157..2858275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS complement(2858280..2859638) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331272.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS complement(2859736..2860290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS 2860446..2862140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS 2862568..2863629 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS complement(2863713..2864408) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461744.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 CDS complement(2864427..2864786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072363.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 CDS 2865003..2867000 product methyl-accepting chemotaxis protein Mlp37 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672477.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 gene mlp37 CDS 2867445..2868239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS 2868615..2869577 product ABC transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705146.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS complement(2869601..2870104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072364.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS 2870595..2871680 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072365.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS complement(2871910..2874489) product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038275.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS complement(2874593..2875309) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819653.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS 2875602..2875994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS complement(2875996..2876592) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118797.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS 2877034..2878326 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706201.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS 2878751..2880118 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023175504.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 CDS complement(2880718..2881356) product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263614.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS complement(2881349..2881483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS 2881484..2882401 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263615.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 CDS 2882916..2884502 product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072485.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 CDS complement(2885416..2886315) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017018211.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS 2886451..2887707 product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418817.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 CDS complement(2888244..2889287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23730 CDS 2890066..2890245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23740 CDS complement(2891106..2894135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS complement(2894784..2895632) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172795079.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 CDS complement(2895719..2897620) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480536.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 CDS 2898529..2899653 product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818717.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS 2899647..2900561 product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948816.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 CDS complement(2900752..2901837) product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705342.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 CDS complement(2901834..2902604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23810 CDS complement(2902923..2904227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS complement(2904606..2904887) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459922.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS 2905591..2907174 product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479897.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS complement(2907417..2907608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS 2908025..2908204 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS complement(2908195..2908407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS complement(2908483..2908977) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035688.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS 2909235..2910533 product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035691.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 gene hmgA CDS complement(2911153..2911344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS 2911328..2912572 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480170.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS 2912547..2913503 product HTH-type transcriptional regulator YidZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073741.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 gene yidZ CDS 2914736..2915470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS 2915470..2917338 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS complement(2918084..2919124) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071624.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 CDS complement(2919198..2920535) product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071623.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS 2920759..2921940 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071622.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS 2922195..2923889 product PhnD/SsuA/transferrin family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071621.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS 2923902..2924501 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071620.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS complement(2924555..2926486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS complement(2926476..2926784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24010 CDS complement(2926792..2927988) product EAL domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706358.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS complement(2927994..2928959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24030 CDS complement(2928916..2929104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS complement(2929360..2929611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24050 CDS complement(2929852..2931363) product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766157.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 CDS complement(2931356..2934499) product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766158.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 CDS complement(2934499..2935620) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788929.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 CDS 2935589..2935771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24090 CDS complement(2936356..2937102) product DTW domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072367.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 CDS complement(2937170..2938483) product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072370.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 gene pssA CDS complement(2938495..2938827) product DUF1904 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072371.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 CDS 2939184..2939360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072372.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS 2939453..2940913 product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072373.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 gene dacB CDS complement(2941005..2942762) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072374.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 CDS complement(2943068..2943610) product DUF2058 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072375.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 CDS complement(2943830..2944525) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072377.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 gene pyrF CDS complement(2944680..2945840) product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072378.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 gene lapB CDS complement(2945842..2946129) product lipopolysaccharide assembly protein LapA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072379.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS complement(2946252..2946539) product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072380.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 gene ihfB CDS complement(2946648..2948315) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072381.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 gene rpsA CDS complement(2948418..2949110) product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072382.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 gene cmk CDS complement(2949370..2950650) product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072383.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 gene aroA CDS 2951089..2952294 product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072384.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS complement(2952453..2953544) product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072388.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 gene serC CDS complement(2953703..2956417) product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072389.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 gene gyrA CDS 2956714..2957439 product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072390.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS 2957451..2958128 product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072391.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS 2958574..2960862 product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072392.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 gene nrdA CDS 2960954..2962084 product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072393.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 gene nrdB CDS 2962074..2962427 product class I ribonucleotide reductase maintenance protein YfaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072394.1 transl_table 11 codon_start 1 locus_tag LOCUS_24310 gene yfaE CDS complement(2962513..2962896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24320 note possible pseudo, internal stop codon CDS complement(2962930..2963265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24330 note possible pseudo, internal stop codon CDS complement(2963983..2964399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24340 CDS complement(2964499..2965602) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24350 CDS complement(2965664..2965882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24360 CDS 2965955..2966191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24370 CDS complement(2966244..2966423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24380 CDS complement(2966722..2968749) product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072396.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 CDS 2968915..2970756 product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072397.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 gene sppA CDS 2971198..2972211 product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072398.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 gene ansA CDS complement(2972254..2972535) product DUF1315 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072399.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 CDS complement(2972532..2972849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072400.1 transl_table 11 codon_start 1 locus_tag LOCUS_24430 CDS complement(2972915..2974042) product M14-type cytosolic carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072401.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 CDS complement(2974195..2974914) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072402.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS complement(2975099..2976868) product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072522.1 transl_table 11 codon_start 1 locus_tag LOCUS_24460 CDS complement(2977037..2979010) product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105472.1 transl_table 11 codon_start 1 locus_tag LOCUS_24470 CDS 2979265..2980026 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940524.1 transl_table 11 codon_start 1 locus_tag LOCUS_24480 CDS 2980127..2980828 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940524.1 transl_table 11 codon_start 1 locus_tag LOCUS_24490 CDS complement(2980858..2981703) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262419.1 transl_table 11 codon_start 1 locus_tag LOCUS_24500 CDS 2981848..2983305 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362111.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 gene cls tRNA 2983632..2983722 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 CDS complement(2984084..2984866) product EcsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106675.1 transl_table 11 codon_start 1 locus_tag LOCUS_24520 CDS complement(2985137..2987134) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817980.1 transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS complement(2987309..2988376) product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072333.1 transl_table 11 codon_start 1 locus_tag LOCUS_24540 gene nadA CDS complement(2988511..2990130) product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072332.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 CDS complement(2990140..2991117) product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072331.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 CDS complement(2991121..2992299) product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072330.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 CDS complement(2992494..2993543) product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072329.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 gene astE CDS 2993853..2994332 product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072328.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 gene msrA CDS complement(2994403..2996067) product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072327.1 transl_table 11 codon_start 1 locus_tag LOCUS_24600 gene pgm CDS complement(2996171..2996713) product replication initiation negative regulator SeqA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072326.1 transl_table 11 codon_start 1 locus_tag LOCUS_24610 gene seqA CDS 2997056..2997802 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072325.1 transl_table 11 codon_start 1 locus_tag LOCUS_24620 CDS 2997889..2998110 product DUF2788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072324.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS 2998122..2998394 product LexA regulated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072323.1 transl_table 11 codon_start 1 locus_tag LOCUS_24640 gene ybfE CDS 2998443..2998973 product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072322.1 transl_table 11 codon_start 1 locus_tag LOCUS_24650 gene fldA CDS 2999311..3000498 product elongation factor P maturation arginine rhamnosyltransferase EarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072321.1 transl_table 11 codon_start 1 locus_tag LOCUS_24660 gene earP CDS 3000546..3001109 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072320.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 gene efp CDS 3001434..3002648 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072448.1 transl_table 11 codon_start 1 locus_tag LOCUS_24680 CDS 3002764..3003351 product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072449.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 gene yfbR CDS 3003385..3004719 product anti-phage deoxyguanosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072450.1 transl_table 11 codon_start 1 locus_tag LOCUS_24700 CDS complement(3004807..3005187) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941946.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 CDS complement(3005204..3006955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS complement(3006969..3007922) product SBBP repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990858.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 CDS complement(3008038..3008670) product YchE family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072194.1 transl_table 11 codon_start 1 locus_tag LOCUS_24740 CDS 3009008..3011608 product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072193.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 gene adhE CDS complement(3011729..3013894) product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113258.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 CDS complement(3014138..3015082) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117795.1 transl_table 11 codon_start 1 locus_tag LOCUS_24770 CDS 3015196..3016779 product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113373.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS complement(3016929..3017939) product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 transl_table 11 codon_start 1 locus_tag LOCUS_24790 CDS complement(3017949..3018641) product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423808.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 CDS complement(3019015..3019563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS complement(3019553..3020878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS complement(3021011..3023062) product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925700.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS complement(3023296..3024828) product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072246.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 CDS 3024951..3026363 product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072245.1 transl_table 11 codon_start 1 locus_tag LOCUS_24850 gene pabB CDS 3026463..3027038 product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072244.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 CDS complement(3027021..3027356) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072243.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 CDS 3027617..3029017 product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072242.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 gene asnS CDS complement(3029162..3030199) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021450998.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 CDS complement(3030233..3031201) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456630.1 transl_table 11 codon_start 1 locus_tag LOCUS_24900 CDS complement(3031204..3032181) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456615.1 transl_table 11 codon_start 1 locus_tag LOCUS_24910 CDS complement(3032193..3033518) product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456652.1 transl_table 11 codon_start 1 locus_tag LOCUS_24920 CDS complement(3033520..3034800) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456628.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 CDS complement(3034867..3035325) product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456608.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 CDS complement(3035322..3035789) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24950 CDS complement(3035801..3037111) product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451008.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 CDS complement(3037241..3037528) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24970 CDS complement(3037545..3038993) product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456668.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 CDS complement(3039039..3039851) product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456561.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 gene cpaB CDS complement(3039888..3041201) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337061.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 CDS complement(3041204..3041779) product prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939394.1 transl_table 11 codon_start 1 locus_tag LOCUS_25010 CDS complement(3041871..3042071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25020 CDS 3042177..3042338 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25030 CDS complement(3042791..3043204) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25040 CDS complement(3043201..3044655) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25050 CDS 3045018..3045302 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25060 CDS 3045351..3047444 product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948448.1 transl_table 11 codon_start 1 locus_tag LOCUS_25070 CDS 3047419..3048786 product arylsulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404073.1 transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS 3048795..3049055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25090 CDS 3049438..3050520 product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403058.1 transl_table 11 codon_start 1 locus_tag LOCUS_25100 CDS 3051472..3051969 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS complement(3051980..3052870) product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072167.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 CDS complement(3052953..3054350) product DUF3570 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072166.1 transl_table 11 codon_start 1 locus_tag LOCUS_25130 CDS complement(3054337..3054555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS complement(3054617..3055132) product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072164.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 CDS 3055350..3055769 product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477375.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 CDS 3055973..3056659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25170 CDS complement(3056656..3059958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25180 CDS 3060245..3061306 product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482347.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 CDS complement(3061384..3062124) product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072670.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 CDS complement(3062482..3064704) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072240.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS complement(3064995..3066209) product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072239.1 transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS complement(3066462..3067838) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479020.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS complement(3068118..3070304) product OsmC domain/YcaO domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071092.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS complement(3070427..3070840) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083011.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 CDS complement(3070897..3071322) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071181.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 CDS 3071474..3072460 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105063490.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 CDS complement(3072490..3072948) product hotdog fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099189.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 CDS 3073222..3073974 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978021.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 CDS 3073952..3075472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25300 CDS complement(3075480..3075851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25310 CDS complement(3075876..3076760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25320 CDS complement(3077015..3077575) product GreA/GreB family elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261386.1 transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS complement(3077565..3077933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071848.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 CDS 3078165..3079073 product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528439.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 gene gcvA CDS 3079258..3080370 product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532533.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 gene aguA CDS 3080410..3081498 product spermidine/putrescine ABC transporter substrate-binding protein PotF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367527.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 gene potF CDS 3081619..3082500 product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464341.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 gene aguB CDS complement(3082568..3083710) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044832542.1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 CDS 3084073..3086166 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071132.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 gene fusA CDS 3086266..3086883 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262921.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 CDS complement(3086982..3087434) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25420 CDS 3087577..3087753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25430 CDS 3088020..3089657 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072257.1 transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS 3089819..3090205 product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072256.1 transl_table 11 codon_start 1 locus_tag LOCUS_25450 CDS 3090237..3090494 product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072255.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 CDS 3090534..3092264 product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072254.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 gene ptsP CDS 3092330..3092839 product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072253.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 gene crr CDS 3093573..3094517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25490 CDS complement(3094597..3094785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25500 CDS complement(3094915..3095508) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147567.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 CDS complement(3095693..3096214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25520 CDS complement(3096640..3097641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25530 CDS complement(3097806..3099314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS complement(3099274..3099456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25550 CDS complement(3099527..3099673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25560 CDS complement(3099670..3099882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS complement(3099992..3101581) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003660.1 transl_table 11 codon_start 1 locus_tag LOCUS_25580 CDS 3101621..3101983 product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925714.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 CDS 3101980..3103113 product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072438.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 gene dapE CDS 3103104..3103784 product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072439.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 CDS 3103870..3104703 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072440.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 CDS 3104977..3105588 product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072441.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 gene can CDS 3105791..3106975 product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072442.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 CDS 3107061..3108131 product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072443.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS 3108211..3108948 product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072444.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 gene kdsB CDS 3108999..3109247 product DUF2897 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072445.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 CDS complement(3109420..3112779) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25680 CDS complement(3113416..3116511) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071991.1 transl_table 11 codon_start 1 locus_tag LOCUS_25690 CDS complement(3116508..3117599) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071990.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 CDS complement(3118013..3119134) product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071989.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 gene bamC CDS complement(3119139..3120023) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071988.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 gene dapA CDS 3120260..3120799 product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071987.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 CDS 3120812..3121168 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25740 CDS 3121238..3122638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25750 CDS 3122640..3124997 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25760 CDS 3125011..3127212 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25770 CDS 3127212..3127697 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25780 CDS 3127844..3128308 product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481097.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 gene bcp CDS 3128347..3129003 product master DNA invertase Mpi family serine-type recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005818830.1 transl_table 11 codon_start 1 locus_tag LOCUS_25800 CDS complement(3129990..3131030) product IS110-like element ISPa11 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147159.1 transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS complement(3131372..3131986) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25820 CDS complement(3131988..3132353) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25830 CDS complement(3132511..3133491) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS complement(3134210..3134827) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25850 CDS complement(3135583..3136209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25860 CDS complement(3136202..3137098) product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392170.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 CDS complement(3137684..3139477) product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181735.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 CDS complement(3139480..3141696) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470932.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 CDS 3141935..3142555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS complement(3142922..3144652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS complement(3144907..3145842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25920 CDS complement(3146252..3147661) product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478369.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS complement(3147667..3148206) product transcriptional regulator VspR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001901324.1 transl_table 11 codon_start 1 locus_tag LOCUS_25940 gene vspR CDS 3148338..3148544 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463131.1 transl_table 11 codon_start 1 locus_tag LOCUS_25950 CDS 3149803..3151878 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25960 CDS complement(3152048..3152506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25970 CDS 3153190..3153933 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25980 CDS 3154082..3154351 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25990 CDS 3154647..3155273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS 3155577..3156110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26010 CDS 3156603..3157808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26020 CDS complement(3158802..3159860) product lipid A deacylase LpxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836384.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 CDS 3160155..3162023 product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263152.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 CDS complement(3162111..3162905) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26050 CDS complement(3163104..3164528) product FAD-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015456667.1 transl_table 11 codon_start 1 locus_tag LOCUS_26060 CDS complement(3165272..3165439) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26070 CDS complement(3165588..3166382) product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286816.1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS complement(3166740..3169922) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26090 CDS complement(3170025..3172697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26100 CDS complement(3173132..3173467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26110 CDS complement(3173665..3177333) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26120 CDS complement(3177349..3178734) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS 3179381..3180616 product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339021.1 transl_table 11 codon_start 1 locus_tag LOCUS_26140 gene egtB CDS 3180613..3181602 product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967207.1 transl_table 11 codon_start 1 locus_tag LOCUS_26150 gene egtD CDS 3181833..3182756 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223173767.1 transl_table 11 codon_start 1 locus_tag LOCUS_26160 CDS 3183375..3184100 product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797789.1 transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS 3184157..3184930 product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797789.1 transl_table 11 codon_start 1 locus_tag LOCUS_26180 CDS 3185385..3185672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS 3185796..3186140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26200 CDS 3186299..3186748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118826739.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 CDS complement(3187302..3187925) product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072781.1 transl_table 11 codon_start 1 locus_tag LOCUS_26220 CDS 3188069..3188977 product LysR family transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072782.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 CDS complement(3189018..3190100) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072783.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 CDS complement(3190159..3190374) product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705565.1 transl_table 11 codon_start 1 locus_tag LOCUS_26250 CDS 3190659..3192119 product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072785.1 transl_table 11 codon_start 1 locus_tag LOCUS_26260 CDS 3192276..3192626 product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072786.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 gene arsC CDS 3192636..3193007 product DUF2069 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072787.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 CDS 3193187..3195163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925887.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 CDS complement(3195263..3195973) product DnaA inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072789.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 gene hda CDS complement(3196055..3197164) product DUF2066 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072790.1 transl_table 11 codon_start 1 locus_tag LOCUS_26310 CDS 3197388..3198584 product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072791.1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 CDS complement(3198654..3199001) product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007649079.1 transl_table 11 codon_start 1 locus_tag LOCUS_26330 CDS 3199209..3199790 product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072792.1 transl_table 11 codon_start 1 locus_tag LOCUS_26340 gene sodB CDS 3200053..3201987 product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072793.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS 3202041..3203309 product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072794.1 transl_table 11 codon_start 1 locus_tag LOCUS_26360 CDS 3203318..3204847 product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072795.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 CDS complement(3204913..3205200) product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072175.1 transl_table 11 codon_start 1 locus_tag LOCUS_26380 gene rplY CDS complement(3205352..3205843) product DUF882 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072173.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 CDS complement(3206007..3207422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26400 CDS complement(3207589..3208158) product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073854.1 transl_table 11 codon_start 1 locus_tag LOCUS_26410 tRNA complement(3208473..3208558) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 tRNA complement(3208641..3208714) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 tRNA complement(3208837..3208912) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 CDS complement(3209146..3209703) product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071974.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 gene pgsA CDS complement(3209751..3211514) product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071973.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 gene uvrC CDS complement(3211640..3212284) product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071972.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 gene uvrY CDS complement(3212666..3213916) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387846.1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 CDS 3214871..3215440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26460 tRNA complement(3215819..3215909) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 CDS 3216142..3217953 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071971.1 transl_table 11 codon_start 1 locus_tag LOCUS_26470 CDS 3218022..3218537 product bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071970.1 transl_table 11 codon_start 1 locus_tag LOCUS_26480 gene fabA CDS complement(3218626..3218802) product ribosome modulation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071969.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 gene rmf CDS complement(3218979..3220886) product DUF3466 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071968.1 transl_table 11 codon_start 1 locus_tag LOCUS_26500 CDS complement(3220916..3222835) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071967.1 transl_table 11 codon_start 1 locus_tag LOCUS_26510 CDS complement(3222832..3223011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26520 CDS complement(3223067..3225202) product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071965.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 gene rlmKL tRNA 3225476..3225552 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 tRNA 3225762..3225838 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 tRNA 3225897..3225973 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 tRNA 3226019..3226095 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 tRNA 3226291..3226367 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 CDS complement(3226818..3227351) product cell division protein ZapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072541.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 CDS complement(3227518..3228537) product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072542.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 gene pyrD CDS complement(3228599..3233437) product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072543.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 CDS complement(3233705..3236020) product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072544.1 transl_table 11 codon_start 1 locus_tag LOCUS_26570 CDS complement(3236034..3237059) product YCF48-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072545.1 transl_table 11 codon_start 1 locus_tag LOCUS_26580 CDS complement(3237112..3238476) product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072546.1 transl_table 11 codon_start 1 locus_tag LOCUS_26590 CDS complement(3238495..3240555) product DUF1302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072547.1 transl_table 11 codon_start 1 locus_tag LOCUS_26600 CDS complement(3240880..3241095) product DUF2835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072548.1 transl_table 11 codon_start 1 locus_tag LOCUS_26610 CDS complement(3241174..3243738) product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072549.1 transl_table 11 codon_start 1 locus_tag LOCUS_26620 gene pepN CDS complement(3243836..3245920) product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925720.1 transl_table 11 codon_start 1 locus_tag LOCUS_26630 gene prc CDS complement(3245945..3246577) product RNA chaperone ProQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072551.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 gene proQ CDS complement(3246852..3247310) product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072552.1 transl_table 11 codon_start 1 locus_tag LOCUS_26650 CDS complement(3247329..3247613) product YebG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072553.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 CDS 3248103..3248465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26670 CDS 3248458..3249090 product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072555.1 transl_table 11 codon_start 1 locus_tag LOCUS_26680 CDS 3249077..3251701 product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072556.1 transl_table 11 codon_start 1 locus_tag LOCUS_26690 CDS 3251852..3252877 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072229.1 transl_table 11 codon_start 1 locus_tag LOCUS_26700 CDS complement(3252894..3253430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26710 CDS complement(3253487..3255628) product marine proteobacterial sortase target protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072227.1 transl_table 11 codon_start 1 locus_tag LOCUS_26720 CDS complement(3255657..3256394) product sortase-associated OmpA-like protein PdsO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072226.1 transl_table 11 codon_start 1 locus_tag LOCUS_26730 gene pdsO CDS 3256679..3257377 product proteobacterial dedicated sortase system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072225.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 gene pdsR CDS 3257734..3259836 product proteobacterial dedicated sortase system histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072224.1 transl_table 11 codon_start 1 locus_tag LOCUS_26750 gene pdsS CDS 3259922..3261145 product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072223.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 CDS complement(3261227..3261871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26770 CDS 3262146..3263324 product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994167.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 CDS complement(3263389..3264141) product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072570.1 transl_table 11 codon_start 1 locus_tag LOCUS_26790 CDS 3264406..3264777 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26800 CDS complement(3264853..3265329) product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072571.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 CDS 3265385..3266095 product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072572.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 gene aat CDS 3266085..3266798 product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072573.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 CDS 3266937..3267155 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006081934.1 transl_table 11 codon_start 1 locus_tag LOCUS_26840 gene infA CDS complement(3267260..3269518) product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072574.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 gene clpA CDS complement(3269557..3269865) product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072575.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 gene clpS CDS 3270111..3270317 product cold shock domain-containing protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072576.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 gene cspD CDS complement(3270423..3272645) product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072577.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 CDS 3273030..3273749 product rRNA large subunit pseudouridine synthase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925722.1 transl_table 11 codon_start 1 locus_tag LOCUS_26890 CDS 3273785..3274261 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072579.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 CDS 3274399..3275517 product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072580.1 transl_table 11 codon_start 1 locus_tag LOCUS_26910 gene mnmA CDS 3275548..3276135 product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072581.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 gene hflD CDS 3276163..3277533 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072582.1 transl_table 11 codon_start 1 locus_tag LOCUS_26930 gene purB CDS 3277620..3278744 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072583.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 CDS complement(3278900..3279343) product DUF4826 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072584.1 transl_table 11 codon_start 1 locus_tag LOCUS_26950 CDS 3279598..3280629 product Glu/Leu/Phe/Val dehydrogenase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072585.1 transl_table 11 codon_start 1 locus_tag LOCUS_26960 CDS 3280837..3281181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072586.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 CDS complement(3281263..3281676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26980 CDS complement(3281722..3282141) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072587.1 transl_table 11 codon_start 1 locus_tag LOCUS_26990 CDS complement(3282251..3282763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27000 CDS complement(3282845..3285898) product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072589.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 CDS complement(3286016..3288385) product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072590.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 gene ppsA CDS 3288512..3289324 product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072591.1 transl_table 11 codon_start 1 locus_tag LOCUS_27030 CDS 3289490..3290551 product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072592.1 transl_table 11 codon_start 1 locus_tag LOCUS_27040 CDS complement(3290599..3292077) product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795828.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 CDS complement(3292195..3294288) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966626.1 transl_table 11 codon_start 1 locus_tag LOCUS_27060 CDS 3294521..3295024 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072593.1 transl_table 11 codon_start 1 locus_tag LOCUS_27070 CDS 3295267..3295926 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072594.1 transl_table 11 codon_start 1 locus_tag LOCUS_27080 CDS complement(3295997..3297424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27090 CDS complement(3297424..3300711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS 3300980..3302644 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454192.1 transl_table 11 codon_start 1 locus_tag LOCUS_27110 CDS 3302647..3303861 product EAL domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029301722.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 CDS complement(3303875..3305164) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072125.1 transl_table 11 codon_start 1 locus_tag LOCUS_27130 CDS complement(3305483..3306106) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018313.1 transl_table 11 codon_start 1 locus_tag LOCUS_27140 CDS complement(3306263..3309685) product PAS-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072681.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 CDS 3309863..3311815 product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072682.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 gene acs CDS 3311940..3313682 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072683.1 transl_table 11 codon_start 1 locus_tag LOCUS_27170 CDS 3313807..3315435 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709077.1 transl_table 11 codon_start 1 locus_tag LOCUS_27180 CDS complement(3316218..3316883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27190 CDS complement(3316880..3317182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27200 CDS complement(3317179..3317541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27210 CDS complement(3317538..3317810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27220 CDS complement(3317813..3318094) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27230 CDS 3318465..3319016 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162012.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 CDS complement(3319632..3320243) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27250 CDS complement(3320284..3321354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27260 CDS complement(3321351..3322817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27270 CDS complement(3322798..3322959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27280 CDS complement(3322959..3323117) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27290 CDS 3323557..3324186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27300 CDS 3324509..3324778 product GrxA family glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072684.1 transl_table 11 codon_start 1 locus_tag LOCUS_27310 CDS complement(3324906..3326048) product DcaP family trimeric outer membrane transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042595882.1 transl_table 11 codon_start 1 locus_tag LOCUS_27320 tRNA complement(3326928..3327003) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 tRNA complement(3327194..3327269) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 tRNA complement(3327331..3327406) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 tRNA complement(3327524..3327599) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 tRNA complement(3327790..3327865) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00560 tRNA complement(3328076..3328151) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00570 tRNA complement(3328213..3328288) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00580 tRNA complement(3328542..3328617) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00590 CDS complement(3328644..3328856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27330 CDS complement(3328897..3329625) product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072685.1 transl_table 11 codon_start 1 locus_tag LOCUS_27340 gene ybgF CDS complement(3329645..3330187) product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072686.1 transl_table 11 codon_start 1 locus_tag LOCUS_27350 gene pal CDS complement(3330222..3331550) product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072687.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 gene tolB CDS complement(3331561..3332520) product cell envelope integrity protein TolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072688.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 gene tolA CDS complement(3332524..3332958) product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072689.1 transl_table 11 codon_start 1 locus_tag LOCUS_27380 gene tolR CDS complement(3332958..3333650) product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072690.1 transl_table 11 codon_start 1 locus_tag LOCUS_27390 gene tolQ CDS complement(3333637..3334035) product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072691.1 transl_table 11 codon_start 1 locus_tag LOCUS_27400 gene ybgC CDS complement(3334204..3336354) product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072692.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 CDS complement(3336968..3337837) product flagellar protein MotY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072693.1 transl_table 11 codon_start 1 locus_tag LOCUS_27420 gene motY CDS 3337979..3338650 product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072694.1 transl_table 11 codon_start 1 locus_tag LOCUS_27430 gene rnt CDS complement(3338774..3339379) product peroxiredoxin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072695.1 transl_table 11 codon_start 1 locus_tag LOCUS_27440 CDS 3339690..3341009 product Na+/H+ antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072696.1 transl_table 11 codon_start 1 locus_tag LOCUS_27450 CDS complement(3341123..3341749) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072698.1 transl_table 11 codon_start 1 locus_tag LOCUS_27460 gene upp CDS 3341963..3343000 product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072699.1 transl_table 11 codon_start 1 locus_tag LOCUS_27470 gene purM CDS 3343000..3343644 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072700.1 transl_table 11 codon_start 1 locus_tag LOCUS_27480 gene purN CDS 3343923..3344210 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27490 CDS 3344305..3345309 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478719.1 transl_table 11 codon_start 1 locus_tag LOCUS_27500 CDS 3345486..3346346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27510 CDS complement(3347029..3347301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27520 CDS 3347819..3350062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27530 CDS 3350431..3350835 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114423.1 transl_table 11 codon_start 1 locus_tag LOCUS_27540 CDS complement(3350853..3351416) product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947704.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 CDS 3351578..3352138 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262231.1 transl_table 11 codon_start 1 locus_tag LOCUS_27560 CDS complement(3352172..3353875) product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118364.1 transl_table 11 codon_start 1 locus_tag LOCUS_27570 CDS complement(3353859..3354197) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27580 CDS complement(3354208..3355701) product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921413.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 CDS complement(3355698..3357188) product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328227.1 transl_table 11 codon_start 1 locus_tag LOCUS_27600 CDS complement(3357188..3357580) product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 transl_table 11 codon_start 1 locus_tag LOCUS_27610 CDS complement(3357613..3358587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27620 CDS complement(3358599..3358973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27630 CDS complement(3358963..3359259) product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389330.1 transl_table 11 codon_start 1 locus_tag LOCUS_27640 CDS complement(3359256..3359639) product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335817.1 transl_table 11 codon_start 1 locus_tag LOCUS_27650 CDS 3360072..3360926 product universal stress protein UspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005656626.1 transl_table 11 codon_start 1 locus_tag LOCUS_27660 gene uspE CDS complement(3360928..3361446) product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307862.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 CDS 3361611..3362987 product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371412.1 transl_table 11 codon_start 1 locus_tag LOCUS_27680 CDS 3363195..3363476 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27690 CDS 3363477..3364031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27700 CDS 3364453..3365721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27710 CDS 3365740..3366528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27720 CDS 3366811..3367557 product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072701.1 transl_table 11 codon_start 1 locus_tag LOCUS_27730 CDS 3367706..3369400 product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072703.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 CDS 3369849..3371525 product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072704.1 transl_table 11 codon_start 1 locus_tag LOCUS_27750 gene asnB CDS complement(3371741..3372091) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072726.1 transl_table 11 codon_start 1 locus_tag LOCUS_27760 CDS complement(3372204..3372911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072727.1 transl_table 11 codon_start 1 locus_tag LOCUS_27770 CDS complement(3373068..3373460) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27780 CDS 3373698..3374090 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072728.1 transl_table 11 codon_start 1 locus_tag LOCUS_27790 CDS complement(3374107..3375123) product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040092.1 transl_table 11 codon_start 1 locus_tag LOCUS_27800 CDS 3375294..3378392 product DUF748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072729.1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 CDS 3378462..3378818 product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072730.1 transl_table 11 codon_start 1 locus_tag LOCUS_27820 CDS 3378992..3379438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072732.1 transl_table 11 codon_start 1 locus_tag LOCUS_27830 CDS 3379649..3379879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27840 CDS complement(3379969..3381501) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072019.1 transl_table 11 codon_start 1 locus_tag LOCUS_27850 CDS complement(3381558..3382397) product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418550.1 transl_table 11 codon_start 1 locus_tag LOCUS_27860 CDS 3382643..3383182 product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072219.1 transl_table 11 codon_start 1 locus_tag LOCUS_27870 CDS 3383209..3383784 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072218.1 transl_table 11 codon_start 1 locus_tag LOCUS_27880 CDS complement(3383970..3386072) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263087.1 transl_table 11 codon_start 1 locus_tag LOCUS_27890 CDS 3386222..3387037 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27900 CDS 3387399..3389702 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925601.1 transl_table 11 codon_start 1 locus_tag LOCUS_27910 CDS complement(3389723..3390520) product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925869.1 transl_table 11 codon_start 1 locus_tag LOCUS_27920 CDS complement(3390702..3391583) product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072215.1 transl_table 11 codon_start 1 locus_tag LOCUS_27930 CDS complement(3392438..3393469) product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072213.1 transl_table 11 codon_start 1 locus_tag LOCUS_27940 gene yejK CDS 3393795..3394010 product YejL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072212.1 transl_table 11 codon_start 1 locus_tag LOCUS_27950 CDS 3394113..3395900 product DUF3413 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072211.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 tRNA 3396189..3396265 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00600 CDS complement(3396381..3396605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27970 CDS 3396963..3397541 product elongation factor P-like protein YeiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261881.1 transl_table 11 codon_start 1 locus_tag LOCUS_27980 gene yeiP CDS complement(3397606..3397854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27990 CDS complement(3397925..3398080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28000 CDS 3398479..3400671 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28010 CDS complement(3400694..3402157) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072107.1 transl_table 11 codon_start 1 locus_tag LOCUS_28020 CDS 3402328..3402804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072106.1 transl_table 11 codon_start 1 locus_tag LOCUS_28030 CDS complement(3402806..3403636) product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072105.1 transl_table 11 codon_start 1 locus_tag LOCUS_28040 gene nadE CDS 3403822..3404646 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071070.1 transl_table 11 codon_start 1 locus_tag LOCUS_28050 CDS 3404771..3405436 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071069.1 transl_table 11 codon_start 1 locus_tag LOCUS_28060 CDS complement(3405507..3406358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074288.1 transl_table 11 codon_start 1 locus_tag LOCUS_28070 CDS complement(3406478..3407752) product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870202.1 transl_table 11 codon_start 1 locus_tag LOCUS_28080 gene mgtE CDS complement(3408557..3409909) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 transl_table 11 codon_start 1 locus_tag LOCUS_28090 CDS complement(3409906..3411525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28100 CDS 3411886..3412716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28110 CDS 3412863..3413207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072044.1 transl_table 11 codon_start 1 locus_tag LOCUS_28120 CDS complement(3413254..3414654) product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707871.1 transl_table 11 codon_start 1 locus_tag LOCUS_28130 gene phnE CDS complement(3414824..3415522) product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125172.1 transl_table 11 codon_start 1 locus_tag LOCUS_28140 CDS complement(3415540..3416394) product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125171.1 transl_table 11 codon_start 1 locus_tag LOCUS_28150 CDS 3416623..3417297 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072043.1 transl_table 11 codon_start 1 locus_tag LOCUS_28160 CDS 3417288..3418655 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072042.1 transl_table 11 codon_start 1 locus_tag LOCUS_28170 CDS complement(3418726..3419421) product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072041.1 transl_table 11 codon_start 1 locus_tag LOCUS_28180 CDS 3419574..3420836 product DUF3391 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072040.1 transl_table 11 codon_start 1 locus_tag LOCUS_28190 CDS 3420946..3421275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28200 CDS complement(3421270..3422217) product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072039.1 transl_table 11 codon_start 1 locus_tag LOCUS_28210 gene corA CDS complement(3422342..3422713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28220 CDS 3422921..3423607 product DUF2057 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073395.1 transl_table 11 codon_start 1 locus_tag LOCUS_28230 rRNA complement(3424359..3424461) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00200 rRNA complement(3424618..3427519) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00210 tRNA complement(3427951..3428026) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00610 tRNA complement(3428163..3428239) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00620 rRNA complement(3428438..3429980) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00220 CDS complement(3430920..3431471) product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072769.1 transl_table 11 codon_start 1 locus_tag LOCUS_28240 gene gmhB CDS 3431693..3433030 product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 transl_table 11 codon_start 1 locus_tag LOCUS_28250 gene pepP CDS complement(3433322..3433735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28260 CDS complement(3434562..3435539) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071719.1 transl_table 11 codon_start 1 locus_tag LOCUS_28270 CDS complement(3436115..3437086) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28280 CDS complement(3437959..3439239) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480719.1 transl_table 11 codon_start 1 locus_tag LOCUS_28290 CDS complement(3439330..3440370) product proline racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258816.1 transl_table 11 codon_start 1 locus_tag LOCUS_28300 CDS 3440573..3441487 product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454899.1 transl_table 11 codon_start 1 locus_tag LOCUS_28310 CDS 3441587..3442588 product 4-hydroxyproline epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480619.1 transl_table 11 codon_start 1 locus_tag LOCUS_28320 CDS 3442652..3444217 product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731065.1 transl_table 11 codon_start 1 locus_tag LOCUS_28330 CDS 3444336..3445007 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072770.1 transl_table 11 codon_start 1 locus_tag LOCUS_28340 CDS 3445107..3446171 product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072771.1 transl_table 11 codon_start 1 locus_tag LOCUS_28350 CDS complement(3446375..3446554) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28360 CDS complement(3446995..3449025) product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072366.1 transl_table 11 codon_start 1 locus_tag LOCUS_28370 CDS complement(3449288..3450688) product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073523.1 transl_table 11 codon_start 1 locus_tag LOCUS_28380 gene pntB CDS complement(3450703..3452247) product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705256.1 transl_table 11 codon_start 1 locus_tag LOCUS_28390 gene pntA CDS complement(3452707..3453285) product lecithin retinol acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072772.1 transl_table 11 codon_start 1 locus_tag LOCUS_28400 CDS complement(3453429..3454112) product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072773.1 transl_table 11 codon_start 1 locus_tag LOCUS_28410 repeat_region 3454156..3454498 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq catcatgaaccaccttaaaa CDS complement(3454438..3456309) product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072774.1 transl_table 11 codon_start 1 locus_tag LOCUS_28420 CDS complement(3456404..3457258) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28430 CDS complement(3457362..3460784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28440 CDS complement(3461094..3462875) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074412.1 transl_table 11 codon_start 1 locus_tag LOCUS_28450 CDS complement(3463242..3464960) product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072775.1 transl_table 11 codon_start 1 locus_tag LOCUS_28460 CDS complement(3464990..3465256) product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072776.1 transl_table 11 codon_start 1 locus_tag LOCUS_28470 CDS 3465820..3467538 product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946763.1 transl_table 11 codon_start 1 locus_tag LOCUS_28480 CDS complement(3467725..3468996) product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477556.1 transl_table 11 codon_start 1 locus_tag LOCUS_28490 CDS complement(3468996..3470720) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262013.1 transl_table 11 codon_start 1 locus_tag LOCUS_28500 CDS complement(3470720..3471886) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262014.1 transl_table 11 codon_start 1 locus_tag LOCUS_28510 CDS complement(3471883..3472503) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28520 CDS complement(3472500..3473501) product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477595.1 transl_table 11 codon_start 1 locus_tag LOCUS_28530 CDS complement(3473506..3474498) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263719.1 transl_table 11 codon_start 1 locus_tag LOCUS_28540 CDS complement(3474713..3477823) product efflux RND transporter permease subunit VexK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625968.1 transl_table 11 codon_start 1 locus_tag LOCUS_28550 gene vexK CDS complement(3477823..3478806) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261804.1 transl_table 11 codon_start 1 locus_tag LOCUS_28560 CDS 3478820..3478975 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28570 CDS 3479632..3480570 product lipid kinase YegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477542.1 transl_table 11 codon_start 1 locus_tag LOCUS_28580 gene yegS CDS complement(3480691..3482160) product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479783.1 transl_table 11 codon_start 1 locus_tag LOCUS_28590 CDS complement(3482162..3485248) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479778.1 transl_table 11 codon_start 1 locus_tag LOCUS_28600 CDS complement(3485254..3486357) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479920.1 transl_table 11 codon_start 1 locus_tag LOCUS_28610 CDS complement(3486448..3487317) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479816.1 transl_table 11 codon_start 1 locus_tag LOCUS_28620 CDS complement(3487556..3488794) product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263662.1 transl_table 11 codon_start 1 locus_tag LOCUS_28630 CDS complement(3488989..3489759) product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262010.1 transl_table 11 codon_start 1 locus_tag LOCUS_28640 CDS complement(3489849..3491402) product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262022.1 transl_table 11 codon_start 1 locus_tag LOCUS_28650 CDS 3491835..3493037 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28660 CDS 3493030..3493623 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805069.1 transl_table 11 codon_start 1 locus_tag LOCUS_28670 CDS 3493721..3495964 product multiheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105063035.1 transl_table 11 codon_start 1 locus_tag LOCUS_28680 CDS 3496081..3496863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263663.1 transl_table 11 codon_start 1 locus_tag LOCUS_28690 CDS complement(3496840..3497037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28700 CDS 3497260..3498528 product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477554.1 transl_table 11 codon_start 1 locus_tag LOCUS_28710 CDS complement(3498627..3499247) product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072777.1 transl_table 11 codon_start 1 locus_tag LOCUS_28720 CDS complement(3499351..3500214) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072778.1 transl_table 11 codon_start 1 locus_tag LOCUS_28730 CDS complement(3500322..3501569) product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072779.1 transl_table 11 codon_start 1 locus_tag LOCUS_28740 CDS complement(3502222..3502734) product DUF2919 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072780.1 transl_table 11 codon_start 1 locus_tag LOCUS_28750 CDS 3503583..3504797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28760 CDS 3504787..3505296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28770 CDS 3505297..3507300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28780 CDS complement(3507432..3509399) product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965961.1 transl_table 11 codon_start 1 locus_tag LOCUS_28790 gene ligA CDS complement(3509483..3510577) product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072806.1 transl_table 11 codon_start 1 locus_tag LOCUS_28800 gene zipA CDS complement(3510600..3514010) product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072807.1 transl_table 11 codon_start 1 locus_tag LOCUS_28810 gene smc CDS 3514207..3514998 product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072808.1 transl_table 11 codon_start 1 locus_tag LOCUS_28820 gene cysZ CDS 3515661..3516710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28830 CDS complement(3516952..3517932) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070523.1 transl_table 11 codon_start 1 locus_tag LOCUS_28840 CDS complement(3518075..3518773) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28850 CDS 3518975..3521350 product DUF5916 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925729.1 transl_table 11 codon_start 1 locus_tag LOCUS_28860 CDS complement(3521755..3522993) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387846.1 transl_table 11 codon_start 1 locus_tag LOCUS_28870 CDS complement(3523216..3524475) product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072811.1 transl_table 11 codon_start 1 locus_tag LOCUS_28880 CDS 3524745..3525713 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072812.1 transl_table 11 codon_start 1 locus_tag LOCUS_28890 gene cysK CDS complement(3525771..3526466) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266953.1 transl_table 11 codon_start 1 locus_tag LOCUS_28900 CDS 3526746..3527177 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461138.1 transl_table 11 codon_start 1 locus_tag LOCUS_28910 CDS 3527344..3527715 product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071286.1 transl_table 11 codon_start 1 locus_tag LOCUS_28920 CDS 3527715..3528371 product NADH-quinone oxidoreductase subunit NuoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386732.1 transl_table 11 codon_start 1 locus_tag LOCUS_28930 gene nuoB CDS 3528374..3530161 product NADH-quinone oxidoreductase subunit C/D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619059.1 transl_table 11 codon_start 1 locus_tag LOCUS_28940 gene nuoC CDS 3530171..3530893 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28950 CDS 3530890..3532230 product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789507.1 transl_table 11 codon_start 1 locus_tag LOCUS_28960 gene nuoF CDS 3532227..3535115 product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705662.1 transl_table 11 codon_start 1 locus_tag LOCUS_28970 gene nuoG CDS 3535112..3536065 product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071280.1 transl_table 11 codon_start 1 locus_tag LOCUS_28980 gene nuoH CDS 3536080..3536595 product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705660.1 transl_table 11 codon_start 1 locus_tag LOCUS_28990 gene nuoI CDS 3536592..3537233 product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317979.1 transl_table 11 codon_start 1 locus_tag LOCUS_29000 gene nuoJ CDS 3537230..3537532 product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210271.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 gene nuoK CDS 3537534..3539426 product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405115.1 transl_table 11 codon_start 1 locus_tag LOCUS_29020 gene nuoL CDS 3539423..3541000 product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619067.1 transl_table 11 codon_start 1 locus_tag LOCUS_29030 gene nuoM CDS 3540997..3542466 product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104515.1 transl_table 11 codon_start 1 locus_tag LOCUS_29040 gene nuoN CDS 3542635..3543711 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072813.1 transl_table 11 codon_start 1 locus_tag LOCUS_29050 CDS 3543828..3544802 product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072814.1 transl_table 11 codon_start 1 locus_tag LOCUS_29060 CDS 3545491..3548109 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458992.1 transl_table 11 codon_start 1 locus_tag LOCUS_29070 CDS complement(3548207..3549757) product putative basic amino acid antiporter YfcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480236.1 transl_table 11 codon_start 1 locus_tag LOCUS_29080 gene yfcC CDS complement(3549856..3550035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29090 CDS 3550558..3551436 product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211331.1 transl_table 11 codon_start 1 locus_tag LOCUS_29100 gene focA CDS 3551473..3553755 product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072817.1 transl_table 11 codon_start 1 locus_tag LOCUS_29110 gene pflB CDS 3553858..3554598 product pyruvate formate lyase 1-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072818.1 transl_table 11 codon_start 1 locus_tag LOCUS_29120 gene pflA CDS complement(3554630..3555073) product terminus macrodomain insulation protein YfbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072819.1 transl_table 11 codon_start 1 locus_tag LOCUS_29130 gene yfbV CDS 3555267..3556463 product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072820.1 transl_table 11 codon_start 1 locus_tag LOCUS_29140 gene ackA CDS 3556590..3558722 product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072821.1 transl_table 11 codon_start 1 locus_tag LOCUS_29150 gene pta CDS 3559195..3559617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072822.1 transl_table 11 codon_start 1 locus_tag LOCUS_29160 CDS 3560192..3560416 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073826.1 transl_table 11 codon_start 1 locus_tag LOCUS_29170 CDS complement(3560530..3561516) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072824.1 transl_table 11 codon_start 1 locus_tag LOCUS_29180 CDS complement(3561538..3562614) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072825.1 transl_table 11 codon_start 1 locus_tag LOCUS_29190 CDS 3562709..3563083 product dihydroneopterin triphosphate 2'-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072826.1 transl_table 11 codon_start 1 locus_tag LOCUS_29200 gene folX CDS 3563266..3564189 product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072827.1 transl_table 11 codon_start 1 locus_tag LOCUS_29210 CDS complement(3564186..3566636) product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072830.1 transl_table 11 codon_start 1 locus_tag LOCUS_29220 CDS complement(3566636..3567385) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072831.1 transl_table 11 codon_start 1 locus_tag LOCUS_29230 CDS 3567447..3568016 product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072832.1 transl_table 11 codon_start 1 locus_tag LOCUS_29240 CDS 3568211..3569329 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29250 CDS 3569860..3571656 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29260 CDS 3572027..3574672 product SO2930 family diheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072834.1 transl_table 11 codon_start 1 locus_tag LOCUS_29270 CDS 3574976..3575974 product SO2930 family diheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072835.1 transl_table 11 codon_start 1 locus_tag LOCUS_29280 CDS complement(3576034..3577059) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072836.1 transl_table 11 codon_start 1 locus_tag LOCUS_29290 CDS complement(3577248..3579863) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072403.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 CDS complement(3580741..3581172) product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072285.1 transl_table 11 codon_start 1 locus_tag LOCUS_29310 gene ndk CDS complement(3581364..3581561) product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460231.1 transl_table 11 codon_start 1 locus_tag LOCUS_29320 gene iscX CDS complement(3581684..3582022) product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072281.1 transl_table 11 codon_start 1 locus_tag LOCUS_29330 gene fdx CDS complement(3582042..3583904) product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072280.1 transl_table 11 codon_start 1 locus_tag LOCUS_29340 gene hscA CDS complement(3583985..3584509) product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072279.1 transl_table 11 codon_start 1 locus_tag LOCUS_29350 gene hscB CDS complement(3584529..3584852) product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072278.1 transl_table 11 codon_start 1 locus_tag LOCUS_29360 gene iscA CDS complement(3584867..3585250) product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072277.1 transl_table 11 codon_start 1 locus_tag LOCUS_29370 gene iscU CDS complement(3585290..3586504) product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072276.1 transl_table 11 codon_start 1 locus_tag LOCUS_29380 CDS complement(3586580..3587083) product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072275.1 transl_table 11 codon_start 1 locus_tag LOCUS_29390 gene iscR CDS complement(3587236..3588057) product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072274.1 transl_table 11 codon_start 1 locus_tag LOCUS_29400 gene cysE CDS complement(3588072..3588836) product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072273.1 transl_table 11 codon_start 1 locus_tag LOCUS_29410 gene trmJ CDS 3588993..3589796 product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072272.1 transl_table 11 codon_start 1 locus_tag LOCUS_29420 gene suhB CDS 3590007..3590405 product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072739.1 transl_table 11 codon_start 1 locus_tag LOCUS_29430 CDS 3590557..3590859 product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072740.1 transl_table 11 codon_start 1 locus_tag LOCUS_29440 CDS 3590972..3591640 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072741.1 transl_table 11 codon_start 1 locus_tag LOCUS_29450 CDS 3591627..3591974 product replication protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072742.1 transl_table 11 codon_start 1 locus_tag LOCUS_29460 CDS complement(3592075..3592338) product YecH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349130.1 transl_table 11 codon_start 1 locus_tag LOCUS_29470 CDS 3592647..3594167 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072746.1 transl_table 11 codon_start 1 locus_tag LOCUS_29480 CDS 3594164..3594874 product two-component system response regulator BtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072747.1 transl_table 11 codon_start 1 locus_tag LOCUS_29490 gene btsR CDS 3595036..3596493 product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477897.1 transl_table 11 codon_start 1 locus_tag LOCUS_29500 CDS complement(3596569..3597108) product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073003.1 transl_table 11 codon_start 1 locus_tag LOCUS_29510 CDS complement(3597228..3598139) product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073004.1 transl_table 11 codon_start 1 locus_tag LOCUS_29520 CDS complement(3598276..3598593) product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073005.1 transl_table 11 codon_start 1 locus_tag LOCUS_29530 CDS complement(3599292..3600239) product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073006.1 transl_table 11 codon_start 1 locus_tag LOCUS_29540 gene secF CDS complement(3600252..3602069) product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073007.1 transl_table 11 codon_start 1 locus_tag LOCUS_29550 gene secD CDS complement(3602121..3602447) product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073008.1 transl_table 11 codon_start 1 locus_tag LOCUS_29560 gene yajC CDS complement(3602480..3603604) product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073009.1 transl_table 11 codon_start 1 locus_tag LOCUS_29570 gene tgt CDS complement(3603820..3604857) product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073010.1 transl_table 11 codon_start 1 locus_tag LOCUS_29580 gene queA CDS complement(3604922..3605083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073011.1 transl_table 11 codon_start 1 locus_tag LOCUS_29590 CDS 3605222..3605836 product acyl carrier protein phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073012.1 transl_table 11 codon_start 1 locus_tag LOCUS_29600 CDS 3605930..3606595 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073014.1 transl_table 11 codon_start 1 locus_tag LOCUS_29610 CDS complement(3606658..3607059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073015.1 transl_table 11 codon_start 1 locus_tag LOCUS_29620 CDS complement(3607284..3608513) product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073018.1 transl_table 11 codon_start 1 locus_tag LOCUS_29630 gene sstT CDS complement(3608708..3609604) product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073019.1 transl_table 11 codon_start 1 locus_tag LOCUS_29640 CDS complement(3609713..3611236) product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479787.1 transl_table 11 codon_start 1 locus_tag LOCUS_29650 CDS complement(3611539..3612009) product dual specificity protein phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073020.1 transl_table 11 codon_start 1 locus_tag LOCUS_29660 CDS complement(3612117..3613412) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073021.1 transl_table 11 codon_start 1 locus_tag LOCUS_29670 CDS complement(3613566..3614123) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073022.1 transl_table 11 codon_start 1 locus_tag LOCUS_29680 CDS complement(3614120..3615349) product AlkA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073023.1 transl_table 11 codon_start 1 locus_tag LOCUS_29690 CDS 3615822..3617651 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073024.1 transl_table 11 codon_start 1 locus_tag LOCUS_29700 tRNA complement(3618212..3618287) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00630 tRNA complement(3618326..3618401) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00640 tRNA complement(3618504..3618579) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00650 tRNA complement(3618732..3618807) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00660 tRNA complement(3618958..3619033) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00670 tRNA complement(3619184..3619259) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00680 tRNA complement(3619512..3619587) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00690 tRNA complement(3619740..3619815) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00700 tRNA complement(3619966..3620041) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00710 tRNA complement(3620294..3620369) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00720 tRNA complement(3620472..3620547) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00730 tRNA complement(3620902..3620977) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00740 CDS complement(3621090..3622499) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073025.1 transl_table 11 codon_start 1 locus_tag LOCUS_29710 gene gltX tRNA 3622928..3623003 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00750 tRNA 3623051..3623126 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00760 tRNA 3623175..3623250 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00770 tRNA 3623299..3623374 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00780 tRNA 3623423..3623498 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00790 tRNA 3623547..3623622 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00800 CDS 3623821..3624048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073026.1 transl_table 11 codon_start 1 locus_tag LOCUS_29720 CDS 3624148..3625425 product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816831.1 transl_table 11 codon_start 1 locus_tag LOCUS_29730 CDS complement(3625488..3626726) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072018.1 transl_table 11 codon_start 1 locus_tag LOCUS_29740 CDS 3626830..3627717 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072017.1 transl_table 11 codon_start 1 locus_tag LOCUS_29750 CDS complement(3627766..3628422) product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071821.1 transl_table 11 codon_start 1 locus_tag LOCUS_29760 gene maiA CDS complement(3628552..3629538) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071820.1 transl_table 11 codon_start 1 locus_tag LOCUS_29770 CDS complement(3629780..3631318) product transcriptional regulator TyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071819.1 transl_table 11 codon_start 1 locus_tag LOCUS_29780 gene tyrR CDS complement(3631545..3631883) product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071818.1 transl_table 11 codon_start 1 locus_tag LOCUS_29790 CDS complement(3632005..3632850) product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071817.1 transl_table 11 codon_start 1 locus_tag LOCUS_29800 gene phhA CDS 3633165..3634085 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071816.1 transl_table 11 codon_start 1 locus_tag LOCUS_29810 gene galU CDS 3634085..3635098 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071815.1 transl_table 11 codon_start 1 locus_tag LOCUS_29820 gene galE CDS 3635211..3635693 product ferredoxin-type protein NapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071814.1 transl_table 11 codon_start 1 locus_tag LOCUS_29830 gene napF CDS 3635820..3636239 product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071813.1 transl_table 11 codon_start 1 locus_tag LOCUS_29840 CDS complement(3636324..3636992) product DUF2982 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071810.1 transl_table 11 codon_start 1 locus_tag LOCUS_29850 CDS complement(3637269..3638009) product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071809.1 transl_table 11 codon_start 1 locus_tag LOCUS_29860 CDS complement(3638087..3638977) product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071808.1 transl_table 11 codon_start 1 locus_tag LOCUS_29870 gene mak CDS complement(3639282..3641870) product exo 1,3/1,4-beta-D-glucan glucohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919915.1 transl_table 11 codon_start 1 locus_tag LOCUS_29880 CDS complement(3641867..3643210) product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036694.1 transl_table 11 codon_start 1 locus_tag LOCUS_29890 gene fucP CDS complement(3643286..3643444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29900 CDS 3643513..3644856 product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584145.1 transl_table 11 codon_start 1 locus_tag LOCUS_29910 CDS 3644948..3646444 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245259.1 transl_table 11 codon_start 1 locus_tag LOCUS_29920 CDS 3646760..3647758 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263241.1 transl_table 11 codon_start 1 locus_tag LOCUS_29930 CDS 3648339..3651308 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275312.1 transl_table 11 codon_start 1 locus_tag LOCUS_29940 CDS 3651468..3653012 product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073349.1 transl_table 11 codon_start 1 locus_tag LOCUS_29950 CDS 3653061..3654563 product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918886.1 transl_table 11 codon_start 1 locus_tag LOCUS_29960 CDS 3654827..3656293 product capsule assembly Wzi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074275.1 transl_table 11 codon_start 1 locus_tag LOCUS_29970 CDS complement(3656352..3657095) product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071805.1 transl_table 11 codon_start 1 locus_tag LOCUS_29980 CDS complement(3657230..3658777) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261589.1 transl_table 11 codon_start 1 locus_tag LOCUS_29990 CDS complement(3658914..3662483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30000 CDS complement(3662502..3663380) product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268833.1 transl_table 11 codon_start 1 locus_tag LOCUS_30010 CDS 3663708..3665012 product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139992.1 transl_table 11 codon_start 1 locus_tag LOCUS_30020 CDS 3665124..3665516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30030 CDS 3665920..3666261 product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460961.1 transl_table 11 codon_start 1 locus_tag LOCUS_30040 CDS 3666324..3667586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30050 CDS 3667605..3669011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30060 CDS 3669033..3670334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30070 CDS 3670622..3672121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30080 CDS 3672111..3673154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30090 CDS 3673433..3675505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30100 CDS 3675564..3677009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30110 CDS 3677090..3677503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30120 CDS 3677519..3678739 product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107919.1 transl_table 11 codon_start 1 locus_tag LOCUS_30130 CDS 3679095..3679580 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269184.1 transl_table 11 codon_start 1 locus_tag LOCUS_30140 CDS complement(3679805..3680764) product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261054.1 transl_table 11 codon_start 1 locus_tag LOCUS_30150 CDS complement(3680908..3681549) product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019083931.1 transl_table 11 codon_start 1 locus_tag LOCUS_30160 gene cysC CDS complement(3681690..3683417) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707307.1 transl_table 11 codon_start 1 locus_tag LOCUS_30170 CDS complement(3683636..3685042) product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021169.1 transl_table 11 codon_start 1 locus_tag LOCUS_30180 gene cysN CDS complement(3685124..3685477) product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261019.1 transl_table 11 codon_start 1 locus_tag LOCUS_30190 CDS complement(3685665..3686570) product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417374.1 transl_table 11 codon_start 1 locus_tag LOCUS_30200 gene cysD CDS 3687351..3687806 product type II toxin-antitoxin system antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073052.1 transl_table 11 codon_start 1 locus_tag LOCUS_30210 CDS 3687873..3688274 product type II toxin-antitoxin system toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073053.1 transl_table 11 codon_start 1 locus_tag LOCUS_30220 CDS complement(3688780..3689337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30230 CDS complement(3689503..3689811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30240 CDS 3689875..3690075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30250 CDS 3690273..3691343 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226625.1 transl_table 11 codon_start 1 locus_tag LOCUS_30260 gene rffG CDS 3691340..3692215 product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815331.1 transl_table 11 codon_start 1 locus_tag LOCUS_30270 gene rfbA CDS complement(3692295..3693182) product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693178.1 transl_table 11 codon_start 1 locus_tag LOCUS_30280 gene galU CDS complement(3693274..3694440) product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467215.1 transl_table 11 codon_start 1 locus_tag LOCUS_30290 CDS complement(3694459..3696366) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269419.1 transl_table 11 codon_start 1 locus_tag LOCUS_30300 CDS complement(3696369..3697124) product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000564500.1 transl_table 11 codon_start 1 locus_tag LOCUS_30310 CDS complement(3697146..3698075) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058151.1 transl_table 11 codon_start 1 locus_tag LOCUS_30320 CDS complement(3698078..3698899) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30330 CDS complement(3699318..3700511) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30340 CDS complement(3700508..3701668) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30350 CDS complement(3701665..3702738) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30360 CDS complement(3702749..3703990) product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939580.1 transl_table 11 codon_start 1 locus_tag LOCUS_30370 CDS complement(3704456..3705544) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390458.1 transl_table 11 codon_start 1 locus_tag LOCUS_30380 CDS complement(3705555..3706376) product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118657.1 transl_table 11 codon_start 1 locus_tag LOCUS_30390 CDS complement(3706510..3707487) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071997.1 transl_table 11 codon_start 1 locus_tag LOCUS_30400 CDS complement(3707982..3709343) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30410 CDS complement(3710015..3712147) product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088763.1 transl_table 11 codon_start 1 locus_tag LOCUS_30420 gene gspD CDS complement(3712144..3712707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30430 CDS complement(3712707..3713273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30440 CDS complement(3713257..3714375) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30450 CDS complement(3714394..3715296) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30460 CDS complement(3715310..3715990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30470 CDS complement(3715981..3716430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30480 CDS complement(3716436..3716849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30490 CDS complement(3716836..3718032) product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196821.1 transl_table 11 codon_start 1 locus_tag LOCUS_30500 gene gspF CDS complement(3718032..3719699) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30510 CDS complement(3719696..3720106) product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110089.1 transl_table 11 codon_start 1 locus_tag LOCUS_30520 gene gspG CDS complement(3720168..3721145) product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073078.1 transl_table 11 codon_start 1 locus_tag LOCUS_30530 CDS complement(3721366..3722418) product UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417117.1 transl_table 11 codon_start 1 locus_tag LOCUS_30540 gene wecA CDS complement(3722584..3725358) product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925895.1 transl_table 11 codon_start 1 locus_tag LOCUS_30550 CDS 3725758..3725961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30560 CDS 3726219..3727775 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261013.1 transl_table 11 codon_start 1 locus_tag LOCUS_30570 CDS 3728631..3730052 product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073082.1 transl_table 11 codon_start 1 locus_tag LOCUS_30580 CDS complement(3730260..3730664) product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261014.1 transl_table 11 codon_start 1 locus_tag LOCUS_30590 CDS complement(3730749..3731852) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073083.1 transl_table 11 codon_start 1 locus_tag LOCUS_30600 CDS complement(3731906..3732769) product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073084.1 transl_table 11 codon_start 1 locus_tag LOCUS_30610 CDS complement(3733424..3733597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30620 CDS 3733662..3735263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073085.1 transl_table 11 codon_start 1 locus_tag LOCUS_30630 CDS 3735492..3735845 product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073086.1 transl_table 11 codon_start 1 locus_tag LOCUS_30640 CDS complement(3735904..3736308) product DUF2802 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073087.1 transl_table 11 codon_start 1 locus_tag LOCUS_30650 CDS complement(3736390..3736896) product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073088.1 transl_table 11 codon_start 1 locus_tag LOCUS_30660 CDS complement(3736889..3737884) product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073089.1 transl_table 11 codon_start 1 locus_tag LOCUS_30670 CDS complement(3737868..3738584) product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073090.1 transl_table 11 codon_start 1 locus_tag LOCUS_30680 CDS complement(3738696..3739301) product membrane anchored protein in chemotaxis locus inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925896.1 transl_table 11 codon_start 1 locus_tag LOCUS_30690 CDS complement(3739294..3740412) product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073092.1 transl_table 11 codon_start 1 locus_tag LOCUS_30700 CDS complement(3740435..3742609) product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073093.1 transl_table 11 codon_start 1 locus_tag LOCUS_30710 CDS complement(3742625..3743362) product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073094.1 transl_table 11 codon_start 1 locus_tag LOCUS_30720 CDS complement(3743377..3743760) product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007649667.1 transl_table 11 codon_start 1 locus_tag LOCUS_30730 gene cheY CDS complement(3743802..3744521) product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073095.1 transl_table 11 codon_start 1 locus_tag LOCUS_30740 CDS complement(3744514..3745395) product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073096.1 transl_table 11 codon_start 1 locus_tag LOCUS_30750 CDS complement(3745400..3746800) product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073097.1 transl_table 11 codon_start 1 locus_tag LOCUS_30760 gene flhF CDS complement(3746813..3748912) product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073098.1 transl_table 11 codon_start 1 locus_tag LOCUS_30770 gene flhA CDS complement(3749179..3750312) product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073099.1 transl_table 11 codon_start 1 locus_tag LOCUS_30780 gene flhB CDS complement(3750345..3751070) product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073100.1 transl_table 11 codon_start 1 locus_tag LOCUS_30790 gene fliR CDS complement(3751197..3751466) product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073101.1 transl_table 11 codon_start 1 locus_tag LOCUS_30800 gene fliQ CDS complement(3751475..3752221) product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073102.1 transl_table 11 codon_start 1 locus_tag LOCUS_30810 gene fliP CDS complement(3752224..3752595) product flagellar biosynthetic protein FliO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073103.1 transl_table 11 codon_start 1 locus_tag LOCUS_30820 gene fliO CDS complement(3752603..3752986) product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073104.1 transl_table 11 codon_start 1 locus_tag LOCUS_30830 gene fliN CDS complement(3753055..3754083) product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073105.1 transl_table 11 codon_start 1 locus_tag LOCUS_30840 gene fliM CDS complement(3754205..3754723) product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073106.1 transl_table 11 codon_start 1 locus_tag LOCUS_30850 gene fliL CDS complement(3754836..3756551) product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073107.1 transl_table 11 codon_start 1 locus_tag LOCUS_30860 CDS complement(3756710..3757156) product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073108.1 transl_table 11 codon_start 1 locus_tag LOCUS_30870 gene fliJ CDS complement(3757202..3758560) product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073109.1 transl_table 11 codon_start 1 locus_tag LOCUS_30880 gene fliI CDS complement(3758526..3759521) product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073110.1 transl_table 11 codon_start 1 locus_tag LOCUS_30890 gene fliH CDS complement(3759521..3760555) product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073111.1 transl_table 11 codon_start 1 locus_tag LOCUS_30900 gene fliG CDS complement(3760545..3762248) product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925897.1 transl_table 11 codon_start 1 locus_tag LOCUS_30910 gene fliF CDS complement(3762327..3762671) product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073113.1 transl_table 11 codon_start 1 locus_tag LOCUS_30920 gene fliE CDS complement(3763168..3764529) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073114.1 transl_table 11 codon_start 1 locus_tag LOCUS_30930 CDS complement(3764522..3765640) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073115.1 transl_table 11 codon_start 1 locus_tag LOCUS_30940 CDS complement(3765813..3767246) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073116.1 transl_table 11 codon_start 1 locus_tag LOCUS_30950 CDS complement(3767552..3767962) product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073117.1 transl_table 11 codon_start 1 locus_tag LOCUS_30960 gene fliS CDS complement(3767969..3768289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30970 CDS complement(3768308..3769672) product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073119.1 transl_table 11 codon_start 1 locus_tag LOCUS_30980 gene fliD CDS complement(3769707..3770105) product flagellar protein FlaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073120.1 transl_table 11 codon_start 1 locus_tag LOCUS_30990 CDS complement(3770239..3771054) product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073122.1 transl_table 11 codon_start 1 locus_tag LOCUS_31000 CDS complement(3771160..3771960) product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073122.1 transl_table 11 codon_start 1 locus_tag LOCUS_31010 CDS complement(3772246..3773061) product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073122.1 transl_table 11 codon_start 1 locus_tag LOCUS_31020 CDS complement(3773495..3774262) product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073121.1 transl_table 11 codon_start 1 locus_tag LOCUS_31030 CDS complement(3774647..3775447) product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073121.1 transl_table 11 codon_start 1 locus_tag LOCUS_31040 CDS complement(3775697..3776515) product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073122.1 transl_table 11 codon_start 1 locus_tag LOCUS_31050 CDS complement(3776604..3777794) product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073123.1 transl_table 11 codon_start 1 locus_tag LOCUS_31060 gene flgL CDS complement(3777806..3779722) product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073124.1 transl_table 11 codon_start 1 locus_tag LOCUS_31070 gene flgK CDS complement(3779796..3780746) product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454015.1 transl_table 11 codon_start 1 locus_tag LOCUS_31080 gene flgJ CDS complement(3781004..3782095) product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073126.1 transl_table 11 codon_start 1 locus_tag LOCUS_31090 CDS complement(3782136..3782828) product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073127.1 transl_table 11 codon_start 1 locus_tag LOCUS_31100 gene flgH CDS complement(3782833..3783621) product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073128.1 transl_table 11 codon_start 1 locus_tag LOCUS_31110 gene flgG CDS complement(3783632..3784375) product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073129.1 transl_table 11 codon_start 1 locus_tag LOCUS_31120 gene flgF CDS complement(3784549..3785910) product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073130.1 transl_table 11 codon_start 1 locus_tag LOCUS_31130 gene flgE CDS complement(3786173..3787537) product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073130.1 transl_table 11 codon_start 1 locus_tag LOCUS_31140 gene flgE CDS complement(3787665..3788483) product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073131.1 transl_table 11 codon_start 1 locus_tag LOCUS_31150 gene flgD CDS complement(3788497..3788910) product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073132.1 transl_table 11 codon_start 1 locus_tag LOCUS_31160 gene flgC CDS complement(3788913..3789311) product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073133.1 transl_table 11 codon_start 1 locus_tag LOCUS_31170 gene flgB CDS complement(3789647..3790480) product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925741.1 transl_table 11 codon_start 1 locus_tag LOCUS_31180 CDS complement(3790622..3791542) product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073135.1 transl_table 11 codon_start 1 locus_tag LOCUS_31190 CDS 3791767..3792471 product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073136.1 transl_table 11 codon_start 1 locus_tag LOCUS_31200 gene flgA CDS 3792556..3792873 product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073137.1 transl_table 11 codon_start 1 locus_tag LOCUS_31210 gene flgM CDS 3792883..3793308 product flagellar protein FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073138.1 transl_table 11 codon_start 1 locus_tag LOCUS_31220 CDS complement(3793615..3794073) product LPP20 family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073139.1 transl_table 11 codon_start 1 locus_tag LOCUS_31230 CDS complement(3794070..3794696) product FlgO family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073140.1 transl_table 11 codon_start 1 locus_tag LOCUS_31240 CDS 3795034..3796812 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31250 CDS 3797064..3798224 product flagellar assembly protein FlgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073141.1 transl_table 11 codon_start 1 locus_tag LOCUS_31260 tRNA 3798354..3798429 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00810 CDS 3798418..3799782 product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073142.1 transl_table 11 codon_start 1 locus_tag LOCUS_31270 CDS 3799775..3800053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31280 CDS 3800064..3801044 product 4,6-dehydratase LegB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002786732.1 transl_table 11 codon_start 1 locus_tag LOCUS_31290 gene legB CDS 3801072..3802232 product LegC family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261001.1 transl_table 11 codon_start 1 locus_tag LOCUS_31300 CDS complement(3802234..3803400) product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823150.1 transl_table 11 codon_start 1 locus_tag LOCUS_31310 gene neuC CDS complement(3803413..3804420) product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230564.1 transl_table 11 codon_start 1 locus_tag LOCUS_31320 gene neuB CDS complement(3804417..3805088) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516588.1 transl_table 11 codon_start 1 locus_tag LOCUS_31330 CDS complement(3805092..3806222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31340 CDS complement(3806232..3807143) product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125015.1 transl_table 11 codon_start 1 locus_tag LOCUS_31350 gene lpxD CDS complement(3807144..3808376) product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879505.1 transl_table 11 codon_start 1 locus_tag LOCUS_31360 CDS complement(3808440..3810914) product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073156.1 transl_table 11 codon_start 1 locus_tag LOCUS_31370 CDS complement(3810908..3811642) product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392279.1 transl_table 11 codon_start 1 locus_tag LOCUS_31380 CDS complement(3811650..3812678) product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261005.1 transl_table 11 codon_start 1 locus_tag LOCUS_31390 CDS 3812911..3813396 product DUF2947 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073157.1 transl_table 11 codon_start 1 locus_tag LOCUS_31400 CDS 3813441..3814010 product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073158.1 transl_table 11 codon_start 1 locus_tag LOCUS_31410 CDS complement(3814092..3814997) product DUF6268 family outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073159.1 transl_table 11 codon_start 1 locus_tag LOCUS_31420 CDS complement(3815098..3815730) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073160.1 transl_table 11 codon_start 1 locus_tag LOCUS_31430 CDS 3815876..3817006 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073161.1 transl_table 11 codon_start 1 locus_tag LOCUS_31440 CDS 3817012..3820101 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073162.1 transl_table 11 codon_start 1 locus_tag LOCUS_31450 CDS 3820360..3822363 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073164.1 transl_table 11 codon_start 1 locus_tag LOCUS_31460 CDS complement(3823326..3824465) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073166.1 transl_table 11 codon_start 1 locus_tag LOCUS_31470 gene cydB CDS complement(3824481..3826037) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073167.1 transl_table 11 codon_start 1 locus_tag LOCUS_31480 CDS complement(3827362..3831246) product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073168.1 transl_table 11 codon_start 1 locus_tag LOCUS_31490 gene purL CDS 3831568..3833010 product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073169.1 transl_table 11 codon_start 1 locus_tag LOCUS_31500 gene mltF CDS complement(3833209..3833778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31510 CDS complement(3833882..3835459) product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073171.1 transl_table 11 codon_start 1 locus_tag LOCUS_31520 gene guaA CDS complement(3835600..3837072) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073172.1 transl_table 11 codon_start 1 locus_tag LOCUS_31530 gene guaB CDS 3837192..3838520 product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073173.1 transl_table 11 codon_start 1 locus_tag LOCUS_31540 gene xseA CDS complement(3838974..3839954) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070523.1 transl_table 11 codon_start 1 locus_tag LOCUS_31550 CDS complement(3841027..3842499) product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073184.1 transl_table 11 codon_start 1 locus_tag LOCUS_31560 gene der CDS complement(3842686..3843873) product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073185.1 transl_table 11 codon_start 1 locus_tag LOCUS_31570 gene bamB CDS complement(3843884..3844504) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073186.1 transl_table 11 codon_start 1 locus_tag LOCUS_31580 CDS complement(3844518..3845792) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073187.1 transl_table 11 codon_start 1 locus_tag LOCUS_31590 gene hisS CDS complement(3846219..3847334) product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073188.1 transl_table 11 codon_start 1 locus_tag LOCUS_31600 gene ispG CDS complement(3847438..3848433) product DUF4115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073189.1 transl_table 11 codon_start 1 locus_tag LOCUS_31610 CDS complement(3848433..3849221) product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073190.1 transl_table 11 codon_start 1 locus_tag LOCUS_31620 gene pilW CDS complement(3849253..3850374) product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073191.1 transl_table 11 codon_start 1 locus_tag LOCUS_31630 CDS 3850718..3851824 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073192.1 transl_table 11 codon_start 1 locus_tag LOCUS_31640 CDS 3852019..3853749 product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073193.1 transl_table 11 codon_start 1 locus_tag LOCUS_31650 CDS complement(3853772..3854683) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073194.1 transl_table 11 codon_start 1 locus_tag LOCUS_31660 CDS 3854844..3855539 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482811.1 transl_table 11 codon_start 1 locus_tag LOCUS_31670 CDS complement(3855570..3856109) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925744.1 transl_table 11 codon_start 1 locus_tag LOCUS_31680 CDS complement(3856266..3856568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073198.1 transl_table 11 codon_start 1 locus_tag LOCUS_31690 CDS complement(3856801..3857028) product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073199.1 transl_table 11 codon_start 1 locus_tag LOCUS_31700 CDS 3857614..3858357 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073201.1 transl_table 11 codon_start 1 locus_tag LOCUS_31710 CDS 3858317..3858808 product CopG family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925745.1 transl_table 11 codon_start 1 locus_tag LOCUS_31720 CDS 3858981..3859805 product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073205.1 transl_table 11 codon_start 1 locus_tag LOCUS_31730 CDS 3859948..3860502 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073206.1 transl_table 11 codon_start 1 locus_tag LOCUS_31740 CDS complement(3860572..3862056) product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073207.1 transl_table 11 codon_start 1 locus_tag LOCUS_31750 CDS complement(3862509..3863879) product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071670.1 transl_table 11 codon_start 1 locus_tag LOCUS_31760 gene aceB CDS complement(3864514..3866292) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925657.1 transl_table 11 codon_start 1 locus_tag LOCUS_31770 CDS complement(3866292..3866513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071666.1 transl_table 11 codon_start 1 locus_tag LOCUS_31780 CDS complement(3866597..3867415) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071665.1 transl_table 11 codon_start 1 locus_tag LOCUS_31790 CDS 3867957..3868484 product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071664.1 transl_table 11 codon_start 1 locus_tag LOCUS_31800 gene bamE CDS complement(3868563..3868895) product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071663.1 transl_table 11 codon_start 1 locus_tag LOCUS_31810 CDS complement(3868985..3869416) product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071662.1 transl_table 11 codon_start 1 locus_tag LOCUS_31820 CDS 3869762..3870256 product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071661.1 transl_table 11 codon_start 1 locus_tag LOCUS_31830 gene smpB tmRNA 3870450..3870804 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(3870946..3871287) product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101229.1 transl_table 11 codon_start 1 locus_tag LOCUS_31840 CDS complement(3872175..3873161) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074174.1 transl_table 11 codon_start 1 locus_tag LOCUS_31850 CDS 3873362..3873667 product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074175.1 transl_table 11 codon_start 1 locus_tag LOCUS_31860 CDS complement(3873879..3874079) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31870 CDS complement(3874429..3874956) product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071407.1 transl_table 11 codon_start 1 locus_tag LOCUS_31880 CDS 3875358..3875867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31890 CDS 3875854..3877635 product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083208.1 transl_table 11 codon_start 1 locus_tag LOCUS_31900 gene nrdD CDS complement(3877714..3879000) product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071852.1 transl_table 11 codon_start 1 locus_tag LOCUS_31910 CDS 3879479..3880039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31920 CDS complement(3880142..3880519) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263219.1 transl_table 11 codon_start 1 locus_tag LOCUS_31930 CDS complement(3880570..3880992) product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460420.1 transl_table 11 codon_start 1 locus_tag LOCUS_31940 CDS 3881345..3882343 product lipid A deacylase LpxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481800.1 transl_table 11 codon_start 1 locus_tag LOCUS_31950 CDS complement(3882454..3883608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31960 CDS complement(3883628..3884548) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136856750.1 transl_table 11 codon_start 1 locus_tag LOCUS_31970 CDS complement(3884541..3888953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31980 CDS complement(3888967..3890124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31990 CDS complement(3890340..3890633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32000 CDS complement(3890759..3891436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32010 CDS 3892093..3892746 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32020 CDS 3893018..3895159 product LruC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263020.1 transl_table 11 codon_start 1 locus_tag LOCUS_32030 CDS 3895193..3895750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32040 CDS complement(3895821..3897428) product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035397.1 transl_table 11 codon_start 1 locus_tag LOCUS_32050 CDS complement(3897490..3897741) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32060 CDS 3898314..3900629 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32070 CDS complement(3900758..3902149) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32080 CDS complement(3902235..3904454) product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071033.1 transl_table 11 codon_start 1 locus_tag LOCUS_32090 CDS 3904774..3905499 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967508.1 transl_table 11 codon_start 1 locus_tag LOCUS_32100 CDS 3905766..3908003 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096995.1 transl_table 11 codon_start 1 locus_tag LOCUS_32110 CDS 3908237..3908560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32120 CDS complement(3908578..3909597) product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704684.1 transl_table 11 codon_start 1 locus_tag LOCUS_32130 CDS 3909771..3910163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32140 CDS complement(3910257..3911252) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085528.1 transl_table 11 codon_start 1 locus_tag LOCUS_32150 CDS complement(3911282..3911866) product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036739.1 transl_table 11 codon_start 1 locus_tag LOCUS_32160 CDS complement(3911869..3912309) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820147.1 transl_table 11 codon_start 1 locus_tag LOCUS_32170 CDS complement(3912382..3913176) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742177.1 transl_table 11 codon_start 1 locus_tag LOCUS_32180 CDS complement(3913178..3914287) product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998299.1 transl_table 11 codon_start 1 locus_tag LOCUS_32190 gene dmpG CDS complement(3914300..3915289) product acetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044300.1 transl_table 11 codon_start 1 locus_tag LOCUS_32200 gene mhpF CDS complement(3915294..3916106) product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160723.1 transl_table 11 codon_start 1 locus_tag LOCUS_32210 gene mhpD CDS complement(3916122..3917636) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257240.1 transl_table 11 codon_start 1 locus_tag LOCUS_32220 CDS 3917889..3918836 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036922.1 transl_table 11 codon_start 1 locus_tag LOCUS_32230 CDS complement(3918910..3919227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32240 CDS 3919507..3920874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32250 CDS complement(3920974..3923364) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072660.1 transl_table 11 codon_start 1 locus_tag LOCUS_32260 CDS 3924099..3925238 product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458373.1 transl_table 11 codon_start 1 locus_tag LOCUS_32270 gene rsgA CDS 3925424..3926689 product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703897.1 transl_table 11 codon_start 1 locus_tag LOCUS_32280 CDS complement(3926762..3927028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32290 CDS 3927435..3927839 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32300 CDS complement(3927888..3928085) product pleiotropic regulatory protein RsmS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261638.1 transl_table 11 codon_start 1 locus_tag LOCUS_32310 gene rsmS CDS complement(3928201..3928896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32320 CDS 3929196..3929435 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071752.1 transl_table 11 codon_start 1 locus_tag LOCUS_32330 CDS 3929661..3929870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32340 CDS 3929970..3930686 product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072425.1 transl_table 11 codon_start 1 locus_tag LOCUS_32350 CDS 3930800..3931315 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464022.1 transl_table 11 codon_start 1 locus_tag LOCUS_32360 CDS 3931451..3931900 product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467601.1 transl_table 11 codon_start 1 locus_tag LOCUS_32370 gene uspA CDS complement(3933202..3934218) product IS110-like element IS1111A family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041952483.1 transl_table 11 codon_start 1 locus_tag LOCUS_32380 CDS 3934631..3934981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32390 CDS 3935292..3935681 product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105951.1 transl_table 11 codon_start 1 locus_tag LOCUS_32400 CDS complement(3936373..3937602) product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707131.1 transl_table 11 codon_start 1 locus_tag LOCUS_32410 gene gltS CDS complement(3938040..3938462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32420 CDS complement(3938521..3938964) product DUF3291 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030162.1 transl_table 11 codon_start 1 locus_tag LOCUS_32430 CDS 3939366..3940460 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480635.1 transl_table 11 codon_start 1 locus_tag LOCUS_32440 CDS complement(3940457..3941746) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072045.1 transl_table 11 codon_start 1 locus_tag LOCUS_32450 CDS 3942090..3943343 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073727.1 transl_table 11 codon_start 1 locus_tag LOCUS_32460 CDS 3943715..3945115 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039147.1 transl_table 11 codon_start 1 locus_tag LOCUS_32470 CDS 3945125..3947545 product NdvB protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275544.1 transl_table 11 codon_start 1 locus_tag LOCUS_32480 CDS 3947545..3948336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32490 CDS complement(3948377..3948832) product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208527.1 transl_table 11 codon_start 1 locus_tag LOCUS_32500 CDS complement(3948959..3949558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32510 CDS 3950004..3950402 product MerR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072005.1 transl_table 11 codon_start 1 locus_tag LOCUS_32520 CDS 3950582..3951751 product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072004.1 transl_table 11 codon_start 1 locus_tag LOCUS_32530 CDS 3951844..3953451 product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072003.1 transl_table 11 codon_start 1 locus_tag LOCUS_32540 CDS 3953497..3954366 product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072002.1 transl_table 11 codon_start 1 locus_tag LOCUS_32550 CDS 3954366..3956501 product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925856.1 transl_table 11 codon_start 1 locus_tag LOCUS_32560 CDS 3956498..3957394 product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072000.1 transl_table 11 codon_start 1 locus_tag LOCUS_32570 CDS 3957493..3958218 product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071999.1 transl_table 11 codon_start 1 locus_tag LOCUS_32580 CDS 3958235..3958891 product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071998.1 transl_table 11 codon_start 1 locus_tag LOCUS_32590 CDS 3959160..3959702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32600 CDS complement(3959722..3960258) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32610 CDS 3960496..3960870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32620 CDS complement(3961163..3961741) product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073032.1 transl_table 11 codon_start 1 locus_tag LOCUS_32630 CDS complement(3961924..3963492) product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262192.1 transl_table 11 codon_start 1 locus_tag LOCUS_32640 CDS complement(3963969..3964892) product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073034.1 transl_table 11 codon_start 1 locus_tag LOCUS_32650 CDS complement(3964892..3965641) product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073035.1 transl_table 11 codon_start 1 locus_tag LOCUS_32660 CDS 3965946..3966338 product H-NS family nucleoid-associated regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073036.1 transl_table 11 codon_start 1 locus_tag LOCUS_32670 CDS 3966496..3969567 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073037.1 transl_table 11 codon_start 1 locus_tag LOCUS_32680 CDS 3969567..3970925 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073038.1 transl_table 11 codon_start 1 locus_tag LOCUS_32690 CDS complement(3970914..3971126) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32700 CDS 3971035..3971421 product Rcs stress response system protein RcsF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073039.1 transl_table 11 codon_start 1 locus_tag LOCUS_32710 gene rcsF CDS 3971475..3972197 product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073040.1 transl_table 11 codon_start 1 locus_tag LOCUS_32720 gene tsaA CDS 3972215..3972853 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073041.1 transl_table 11 codon_start 1 locus_tag LOCUS_32730 CDS 3973055..3973717 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32740 CDS 3974302..3975318 product IS110-like element IS1111A family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041952483.1 transl_table 11 codon_start 1 locus_tag LOCUS_32750 CDS 3975937..3977679 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707759.1 transl_table 11 codon_start 1 locus_tag LOCUS_32760 CDS 3978448..3980157 product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073042.1 transl_table 11 codon_start 1 locus_tag LOCUS_32770 CDS 3980344..3981465 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073043.1 transl_table 11 codon_start 1 locus_tag LOCUS_32780 CDS complement(3981486..3982199) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195885.1 transl_table 11 codon_start 1 locus_tag LOCUS_32790 CDS complement(3982203..3984152) product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071802.1 transl_table 11 codon_start 1 locus_tag LOCUS_32800 CDS 3984336..3985217 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071801.1 transl_table 11 codon_start 1 locus_tag LOCUS_32810 CDS complement(3985249..3986670) product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071800.1 transl_table 11 codon_start 1 locus_tag LOCUS_32820 gene tilS CDS complement(3986672..3990145) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071799.1 transl_table 11 codon_start 1 locus_tag LOCUS_32830 gene dnaE CDS complement(3990271..3990915) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071798.1 transl_table 11 codon_start 1 locus_tag LOCUS_32840 gene rnhB CDS complement(3990947..3992086) product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071797.1 transl_table 11 codon_start 1 locus_tag LOCUS_32850 gene lpxB CDS complement(3992160..3992927) product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071796.1 transl_table 11 codon_start 1 locus_tag LOCUS_32860 gene lpxA CDS complement(3992924..3993382) product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071795.1 transl_table 11 codon_start 1 locus_tag LOCUS_32870 gene fabZ CDS complement(3993412..3994437) product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071794.1 transl_table 11 codon_start 1 locus_tag LOCUS_32880 gene lpxD CDS complement(3994457..3994960) product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037416754.1 transl_table 11 codon_start 1 locus_tag LOCUS_32890 CDS complement(3995019..3997502) product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071792.1 transl_table 11 codon_start 1 locus_tag LOCUS_32900 gene bamA CDS complement(3997534..3998910) product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071791.1 transl_table 11 codon_start 1 locus_tag LOCUS_32910 gene rseP CDS complement(3998928..4000115) product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071790.1 transl_table 11 codon_start 1 locus_tag LOCUS_32920 gene ispC CDS complement(4000120..4000914) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071789.1 transl_table 11 codon_start 1 locus_tag LOCUS_32930 CDS complement(4000999..4001790) product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071788.1 transl_table 11 codon_start 1 locus_tag LOCUS_32940 gene uppS CDS complement(4001870..4002427) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071787.1 transl_table 11 codon_start 1 locus_tag LOCUS_32950 gene frr CDS complement(4002515..4003255) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071786.1 transl_table 11 codon_start 1 locus_tag LOCUS_32960 gene pyrH CDS complement(4003347..4004195) product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071785.1 transl_table 11 codon_start 1 locus_tag LOCUS_32970 gene tsf CDS complement(4004332..4005060) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071784.1 transl_table 11 codon_start 1 locus_tag LOCUS_32980 gene rpsB CDS 4005400..4006197 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071783.1 transl_table 11 codon_start 1 locus_tag LOCUS_32990 gene map CDS 4006304..4008877 product bifunctional uridylyltransferase/uridylyl-removing protein GlnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071782.1 transl_table 11 codon_start 1 locus_tag LOCUS_33000 gene glnD CDS 4009063..4009887 product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071781.1 transl_table 11 codon_start 1 locus_tag LOCUS_33010 gene dapD CDS 4010107..4010451 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33020 CDS 4011108..4011452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33030 CDS complement(4011540..4012373) product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925851.1 transl_table 11 codon_start 1 locus_tag LOCUS_33040 gene purU CDS complement(4012424..4013893) product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071779.1 transl_table 11 codon_start 1 locus_tag LOCUS_33050 CDS complement(4013845..4014309) product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071778.1 transl_table 11 codon_start 1 locus_tag LOCUS_33060 CDS 4014410..4014601 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33070 CDS complement(4014593..4015483) product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071776.1 transl_table 11 codon_start 1 locus_tag LOCUS_33080 gene truC CDS complement(4015470..4015802) product YqcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071775.1 transl_table 11 codon_start 1 locus_tag LOCUS_33090 CDS 4015947..4016960 product DUF3549 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071774.1 transl_table 11 codon_start 1 locus_tag LOCUS_33100 CDS 4016957..4017346 product DUF3301 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071773.1 transl_table 11 codon_start 1 locus_tag LOCUS_33110 CDS complement(4018393..4018710) product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071772.1 transl_table 11 codon_start 1 locus_tag LOCUS_33120 CDS complement(4018734..4019378) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071771.1 transl_table 11 codon_start 1 locus_tag LOCUS_33130 CDS 4019543..4019770 product DUF2789 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071770.1 transl_table 11 codon_start 1 locus_tag LOCUS_33140 CDS complement(4019784..4020155) product DUF3192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071769.1 transl_table 11 codon_start 1 locus_tag LOCUS_33150 CDS 4020305..4020628 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071768.1 transl_table 11 codon_start 1 locus_tag LOCUS_33160 CDS 4020628..4021401 product Zn-ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071767.1 transl_table 11 codon_start 1 locus_tag LOCUS_33170 CDS complement(4021443..4022108) product SecY-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925666.1 transl_table 11 codon_start 1 locus_tag LOCUS_33180 gene syd CDS 4022169..4023026 product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071765.1 transl_table 11 codon_start 1 locus_tag LOCUS_33190 gene queF CDS complement(4023360..4024178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33200 CDS complement(4024272..4024943) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261535.1 transl_table 11 codon_start 1 locus_tag LOCUS_33210 CDS complement(4025144..4026049) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071764.1 transl_table 11 codon_start 1 locus_tag LOCUS_33220 CDS complement(4026146..4027057) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071764.1 transl_table 11 codon_start 1 locus_tag LOCUS_33230 CDS 4027240..4029282 product alkyl sulfatase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071763.1 transl_table 11 codon_start 1 locus_tag LOCUS_33240 CDS 4029584..4030774 product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265575.1 transl_table 11 codon_start 1 locus_tag LOCUS_33250 CDS complement(4030932..4031810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33260 CDS 4032021..4032242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33270 CDS 4032478..4032888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33280 CDS complement(4033029..4033208) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33290 CDS complement(4033375..4034658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261739.1 transl_table 11 codon_start 1 locus_tag LOCUS_33300 CDS complement(4034655..4035338) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261737.1 transl_table 11 codon_start 1 locus_tag LOCUS_33310 CDS complement(4035423..4036661) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482694.1 transl_table 11 codon_start 1 locus_tag LOCUS_33320 CDS complement(4036742..4037998) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261735.1 transl_table 11 codon_start 1 locus_tag LOCUS_33330 CDS complement(4038055..4038804) product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261734.1 transl_table 11 codon_start 1 locus_tag LOCUS_33340 CDS complement(4039103..4041193) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479820.1 transl_table 11 codon_start 1 locus_tag LOCUS_33350 gene fusA CDS 4041677..4042534 product transcriptional regulator of eicosapentaenoic acid synthesis PfaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071760.1 transl_table 11 codon_start 1 locus_tag LOCUS_33360 CDS 4042534..4050747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33370 CDS 4050747..4053062 product PfaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071758.1 transl_table 11 codon_start 1 locus_tag LOCUS_33380 CDS 4053062..4058923 product beta-ketoacyl synthase N-terminal-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172966575.1 transl_table 11 codon_start 1 locus_tag LOCUS_33390 CDS 4059041..4060678 product eicosapentaenoate synthase subunit PfaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071756.1 transl_table 11 codon_start 1 locus_tag LOCUS_33400 gene pfaD CDS complement(4060889..4061893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33410 CDS complement(4062002..4062814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33420 CDS complement(4063522..4063938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33430 CDS complement(4064141..4064533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33440 CDS complement(4064533..4065693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33450 CDS complement(4065693..4066433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33460 CDS complement(4066433..4067272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33470 CDS complement(4067269..4068666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33480 CDS complement(4068663..4073768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33490 CDS complement(4073798..4074181) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33500 CDS complement(4074202..4074546) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33510 CDS complement(4074604..4075557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33520 CDS complement(4075554..4075727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33530 CDS complement(4075757..4076194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33540 CDS complement(4076217..4076666) product DUF1320 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071001.1 transl_table 11 codon_start 1 locus_tag LOCUS_33550 CDS complement(4076666..4077202) product HI1506-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071000.1 transl_table 11 codon_start 1 locus_tag LOCUS_33560 CDS complement(4077300..4078193) product Mu-like prophage major head subunit gpT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939979.1 transl_table 11 codon_start 1 locus_tag LOCUS_33570 CDS complement(4078248..4078646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33580 CDS complement(4078659..4079873) product phage protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042037289.1 transl_table 11 codon_start 1 locus_tag LOCUS_33590 CDS complement(4079928..4080251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33600 CDS complement(4080403..4080711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33610 CDS complement(4080817..4081341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33620 CDS complement(4081572..4081925) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33630 CDS complement(4082047..4082523) product phage virion morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938413.1 transl_table 11 codon_start 1 locus_tag LOCUS_33640 CDS complement(4082523..4082738) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33650 CDS complement(4082738..4084177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33660 CDS complement(4084177..4085853) product DUF935 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869229.1 transl_table 11 codon_start 1 locus_tag LOCUS_33670 CDS complement(4085856..4087529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070989.1 transl_table 11 codon_start 1 locus_tag LOCUS_33680 CDS complement(4087529..4088107) product DUF3486 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070988.1 transl_table 11 codon_start 1 locus_tag LOCUS_33690 CDS complement(4088104..4088367) product phage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070987.1 transl_table 11 codon_start 1 locus_tag LOCUS_33700 CDS complement(4088369..4088665) product phage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070986.1 transl_table 11 codon_start 1 locus_tag LOCUS_33710 CDS complement(4088665..4088973) product DUF2730 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072622.1 transl_table 11 codon_start 1 locus_tag LOCUS_33720 CDS complement(4088984..4089199) product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072621.1 transl_table 11 codon_start 1 locus_tag LOCUS_33730 CDS complement(4089273..4089491) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33740 CDS complement(4089488..4089907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33750 CDS complement(4090182..4090781) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33760 CDS complement(4090879..4091409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33770 CDS complement(4091419..4091613) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33780 CDS complement(4091723..4093099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33790 CDS complement(4093110..4093496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33800 CDS complement(4093526..4094488) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33810 CDS complement(4094511..4094930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33820 CDS 4095040..4095312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33830 CDS complement(4095239..4095697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33840 CDS 4095820..4096308 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33850 CDS 4096314..4096643 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33860 CDS 4096659..4097630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33870 CDS 4097633..4099420 product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701232.1 transl_table 11 codon_start 1 locus_tag LOCUS_33880 CDS 4099444..4100910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33890 CDS 4100907..4101170 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33900 CDS 4101200..4101820 product DUF3164 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072605.1 transl_table 11 codon_start 1 locus_tag LOCUS_33910 CDS 4101830..4102477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33920 CDS 4102533..4102721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33930 CDS 4102721..4103059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33940 CDS complement(4103065..4103709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33950 CDS complement(4104199..4105002) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480600.1 transl_table 11 codon_start 1 locus_tag LOCUS_33960 CDS 4105805..4106212 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33970 CDS 4106580..4106966 product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403950.1 transl_table 11 codon_start 1 locus_tag LOCUS_33980 CDS complement(4107196..4108398) product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206663.1 transl_table 11 codon_start 1 locus_tag LOCUS_33990 gene trpB CDS 4108788..4110185 product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103273.1 transl_table 11 codon_start 1 locus_tag LOCUS_34000 CDS 4110445..4111806 product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103270.1 transl_table 11 codon_start 1 locus_tag LOCUS_34010 CDS complement(4111955..4115074) product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705231.1 transl_table 11 codon_start 1 locus_tag LOCUS_34020 CDS complement(4115107..4116255) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206729.1 transl_table 11 codon_start 1 locus_tag LOCUS_34030 CDS 4116517..4117194 product cationic peptide response regulator transcription factor CprR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091311.1 transl_table 11 codon_start 1 locus_tag LOCUS_34040 gene cprR CDS 4117191..4118489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34050 CDS complement(4118490..4119038) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34060 CDS complement(4119362..4121584) product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535630.1 transl_table 11 codon_start 1 locus_tag LOCUS_34070 CDS complement(4121814..4122080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34080 CDS 4122198..4122536 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34090 CDS 4123260..4126106 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037702.1 transl_table 11 codon_start 1 locus_tag LOCUS_34100 CDS complement(4126188..4127084) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262935.1 transl_table 11 codon_start 1 locus_tag LOCUS_34110 CDS 4127231..4127668 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090322.1 transl_table 11 codon_start 1 locus_tag LOCUS_34120 CDS complement(4127681..4129030) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112637.1 transl_table 11 codon_start 1 locus_tag LOCUS_34130 CDS complement(4129287..4131749) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071669.1 transl_table 11 codon_start 1 locus_tag LOCUS_34140 CDS complement(4131936..4132895) product choice-of-anchor H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074239.1 transl_table 11 codon_start 1 locus_tag LOCUS_34150 CDS 4133209..4133550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34160 CDS 4133723..4134433 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074241.1 transl_table 11 codon_start 1 locus_tag LOCUS_34170 CDS 4134423..4135808 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074242.1 transl_table 11 codon_start 1 locus_tag LOCUS_34180 CDS 4135899..4137344 product DUF3300 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074243.1 transl_table 11 codon_start 1 locus_tag LOCUS_34190 CDS complement(4137397..4138098) product 16S rRNA pseudouridine(516) synthase RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073606.1 transl_table 11 codon_start 1 locus_tag LOCUS_34200 gene rsuA CDS 4138380..4139138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34210 CDS 4139286..4140743 product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167742.1 transl_table 11 codon_start 1 locus_tag LOCUS_34220 CDS 4140730..4142292 product phosphomannomutase CpsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208588.1 transl_table 11 codon_start 1 locus_tag LOCUS_34230 gene cpsG CDS 4142510..4144579 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074327.1 transl_table 11 codon_start 1 locus_tag LOCUS_34240 CDS 4144909..4145613 product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072663.1 transl_table 11 codon_start 1 locus_tag LOCUS_34250 gene deoD CDS 4145758..4146933 product MFS transporter TsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072662.1 transl_table 11 codon_start 1 locus_tag LOCUS_34260 gene tsgA CDS complement(4147252..4147926) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072661.1 transl_table 11 codon_start 1 locus_tag LOCUS_34270 CDS complement(4148175..4149554) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34280 note possible pseudo, internal stop codon CDS complement(4149609..4150049) product DUF2141 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932889.1 transl_table 11 codon_start 1 locus_tag LOCUS_34290 CDS 4150277..4151392 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036327.1 transl_table 11 codon_start 1 locus_tag LOCUS_34300 CDS 4151457..4152098 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036328.1 transl_table 11 codon_start 1 locus_tag LOCUS_34310 CDS 4152245..4152877 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479200.1 transl_table 11 codon_start 1 locus_tag LOCUS_34320 CDS 4152900..4154825 product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263152.1 transl_table 11 codon_start 1 locus_tag LOCUS_34330 CDS 4155257..4156969 product bifunctional UDP-sugar hydrolase/5'-nucleotidase UshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478924.1 transl_table 11 codon_start 1 locus_tag LOCUS_34340 gene ushA CDS complement(4157072..4157428) product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073262.1 transl_table 11 codon_start 1 locus_tag LOCUS_34350 gene raiA CDS 4158416..4160047 product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073265.1 transl_table 11 codon_start 1 locus_tag LOCUS_34360 CDS 4160050..4160388 product DUF3325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073266.1 transl_table 11 codon_start 1 locus_tag LOCUS_34370 CDS 4160561..4161028 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073268.1 transl_table 11 codon_start 1 locus_tag LOCUS_34380 CDS complement(4161226..4161888) product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462716.1 transl_table 11 codon_start 1 locus_tag LOCUS_34390 CDS complement(4161894..4163006) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263886.1 transl_table 11 codon_start 1 locus_tag LOCUS_34400 CDS complement(4163196..4163786) product YSC84-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704661.1 transl_table 11 codon_start 1 locus_tag LOCUS_34410 CDS complement(4164007..4165032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34420 CDS complement(4165125..4166000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925870.1 transl_table 11 codon_start 1 locus_tag LOCUS_34430 CDS complement(4166005..4167039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34440 CDS complement(4167029..4168183) product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263571.1 transl_table 11 codon_start 1 locus_tag LOCUS_34450 CDS complement(4168695..4171979) product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073269.1 transl_table 11 codon_start 1 locus_tag LOCUS_34460 CDS 4172145..4172621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261145.1 transl_table 11 codon_start 1 locus_tag LOCUS_34470 CDS complement(4172723..4173526) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34480 CDS complement(4173516..4174127) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073380.1 transl_table 11 codon_start 1 locus_tag LOCUS_34490 CDS complement(4174195..4176222) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073381.1 transl_table 11 codon_start 1 locus_tag LOCUS_34500 CDS complement(4176343..4177191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34510 CDS complement(4177340..4177849) product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704271.1 transl_table 11 codon_start 1 locus_tag LOCUS_34520 gene purE CDS complement(4178629..4178988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34530 CDS 4179660..4180484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34540 CDS complement(4180691..4181668) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071719.1 transl_table 11 codon_start 1 locus_tag LOCUS_34550 CDS complement(4181751..4182080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34560 CDS complement(4182483..4182968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34570 CDS complement(4183260..4183943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34580 CDS complement(4184729..4185361) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073386.1 transl_table 11 codon_start 1 locus_tag LOCUS_34590 CDS complement(4185549..4185974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925753.1 transl_table 11 codon_start 1 locus_tag LOCUS_34600 CDS complement(4186069..4187703) product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073388.1 transl_table 11 codon_start 1 locus_tag LOCUS_34610 gene gshA CDS complement(4187872..4190706) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073389.1 transl_table 11 codon_start 1 locus_tag LOCUS_34620 CDS complement(4190789..4191211) product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073390.1 transl_table 11 codon_start 1 locus_tag LOCUS_34630 CDS 4191483..4192733 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073391.1 transl_table 11 codon_start 1 locus_tag LOCUS_34640 CDS 4192866..4193051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34650 CDS 4193207..4193542 product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261999.1 transl_table 11 codon_start 1 locus_tag LOCUS_34660 CDS complement(4193637..4193831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34670 CDS complement(4194096..4195649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34680 CDS complement(4195677..4196039) product group 1 truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730775.1 transl_table 11 codon_start 1 locus_tag LOCUS_34690 CDS complement(4196208..4197338) product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480910.1 transl_table 11 codon_start 1 locus_tag LOCUS_34700 CDS complement(4197347..4199146) product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480900.1 transl_table 11 codon_start 1 locus_tag LOCUS_34710 gene oadA CDS complement(4199168..4199413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34720 tRNA complement(4199994..4200085) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00820 tRNA complement(4200106..4200182) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00830 tRNA complement(4200264..4200340) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00840 tRNA complement(4200377..4200453) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00850 tRNA complement(4200489..4200565) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00860 tRNA complement(4200600..4200676) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00870 tRNA complement(4200792..4200883) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00880 tRNA complement(4200904..4200980) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00890 tRNA complement(4201064..4201140) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00900 tRNA complement(4201289..4201365) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00910 tRNA complement(4201400..4201476) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00920 tRNA complement(4201498..4201589) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00930 CDS complement(4201847..4202044) product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006082602.1 transl_table 11 codon_start 1 locus_tag LOCUS_34730 gene csrA CDS complement(4202557..4205181) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073284.1 transl_table 11 codon_start 1 locus_tag LOCUS_34740 gene alaS CDS complement(4205589..4206668) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073286.1 transl_table 11 codon_start 1 locus_tag LOCUS_34750 gene recA CDS 4207000..4209567 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073287.1 transl_table 11 codon_start 1 locus_tag LOCUS_34760 gene mutS CDS complement(4209958..4210929) product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073288.1 transl_table 11 codon_start 1 locus_tag LOCUS_34770 gene rpoS CDS complement(4211007..4211798) product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073289.1 transl_table 11 codon_start 1 locus_tag LOCUS_34780 CDS complement(4212006..4212641) product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073290.1 transl_table 11 codon_start 1 locus_tag LOCUS_34790 CDS complement(4212638..4213387) product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073291.1 transl_table 11 codon_start 1 locus_tag LOCUS_34800 gene surE CDS complement(4213453..4214520) product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073292.1 transl_table 11 codon_start 1 locus_tag LOCUS_34810 CDS complement(4214575..4215060) product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073293.1 transl_table 11 codon_start 1 locus_tag LOCUS_34820 gene ispF CDS complement(4215158..4215856) product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073294.1 transl_table 11 codon_start 1 locus_tag LOCUS_34830 gene ispD CDS complement(4215891..4216181) product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073295.1 transl_table 11 codon_start 1 locus_tag LOCUS_34840 gene ftsB CDS complement(4216329..4217624) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073296.1 transl_table 11 codon_start 1 locus_tag LOCUS_34850 gene eno CDS complement(4217749..4219386) product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073297.1 transl_table 11 codon_start 1 locus_tag LOCUS_34860 CDS complement(4219498..4220301) product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073298.1 transl_table 11 codon_start 1 locus_tag LOCUS_34870 gene mazG CDS complement(4220375..4222585) product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073302.1 transl_table 11 codon_start 1 locus_tag LOCUS_34880 gene relA CDS complement(4222728..4224083) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073303.1 transl_table 11 codon_start 1 locus_tag LOCUS_34890 gene rlmD CDS 4224179..4226977 product two-component sensor histidine kinase BarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073304.1 transl_table 11 codon_start 1 locus_tag LOCUS_34900 gene barA CDS 4226967..4227572 product YjaG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073305.1 transl_table 11 codon_start 1 locus_tag LOCUS_34910 CDS 4227936..4228154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34920 CDS complement(4228211..4228396) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34930 CDS 4228335..4229330 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073308.1 transl_table 11 codon_start 1 locus_tag LOCUS_34940 CDS 4229461..4231122 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073309.1 transl_table 11 codon_start 1 locus_tag LOCUS_34950 gene recN CDS 4231251..4232015 product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208160.1 transl_table 11 codon_start 1 locus_tag LOCUS_34960 CDS complement(4232012..4232506) product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073310.1 transl_table 11 codon_start 1 locus_tag LOCUS_34970 CDS complement(4232506..4233465) product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073311.1 transl_table 11 codon_start 1 locus_tag LOCUS_34980 gene thiL CDS complement(4233574..4233978) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073312.1 transl_table 11 codon_start 1 locus_tag LOCUS_34990 gene nusB CDS complement(4233987..4234469) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073313.1 transl_table 11 codon_start 1 locus_tag LOCUS_35000 gene ribE CDS complement(4234594..4235697) product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073314.1 transl_table 11 codon_start 1 locus_tag LOCUS_35010 gene ribBA CDS complement(4235814..4236476) product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073315.1 transl_table 11 codon_start 1 locus_tag LOCUS_35020 CDS complement(4236480..4237595) product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073316.1 transl_table 11 codon_start 1 locus_tag LOCUS_35030 gene ribD CDS complement(4237678..4238127) product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073317.1 transl_table 11 codon_start 1 locus_tag LOCUS_35040 gene nrdR CDS complement(4238276..4239532) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073318.1 transl_table 11 codon_start 1 locus_tag LOCUS_35050 CDS 4239968..4241632 product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073319.1 transl_table 11 codon_start 1 locus_tag LOCUS_35060 gene ettA CDS 4241861..4243057 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073324.1 transl_table 11 codon_start 1 locus_tag LOCUS_35070 CDS complement(4243112..4243498) product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962382.1 transl_table 11 codon_start 1 locus_tag LOCUS_35080 CDS 4243680..4244093 product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963868.1 transl_table 11 codon_start 1 locus_tag LOCUS_35090 CDS complement(4244148..4247255) product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073327.1 transl_table 11 codon_start 1 locus_tag LOCUS_35100 CDS complement(4247255..4248373) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073326.1 transl_table 11 codon_start 1 locus_tag LOCUS_35110 CDS 4248697..4249161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35120 CDS complement(4249304..4250332) product DUF2955 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263570.1 transl_table 11 codon_start 1 locus_tag LOCUS_35130 CDS complement(4250410..4251477) product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263571.1 transl_table 11 codon_start 1 locus_tag LOCUS_35140 CDS 4251605..4252474 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263572.1 transl_table 11 codon_start 1 locus_tag LOCUS_35150 CDS 4252634..4253893 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35160 CDS 4254027..4254506 product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073331.1 transl_table 11 codon_start 1 locus_tag LOCUS_35170 CDS complement(4254882..4256672) product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071730.1 transl_table 11 codon_start 1 locus_tag LOCUS_35180 CDS 4256918..4257808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35190 CDS complement(4258186..4259157) product phosphate ABC transporter substrate-binding protein PstS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071729.1 transl_table 11 codon_start 1 locus_tag LOCUS_35200 CDS complement(4259374..4260567) product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071728.1 transl_table 11 codon_start 1 locus_tag LOCUS_35210 gene phoR CDS complement(4260773..4261462) product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071727.1 transl_table 11 codon_start 1 locus_tag LOCUS_35220 gene phoB CDS complement(4261656..4262612) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925663.1 transl_table 11 codon_start 1 locus_tag LOCUS_35230 CDS 4262907..4263818 product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071725.1 transl_table 11 codon_start 1 locus_tag LOCUS_35240 gene rdgC CDS complement(4263920..4265725) product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524104.1 transl_table 11 codon_start 1 locus_tag LOCUS_35250 CDS 4265922..4268075 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071724.1 transl_table 11 codon_start 1 locus_tag LOCUS_35260 CDS 4268220..4269776 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071723.1 transl_table 11 codon_start 1 locus_tag LOCUS_35270 CDS 4269878..4271230 product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071722.1 transl_table 11 codon_start 1 locus_tag LOCUS_35280 gene ppnN CDS 4271339..4272097 product flap endonuclease Xni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071721.1 transl_table 11 codon_start 1 locus_tag LOCUS_35290 gene xni CDS 4272277..4272663 product DUF3192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071720.1 transl_table 11 codon_start 1 locus_tag LOCUS_35300 CDS complement(4272700..4273299) product ribosomal protein S5-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704794.1 transl_table 11 codon_start 1 locus_tag LOCUS_35310 gene rimJ CDS complement(4273296..4274042) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951964.1 transl_table 11 codon_start 1 locus_tag LOCUS_35320 CDS complement(4274129..4274593) product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037388632.1 transl_table 11 codon_start 1 locus_tag LOCUS_35330 CDS complement(4274628..4275290) product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932168.1 transl_table 11 codon_start 1 locus_tag LOCUS_35340 CDS complement(4275508..4278309) product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071716.1 transl_table 11 codon_start 1 locus_tag LOCUS_35350 CDS 4278623..4279630 product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071715.1 transl_table 11 codon_start 1 locus_tag LOCUS_35360 CDS complement(4279691..4280773) product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071714.1 transl_table 11 codon_start 1 locus_tag LOCUS_35370 gene rlmM CDS complement(4280940..4281329) product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071713.1 transl_table 11 codon_start 1 locus_tag LOCUS_35380 CDS complement(4281322..4282059) product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925662.1 transl_table 11 codon_start 1 locus_tag LOCUS_35390 CDS complement(4282040..4282951) product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071711.1 transl_table 11 codon_start 1 locus_tag LOCUS_35400 CDS 4283133..4283360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35410 CDS complement(4283736..4285190) product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071709.1 transl_table 11 codon_start 1 locus_tag LOCUS_35420 gene thiI CDS complement(4285433..4286410) product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071708.1 transl_table 11 codon_start 1 locus_tag LOCUS_35430 CDS complement(4286415..4287182) product flagellar motor protein PomA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071707.1 transl_table 11 codon_start 1 locus_tag LOCUS_35440 gene pomA CDS 4287619..4287858 product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071706.1 transl_table 11 codon_start 1 locus_tag LOCUS_35450 gene xseB CDS 4287859..4288740 product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071705.1 transl_table 11 codon_start 1 locus_tag LOCUS_35460 gene ispA CDS 4288763..4290628 product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071704.1 transl_table 11 codon_start 1 locus_tag LOCUS_35470 gene dxs CDS complement(4290817..4291446) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071703.1 transl_table 11 codon_start 1 locus_tag LOCUS_35480 gene grpE CDS 4291589..4292467 product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071702.1 transl_table 11 codon_start 1 locus_tag LOCUS_35490 gene nadK CDS complement(4292518..4293708) product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073757.1 transl_table 11 codon_start 1 locus_tag LOCUS_35500 CDS complement(4293866..4294975) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071685.1 transl_table 11 codon_start 1 locus_tag LOCUS_35510 CDS 4295279..4296670 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481245.1 transl_table 11 codon_start 1 locus_tag LOCUS_35520 CDS complement(4296754..4298046) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071684.1 transl_table 11 codon_start 1 locus_tag LOCUS_35530 CDS complement(4298106..4301162) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071683.1 transl_table 11 codon_start 1 locus_tag LOCUS_35540 CDS 4301517..4302215 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071482.1 transl_table 11 codon_start 1 locus_tag LOCUS_35550 CDS 4302277..4302735 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071479.1 transl_table 11 codon_start 1 locus_tag LOCUS_35560 CDS complement(4302802..4304352) product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071478.1 transl_table 11 codon_start 1 locus_tag LOCUS_35570 CDS complement(4304420..4305274) product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071477.1 transl_table 11 codon_start 1 locus_tag LOCUS_35580 CDS 4305574..4306953 product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071476.1 transl_table 11 codon_start 1 locus_tag LOCUS_35590 gene yegQ CDS 4307089..4307346 product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071475.1 transl_table 11 codon_start 1 locus_tag LOCUS_35600 CDS complement(4307422..4309224) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365019.1 transl_table 11 codon_start 1 locus_tag LOCUS_35610 CDS complement(4309494..4310006) product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071474.1 transl_table 11 codon_start 1 locus_tag LOCUS_35620 CDS 4310184..4311185 product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071473.1 transl_table 11 codon_start 1 locus_tag LOCUS_35630 CDS 4311269..4312123 product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071472.1 transl_table 11 codon_start 1 locus_tag LOCUS_35640 CDS complement(4312212..4312886) product DUF998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071471.1 transl_table 11 codon_start 1 locus_tag LOCUS_35650 CDS 4313244..4313591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35660 CDS complement(4313689..4314507) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938152.1 transl_table 11 codon_start 1 locus_tag LOCUS_35670 CDS complement(4314703..4315380) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480862.1 transl_table 11 codon_start 1 locus_tag LOCUS_35680 CDS 4315891..4317246 product YjiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071470.1 transl_table 11 codon_start 1 locus_tag LOCUS_35690 CDS 4317380..4321084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35700 CDS 4321186..4321605 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071464.1 transl_table 11 codon_start 1 locus_tag LOCUS_35710 CDS complement(4321647..4323017) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071463.1 transl_table 11 codon_start 1 locus_tag LOCUS_35720 CDS 4323490..4324689 product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705471.1 transl_table 11 codon_start 1 locus_tag LOCUS_35730 CDS complement(4324612..4325193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35740 CDS 4325434..4325604 product trimethylamine N-oxide reductase system protein TorE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071462.1 transl_table 11 codon_start 1 locus_tag LOCUS_35750 gene torE CDS 4325675..4326853 product pentaheme c-type cytochrome TorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071461.1 transl_table 11 codon_start 1 locus_tag LOCUS_35760 gene torC CDS 4326887..4329379 product trimethylamine-N-oxide reductase TorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071460.1 transl_table 11 codon_start 1 locus_tag LOCUS_35770 gene torA CDS 4329527..4330201 product molecular chaperone TorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071459.1 transl_table 11 codon_start 1 locus_tag LOCUS_35780 gene torD CDS complement(4330305..4331114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35790 note possible pseudo, frameshifted CDS complement(4331162..4331476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35800 CDS complement(4331531..4332529) product dihydroorotate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295918.1 transl_table 11 codon_start 1 locus_tag LOCUS_35810 CDS complement(4332765..4334033) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073255.1 transl_table 11 codon_start 1 locus_tag LOCUS_35820 CDS complement(4334115..4337162) product TMAO reductase system sensor histidine kinase/response regulator TorS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071458.1 transl_table 11 codon_start 1 locus_tag LOCUS_35830 gene torS CDS 4337223..4338380 product TMAO reductase system periplasmic protein TorT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071457.1 transl_table 11 codon_start 1 locus_tag LOCUS_35840 gene torT CDS complement(4338418..4339152) product two-component system response regulator TorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071456.1 transl_table 11 codon_start 1 locus_tag LOCUS_35850 gene torR CDS 4339559..4339927 product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925839.1 transl_table 11 codon_start 1 locus_tag LOCUS_35860 CDS complement(4340036..4340743) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224891.1 transl_table 11 codon_start 1 locus_tag LOCUS_35870 gene deoD CDS 4340742..4340903 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35880 CDS 4340890..4341546 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073959.1 transl_table 11 codon_start 1 locus_tag LOCUS_35890 CDS complement(4341564..4341917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35900 CDS 4343216..4344598 product DUF4041 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195116.1 transl_table 11 codon_start 1 locus_tag LOCUS_35910 CDS complement(4345240..4346613) product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417762.1 transl_table 11 codon_start 1 locus_tag LOCUS_35920 gene radA CDS 4346947..4349361 product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071453.1 transl_table 11 codon_start 1 locus_tag LOCUS_35930 CDS complement(4349406..4349837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35940 CDS 4350015..4350158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35950 CDS complement(4350545..4351525) product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071451.1 transl_table 11 codon_start 1 locus_tag LOCUS_35960 gene serB CDS 4351658..4352239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35970 CDS complement(4352383..4353093) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071449.1 transl_table 11 codon_start 1 locus_tag LOCUS_35980 gene deoD CDS complement(4353233..4354450) product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071448.1 transl_table 11 codon_start 1 locus_tag LOCUS_35990 CDS complement(4354473..4355804) product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071447.1 transl_table 11 codon_start 1 locus_tag LOCUS_36000 gene deoA CDS complement(4356005..4356778) product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071446.1 transl_table 11 codon_start 1 locus_tag LOCUS_36010 gene deoC CDS complement(4357277..4358119) product outer membrane protein OmpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071445.1 transl_table 11 codon_start 1 locus_tag LOCUS_36020 CDS complement(4358499..4359773) product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071444.1 transl_table 11 codon_start 1 locus_tag LOCUS_36030 CDS complement(4359936..4360721) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925838.1 transl_table 11 codon_start 1 locus_tag LOCUS_36040 CDS complement(4360999..4362579) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071441.1 transl_table 11 codon_start 1 locus_tag LOCUS_36050 gene prfC CDS complement(4362778..4363671) product lipoprotein NlpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071440.1 transl_table 11 codon_start 1 locus_tag LOCUS_36060 gene nlpI CDS complement(4363896..4366004) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071439.1 transl_table 11 codon_start 1 locus_tag LOCUS_36070 gene pnp CDS 4366188..4368233 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071438.1 transl_table 11 codon_start 1 locus_tag LOCUS_36080 CDS complement(4368349..4368618) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071437.1 transl_table 11 codon_start 1 locus_tag LOCUS_36090 gene rpsO CDS complement(4368758..4369702) product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071436.1 transl_table 11 codon_start 1 locus_tag LOCUS_36100 gene truB CDS complement(4369702..4370124) product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071435.1 transl_table 11 codon_start 1 locus_tag LOCUS_36110 gene rbfA CDS complement(4370199..4372877) product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071434.1 transl_table 11 codon_start 1 locus_tag LOCUS_36120 gene infB CDS complement(4372904..4374403) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071433.1 transl_table 11 codon_start 1 locus_tag LOCUS_36130 gene nusA CDS complement(4374432..4374887) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071432.1 transl_table 11 codon_start 1 locus_tag LOCUS_36140 gene rimP tRNA complement(4375051..4375127) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00940 tRNA complement(4375219..4375305) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00950 CDS complement(4375455..4375799) product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071431.1 transl_table 11 codon_start 1 locus_tag LOCUS_36150 gene secG CDS complement(4375801..4376583) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071430.1 transl_table 11 codon_start 1 locus_tag LOCUS_36160 gene tpiA CDS complement(4376775..4378118) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071429.1 transl_table 11 codon_start 1 locus_tag LOCUS_36170 gene glmM CDS complement(4378243..4379085) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071428.1 transl_table 11 codon_start 1 locus_tag LOCUS_36180 gene folP CDS complement(4379190..4381067) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925641.1 transl_table 11 codon_start 1 locus_tag LOCUS_36190 gene ftsH CDS complement(4381215..4381805) product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071426.1 transl_table 11 codon_start 1 locus_tag LOCUS_36200 gene rlmE CDS 4381936..4382235 product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071425.1 transl_table 11 codon_start 1 locus_tag LOCUS_36210 gene yhbY CDS complement(4382349..4383278) product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071424.1 transl_table 11 codon_start 1 locus_tag LOCUS_36220 gene secF CDS complement(4383280..4385094) product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071423.1 transl_table 11 codon_start 1 locus_tag LOCUS_36230 gene secD CDS complement(4385227..4385724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36240 CDS complement(4385871..4386347) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071421.1 transl_table 11 codon_start 1 locus_tag LOCUS_36250 gene greA CDS 4386730..4387383 product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070887.1 transl_table 11 codon_start 1 locus_tag LOCUS_36260 CDS complement(4387507..4389825) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684941.1 transl_table 11 codon_start 1 locus_tag LOCUS_36270 CDS complement(4389961..4393179) product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071375.1 transl_table 11 codon_start 1 locus_tag LOCUS_36280 gene carB CDS complement(4393199..4394341) product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071374.1 transl_table 11 codon_start 1 locus_tag LOCUS_36290 gene carA CDS complement(4394608..4395420) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071373.1 transl_table 11 codon_start 1 locus_tag LOCUS_36300 gene dapB CDS complement(4395558..4396175) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071372.1 transl_table 11 codon_start 1 locus_tag LOCUS_36310 CDS complement(4396259..4397062) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071371.1 transl_table 11 codon_start 1 locus_tag LOCUS_36320 CDS complement(4397364..4398491) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071368.1 transl_table 11 codon_start 1 locus_tag LOCUS_36330 gene dnaJ CDS complement(4398613..4400535) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071367.1 transl_table 11 codon_start 1 locus_tag LOCUS_36340 gene dnaK CDS 4400914..4401840 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071366.1 transl_table 11 codon_start 1 locus_tag LOCUS_36350 CDS complement(4401990..4402667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36360 CDS 4403181..4405115 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963528.1 transl_table 11 codon_start 1 locus_tag LOCUS_36370 CDS 4405336..4405974 product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070729.1 transl_table 11 codon_start 1 locus_tag LOCUS_36380 CDS complement(4406013..4406576) product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073580.1 transl_table 11 codon_start 1 locus_tag LOCUS_36390 CDS complement(4406902..4407762) product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073578.1 transl_table 11 codon_start 1 locus_tag LOCUS_36400 CDS complement(4407874..4408935) product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073579.1 transl_table 11 codon_start 1 locus_tag LOCUS_36410 CDS complement(4409093..4409665) product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073580.1 transl_table 11 codon_start 1 locus_tag LOCUS_36420 CDS 4409836..4410402 product YajG family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073581.1 transl_table 11 codon_start 1 locus_tag LOCUS_36430 CDS 4410471..4411067 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073582.1 transl_table 11 codon_start 1 locus_tag LOCUS_36440 CDS 4411231..4411557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073583.1 transl_table 11 codon_start 1 locus_tag LOCUS_36450 CDS 4412342..4413757 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073584.1 transl_table 11 codon_start 1 locus_tag LOCUS_36460 CDS complement(4413864..4414349) product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073585.1 transl_table 11 codon_start 1 locus_tag LOCUS_36470 CDS 4415192..4416178 product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073587.1 transl_table 11 codon_start 1 locus_tag LOCUS_36480 CDS complement(4416166..4416294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36490 CDS 4416353..4417840 product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420103.1 transl_table 11 codon_start 1 locus_tag LOCUS_36500 CDS complement(4418075..4418923) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464903.1 transl_table 11 codon_start 1 locus_tag LOCUS_36510 CDS 4419076..4419465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36520 CDS 4419650..4420282 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545448.1 transl_table 11 codon_start 1 locus_tag LOCUS_36530 CDS complement(4420307..4421179) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073590.1 transl_table 11 codon_start 1 locus_tag LOCUS_36540 CDS complement(4421365..4422906) product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070418.1 transl_table 11 codon_start 1 locus_tag LOCUS_36550 CDS complement(4423093..4423941) product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073591.1 transl_table 11 codon_start 1 locus_tag LOCUS_36560 gene kdsA CDS complement(4424750..4426012) product DUF819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073592.1 transl_table 11 codon_start 1 locus_tag LOCUS_36570 CDS complement(4426212..4427000) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073593.1 transl_table 11 codon_start 1 locus_tag LOCUS_36580 CDS complement(4427000..4427395) product SirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073594.1 transl_table 11 codon_start 1 locus_tag LOCUS_36590 CDS complement(4427518..4428423) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105226.1 transl_table 11 codon_start 1 locus_tag LOCUS_36600 CDS 4428515..4428934 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073595.1 transl_table 11 codon_start 1 locus_tag LOCUS_36610 CDS complement(4429409..4430251) product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073596.1 transl_table 11 codon_start 1 locus_tag LOCUS_36620 gene prmC CDS complement(4430324..4431409) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073597.1 transl_table 11 codon_start 1 locus_tag LOCUS_36630 gene prfA CDS complement(4431423..4432673) product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073598.1 transl_table 11 codon_start 1 locus_tag LOCUS_36640 gene hemA CDS 4433184..4433609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36650 CDS 4433610..4434467 product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073600.1 transl_table 11 codon_start 1 locus_tag LOCUS_36660 gene ispE CDS 4434508..4435482 product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073601.1 transl_table 11 codon_start 1 locus_tag LOCUS_36670 tRNA complement(4436332..4436416) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00960 tRNA complement(4436526..4436610) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00970 tRNA complement(4436728..4436802) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00980 tRNA complement(4436858..4436942) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00990 tRNA complement(4437138..4437214) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t01000 tRNA complement(4437250..4437324) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t01010 tRNA complement(4437356..4437430) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t01020 tRNA complement(4437482..4437566) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t01030 tRNA complement(4437710..4437786) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t01040 CDS complement(4438086..4439177) product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071416.1 transl_table 11 codon_start 1 locus_tag LOCUS_36680 gene ychF CDS complement(4439299..4439895) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071415.1 transl_table 11 codon_start 1 locus_tag LOCUS_36690 gene pth CDS complement(4440095..4441291) product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071414.1 transl_table 11 codon_start 1 locus_tag LOCUS_36700 CDS 4441507..4441818 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36710 CDS 4442137..4443561 product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071412.1 transl_table 11 codon_start 1 locus_tag LOCUS_36720 gene miaB CDS 4443718..4444758 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071411.1 transl_table 11 codon_start 1 locus_tag LOCUS_36730 CDS 4444751..4445227 product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071410.1 transl_table 11 codon_start 1 locus_tag LOCUS_36740 gene ybeY CDS 4445277..4446152 product CNNM family magnesium/cobalt transport protein CorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071409.1 transl_table 11 codon_start 1 locus_tag LOCUS_36750 gene corC CDS 4446626..4447747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36760 CDS complement(4447835..4449703) product methyl-accepting chemotaxis protein Mlp37 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672477.1 transl_table 11 codon_start 1 locus_tag LOCUS_36770 gene mlp37 CDS 4450162..4450539 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422154.1 transl_table 11 codon_start 1 locus_tag LOCUS_36780 CDS complement(4450600..4453419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36790 CDS complement(4454246..4454440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36800 CDS 4454685..4455119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36810 CDS complement(4455230..4455730) product zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071406.1 transl_table 11 codon_start 1 locus_tag LOCUS_36820 CDS 4455850..4458453 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071405.1 transl_table 11 codon_start 1 locus_tag LOCUS_36830 gene leuS CDS 4458529..4458978 product LPS exporter LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071404.1 transl_table 11 codon_start 1 locus_tag LOCUS_36840 CDS 4459103..4460086 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071403.1 transl_table 11 codon_start 1 locus_tag LOCUS_36850 gene holA CDS 4460091..4460729 product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071402.1 transl_table 11 codon_start 1 locus_tag LOCUS_36860 gene nadD CDS 4460835..4461164 product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071401.1 transl_table 11 codon_start 1 locus_tag LOCUS_36870 gene rsfS CDS 4461164..4461634 product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071400.1 transl_table 11 codon_start 1 locus_tag LOCUS_36880 gene rlmH CDS 4461735..4463567 product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071399.1 transl_table 11 codon_start 1 locus_tag LOCUS_36890 gene mrdA CDS 4463564..4464670 product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071398.1 transl_table 11 codon_start 1 locus_tag LOCUS_36900 gene rodA CDS 4464858..4465877 product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071397.1 transl_table 11 codon_start 1 locus_tag LOCUS_36910 gene mltB CDS 4465970..4466776 product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071396.1 transl_table 11 codon_start 1 locus_tag LOCUS_36920 CDS 4466928..4468100 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071395.1 transl_table 11 codon_start 1 locus_tag LOCUS_36930 CDS 4468223..4468489 product DUF493 family protein YbeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071394.1 transl_table 11 codon_start 1 locus_tag LOCUS_36940 gene ybeD CDS 4468654..4469319 product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071393.1 transl_table 11 codon_start 1 locus_tag LOCUS_36950 gene lipB CDS 4469312..4470277 product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071392.1 transl_table 11 codon_start 1 locus_tag LOCUS_36960 gene lipA CDS complement(4470371..4470826) product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925834.1 transl_table 11 codon_start 1 locus_tag LOCUS_36970 gene rimI CDS complement(4470816..4471184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36980 tRNA complement(4471459..4471535) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t01050 tRNA complement(4471603..4471679) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t01060 CDS complement(4472878..4473144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36990 CDS complement(4473428..4473946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37000 note possible pseudo, frameshifted CDS 4474285..4474437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37010 rRNA complement(4474674..4474776) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00230 rRNA complement(4474932..4477833) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00240 rRNA complement(4478170..4479712) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00250 CDS complement(4480471..4481226) product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073396.1 transl_table 11 codon_start 1 locus_tag LOCUS_37020 gene pssA CDS 4481370..4481816 product DUF4124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073397.1 transl_table 11 codon_start 1 locus_tag LOCUS_37030 CDS complement(4481948..4484521) product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073398.1 transl_table 11 codon_start 1 locus_tag LOCUS_37040 gene clpB CDS complement(4484643..4485362) product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073399.1 transl_table 11 codon_start 1 locus_tag LOCUS_37050 gene pgeF CDS complement(4485381..4486352) product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073400.1 transl_table 11 codon_start 1 locus_tag LOCUS_37060 gene rluD CDS 4486430..4487236 product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073401.1 transl_table 11 codon_start 1 locus_tag LOCUS_37070 tRNA 4487500..4487575 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t01070 CDS complement(4487695..4489557) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073602.1 transl_table 11 codon_start 1 locus_tag LOCUS_37080 CDS 4489819..4490781 product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480764.1 transl_table 11 codon_start 1 locus_tag LOCUS_37090 CDS 4491017..4491553 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073603.1 transl_table 11 codon_start 1 locus_tag LOCUS_37100 CDS 4491553..4492095 product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073604.1 transl_table 11 codon_start 1 locus_tag LOCUS_37110 CDS 4492092..4493042 product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073605.1 transl_table 11 codon_start 1 locus_tag LOCUS_37120 CDS complement(4493106..4493795) product 16S rRNA pseudouridine(516) synthase RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073606.1 transl_table 11 codon_start 1 locus_tag LOCUS_37130 gene rsuA CDS 4494218..4496302 product M13 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073607.1 transl_table 11 codon_start 1 locus_tag LOCUS_37140 CDS 4496489..4497292 product RelA/SpoT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073608.1 transl_table 11 codon_start 1 locus_tag LOCUS_37150 CDS 4497357..4497767 product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073609.1 transl_table 11 codon_start 1 locus_tag LOCUS_37160 CDS 4497994..4498383 product DUF4447 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073610.1 transl_table 11 codon_start 1 locus_tag LOCUS_37170 CDS complement(4498503..4499126) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706087.1 transl_table 11 codon_start 1 locus_tag LOCUS_37180 CDS 4499783..4501072 product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478826.1 transl_table 11 codon_start 1 locus_tag LOCUS_37190 CDS 4501095..4502489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37200 CDS 4502606..4503070 product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037422212.1 transl_table 11 codon_start 1 locus_tag LOCUS_37210 CDS 4503274..4504962 product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073614.1 transl_table 11 codon_start 1 locus_tag LOCUS_37220 CDS 4505678..4506550 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071258.1 transl_table 11 codon_start 1 locus_tag LOCUS_37230 CDS complement(4506649..4508343) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071259.1 transl_table 11 codon_start 1 locus_tag LOCUS_37240 CDS complement(4508745..4509182) product DUF3069 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073615.1 transl_table 11 codon_start 1 locus_tag LOCUS_37250 CDS 4509569..4511401 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073617.1 transl_table 11 codon_start 1 locus_tag LOCUS_37260 CDS complement(4511422..4512255) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073618.1 transl_table 11 codon_start 1 locus_tag LOCUS_37270 CDS 4512463..4512918 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37280 CDS complement(4512981..4513529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37290 CDS complement(4513783..4515237) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081157730.1 transl_table 11 codon_start 1 locus_tag LOCUS_37300 CDS complement(4515239..4516909) product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142798.1 transl_table 11 codon_start 1 locus_tag LOCUS_37310 CDS complement(4516999..4517823) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531321.1 transl_table 11 codon_start 1 locus_tag LOCUS_37320 CDS complement(4517880..4518425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37330 CDS complement(4518441..4519376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37340 CDS complement(4519738..4520562) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529874.1 transl_table 11 codon_start 1 locus_tag LOCUS_37350 CDS 4520725..4521411 product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195469.1 transl_table 11 codon_start 1 locus_tag LOCUS_37360 CDS 4521455..4521784 product ferredoxin family 2Fe-2S iron-sulfur cluster binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389779.1 transl_table 11 codon_start 1 locus_tag LOCUS_37370 CDS 4522030..4523025 product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454392.1 transl_table 11 codon_start 1 locus_tag LOCUS_37380 gene add CDS complement(4523093..4524691) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106074.1 transl_table 11 codon_start 1 locus_tag LOCUS_37390 CDS complement(4524898..4525623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37400 CDS complement(4525698..4526141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37410 CDS complement(4526248..4527099) product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966449.1 transl_table 11 codon_start 1 locus_tag LOCUS_37420 CDS complement(4527128..4528495) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729591.1 transl_table 11 codon_start 1 locus_tag LOCUS_37430 CDS 4528894..4530090 product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073619.1 transl_table 11 codon_start 1 locus_tag LOCUS_37440 gene queG CDS complement(4530193..4530399) product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097345.1 transl_table 11 codon_start 1 locus_tag LOCUS_37450 CDS complement(4530865..4531881) product IS110-like element ISPa11 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147159.1 transl_table 11 codon_start 1 locus_tag LOCUS_37460 CDS 4532426..4532656 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37470 CDS 4532760..4533206 product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206733.1 transl_table 11 codon_start 1 locus_tag LOCUS_37480 CDS complement(4533568..4533828) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37490 note possible pseudo, internal stop codon CDS 4534246..4535793 product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071238.1 transl_table 11 codon_start 1 locus_tag LOCUS_37500 CDS 4536086..4538053 product alkyl sulfatase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706082.1 transl_table 11 codon_start 1 locus_tag LOCUS_37510 CDS complement(4538242..4539936) product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612392.1 transl_table 11 codon_start 1 locus_tag LOCUS_37520 CDS complement(4539961..4540614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37530 CDS complement(4540608..4541180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37540 CDS 4541458..4542777 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921846.1 transl_table 11 codon_start 1 locus_tag LOCUS_37550 CDS 4542877..4543242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37560 CDS complement(4543313..4543885) product protein disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421462.1 transl_table 11 codon_start 1 locus_tag LOCUS_37570 CDS complement(4543882..4544736) product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815919.1 transl_table 11 codon_start 1 locus_tag LOCUS_37580 CDS complement(4544861..4546939) product protein-disulfide reductase DsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481629.1 transl_table 11 codon_start 1 locus_tag LOCUS_37590 CDS complement(4547064..4550192) product multidrug efflux RND transporter permease subunit VmeZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477161.1 transl_table 11 codon_start 1 locus_tag LOCUS_37600 gene vmeZ CDS complement(4550189..4551367) product multidrug efflux RND transporter periplasmic adaptor subunit VmeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477351.1 transl_table 11 codon_start 1 locus_tag LOCUS_37610 gene vmeY CDS complement(4551667..4552167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37620 CDS 4552484..4554034 product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106349.1 transl_table 11 codon_start 1 locus_tag LOCUS_37630 CDS 4554466..4555242 product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693864.1 transl_table 11 codon_start 1 locus_tag LOCUS_37640 gene kdsB CDS complement(4555492..4557804) product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071112.1 transl_table 11 codon_start 1 locus_tag LOCUS_37650 gene metE CDS 4558016..4558921 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071111.1 transl_table 11 codon_start 1 locus_tag LOCUS_37660 CDS complement(4559047..4559775) product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071110.1 transl_table 11 codon_start 1 locus_tag LOCUS_37670 CDS complement(4560062..4560685) product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691652.1 transl_table 11 codon_start 1 locus_tag LOCUS_37680 CDS complement(4561055..4562911) product TonB-dependent vitamin B12 receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112350.1 transl_table 11 codon_start 1 locus_tag LOCUS_37690 gene btuB CDS 4563730..4564167 product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640294.1 transl_table 11 codon_start 1 locus_tag LOCUS_37700 CDS 4564164..4565462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37710 CDS complement(4565684..4566004) product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789114.1 transl_table 11 codon_start 1 locus_tag LOCUS_37720 CDS complement(4565994..4566587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37730 CDS 4566830..4567309 product azurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071104.1 transl_table 11 codon_start 1 locus_tag LOCUS_37740 gene azu CDS 4567589..4569355 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37750 CDS 4569626..4571203 product autoinducer-2 kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042661593.1 transl_table 11 codon_start 1 locus_tag LOCUS_37760 gene lsrK CDS 4571338..4571712 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000909986.1 transl_table 11 codon_start 1 locus_tag LOCUS_37770 CDS complement(4571750..4572286) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263911.1 transl_table 11 codon_start 1 locus_tag LOCUS_37780 CDS complement(4572404..4573678) product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261548.1 transl_table 11 codon_start 1 locus_tag LOCUS_37790 CDS 4573801..4574760 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263913.1 transl_table 11 codon_start 1 locus_tag LOCUS_37800 CDS 4574939..4577116 product cation:dicarboxylase symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020540.1 transl_table 11 codon_start 1 locus_tag LOCUS_37810 CDS complement(4577200..4577736) product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042161.1 transl_table 11 codon_start 1 locus_tag LOCUS_37820 CDS complement(4577788..4578630) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37830 CDS complement(4578775..4579506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072480.1 transl_table 11 codon_start 1 locus_tag LOCUS_37840 CDS 4579733..4579918 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37850 CDS complement(4579951..4580670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37860 CDS 4580920..4581954 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764852.1 transl_table 11 codon_start 1 locus_tag LOCUS_37870 gene pyrC CDS complement(4582081..4582386) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37880 CDS complement(4582727..4583260) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071762.1 transl_table 11 codon_start 1 locus_tag LOCUS_37890 CDS 4583422..4583676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37900 CDS complement(4583858..4585096) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071842.1 transl_table 11 codon_start 1 locus_tag LOCUS_37910 CDS complement(4585417..4585725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37920 CDS complement(4586240..4587217) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071997.1 transl_table 11 codon_start 1 locus_tag LOCUS_37930 CDS complement(4587484..4587879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37940 CDS complement(4587896..4591174) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071845.1 transl_table 11 codon_start 1 locus_tag LOCUS_37950 CDS complement(4591658..4592776) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070848.1 transl_table 11 codon_start 1 locus_tag LOCUS_37960 CDS complement(4593092..4593412) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263074.1 transl_table 11 codon_start 1 locus_tag LOCUS_37970 CDS 4593348..4593575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37980 CDS complement(4593572..4593871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37990 CDS complement(4594076..4594612) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480180.1 transl_table 11 codon_start 1 locus_tag LOCUS_38000 CDS 4595066..4596388 product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261107.1 transl_table 11 codon_start 1 locus_tag LOCUS_38010 CDS 4596385..4599510 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261108.1 transl_table 11 codon_start 1 locus_tag LOCUS_38020 CDS 4600138..4600416 product peptidylprolyl isomerase PpiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422988.1 transl_table 11 codon_start 1 locus_tag LOCUS_38030 gene ppiC CDS complement(4600710..4602209) product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021902.1 transl_table 11 codon_start 1 locus_tag LOCUS_38040 CDS complement(4602524..4603378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38050 CDS complement(4603375..4603842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38060 CDS complement(4603850..4605673) product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013008044.1 transl_table 11 codon_start 1 locus_tag LOCUS_38070 CDS complement(4605772..4607391) product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056336.1 transl_table 11 codon_start 1 locus_tag LOCUS_38080 CDS complement(4607747..4608322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38090 CDS complement(4608605..4611058) product OmcA/MtrC family decaheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483575.1 transl_table 11 codon_start 1 locus_tag LOCUS_38100 CDS 4611151..4611294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38110 CDS complement(4611523..4612026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38120 CDS 4612333..4612500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38130 CDS 4612505..4613776 product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875867.1 transl_table 11 codon_start 1 locus_tag LOCUS_38140 gene hemL CDS 4614133..4614315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38150 CDS complement(4614364..4615035) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263640.1 transl_table 11 codon_start 1 locus_tag LOCUS_38160 CDS 4615468..4616049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38170 CDS complement(4616148..4616804) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263525.1 transl_table 11 codon_start 1 locus_tag LOCUS_38180 CDS 4617036..4619108 product M13 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073607.1 transl_table 11 codon_start 1 locus_tag LOCUS_38190 CDS complement(4619239..4619487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38200 CDS complement(4619740..4621026) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938989.1 transl_table 11 codon_start 1 locus_tag LOCUS_38210 CDS complement(4621026..4621937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494047.1 transl_table 11 codon_start 1 locus_tag LOCUS_38220 CDS complement(4621940..4622575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38230 CDS complement(4622978..4624015) product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478421.1 transl_table 11 codon_start 1 locus_tag LOCUS_38240 CDS complement(4624556..4625092) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071218.1 transl_table 11 codon_start 1 locus_tag LOCUS_38250 CDS complement(4625104..4625928) product cytochrome C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925828.1 transl_table 11 codon_start 1 locus_tag LOCUS_38260 CDS 4626400..4627134 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071220.1 transl_table 11 codon_start 1 locus_tag LOCUS_38270 CDS 4627127..4627645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071221.1 transl_table 11 codon_start 1 locus_tag LOCUS_38280 CDS 4627933..4628145 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423776.1 transl_table 11 codon_start 1 locus_tag LOCUS_38290 CDS 4628438..4628647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38300 CDS complement(4628658..4628888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38310 CDS complement(4629290..4630138) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012535189.1 transl_table 11 codon_start 1 locus_tag LOCUS_38320 CDS 4630455..4632275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38330 CDS complement(4632345..4633997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38340 CDS 4634363..4636900 product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403224.1 transl_table 11 codon_start 1 locus_tag LOCUS_38350 CDS complement(4636947..4637348) product ribosome recycling factor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071091.1 transl_table 11 codon_start 1 locus_tag LOCUS_38360 CDS complement(4637496..4638569) product DUF3083 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072833.1 transl_table 11 codon_start 1 locus_tag LOCUS_38370 CDS complement(4638909..4639652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38380 CDS 4640082..4641779 product phosphoethanolamine--lipid A transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705420.1 transl_table 11 codon_start 1 locus_tag LOCUS_38390 CDS complement(4641988..4642236) product DUF3297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071089.1 transl_table 11 codon_start 1 locus_tag LOCUS_38400 CDS complement(4642481..4643710) product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094878.1 transl_table 11 codon_start 1 locus_tag LOCUS_38410 gene gltS CDS 4644147..4645820 product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838696.1 transl_table 11 codon_start 1 locus_tag LOCUS_38420 CDS complement(4645898..4647451) product ammonia-forming nitrite reductase cytochrome c552 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073711.1 transl_table 11 codon_start 1 locus_tag LOCUS_38430 gene nrfA CDS 4648527..4648976 product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477123.1 transl_table 11 codon_start 1 locus_tag LOCUS_38440 CDS complement(4648962..4650224) product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626085.1 transl_table 11 codon_start 1 locus_tag LOCUS_38450 CDS 4650528..4650974 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073336.1 transl_table 11 codon_start 1 locus_tag LOCUS_38460 CDS 4651073..4651480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38470 CDS 4651980..4654028 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38480 CDS complement(4654375..4654776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38490 note possible pseudo, frameshifted CDS complement(4654716..4655375) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38500 note possible pseudo, frameshifted CDS 4656300..4656743 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38510 CDS 4657038..4657385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38520 CDS 4657379..4657675 product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389330.1 transl_table 11 codon_start 1 locus_tag LOCUS_38530 CDS 4657672..4658013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38540 CDS 4658091..4659146 product DUF4040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599366.1 transl_table 11 codon_start 1 locus_tag LOCUS_38550 CDS 4659127..4659495 product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 transl_table 11 codon_start 1 locus_tag LOCUS_38560 CDS 4659489..4660967 product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328227.1 transl_table 11 codon_start 1 locus_tag LOCUS_38570 CDS 4660964..4662454 product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921413.1 transl_table 11 codon_start 1 locus_tag LOCUS_38580 CDS 4662444..4662866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38590 CDS 4662853..4664565 product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118364.1 transl_table 11 codon_start 1 locus_tag LOCUS_38600 CDS complement(4664828..4665343) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38610 CDS complement(4666592..4669492) product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071084.1 transl_table 11 codon_start 1 locus_tag LOCUS_38620 gene gcvP CDS complement(4669825..4670214) product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071083.1 transl_table 11 codon_start 1 locus_tag LOCUS_38630 gene gcvH CDS complement(4670260..4671354) product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071082.1 transl_table 11 codon_start 1 locus_tag LOCUS_38640 gene gcvT CDS complement(4671797..4673029) product FAD-dependent 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071081.1 transl_table 11 codon_start 1 locus_tag LOCUS_38650 CDS complement(4673100..4674377) product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071080.1 transl_table 11 codon_start 1 locus_tag LOCUS_38660 gene ubiH CDS complement(4674490..4675065) product UPF0149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071079.1 transl_table 11 codon_start 1 locus_tag LOCUS_38670 CDS 4675389..4675697 product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071078.1 transl_table 11 codon_start 1 locus_tag LOCUS_38680 gene zapA CDS 4676171..4677739 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470631.1 transl_table 11 codon_start 1 locus_tag LOCUS_38690 CDS 4677930..4678568 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38700 CDS 4679115..4679498 product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815873.1 transl_table 11 codon_start 1 locus_tag LOCUS_38710 CDS 4679495..4679695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38720 CDS complement(4679782..4680375) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162012.1 transl_table 11 codon_start 1 locus_tag LOCUS_38730 CDS complement(4680486..4681118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38740 CDS complement(4681477..4682484) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38750 CDS complement(4682661..4684169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38760 CDS complement(4684135..4684311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38770 CDS complement(4684382..4684528) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38780 CDS complement(4684525..4684737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38790 CDS complement(4685433..4685600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38800 CDS 4685802..4686449 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071077.1 transl_table 11 codon_start 1 locus_tag LOCUS_38810 CDS complement(4686480..4687289) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073325.1 transl_table 11 codon_start 1 locus_tag LOCUS_38820 CDS 4687573..4688067 product copper resistance protein NlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925739.1 transl_table 11 codon_start 1 locus_tag LOCUS_38830 CDS complement(4688145..4688813) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925909.1 transl_table 11 codon_start 1 locus_tag LOCUS_38840 gene ung CDS 4689026..4689577 product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073454.1 transl_table 11 codon_start 1 locus_tag LOCUS_38850 CDS 4689621..4690145 product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073454.1 transl_table 11 codon_start 1 locus_tag LOCUS_38860 CDS 4690312..4690671 product DUF3144 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073455.1 transl_table 11 codon_start 1 locus_tag LOCUS_38870 CDS complement(4690850..4691464) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073456.1 transl_table 11 codon_start 1 locus_tag LOCUS_38880 CDS complement(4691683..4694256) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919539.1 transl_table 11 codon_start 1 locus_tag LOCUS_38890 CDS 4694808..4696256 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073458.1 transl_table 11 codon_start 1 locus_tag LOCUS_38900 CDS 4696489..4697985 product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073459.1 transl_table 11 codon_start 1 locus_tag LOCUS_38910 gene ccoG CDS 4698250..4699851 product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073460.1 transl_table 11 codon_start 1 locus_tag LOCUS_38920 CDS complement(4699909..4700919) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582560.1 transl_table 11 codon_start 1 locus_tag LOCUS_38930 CDS complement(4700945..4701415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38940 CDS 4702099..4702368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420208.1 transl_table 11 codon_start 1 locus_tag LOCUS_38950 CDS complement(4702657..4703178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38960 CDS 4703663..4704679 product IS110-like element ISPa11 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147159.1 transl_table 11 codon_start 1 locus_tag LOCUS_38970 CDS complement(4705123..4706967) product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073461.1 transl_table 11 codon_start 1 locus_tag LOCUS_38980 CDS 4707193..4707519 product DUF2956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481072.1 transl_table 11 codon_start 1 locus_tag LOCUS_38990 CDS complement(4707569..4709737) product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704907.1 transl_table 11 codon_start 1 locus_tag LOCUS_39000 CDS 4709917..4710447 product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088234.1 transl_table 11 codon_start 1 locus_tag LOCUS_39010 CDS 4710447..4710836 product DUF2149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024510.1 transl_table 11 codon_start 1 locus_tag LOCUS_39020 CDS 4710836..4714771 product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114926.1 transl_table 11 codon_start 1 locus_tag LOCUS_39030 gene cobN CDS 4715279..4715485 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011562175.1 transl_table 11 codon_start 1 locus_tag LOCUS_39040 CDS complement(4715653..4715805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39050 CDS 4716062..4716232 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072284.1 transl_table 11 codon_start 1 locus_tag LOCUS_39060 CDS 4716478..4717395 product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261404.1 transl_table 11 codon_start 1 locus_tag LOCUS_39070 CDS 4717481..4717783 product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418034.1 transl_table 11 codon_start 1 locus_tag LOCUS_39080 gene ureA CDS 4717834..4718151 product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261403.1 transl_table 11 codon_start 1 locus_tag LOCUS_39090 CDS 4718154..4719857 product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261402.1 transl_table 11 codon_start 1 locus_tag LOCUS_39100 gene ureC CDS 4719914..4720468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39110 CDS 4720472..4721155 product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418029.1 transl_table 11 codon_start 1 locus_tag LOCUS_39120 CDS 4721283..4721906 product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261400.1 transl_table 11 codon_start 1 locus_tag LOCUS_39130 gene ureG CDS 4722052..4723311 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706908.1 transl_table 11 codon_start 1 locus_tag LOCUS_39140 CDS complement(4723390..4724280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39150 CDS complement(4724493..4724786) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073474.1 transl_table 11 codon_start 1 locus_tag LOCUS_39160 CDS 4724983..4725708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39170 CDS 4725710..4727257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39180 CDS 4727323..4727889 product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460763.1 transl_table 11 codon_start 1 locus_tag LOCUS_39190 CDS complement(4728449..4729075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39200 CDS complement(4729675..4730016) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39210 CDS complement(4730231..4730647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39220 CDS complement(4730664..4731656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39230 CDS complement(4731813..4732244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39240 CDS complement(4732494..4734122) product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967310.1 transl_table 11 codon_start 1 locus_tag LOCUS_39250 CDS complement(4734582..4735328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970466.1 transl_table 11 codon_start 1 locus_tag LOCUS_39260 CDS complement(4735352..4736047) product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008460272.1 transl_table 11 codon_start 1 locus_tag LOCUS_39270 CDS complement(4736248..4736577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39280 CDS complement(4736910..4737989) product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073258.1 transl_table 11 codon_start 1 locus_tag LOCUS_39290 CDS 4738118..4738714 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073259.1 transl_table 11 codon_start 1 locus_tag LOCUS_39300 CDS complement(4739048..4739491) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073475.1 transl_table 11 codon_start 1 locus_tag LOCUS_39310 CDS complement(4739597..4740028) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073476.1 transl_table 11 codon_start 1 locus_tag LOCUS_39320 CDS complement(4740264..4740695) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073476.1 transl_table 11 codon_start 1 locus_tag LOCUS_39330 CDS 4741081..4742532 product coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073478.1 transl_table 11 codon_start 1 locus_tag LOCUS_39340 CDS 4742679..4743254 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073479.1 transl_table 11 codon_start 1 locus_tag LOCUS_39350 CDS complement(4743319..4744662) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39360 CDS complement(4744886..4746397) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073484.1 transl_table 11 codon_start 1 locus_tag LOCUS_39370 CDS complement(4746615..4747823) product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073485.1 transl_table 11 codon_start 1 locus_tag LOCUS_39380 CDS complement(4747849..4749150) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073486.1 transl_table 11 codon_start 1 locus_tag LOCUS_39390 CDS complement(4749162..4749959) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073487.1 transl_table 11 codon_start 1 locus_tag LOCUS_39400 CDS complement(4750073..4750396) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39410 CDS complement(4750407..4751669) product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073489.1 transl_table 11 codon_start 1 locus_tag LOCUS_39420 CDS 4752027..4753064 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072998.1 transl_table 11 codon_start 1 locus_tag LOCUS_39430 CDS 4753076..4756318 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072999.1 transl_table 11 codon_start 1 locus_tag LOCUS_39440 CDS 4756382..4756609 product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073000.1 transl_table 11 codon_start 1 locus_tag LOCUS_39450 CDS 4756655..4757002 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969103.1 transl_table 11 codon_start 1 locus_tag LOCUS_39460 CDS 4757434..4758468 product IS110-like element IS1111A family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041952483.1 transl_table 11 codon_start 1 locus_tag LOCUS_39470 CDS complement(4759257..4759640) product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073500.1 transl_table 11 codon_start 1 locus_tag LOCUS_39480 CDS complement(4759728..4760579) product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073501.1 transl_table 11 codon_start 1 locus_tag LOCUS_39490 CDS complement(4761074..4761727) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071298.1 transl_table 11 codon_start 1 locus_tag LOCUS_39500 gene cobO CDS complement(4761764..4763323) product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071297.1 transl_table 11 codon_start 1 locus_tag LOCUS_39510 CDS complement(4763492..4764046) product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071296.1 transl_table 11 codon_start 1 locus_tag LOCUS_39520 gene cobU CDS complement(4764163..4764951) product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071295.1 transl_table 11 codon_start 1 locus_tag LOCUS_39530 CDS complement(4765009..4766037) product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071294.1 transl_table 11 codon_start 1 locus_tag LOCUS_39540 gene cobT CDS complement(4766257..4767369) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071293.1 transl_table 11 codon_start 1 locus_tag LOCUS_39550 CDS complement(4767362..4768291) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071292.1 transl_table 11 codon_start 1 locus_tag LOCUS_39560 CDS complement(4768918..4769559) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071291.1 transl_table 11 codon_start 1 locus_tag LOCUS_39570 CDS complement(4769680..4772571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39580 CDS 4773264..4777019 product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071290.1 transl_table 11 codon_start 1 locus_tag LOCUS_39590 gene metH CDS 4777897..4778049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39600 CDS 4778039..4778644 product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071193.1 transl_table 11 codon_start 1 locus_tag LOCUS_39610 CDS complement(4778619..4778837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39620 CDS complement(4779229..4780419) product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538099.1 transl_table 11 codon_start 1 locus_tag LOCUS_39630 CDS 4780738..4782459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39640 CDS complement(4783086..4783850) product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878638.1 transl_table 11 codon_start 1 locus_tag LOCUS_39650 CDS complement(4783962..4784729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39660 CDS complement(4784726..4785907) product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860940.1 transl_table 11 codon_start 1 locus_tag LOCUS_39670 CDS complement(4787049..4789184) product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073033.1 transl_table 11 codon_start 1 locus_tag LOCUS_39680 CDS complement(4789843..4790250) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39690 CDS complement(4790362..4791240) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704739.1 transl_table 11 codon_start 1 locus_tag LOCUS_39700 CDS 4791335..4791778 product PACE efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462438.1 transl_table 11 codon_start 1 locus_tag LOCUS_39710 CDS 4791893..4793518 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073402.1 transl_table 11 codon_start 1 locus_tag LOCUS_39720 CDS complement(4793651..4796257) product bifunctional uridylyltransferase/uridylyl-removing protein GlnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071782.1 transl_table 11 codon_start 1 locus_tag LOCUS_39730 gene glnD CDS complement(4796620..4797159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39740 CDS 4797603..4797848 product YdcH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263641.1 transl_table 11 codon_start 1 locus_tag LOCUS_39750 CDS 4798312..4798683 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39760 CDS complement(4798798..4799607) product DUF599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073551.1 transl_table 11 codon_start 1 locus_tag LOCUS_39770 CDS 4799644..4799838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39780 CDS 4799878..4800135 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39790 CDS 4800487..4801083 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39800 CDS 4801167..4801640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39810 CDS complement(4801852..4802058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39820 CDS 4802387..4802860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071052.1 transl_table 11 codon_start 1 locus_tag LOCUS_39830 CDS 4803155..4804015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39840 CDS complement(4804127..4804489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39850 CDS complement(4804709..4806187) product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337441.1 transl_table 11 codon_start 1 locus_tag LOCUS_39860 CDS complement(4806330..4807112) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389704.1 transl_table 11 codon_start 1 locus_tag LOCUS_39870 CDS 4807220..4808473 product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097065.1 transl_table 11 codon_start 1 locus_tag LOCUS_39880 CDS 4808626..4809207 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925848.1 transl_table 11 codon_start 1 locus_tag LOCUS_39890 CDS 4809324..4809863 product YgjV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071751.1 transl_table 11 codon_start 1 locus_tag LOCUS_39900 CDS 4810197..4813007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39910 CDS 4813150..4814031 product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027710.1 transl_table 11 codon_start 1 locus_tag LOCUS_39920 gene fabG CDS 4814102..4815163 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083827.1 transl_table 11 codon_start 1 locus_tag LOCUS_39930 CDS 4815329..4815544 product ribosome alternative rescue factor ArfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925916.1 transl_table 11 codon_start 1 locus_tag LOCUS_39940 CDS 4816006..4816938 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207404.1 transl_table 11 codon_start 1 locus_tag LOCUS_39950 CDS complement(4816985..4817395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39960 CDS complement(4817454..4817948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39970 CDS complement(4818291..4818503) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39980 CDS complement(4818813..4819733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071385.1 transl_table 11 codon_start 1 locus_tag LOCUS_39990 CDS complement(4819867..4821045) product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477374.1 transl_table 11 codon_start 1 locus_tag LOCUS_40000 CDS complement(4821330..4822421) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071380.1 transl_table 11 codon_start 1 locus_tag LOCUS_40010 CDS 4822650..4823915 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072061.1 transl_table 11 codon_start 1 locus_tag LOCUS_40020 CDS 4823939..4824151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40030 CDS complement(4824181..4825014) product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071303.1 transl_table 11 codon_start 1 locus_tag LOCUS_40040 CDS complement(4825093..4826727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40050 CDS 4827228..4827887 product DNA-J related domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073506.1 transl_table 11 codon_start 1 locus_tag LOCUS_40060 CDS 4828076..4828729 product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073507.1 transl_table 11 codon_start 1 locus_tag LOCUS_40070 CDS complement(4828811..4829887) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40080 CDS complement(4829924..4830460) product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073508.1 transl_table 11 codon_start 1 locus_tag LOCUS_40090 CDS complement(4830555..4830998) product menaquinone-dependent protoporphyrinogen IX dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073509.1 transl_table 11 codon_start 1 locus_tag LOCUS_40100 gene hemG CDS complement(4831319..4832938) product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695173.1 transl_table 11 codon_start 1 locus_tag LOCUS_40110 CDS complement(4833091..4834245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40120 CDS complement(4834324..4835709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40130 CDS 4836068..4837240 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423059.1 transl_table 11 codon_start 1 locus_tag LOCUS_40140 CDS 4837328..4838161 product TIGR03899 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073510.1 transl_table 11 codon_start 1 locus_tag LOCUS_40150 CDS complement(4838175..4839023) product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073514.1 transl_table 11 codon_start 1 locus_tag LOCUS_40160 gene cobA CDS 4839458..4840969 product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073515.1 transl_table 11 codon_start 1 locus_tag LOCUS_40170 CDS 4840998..4841345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40180 CDS 4841583..4841843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40190 CDS 4841922..4842446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40200 CDS complement(4842492..4843346) product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073708.1 transl_table 11 codon_start 1 locus_tag LOCUS_40210 CDS complement(4843462..4843875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40220 CDS complement(4843994..4845748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073516.1 transl_table 11 codon_start 1 locus_tag LOCUS_40230 CDS complement(4846436..4847206) product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073519.1 transl_table 11 codon_start 1 locus_tag LOCUS_40240 CDS complement(4847181..4848947) product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073520.1 transl_table 11 codon_start 1 locus_tag LOCUS_40250 gene cysI CDS complement(4849012..4850814) product assimilatory sulfite reductase (NADPH) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073521.1 transl_table 11 codon_start 1 locus_tag LOCUS_40260 CDS 4851064..4852548 product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483426.1 transl_table 11 codon_start 1 locus_tag LOCUS_40270 CDS 4852831..4853097 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40280 CDS complement(4853436..4853921) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073525.1 transl_table 11 codon_start 1 locus_tag LOCUS_40290 CDS complement(4854040..4854921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073526.1 transl_table 11 codon_start 1 locus_tag LOCUS_40300 CDS 4855232..4856080 product LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073528.1 transl_table 11 codon_start 1 locus_tag LOCUS_40310 CDS 4856328..4858616 product nitric-oxide reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527410.1 transl_table 11 codon_start 1 locus_tag LOCUS_40320 CDS 4858838..4860388 product nitric oxide reductase transcriptional regulator NorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703251.1 transl_table 11 codon_start 1 locus_tag LOCUS_40330 gene norR CDS 4860471..4861916 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073532.1 transl_table 11 codon_start 1 locus_tag LOCUS_40340 CDS 4861913..4863514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40350 CDS 4863925..4864557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40360 CDS 4864672..4864944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40370 CDS 4865003..4865308 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40380 CDS 4865428..4866879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40390 CDS 4866879..4867748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40400 CDS 4867752..4868426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40410 CDS 4868429..4868626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40420 CDS 4868640..4869536 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40430 CDS 4869533..4870843 product pilus assembly protein N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064054.1 transl_table 11 codon_start 1 locus_tag LOCUS_40440 CDS 4870853..4872586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40450 CDS 4872579..4873430 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136348290.1 transl_table 11 codon_start 1 locus_tag LOCUS_40460 CDS 4873440..4874303 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40470 CDS 4874305..4874649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40480 CDS 4874637..4875140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40490 CDS 4875179..4875826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40500 CDS 4875966..4880018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40510 CDS 4880072..4880479 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40520 CDS 4880636..4881343 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40530 CDS 4881333..4881803 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40540 CDS 4881874..4882419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40550 CDS 4882424..4883104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40560 CDS 4883239..4883682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40570 CDS 4883751..4884770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40580 CDS 4884830..4885048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40590 CDS 4885451..4886980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40600 CDS 4887218..4889068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40610 CDS 4889140..4890582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40620 CDS 4890661..4891815 product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925763.1 transl_table 11 codon_start 1 locus_tag LOCUS_40630 gene zapE CDS 4891957..4894044 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099358.1 transl_table 11 codon_start 1 locus_tag LOCUS_40640 CDS 4894205..4896448 product DUF6351 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225776.1 transl_table 11 codon_start 1 locus_tag LOCUS_40650 CDS 4896510..4898183 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266361.1 transl_table 11 codon_start 1 locus_tag LOCUS_40660 CDS complement(4898383..4899957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40670 CDS 4900183..4900644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40680 CDS 4900659..4901447 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478879.1 transl_table 11 codon_start 1 locus_tag LOCUS_40690 CDS complement(4901476..4902156) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40700 CDS 4902314..4903198 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929840.1 transl_table 11 codon_start 1 locus_tag LOCUS_40710 CDS complement(4903242..4903604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40720 CDS complement(4903711..4904454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40730 CDS complement(4904650..4905417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40740 CDS complement(4905650..4906099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40750 CDS complement(4906123..4913793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40760 CDS complement(4914113..4916974) product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073537.1 transl_table 11 codon_start 1 locus_tag LOCUS_40770 gene glnE CDS 4917245..4918204 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073538.1 transl_table 11 codon_start 1 locus_tag LOCUS_40780 CDS 4918218..4919117 product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073539.1 transl_table 11 codon_start 1 locus_tag LOCUS_40790 CDS 4919199..4920926 product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073540.1 transl_table 11 codon_start 1 locus_tag LOCUS_40800 CDS 4921049..4921462 product DUF2170 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007645549.1 transl_table 11 codon_start 1 locus_tag LOCUS_40810 CDS 4921546..4922232 product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073541.1 transl_table 11 codon_start 1 locus_tag LOCUS_40820 CDS 4922358..4923011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073542.1 transl_table 11 codon_start 1 locus_tag LOCUS_40830 CDS 4923102..4923431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073543.1 transl_table 11 codon_start 1 locus_tag LOCUS_40840 CDS 4923500..4924309 product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073544.1 transl_table 11 codon_start 1 locus_tag LOCUS_40850 CDS complement(4924641..4926143) product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073545.1 transl_table 11 codon_start 1 locus_tag LOCUS_40860 CDS 4926430..4927110 product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073546.1 transl_table 11 codon_start 1 locus_tag LOCUS_40870 CDS 4927135..4928403 product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073547.1 transl_table 11 codon_start 1 locus_tag LOCUS_40880 CDS 4928638..4929213 product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925911.1 transl_table 11 codon_start 1 locus_tag LOCUS_40890 CDS 4929527..4932721 product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193378418.1 transl_table 11 codon_start 1 locus_tag LOCUS_40900 gene putA CDS 4932838..4933014 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073552.1 transl_table 11 codon_start 1 locus_tag LOCUS_40910 CDS 4933273..4935156 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482186.1 transl_table 11 codon_start 1 locus_tag LOCUS_40920 CDS complement(4935248..4937035) product cysteine/glutathione ABC transporter ATP-binding protein/permease CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073554.1 transl_table 11 codon_start 1 locus_tag LOCUS_40930 gene cydC CDS complement(4937032..4938837) product cysteine/glutathione ABC transporter permease/ATP-binding protein CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073555.1 transl_table 11 codon_start 1 locus_tag LOCUS_40940 gene cydD CDS complement(4939134..4939487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40950 CDS complement(4939566..4939775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40960 CDS 4940312..4942279 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40970 CDS complement(4942345..4942893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40980 CDS 4943285..4944739 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073558.1 transl_table 11 codon_start 1 locus_tag LOCUS_40990 CDS complement(4944793..4946175) product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072447.1 transl_table 11 codon_start 1 locus_tag LOCUS_41000 CDS 4946576..4947025 product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071172.1 transl_table 11 codon_start 1 locus_tag LOCUS_41010 CDS 4947219..4948907 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838626.1 transl_table 11 codon_start 1 locus_tag LOCUS_41020 CDS 4949049..4949480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41030 CDS complement(4950146..4951522) product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071179.1 transl_table 11 codon_start 1 locus_tag LOCUS_41040 gene dbpA CDS complement(4951909..4953309) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202813.1 transl_table 11 codon_start 1 locus_tag LOCUS_41050 CDS 4953655..4953966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41060 CDS 4954101..4956023 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041216960.1 transl_table 11 codon_start 1 locus_tag LOCUS_41070 rRNA complement(4957381..4957483) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00260 rRNA complement(4957639..4960540) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00270 rRNA complement(4960862..4962404) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00280 CDS complement(4963800..4964012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41080 rRNA complement(4964098..4964200) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00290 rRNA complement(4964356..4967257) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00300 rRNA complement(4967579..4969121) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00310 CDS 4970324..4970794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41090 CDS complement(4970892..4971092) product YheV family putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071175.1 transl_table 11 codon_start 1 locus_tag LOCUS_41100 CDS 4971274..4973184 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071174.1 transl_table 11 codon_start 1 locus_tag LOCUS_41110 CDS 4973237..4973674 product DUF2390 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071173.1 transl_table 11 codon_start 1 locus_tag LOCUS_41120 CDS complement(4973730..4975316) product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071171.1 transl_table 11 codon_start 1 locus_tag LOCUS_41130 CDS complement(4975398..4975907) product TAT leader-containing periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071170.1 transl_table 11 codon_start 1 locus_tag LOCUS_41140 CDS 4976089..4977051 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071169.1 transl_table 11 codon_start 1 locus_tag LOCUS_41150 CDS 4977087..4977323 product YheU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071168.1 transl_table 11 codon_start 1 locus_tag LOCUS_41160 CDS 4977483..4978370 product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071167.1 transl_table 11 codon_start 1 locus_tag LOCUS_41170 CDS complement(4979069..4979848) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070955.1 transl_table 11 codon_start 1 locus_tag LOCUS_41180 CDS 4980300..4980935 product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070954.1 transl_table 11 codon_start 1 locus_tag LOCUS_41190 gene crp CDS 4981019..4981357 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070953.1 transl_table 11 codon_start 1 locus_tag LOCUS_41200 CDS 4981389..4982063 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070952.1 transl_table 11 codon_start 1 locus_tag LOCUS_41210 CDS 4982060..4983382 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070951.1 transl_table 11 codon_start 1 locus_tag LOCUS_41220 CDS complement(4983455..4984252) product DUF1338 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070950.1 transl_table 11 codon_start 1 locus_tag LOCUS_41230 CDS complement(4984437..4985897) product succinylglutamate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070949.1 transl_table 11 codon_start 1 locus_tag LOCUS_41240 gene astD CDS complement(4985906..4986925) product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070948.1 transl_table 11 codon_start 1 locus_tag LOCUS_41250 gene astA CDS complement(4987074..4988291) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070947.1 transl_table 11 codon_start 1 locus_tag LOCUS_41260 CDS complement(4988732..4989874) product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070945.1 transl_table 11 codon_start 1 locus_tag LOCUS_41270 CDS complement(4990006..4990413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41280 CDS complement(4990489..4992972) product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070944.1 transl_table 11 codon_start 1 locus_tag LOCUS_41290 CDS complement(4993134..4993706) product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070943.1 transl_table 11 codon_start 1 locus_tag LOCUS_41300 CDS complement(4993866..4994348) product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070942.1 transl_table 11 codon_start 1 locus_tag LOCUS_41310 CDS complement(4994348..4994977) product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070941.1 transl_table 11 codon_start 1 locus_tag LOCUS_41320 gene sspA CDS complement(4995076..4995777) product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070940.1 transl_table 11 codon_start 1 locus_tag LOCUS_41330 CDS complement(4995777..4996991) product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070939.1 transl_table 11 codon_start 1 locus_tag LOCUS_41340 CDS complement(4996991..4997581) product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070938.1 transl_table 11 codon_start 1 locus_tag LOCUS_41350 gene petA CDS complement(4997908..4998786) product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070937.1 transl_table 11 codon_start 1 locus_tag LOCUS_41360 gene hflC CDS complement(4998789..4999937) product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070936.1 transl_table 11 codon_start 1 locus_tag LOCUS_41370 gene hflK CDS complement(4999980..5001278) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070935.1 transl_table 11 codon_start 1 locus_tag LOCUS_41380 gene hflX CDS complement(5001299..5001565) product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070934.1 transl_table 11 codon_start 1 locus_tag LOCUS_41390 gene hfq CDS complement(5001660..5002586) product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070933.1 transl_table 11 codon_start 1 locus_tag LOCUS_41400 gene miaA CDS complement(5002663..5004552) product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070932.1 transl_table 11 codon_start 1 locus_tag LOCUS_41410 gene mutL CDS complement(5004602..5005921) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070931.1 transl_table 11 codon_start 1 locus_tag LOCUS_41420 CDS complement(5005924..5006403) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070930.1 transl_table 11 codon_start 1 locus_tag LOCUS_41430 gene tsaE CDS complement(5006484..5007974) product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070929.1 transl_table 11 codon_start 1 locus_tag LOCUS_41440 CDS complement(5008307..5008762) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070928.1 transl_table 11 codon_start 1 locus_tag LOCUS_41450 tRNA complement(5009354..5009447) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t01080 tRNA complement(5009625..5009700) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t01090 tRNA complement(5009751..5009826) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t01100 tRNA complement(5009875..5009950) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t01110 tRNA complement(5010205..5010280) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t01120 CDS complement(5010472..5011017) product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070927.1 transl_table 11 codon_start 1 locus_tag LOCUS_41460 gene orn CDS 5011171..5012184 product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070926.1 transl_table 11 codon_start 1 locus_tag LOCUS_41470 gene rsgA CDS 5012218..5013081 product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070925.1 transl_table 11 codon_start 1 locus_tag LOCUS_41480 gene asd CDS 5013081..5013959 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037769.1 transl_table 11 codon_start 1 locus_tag LOCUS_41490 CDS 5014125..5017337 product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070924.1 transl_table 11 codon_start 1 locus_tag LOCUS_41500 CDS 5017337..5018032 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070923.1 transl_table 11 codon_start 1 locus_tag LOCUS_41510 CDS 5018210..5019136 product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070921.1 transl_table 11 codon_start 1 locus_tag LOCUS_41520 CDS complement(5019173..5020750) product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070920.1 transl_table 11 codon_start 1 locus_tag LOCUS_41530 CDS 5021013..5021204 product bacterioferritin-associated ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070919.1 transl_table 11 codon_start 1 locus_tag LOCUS_41540 CDS complement(5021284..5023557) product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073643.1 transl_table 11 codon_start 1 locus_tag LOCUS_41550 gene parC CDS complement(5023554..5024621) product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073644.1 transl_table 11 codon_start 1 locus_tag LOCUS_41560 CDS complement(5024765..5026651) product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073645.1 transl_table 11 codon_start 1 locus_tag LOCUS_41570 gene parE CDS complement(5026707..5027279) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073646.1 transl_table 11 codon_start 1 locus_tag LOCUS_41580 CDS complement(5027493..5028332) product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073647.1 transl_table 11 codon_start 1 locus_tag LOCUS_41590 gene cpdA CDS complement(5028345..5028635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41600 CDS complement(5029029..5029637) product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369649.1 transl_table 11 codon_start 1 locus_tag LOCUS_41610 gene nudF CDS 5029971..5031299 product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073650.1 transl_table 11 codon_start 1 locus_tag LOCUS_41620 gene tolC CDS complement(5031442..5032191) product TIGR04219 family outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073651.1 transl_table 11 codon_start 1 locus_tag LOCUS_41630 CDS complement(5032199..5033170) product DUF2333 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073652.1 transl_table 11 codon_start 1 locus_tag LOCUS_41640 CDS complement(5033201..5033680) product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073653.1 transl_table 11 codon_start 1 locus_tag LOCUS_41650 CDS 5033712..5034449 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073654.1 transl_table 11 codon_start 1 locus_tag LOCUS_41660 CDS complement(5034528..5034929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41670 CDS complement(5034926..5035138) product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073655.1 transl_table 11 codon_start 1 locus_tag LOCUS_41680 CDS complement(5035283..5035582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073657.1 transl_table 11 codon_start 1 locus_tag LOCUS_41690 CDS complement(5035855..5036856) product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073658.1 transl_table 11 codon_start 1 locus_tag LOCUS_41700 gene dusA CDS 5037109..5037573 product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073661.1 transl_table 11 codon_start 1 locus_tag LOCUS_41710 CDS complement(5037633..5038988) product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477374.1 transl_table 11 codon_start 1 locus_tag LOCUS_41720 CDS complement(5039058..5040134) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073662.1 transl_table 11 codon_start 1 locus_tag LOCUS_41730 gene alr CDS complement(5040319..5041725) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073663.1 transl_table 11 codon_start 1 locus_tag LOCUS_41740 gene dnaB CDS 5041837..5044059 product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073664.1 transl_table 11 codon_start 1 locus_tag LOCUS_41750 CDS complement(5044698..5045150) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073672.1 transl_table 11 codon_start 1 locus_tag LOCUS_41760 gene rplI CDS complement(5045178..5045405) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006083042.1 transl_table 11 codon_start 1 locus_tag LOCUS_41770 gene rpsR CDS complement(5045417..5045599) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41780 CDS complement(5045731..5046159) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073674.1 transl_table 11 codon_start 1 locus_tag LOCUS_41790 gene rpsF CDS 5046540..5047301 product DUF481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073675.1 transl_table 11 codon_start 1 locus_tag LOCUS_41800 CDS complement(5048097..5048387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41810 CDS complement(5048585..5048812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41820 CDS complement(5048963..5049820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41830 CDS complement(5050739..5051488) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073677.1 transl_table 11 codon_start 1 locus_tag LOCUS_41840 gene rlmB CDS complement(5051504..5054005) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073678.1 transl_table 11 codon_start 1 locus_tag LOCUS_41850 gene rnr CDS complement(5054074..5054730) product flagellar protein MotX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073679.1 transl_table 11 codon_start 1 locus_tag LOCUS_41860 gene motX CDS complement(5054957..5056252) product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073680.1 transl_table 11 codon_start 1 locus_tag LOCUS_41870 CDS complement(5056319..5056507) product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073681.1 transl_table 11 codon_start 1 locus_tag LOCUS_41880 CDS complement(5056676..5057068) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006083052.1 transl_table 11 codon_start 1 locus_tag LOCUS_41890 gene rpsI CDS complement(5057083..5057514) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073682.1 transl_table 11 codon_start 1 locus_tag LOCUS_41900 gene rplM CDS complement(5057767..5058873) product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073683.1 transl_table 11 codon_start 1 locus_tag LOCUS_41910 gene zapE CDS 5058975..5059349 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41920 CDS 5059507..5060859 product Do family serine endopeptidase DegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073684.1 transl_table 11 codon_start 1 locus_tag LOCUS_41930 gene degQ CDS 5061032..5062114 product outer membrane-stress sensor serine endopeptidase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073685.1 transl_table 11 codon_start 1 locus_tag LOCUS_41940 gene degS CDS complement(5062496..5064193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41950 CDS complement(5064391..5065023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41960 CDS complement(5065016..5066419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41970 CDS complement(5066988..5067863) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454103.1 transl_table 11 codon_start 1 locus_tag LOCUS_41980 CDS complement(5068207..5069466) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073687.1 transl_table 11 codon_start 1 locus_tag LOCUS_41990 gene murA CDS complement(5069480..5069770) product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073688.1 transl_table 11 codon_start 1 locus_tag LOCUS_42000 CDS complement(5069775..5070077) product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073689.1 transl_table 11 codon_start 1 locus_tag LOCUS_42010 CDS complement(5070078..5070740) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073690.1 transl_table 11 codon_start 1 locus_tag LOCUS_42020 CDS complement(5070812..5071276) product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073691.1 transl_table 11 codon_start 1 locus_tag LOCUS_42030 gene mlaD CDS complement(5071331..5072113) product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073692.1 transl_table 11 codon_start 1 locus_tag LOCUS_42040 gene mlaE CDS complement(5072175..5072993) product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073693.1 transl_table 11 codon_start 1 locus_tag LOCUS_42050 gene mlaF CDS 5073164..5074123 product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261186.1 transl_table 11 codon_start 1 locus_tag LOCUS_42060 CDS 5074163..5075140 product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073694.1 transl_table 11 codon_start 1 locus_tag LOCUS_42070 CDS 5075142..5075699 product 3-deoxy-manno-octulosonate-8-phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073695.1 transl_table 11 codon_start 1 locus_tag LOCUS_42080 gene kdsC CDS 5075696..5076283 product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073696.1 transl_table 11 codon_start 1 locus_tag LOCUS_42090 gene lptC CDS 5076382..5076960 product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073697.1 transl_table 11 codon_start 1 locus_tag LOCUS_42100 gene lptA CDS 5076957..5077688 product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073698.1 transl_table 11 codon_start 1 locus_tag LOCUS_42110 gene lptB CDS 5077842..5079320 product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073699.1 transl_table 11 codon_start 1 locus_tag LOCUS_42120 CDS 5079532..5079819 product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073700.1 transl_table 11 codon_start 1 locus_tag LOCUS_42130 gene hpf CDS 5079822..5080265 product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073701.1 transl_table 11 codon_start 1 locus_tag LOCUS_42140 gene ptsN CDS 5080262..5081110 product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073702.1 transl_table 11 codon_start 1 locus_tag LOCUS_42150 gene rapZ CDS 5081103..5081378 product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073703.1 transl_table 11 codon_start 1 locus_tag LOCUS_42160 CDS 5081753..5083114 product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073704.1 transl_table 11 codon_start 1 locus_tag LOCUS_42170 gene mgtE CDS complement(5083270..5084061) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073705.1 transl_table 11 codon_start 1 locus_tag LOCUS_42180 CDS complement(5084278..5084958) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073706.1 transl_table 11 codon_start 1 locus_tag LOCUS_42190 CDS complement(5085084..5085497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42200 CDS complement(5085494..5086891) product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095324.1 transl_table 11 codon_start 1 locus_tag LOCUS_42210 CDS complement(5086888..5087907) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057335.1 transl_table 11 codon_start 1 locus_tag LOCUS_42220 CDS 5088037..5088735 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457963.1 transl_table 11 codon_start 1 locus_tag LOCUS_42230 CDS 5088812..5089981 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457946.1 transl_table 11 codon_start 1 locus_tag LOCUS_42240 CDS complement(5089997..5090209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42250 CDS complement(5090473..5090835) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42260 CDS complement(5091227..5093377) product decaheme c-type cytochrome OmcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071902.1 transl_table 11 codon_start 1 locus_tag LOCUS_42270 gene omcA CDS 5093316..5093645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42280 CDS 5093796..5095121 product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703897.1 transl_table 11 codon_start 1 locus_tag LOCUS_42290 CDS 5095146..5096102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703898.1 transl_table 11 codon_start 1 locus_tag LOCUS_42300 CDS complement(5096157..5096963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42310 CDS 5097188..5098144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42320 CDS complement(5098207..5099574) product DUF4397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073739.1 transl_table 11 codon_start 1 locus_tag LOCUS_42330 CDS complement(5099859..5101439) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42340 CDS complement(5101771..5102454) product tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010991902.1 transl_table 11 codon_start 1 locus_tag LOCUS_42350 gene mnmD CDS 5102736..5103680 product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481255.1 transl_table 11 codon_start 1 locus_tag LOCUS_42360 gene rarD CDS complement(5103699..5104301) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125221.1 transl_table 11 codon_start 1 locus_tag LOCUS_42370 CDS 5104420..5105427 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072427.1 transl_table 11 codon_start 1 locus_tag LOCUS_42380 CDS complement(5105514..5106890) product class II fumarate hydratase FumC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112741.1 transl_table 11 codon_start 1 locus_tag LOCUS_42390 gene fumC CDS complement(5106975..5107349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42400 CDS complement(5107541..5109613) product alkyl sulfatase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110061.1 transl_table 11 codon_start 1 locus_tag LOCUS_42410 CDS complement(5109704..5110720) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444337.1 transl_table 11 codon_start 1 locus_tag LOCUS_42420 CDS 5111501..5114521 product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070509.1 transl_table 11 codon_start 1 transl_except (pos:5112080..5112082,aa:Sec) note codon on position 194 is selenocysteine opal codon. locus_tag LOCUS_42430 gene fdnG CDS 5114524..5115441 product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070510.1 transl_table 11 codon_start 1 locus_tag LOCUS_42440 gene fdxH CDS 5115447..5116091 product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070511.1 transl_table 11 codon_start 1 locus_tag LOCUS_42450 CDS 5116094..5117023 product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070512.1 transl_table 11 codon_start 1 locus_tag LOCUS_42460 gene fdhE CDS 5117102..5118535 product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070513.1 transl_table 11 codon_start 1 locus_tag LOCUS_42470 gene selA CDS 5118665..5120560 product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025822336.1 transl_table 11 codon_start 1 locus_tag LOCUS_42480 gene selB tRNA complement(5120545..5120639) product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t01130 CDS 5120779..5121645 product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070515.1 transl_table 11 codon_start 1 locus_tag LOCUS_42490 gene fdhD CDS complement(5121691..5122410) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889420.1 transl_table 11 codon_start 1 locus_tag LOCUS_42500 gene pstB CDS complement(5122404..5123234) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791711.1 transl_table 11 codon_start 1 locus_tag LOCUS_42510 CDS complement(5123288..5124166) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791710.1 transl_table 11 codon_start 1 locus_tag LOCUS_42520 CDS complement(5124192..5125028) product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939936.1 transl_table 11 codon_start 1 locus_tag LOCUS_42530 CDS complement(5125350..5132360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42540 CDS complement(5133016..5134914) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162796741.1 transl_table 11 codon_start 1 locus_tag LOCUS_42550 CDS complement(5135175..5136182) product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071353.1 transl_table 11 codon_start 1 locus_tag LOCUS_42560 CDS complement(5136281..5138035) product urocanate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074216.1 transl_table 11 codon_start 1 locus_tag LOCUS_42570 gene urdA CDS complement(5138065..5138811) product outer membrane protein OmpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074217.1 transl_table 11 codon_start 1 locus_tag LOCUS_42580 CDS complement(5139188..5140399) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074218.1 transl_table 11 codon_start 1 locus_tag LOCUS_42590 CDS complement(5140389..5141063) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074219.1 transl_table 11 codon_start 1 locus_tag LOCUS_42600 CDS complement(5141067..5141813) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074220.1 transl_table 11 codon_start 1 locus_tag LOCUS_42610 CDS 5142284..5143456 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925604.1 transl_table 11 codon_start 1 locus_tag LOCUS_42620 CDS complement(5143556..5144773) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705373.1 transl_table 11 codon_start 1 locus_tag LOCUS_42630 CDS 5145001..5145630 product DUF1326 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148701912.1 transl_table 11 codon_start 1 locus_tag LOCUS_42640 CDS 5145823..5146383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42650 CDS 5146737..5147387 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42660 CDS 5147398..5150115 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42670 CDS complement(5150228..5150791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42680 CDS 5150806..5151867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42690 CDS 5151925..5152545 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42700 CDS 5152539..5154080 product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214612.1 transl_table 11 codon_start 1 locus_tag LOCUS_42710 CDS 5154084..5154797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42720 CDS 5154821..5155417 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42730 CDS complement(5155404..5155712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42740 CDS 5155674..5156075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42750 CDS 5156508..5156873 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42760 CDS complement(5157506..5157844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42770 CDS 5157935..5158114 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42780 CDS 5158367..5159308 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42790 CDS 5159312..5159980 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042743.1 transl_table 11 codon_start 1 locus_tag LOCUS_42800 CDS complement(5160001..5160747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42810 CDS complement(5161062..5161460) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941568.1 transl_table 11 codon_start 1 locus_tag LOCUS_42820 CDS complement(5161809..5162186) product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530046.1 transl_table 11 codon_start 1 locus_tag LOCUS_42830 CDS complement(5162733..5162945) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42840 CDS complement(5163358..5163852) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481711.1 transl_table 11 codon_start 1 locus_tag LOCUS_42850 CDS complement(5163972..5164802) product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071310.1 transl_table 11 codon_start 1 locus_tag LOCUS_42860 CDS 5165106..5166524 product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918774.1 transl_table 11 codon_start 1 locus_tag LOCUS_42870 CDS 5167229..5168146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42880 CDS complement(5168214..5169290) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921231.1 transl_table 11 codon_start 1 locus_tag LOCUS_42890 CDS complement(5169425..5169928) product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071039.1 transl_table 11 codon_start 1 locus_tag LOCUS_42900 CDS complement(5169951..5170187) product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071038.1 transl_table 11 codon_start 1 locus_tag LOCUS_42910 CDS complement(5170503..5170874) product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764611.1 transl_table 11 codon_start 1 locus_tag LOCUS_42920 CDS 5171134..5173104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42930 CDS 5173207..5173458 product DUF2999 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071035.1 transl_table 11 codon_start 1 locus_tag LOCUS_42940 CDS 5173795..5175204 product ammonia-forming nitrite reductase cytochrome c552 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073711.1 transl_table 11 codon_start 1 locus_tag LOCUS_42950 gene nrfA CDS 5175659..5176864 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706715.1 transl_table 11 codon_start 1 locus_tag LOCUS_42960 tRNA complement(5177178..5177253) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t01140 CDS complement(5177570..5177890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42970 CDS 5178102..5179244 product NAD/NADP-dependent octopine/nopaline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485002.1 transl_table 11 codon_start 1 locus_tag LOCUS_42980 CDS 5179731..5181293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42990 CDS 5181460..5181732 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43000 CDS complement(5181858..5183570) product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460261.1 transl_table 11 codon_start 1 locus_tag LOCUS_43010 CDS complement(5184138..5185115) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071997.1 transl_table 11 codon_start 1 locus_tag LOCUS_43020 CDS complement(5185229..5185948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43030 CDS complement(5186104..5186616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43040 CDS complement(5186697..5188295) product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015051728.1 transl_table 11 codon_start 1 locus_tag LOCUS_43050 CDS complement(5188626..5189603) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071997.1 transl_table 11 codon_start 1 locus_tag LOCUS_43060 CDS complement(5189704..5190720) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446974.1 transl_table 11 codon_start 1 locus_tag LOCUS_43070 CDS complement(5190953..5191375) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43080 CDS complement(5191914..5192816) product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261738.1 transl_table 11 codon_start 1 locus_tag LOCUS_43090 CDS 5193303..5194361 product nuclease-related domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888392.1 transl_table 11 codon_start 1 locus_tag LOCUS_43100 CDS 5194417..5194941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43110 CDS complement(5195366..5195926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43120 CDS complement(5196376..5198028) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071022.1 transl_table 11 codon_start 1 locus_tag LOCUS_43130 gene groL CDS complement(5198112..5198402) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071021.1 transl_table 11 codon_start 1 locus_tag LOCUS_43140 CDS 5198653..5199987 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071020.1 transl_table 11 codon_start 1 locus_tag LOCUS_43150 CDS complement(5200078..5200404) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43160 CDS 5200300..5200731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43170 CDS complement(5200796..5201740) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071019.1 transl_table 11 codon_start 1 locus_tag LOCUS_43180 CDS 5201990..5203069 product efflux RND transporter periplasmic adaptor subunit VmeG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462329.1 transl_table 11 codon_start 1 locus_tag LOCUS_43190 gene vmeG CDS 5203133..5206204 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141271555.1 transl_table 11 codon_start 1 locus_tag LOCUS_43200 CDS 5206422..5206823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43210 CDS 5206940..5207299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073750.1 transl_table 11 codon_start 1 locus_tag LOCUS_43220 CDS complement(5207485..5207787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43230 CDS complement(5207980..5208384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43240 CDS complement(5208524..5210926) product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070915.1 transl_table 11 codon_start 1 locus_tag LOCUS_43250 CDS complement(5211160..5214867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43260 CDS complement(5215154..5216548) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070914.1 transl_table 11 codon_start 1 locus_tag LOCUS_43270 CDS 5216956..5219862 product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070913.1 transl_table 11 codon_start 1 locus_tag LOCUS_43280 gene rapA CDS 5220063..5220905 product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070912.1 transl_table 11 codon_start 1 locus_tag LOCUS_43290 CDS complement(5220951..5221448) product YqhA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880137.1 transl_table 11 codon_start 1 locus_tag LOCUS_43300 CDS complement(5221610..5222416) product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070911.1 transl_table 11 codon_start 1 locus_tag LOCUS_43310 CDS 5222754..5223698 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070910.1 transl_table 11 codon_start 1 locus_tag LOCUS_43320 CDS 5223712..5224674 product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070909.1 transl_table 11 codon_start 1 locus_tag LOCUS_43330 CDS complement(5224767..5225180) product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070908.1 transl_table 11 codon_start 1 locus_tag LOCUS_43340 gene rraB CDS complement(5225312..5226037) product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070907.1 transl_table 11 codon_start 1 locus_tag LOCUS_43350 CDS complement(5226279..5227070) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070906.1 transl_table 11 codon_start 1 locus_tag LOCUS_43360 CDS complement(5227142..5228056) product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925611.1 transl_table 11 codon_start 1 locus_tag LOCUS_43370 CDS complement(5228040..5229257) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070904.1 transl_table 11 codon_start 1 locus_tag LOCUS_43380 CDS complement(5229500..5229784) product zinc ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070903.1 transl_table 11 codon_start 1 locus_tag LOCUS_43390 CDS complement(5230384..5230797) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070901.1 transl_table 11 codon_start 1 locus_tag LOCUS_43400 CDS 5230940..5232544 product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263910.1 transl_table 11 codon_start 1 locus_tag LOCUS_43410 CDS complement(5232599..5234311) product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070900.1 transl_table 11 codon_start 1 locus_tag LOCUS_43420 CDS 5234499..5235446 product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187219.1 transl_table 11 codon_start 1 locus_tag LOCUS_43430 CDS complement(5235588..5236472) product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070899.1 transl_table 11 codon_start 1 locus_tag LOCUS_43440 CDS complement(5236683..5237309) product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931672.1 transl_table 11 codon_start 1 locus_tag LOCUS_43450 gene cheD CDS complement(5237448..5238329) product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070897.1 transl_table 11 codon_start 1 locus_tag LOCUS_43460 CDS 5238385..5238696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070896.1 transl_table 11 codon_start 1 locus_tag LOCUS_43470 CDS complement(5238805..5239341) product DUF3016 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070894.1 transl_table 11 codon_start 1 locus_tag LOCUS_43480 CDS 5239572..5239877 product periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070893.1 transl_table 11 codon_start 1 locus_tag LOCUS_43490 CDS 5239970..5240251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43500 CDS 5240600..5240917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43510 CDS complement(5240976..5241491) product DUF4240 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070891.1 transl_table 11 codon_start 1 locus_tag LOCUS_43520 CDS 5241718..5242122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070890.1 transl_table 11 codon_start 1 locus_tag LOCUS_43530 CDS 5242399..5242671 product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070888.1 transl_table 11 codon_start 1 locus_tag LOCUS_43540 CDS 5242935..5243627 product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070887.1 transl_table 11 codon_start 1 locus_tag LOCUS_43550 CDS 5244033..5244206 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070882.1 transl_table 11 codon_start 1 locus_tag LOCUS_43560 CDS complement(5244349..5244834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43570 CDS complement(5244837..5246036) product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256452.1 transl_table 11 codon_start 1 locus_tag LOCUS_43580 CDS complement(5246383..5247756) product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113324.1 transl_table 11 codon_start 1 locus_tag LOCUS_43590 CDS 5248994..5249245 product YgjV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073879.1 transl_table 11 codon_start 1 locus_tag LOCUS_43600 CDS complement(5250145..5251377) product organoarsenical effux MFS transporter ArsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070878.1 transl_table 11 codon_start 1 locus_tag LOCUS_43610 gene arsJ CDS complement(5251466..5252503) product ArsJ-associated glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070877.1 transl_table 11 codon_start 1 locus_tag LOCUS_43620 CDS complement(5252636..5253682) product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070874.1 transl_table 11 codon_start 1 locus_tag LOCUS_43630 gene arsB CDS complement(5253706..5254053) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070872.1 transl_table 11 codon_start 1 locus_tag LOCUS_43640 CDS 5254294..5255565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43650 CDS complement(5255608..5256948) product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073785.1 transl_table 11 codon_start 1 locus_tag LOCUS_43660 gene pmbA CDS 5257089..5257628 product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073786.1 transl_table 11 codon_start 1 locus_tag LOCUS_43670 gene yjgA CDS 5257712..5260216 product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073787.1 transl_table 11 codon_start 1 locus_tag LOCUS_43680 CDS 5260384..5260785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43690 CDS complement(5261021..5262187) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073791.1 transl_table 11 codon_start 1 locus_tag LOCUS_43700 CDS complement(5262184..5263338) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925917.1 transl_table 11 codon_start 1 locus_tag LOCUS_43710 CDS complement(5263352..5264323) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073793.1 transl_table 11 codon_start 1 locus_tag LOCUS_43720 CDS complement(5264313..5265728) product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073794.1 transl_table 11 codon_start 1 locus_tag LOCUS_43730 CDS complement(5265859..5267310) product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073795.1 transl_table 11 codon_start 1 locus_tag LOCUS_43740 gene tldD CDS complement(5267369..5268112) product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073796.1 transl_table 11 codon_start 1 locus_tag LOCUS_43750 CDS complement(5268147..5272271) product YhdP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073797.1 transl_table 11 codon_start 1 locus_tag LOCUS_43760 CDS complement(5272337..5273839) product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925918.1 transl_table 11 codon_start 1 locus_tag LOCUS_43770 gene rng CDS complement(5273895..5274488) product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073799.1 transl_table 11 codon_start 1 locus_tag LOCUS_43780 CDS complement(5274492..5274980) product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073800.1 transl_table 11 codon_start 1 locus_tag LOCUS_43790 gene mreD CDS complement(5274977..5275864) product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073801.1 transl_table 11 codon_start 1 locus_tag LOCUS_43800 gene mreC CDS complement(5276026..5277075) product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007651015.1 transl_table 11 codon_start 1 locus_tag LOCUS_43810 CDS complement(5277320..5281987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43820 CDS complement(5281980..5282456) product MSHA biogenesis protein MshP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073803.1 transl_table 11 codon_start 1 locus_tag LOCUS_43830 CDS complement(5282446..5283285) product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073804.1 transl_table 11 codon_start 1 locus_tag LOCUS_43840 CDS complement(5283285..5283893) product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073805.1 transl_table 11 codon_start 1 locus_tag LOCUS_43850 CDS complement(5283883..5284344) product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073806.1 transl_table 11 codon_start 1 locus_tag LOCUS_43860 CDS complement(5284549..5285070) product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071407.1 transl_table 11 codon_start 1 locus_tag LOCUS_43870 CDS complement(5285203..5285700) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43880 CDS complement(5285880..5286383) product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139685680.1 transl_table 11 codon_start 1 locus_tag LOCUS_43890 CDS complement(5286398..5286901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43900 CDS complement(5286997..5287653) product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073808.1 transl_table 11 codon_start 1 locus_tag LOCUS_43910 CDS complement(5287733..5288221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43920 CDS complement(5288332..5289552) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073810.1 transl_table 11 codon_start 1 locus_tag LOCUS_43930 CDS complement(5289582..5291327) product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073811.1 transl_table 11 codon_start 1 locus_tag LOCUS_43940 CDS complement(5291324..5292562) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073812.1 transl_table 11 codon_start 1 locus_tag LOCUS_43950 CDS complement(5292559..5292804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43960 CDS complement(5292795..5293709) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073813.1 transl_table 11 codon_start 1 locus_tag LOCUS_43970 CDS complement(5293713..5295416) product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073814.1 transl_table 11 codon_start 1 locus_tag LOCUS_43980 gene mshL CDS complement(5295422..5295751) product MSHA biogenesis protein MshK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073815.1 transl_table 11 codon_start 1 locus_tag LOCUS_43990 CDS complement(5295732..5296388) product MSHA biogenesis protein MshJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073816.1 transl_table 11 codon_start 1 locus_tag LOCUS_44000 CDS complement(5296385..5296990) product MSHA biogenesis protein MshI2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073817.1 transl_table 11 codon_start 1 locus_tag LOCUS_44010 CDS complement(5296987..5297928) product MSHA biogenesis protein MshI1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073818.1 transl_table 11 codon_start 1 locus_tag LOCUS_44020 CDS complement(5298242..5300152) product RNase E specificity factor CsrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073819.1 transl_table 11 codon_start 1 locus_tag LOCUS_44030 gene csrD CDS complement(5300434..5301681) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073820.1 transl_table 11 codon_start 1 locus_tag LOCUS_44040 CDS complement(5301859..5302695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44050 CDS complement(5303113..5303352) product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073821.1 transl_table 11 codon_start 1 locus_tag LOCUS_44060 gene rpmE CDS complement(5303498..5304265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44070 CDS 5304366..5306561 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073823.1 transl_table 11 codon_start 1 locus_tag LOCUS_44080 gene priA CDS 5306697..5308442 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073824.1 transl_table 11 codon_start 1 locus_tag LOCUS_44090 gene argS CDS 5308463..5309050 product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073825.1 transl_table 11 codon_start 1 locus_tag LOCUS_44100 CDS 5309245..5309769 product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073856.1 transl_table 11 codon_start 1 locus_tag LOCUS_44110 gene hslV CDS 5309843..5311168 product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073857.1 transl_table 11 codon_start 1 locus_tag LOCUS_44120 gene hslU CDS 5311238..5311633 product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073858.1 transl_table 11 codon_start 1 locus_tag LOCUS_44130 CDS complement(5311712..5312662) product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436788.1 transl_table 11 codon_start 1 locus_tag LOCUS_44140 CDS complement(5312927..5313097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44150 CDS 5313177..5313587 product DUF3859 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123965.1 transl_table 11 codon_start 1 locus_tag LOCUS_44160 tRNA complement(5314133..5314223) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t01150 CDS complement(5314411..5315592) product aromatic amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072133.1 transl_table 11 codon_start 1 locus_tag LOCUS_44170 CDS complement(5315945..5316625) product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169692.1 transl_table 11 codon_start 1 locus_tag LOCUS_44180 gene yjjG CDS 5316859..5317509 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072829.1 transl_table 11 codon_start 1 locus_tag LOCUS_44190 gene lepB CDS 5317653..5318150 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44200 CDS complement(5318190..5318426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44210 CDS complement(5318548..5319987) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816561.1 transl_table 11 codon_start 1 locus_tag LOCUS_44220 CDS 5320122..5320646 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921584.1 transl_table 11 codon_start 1 locus_tag LOCUS_44230 CDS complement(5320647..5321630) product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707542.1 transl_table 11 codon_start 1 locus_tag LOCUS_44240 CDS complement(5321823..5323802) product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074381.1 transl_table 11 codon_start 1 locus_tag LOCUS_44250 CDS complement(5324078..5324608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44260 CDS 5324817..5326298 product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070851.1 transl_table 11 codon_start 1 locus_tag LOCUS_44270 gene ubiD CDS 5326389..5327099 product NAD(P)H-flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070849.1 transl_table 11 codon_start 1 locus_tag LOCUS_44280 gene fre CDS complement(5327261..5328544) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070839.1 transl_table 11 codon_start 1 locus_tag LOCUS_44290 CDS complement(5328765..5329613) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070838.1 transl_table 11 codon_start 1 locus_tag LOCUS_44300 CDS complement(5329628..5330539) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070837.1 transl_table 11 codon_start 1 locus_tag LOCUS_44310 CDS complement(5330605..5331855) product nitrous oxide reductase family maturation protein NosD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070836.1 transl_table 11 codon_start 1 locus_tag LOCUS_44320 gene nosD CDS complement(5331901..5332389) product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070835.1 transl_table 11 codon_start 1 locus_tag LOCUS_44330 CDS complement(5332572..5333519) product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070834.1 transl_table 11 codon_start 1 locus_tag LOCUS_44340 gene nrfD CDS complement(5333522..5333662) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44350 CDS complement(5333665..5334315) product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070833.1 transl_table 11 codon_start 1 locus_tag LOCUS_44360 CDS complement(5334429..5335142) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070832.1 transl_table 11 codon_start 1 locus_tag LOCUS_44370 CDS complement(5335195..5335986) product FKBP-type peptidyl-prolyl cis-trans isomerase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070831.1 transl_table 11 codon_start 1 locus_tag LOCUS_44380 CDS complement(5336047..5336475) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070830.1 transl_table 11 codon_start 1 locus_tag LOCUS_44390 CDS complement(5336569..5338599) product dissimilatory sulfite reductase SirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070829.1 transl_table 11 codon_start 1 locus_tag LOCUS_44400 gene sirA CDS complement(5339763..5341046) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070839.1 transl_table 11 codon_start 1 locus_tag LOCUS_44410 CDS complement(5341219..5341707) product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070835.1 transl_table 11 codon_start 1 locus_tag LOCUS_44420 CDS complement(5342025..5342972) product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070834.1 transl_table 11 codon_start 1 locus_tag LOCUS_44430 gene nrfD CDS complement(5342974..5343678) product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070833.1 transl_table 11 codon_start 1 locus_tag LOCUS_44440 CDS complement(5343743..5344474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44450 CDS complement(5344509..5345300) product FKBP-type peptidyl-prolyl cis-trans isomerase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070831.1 transl_table 11 codon_start 1 locus_tag LOCUS_44460 CDS complement(5345354..5345782) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070830.1 transl_table 11 codon_start 1 locus_tag LOCUS_44470 CDS complement(5345853..5347889) product dissimilatory sulfite reductase SirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070829.1 transl_table 11 codon_start 1 locus_tag LOCUS_44480 gene sirA CDS 5348379..5350388 product heme lyase NrfEFG subunit NrfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070828.1 transl_table 11 codon_start 1 locus_tag LOCUS_44490 gene nrfE CDS 5350385..5350864 product heme lyase NrfEFG subunit NrfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070642.1 transl_table 11 codon_start 1 locus_tag LOCUS_44500 gene nrfF CDS 5350861..5351484 product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070826.1 transl_table 11 codon_start 1 locus_tag LOCUS_44510 CDS complement(5351562..5351795) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946172.1 transl_table 11 codon_start 1 locus_tag LOCUS_44520 CDS complement(5351810..5352397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44530 CDS 5352513..5354579 product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730594.1 transl_table 11 codon_start 1 locus_tag LOCUS_44540 CDS 5355168..5357153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44550 CDS complement(5357234..5358328) product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070705.1 transl_table 11 codon_start 1 locus_tag LOCUS_44560 CDS complement(5358473..5359246) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073431.1 transl_table 11 codon_start 1 locus_tag LOCUS_44570 CDS 5359434..5360936 product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072956.1 transl_table 11 codon_start 1 locus_tag LOCUS_44580 CDS 5360947..5361297 product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073430.1 transl_table 11 codon_start 1 locus_tag LOCUS_44590 CDS 5361392..5362129 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073429.1 transl_table 11 codon_start 1 locus_tag LOCUS_44600 CDS 5362182..5362655 product DUF3299 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073428.1 transl_table 11 codon_start 1 locus_tag LOCUS_44610 CDS 5362682..5363821 product outer membrane beta barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071616.1 transl_table 11 codon_start 1 locus_tag LOCUS_44620 CDS 5364140..5365768 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267230.1 transl_table 11 codon_start 1 locus_tag LOCUS_44630 CDS 5366291..5367430 product outer membrane beta barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071616.1 transl_table 11 codon_start 1 locus_tag LOCUS_44640 CDS complement(5367586..5368377) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071619.1 transl_table 11 codon_start 1 locus_tag LOCUS_44650 CDS 5368717..5370234 product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071618.1 transl_table 11 codon_start 1 locus_tag LOCUS_44660 CDS 5370240..5370608 product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071617.1 transl_table 11 codon_start 1 locus_tag LOCUS_44670 CDS 5370666..5371799 product outer membrane beta barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071616.1 transl_table 11 codon_start 1 locus_tag LOCUS_44680 CDS 5371962..5373044 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071615.1 transl_table 11 codon_start 1 locus_tag LOCUS_44690 CDS 5373223..5373960 product periplasmic RmlC-type Cupin domain family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071614.1 transl_table 11 codon_start 1 locus_tag LOCUS_44700 CDS complement(5373997..5375193) product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454985.1 transl_table 11 codon_start 1 locus_tag LOCUS_44710 CDS complement(5375193..5376350) product DUF4056 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105812.1 transl_table 11 codon_start 1 locus_tag LOCUS_44720 CDS complement(5376455..5377369) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026612303.1 transl_table 11 codon_start 1 locus_tag LOCUS_44730 CDS complement(5377669..5379024) product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947330.1 transl_table 11 codon_start 1 locus_tag LOCUS_44740 CDS 5379251..5379886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44750 CDS complement(5379916..5380104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44760 CDS 5380304..5380915 product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082431.1 transl_table 11 codon_start 1 locus_tag LOCUS_44770 CDS 5381303..5381506 product cell division protein ZapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070700.1 transl_table 11 codon_start 1 locus_tag LOCUS_44780 CDS complement(5381545..5381757) product DUF1107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070699.1 transl_table 11 codon_start 1 locus_tag LOCUS_44790 CDS complement(5382271..5382576) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44800 CDS complement(5382714..5383325) product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070698.1 transl_table 11 codon_start 1 locus_tag LOCUS_44810 CDS complement(5383496..5384500) product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070697.1 transl_table 11 codon_start 1 locus_tag LOCUS_44820 CDS complement(5384497..5384790) product DUF3630 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925591.1 transl_table 11 codon_start 1 locus_tag LOCUS_44830 CDS complement(5384867..5385166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925590.1 transl_table 11 codon_start 1 locus_tag LOCUS_44840 CDS complement(5385263..5386108) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070693.1 transl_table 11 codon_start 1 locus_tag LOCUS_44850 CDS 5386519..5386914 product nitrous oxide-stimulated promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461033.1 transl_table 11 codon_start 1 locus_tag LOCUS_44860 CDS 5387775..5388236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44870 CDS 5388354..5390432 product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868463.1 transl_table 11 codon_start 1 locus_tag LOCUS_44880 CDS 5390620..5391177 product lipid-binding SYLF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070689.1 transl_table 11 codon_start 1 locus_tag LOCUS_44890 CDS complement(5391663..5392565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44900 CDS complement(5392708..5392995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44910 CDS complement(5394532..5395116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925589.1 transl_table 11 codon_start 1 locus_tag LOCUS_44920 CDS complement(5395286..5398324) product tetrathionate reductase subunit TtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816071.1 transl_table 11 codon_start 1 locus_tag LOCUS_44930 gene ttrA CDS complement(5398334..5399029) product tetrathionate reductase subunit TtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269830.1 transl_table 11 codon_start 1 locus_tag LOCUS_44940 gene ttrB CDS 5399555..5400520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44950 CDS 5400805..5403021 product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461961.1 transl_table 11 codon_start 1 locus_tag LOCUS_44960 CDS 5403032..5403577 product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461960.1 transl_table 11 codon_start 1 locus_tag LOCUS_44970 CDS 5403577..5404191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44980 CDS 5404302..5405267 product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074134.1 transl_table 11 codon_start 1 locus_tag LOCUS_44990 CDS 5405442..5406491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45000 CDS complement(5406758..5407618) product HTH-type transcriptional regulator PtxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089264.1 transl_table 11 codon_start 1 locus_tag LOCUS_45010 gene ptxR CDS 5407748..5408689 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45020 CDS complement(5408796..5411102) product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140233143.1 transl_table 11 codon_start 1 locus_tag LOCUS_45030 CDS complement(5411299..5411712) product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070678.1 transl_table 11 codon_start 1 locus_tag LOCUS_45040 CDS 5411874..5413094 product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070677.1 transl_table 11 codon_start 1 locus_tag LOCUS_45050 CDS 5413433..5415118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070676.1 transl_table 11 codon_start 1 locus_tag LOCUS_45060 CDS 5415244..5416083 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45070 CDS 5417009..5417761 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477064.1 transl_table 11 codon_start 1 locus_tag LOCUS_45080 CDS 5417903..5418175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45090 CDS complement(5418702..5419028) product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074447.1 transl_table 11 codon_start 1 locus_tag LOCUS_45100 CDS complement(5419253..5419810) product S-(hydroxymethyl)glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975095.1 transl_table 11 codon_start 1 locus_tag LOCUS_45110 gene gfa CDS complement(5419868..5421019) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074450.1 transl_table 11 codon_start 1 locus_tag LOCUS_45120 CDS 5421330..5422199 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074451.1 transl_table 11 codon_start 1 locus_tag LOCUS_45130 CDS 5422532..5423536 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971233.1 transl_table 11 codon_start 1 locus_tag LOCUS_45140 CDS 5423621..5424520 product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241012.1 transl_table 11 codon_start 1 locus_tag LOCUS_45150 CDS 5424531..5425781 product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810308.1 transl_table 11 codon_start 1 locus_tag LOCUS_45160 CDS 5426143..5427354 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262757.1 transl_table 11 codon_start 1 locus_tag LOCUS_45170 CDS complement(5427660..5429021) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070839.1 transl_table 11 codon_start 1 locus_tag LOCUS_45180 CDS complement(5429213..5431540) product decaheme c-type cytochrome MtrF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071903.1 transl_table 11 codon_start 1 locus_tag LOCUS_45190 gene mtrF CDS 5432017..5433204 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45200 CDS complement(5433250..5434230) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074174.1 transl_table 11 codon_start 1 locus_tag LOCUS_45210 CDS 5434634..5435131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45220 CDS 5435222..5435698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45230 CDS 5435709..5436392 product cytochrome c nitrite reductase Fe-S protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262126.1 transl_table 11 codon_start 1 locus_tag LOCUS_45240 gene nrfC CDS 5436389..5437330 product cytochrome c nitrite reductase subunit NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074173.1 transl_table 11 codon_start 1 locus_tag LOCUS_45250 gene nrfD CDS complement(5438000..5438845) product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070673.1 transl_table 11 codon_start 1 locus_tag LOCUS_45260 gene rsmI CDS 5438948..5440807 product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070672.1 transl_table 11 codon_start 1 locus_tag LOCUS_45270 CDS 5440807..5441169 product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070671.1 transl_table 11 codon_start 1 locus_tag LOCUS_45280 CDS 5441253..5441843 product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070670.1 transl_table 11 codon_start 1 locus_tag LOCUS_45290 CDS 5441875..5442444 product division/outer membrane stress-associated lipid-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070669.1 transl_table 11 codon_start 1 locus_tag LOCUS_45300 gene dolP CDS complement(5442504..5443403) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070668.1 transl_table 11 codon_start 1 locus_tag LOCUS_45310 CDS 5443535..5444419 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925588.1 transl_table 11 codon_start 1 locus_tag LOCUS_45320 CDS complement(5444475..5445482) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070666.1 transl_table 11 codon_start 1 locus_tag LOCUS_45330 gene trpS CDS complement(5445475..5446185) product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070665.1 transl_table 11 codon_start 1 locus_tag LOCUS_45340 CDS complement(5446189..5446863) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070664.1 transl_table 11 codon_start 1 locus_tag LOCUS_45350 gene rpe CDS 5447072..5447425 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070663.1 transl_table 11 codon_start 1 locus_tag LOCUS_45360 CDS complement(5447935..5448774) product Dam family site-specific DNA-(adenine-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070661.1 transl_table 11 codon_start 1 locus_tag LOCUS_45370 CDS complement(5448824..5450227) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070660.1 transl_table 11 codon_start 1 locus_tag LOCUS_45380 CDS complement(5450245..5451321) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070659.1 transl_table 11 codon_start 1 locus_tag LOCUS_45390 gene aroB CDS complement(5451330..5451845) product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070658.1 transl_table 11 codon_start 1 locus_tag LOCUS_45400 gene aroK CDS complement(5452064..5454109) product type IV pilus secretin PilQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070657.1 transl_table 11 codon_start 1 locus_tag LOCUS_45410 CDS complement(5454131..5454652) product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070656.1 transl_table 11 codon_start 1 locus_tag LOCUS_45420 CDS complement(5454649..5455269) product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070655.1 transl_table 11 codon_start 1 locus_tag LOCUS_45430 CDS complement(5455266..5455838) product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070654.1 transl_table 11 codon_start 1 locus_tag LOCUS_45440 CDS complement(5455826..5456905) product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070653.1 transl_table 11 codon_start 1 locus_tag LOCUS_45450 CDS 5457093..5459624 product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070652.1 transl_table 11 codon_start 1 locus_tag LOCUS_45460 CDS complement(5459781..5461148) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070651.1 transl_table 11 codon_start 1 locus_tag LOCUS_45470 gene argH CDS complement(5461223..5462446) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070650.1 transl_table 11 codon_start 1 locus_tag LOCUS_45480 CDS complement(5462529..5463437) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070649.1 transl_table 11 codon_start 1 locus_tag LOCUS_45490 CDS complement(5463539..5464324) product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070648.1 transl_table 11 codon_start 1 locus_tag LOCUS_45500 gene argB CDS complement(5464347..5465327) product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070647.1 transl_table 11 codon_start 1 locus_tag LOCUS_45510 gene argC CDS 5465589..5466740 product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298964.1 transl_table 11 codon_start 1 locus_tag LOCUS_45520 gene argE CDS 5466898..5469531 product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070646.1 transl_table 11 codon_start 1 locus_tag LOCUS_45530 gene ppc CDS 5469528..5470076 product DUF1439 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070645.1 transl_table 11 codon_start 1 locus_tag LOCUS_45540 CDS complement(5470182..5471456) product CinA family nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070644.1 transl_table 11 codon_start 1 locus_tag LOCUS_45550 CDS complement(5471688..5472380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45560 CDS 5472675..5474396 product OPT family oligopeptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266869.1 transl_table 11 codon_start 1 locus_tag LOCUS_45570 CDS 5475005..5475865 product decaheme c-type cytochrome MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071900.1 transl_table 11 codon_start 1 locus_tag LOCUS_45580 gene mtrA CDS 5475990..5477699 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45590 CDS 5477709..5480231 product dimethyl sulfoxide reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074013.1 transl_table 11 codon_start 1 locus_tag LOCUS_45600 CDS 5480244..5480867 product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483443.1 transl_table 11 codon_start 1 locus_tag LOCUS_45610 gene dmsB CDS 5480882..5482957 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074011.1 transl_table 11 codon_start 1 locus_tag LOCUS_45620 CDS 5483076..5483702 product molecular chaperone TorD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071633.1 transl_table 11 codon_start 1 locus_tag LOCUS_45630 CDS complement(5483861..5484541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45640 CDS 5485121..5485981 product decaheme c-type cytochrome MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071900.1 transl_table 11 codon_start 1 locus_tag LOCUS_45650 gene mtrA CDS 5485991..5487688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45660 CDS 5487721..5490171 product dimethyl sulfoxide reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074013.1 transl_table 11 codon_start 1 locus_tag LOCUS_45670 CDS 5490181..5490798 product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483443.1 transl_table 11 codon_start 1 locus_tag LOCUS_45680 gene dmsB CDS 5490800..5492908 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074011.1 transl_table 11 codon_start 1 locus_tag LOCUS_45690 CDS 5492962..5493582 product molecular chaperone TorD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071633.1 transl_table 11 codon_start 1 locus_tag LOCUS_45700 CDS complement(5493732..5494430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45710 CDS 5495064..5496584 product OPT family oligopeptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266869.1 transl_table 11 codon_start 1 locus_tag LOCUS_45720 CDS 5496684..5496974 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45730 CDS complement(5497428..5498495) product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925592.1 transl_table 11 codon_start 1 locus_tag LOCUS_45740 CDS complement(5498492..5499490) product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070726.1 transl_table 11 codon_start 1 locus_tag LOCUS_45750 CDS complement(5499567..5500646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45760 CDS 5500968..5501591 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070724.1 transl_table 11 codon_start 1 locus_tag LOCUS_45770 gene gmk CDS 5501648..5501932 product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007651394.1 transl_table 11 codon_start 1 locus_tag LOCUS_45780 gene rpoZ CDS 5501946..5504051 product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070723.1 transl_table 11 codon_start 1 locus_tag LOCUS_45790 gene spoT CDS 5504088..5504471 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070722.1 transl_table 11 codon_start 1 locus_tag LOCUS_45800 CDS 5504539..5505240 product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260972.1 transl_table 11 codon_start 1 locus_tag LOCUS_45810 gene trmH CDS complement(5505632..5506648) product IS110-like element ISPa11 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147159.1 transl_table 11 codon_start 1 locus_tag LOCUS_45820 CDS complement(5507074..5507550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45830 CDS complement(5507550..5508452) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45840 CDS 5509517..5511175 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070720.1 transl_table 11 codon_start 1 locus_tag LOCUS_45850 CDS 5511344..5512276 product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 transl_table 11 codon_start 1 locus_tag LOCUS_45860 CDS 5512422..5513117 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070718.1 transl_table 11 codon_start 1 locus_tag LOCUS_45870 CDS 5513174..5514268 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070717.1 transl_table 11 codon_start 1 locus_tag LOCUS_45880 CDS 5514286..5514882 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070716.1 transl_table 11 codon_start 1 locus_tag LOCUS_45890 CDS 5514994..5517081 product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074018.1 transl_table 11 codon_start 1 locus_tag LOCUS_45900 gene recG CDS 5517249..5518115 product DUF3014 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074019.1 transl_table 11 codon_start 1 locus_tag LOCUS_45910 CDS 5518374..5519090 product beta-ketoacyl synthase chain length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074020.1 transl_table 11 codon_start 1 locus_tag LOCUS_45920 CDS 5519083..5519874 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074021.1 transl_table 11 codon_start 1 locus_tag LOCUS_45930 CDS 5519871..5520128 product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074022.1 transl_table 11 codon_start 1 locus_tag LOCUS_45940 CDS 5520137..5520385 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074023.1 transl_table 11 codon_start 1 locus_tag LOCUS_45950 CDS 5520385..5520933 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074024.1 transl_table 11 codon_start 1 locus_tag LOCUS_45960 CDS 5520930..5522294 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074025.1 transl_table 11 codon_start 1 locus_tag LOCUS_45970 CDS 5522287..5522658 product thioester dehydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074026.1 transl_table 11 codon_start 1 locus_tag LOCUS_45980 CDS 5522658..5524373 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925926.1 transl_table 11 codon_start 1 locus_tag LOCUS_45990 CDS 5524374..5525936 product aromatic amino acid ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074028.1 transl_table 11 codon_start 1 locus_tag LOCUS_46000 CDS 5525933..5526385 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074029.1 transl_table 11 codon_start 1 locus_tag LOCUS_46010 CDS 5526385..5527173 product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074030.1 transl_table 11 codon_start 1 locus_tag LOCUS_46020 CDS 5527314..5529602 product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074031.1 transl_table 11 codon_start 1 locus_tag LOCUS_46030 CDS 5529599..5530864 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074032.1 transl_table 11 codon_start 1 locus_tag LOCUS_46040 CDS 5530875..5531540 product DUF3261 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074033.1 transl_table 11 codon_start 1 locus_tag LOCUS_46050 CDS 5531595..5532812 product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074034.1 transl_table 11 codon_start 1 locus_tag LOCUS_46060 CDS 5532884..5533309 product hotdog family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074035.1 transl_table 11 codon_start 1 locus_tag LOCUS_46070 CDS 5533306..5534040 product 3-ketoacyl-ACP reductase FabG2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074036.1 transl_table 11 codon_start 1 locus_tag LOCUS_46080 CDS 5534132..5535382 product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074037.1 transl_table 11 codon_start 1 locus_tag LOCUS_46090 CDS 5535396..5536139 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074038.1 transl_table 11 codon_start 1 locus_tag LOCUS_46100 CDS complement(5536221..5536814) product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074045.1 transl_table 11 codon_start 1 locus_tag LOCUS_46110 gene azoR CDS complement(5536990..5537493) product YiiD C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074046.1 transl_table 11 codon_start 1 locus_tag LOCUS_46120 CDS complement(5537502..5537939) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074047.1 transl_table 11 codon_start 1 locus_tag LOCUS_46130 gene dtd CDS complement(5537998..5538555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074048.1 transl_table 11 codon_start 1 locus_tag LOCUS_46140 CDS complement(5538572..5539516) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074049.1 transl_table 11 codon_start 1 locus_tag LOCUS_46150 CDS complement(5539513..5540526) product virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074050.1 transl_table 11 codon_start 1 locus_tag LOCUS_46160 CDS 5540629..5540850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074051.1 transl_table 11 codon_start 1 locus_tag LOCUS_46170 CDS 5540905..5541552 product DUF2959 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074052.1 transl_table 11 codon_start 1 locus_tag LOCUS_46180 CDS 5541907..5543121 product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074053.1 transl_table 11 codon_start 1 locus_tag LOCUS_46190 CDS 5543762..5545729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943012.1 transl_table 11 codon_start 1 locus_tag LOCUS_46200 CDS complement(5546444..5548255) product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074056.1 transl_table 11 codon_start 1 locus_tag LOCUS_46210 gene typA CDS 5548627..5550036 product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074057.1 transl_table 11 codon_start 1 locus_tag LOCUS_46220 gene glnA CDS 5550207..5551439 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649362.1 transl_table 11 codon_start 1 locus_tag LOCUS_46230 CDS 5551609..5551911 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46240 CDS 5552118..5552657 product DUF4124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074099.1 transl_table 11 codon_start 1 locus_tag LOCUS_46250 CDS 5552782..5553837 product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074100.1 transl_table 11 codon_start 1 locus_tag LOCUS_46260 gene glnL CDS 5553877..5555286 product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074101.1 transl_table 11 codon_start 1 locus_tag LOCUS_46270 gene glnG CDS complement(5555364..5555546) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46280 rRNA complement(5555859..5555961) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00320 rRNA complement(5556118..5559019) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00330 rRNA complement(5559341..5560883) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00340 CDS complement(5561565..5562134) product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070643.1 transl_table 11 codon_start 1 locus_tag LOCUS_46290 CDS complement(5562131..5562610) product heme lyase NrfEFG subunit NrfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070642.1 transl_table 11 codon_start 1 locus_tag LOCUS_46300 gene nrfF CDS complement(5562607..5563161) product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070641.1 transl_table 11 codon_start 1 locus_tag LOCUS_46310 CDS complement(5563194..5565170) product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070640.1 transl_table 11 codon_start 1 locus_tag LOCUS_46320 CDS 5565591..5566838 product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070639.1 transl_table 11 codon_start 1 locus_tag LOCUS_46330 gene ccmI CDS complement(5567058..5567351) product monoheme cytochrome c5 ScyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070638.1 transl_table 11 codon_start 1 locus_tag LOCUS_46340 gene scyA CDS 5567718..5568365 product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070637.1 transl_table 11 codon_start 1 locus_tag LOCUS_46350 gene ccmA CDS 5568376..5569062 product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070636.1 transl_table 11 codon_start 1 locus_tag LOCUS_46360 gene ccmB CDS 5569064..5569810 product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070635.1 transl_table 11 codon_start 1 locus_tag LOCUS_46370 CDS 5569810..5570010 product heme exporter protein CcmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070634.1 transl_table 11 codon_start 1 locus_tag LOCUS_46380 gene ccmD CDS 5570007..5570492 product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070633.1 transl_table 11 codon_start 1 locus_tag LOCUS_46390 gene ccmE CDS 5570602..5571588 product ABC transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705146.1 transl_table 11 codon_start 1 locus_tag LOCUS_46400 CDS complement(5571646..5573007) product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868917.1 transl_table 11 codon_start 1 locus_tag LOCUS_46410 CDS complement(5573027..5573206) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46420 CDS complement(5573139..5573621) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366918.1 transl_table 11 codon_start 1 locus_tag LOCUS_46430 CDS complement(5573608..5576841) product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705205.1 transl_table 11 codon_start 1 locus_tag LOCUS_46440 CDS complement(5577244..5577642) product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007644470.1 transl_table 11 codon_start 1 locus_tag LOCUS_46450 gene rplQ CDS complement(5577683..5578672) product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070632.1 transl_table 11 codon_start 1 locus_tag LOCUS_46460 gene rpoA CDS complement(5578697..5579317) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070631.1 transl_table 11 codon_start 1 locus_tag LOCUS_46470 gene rpsD CDS complement(5579353..5579745) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006083577.1 transl_table 11 codon_start 1 locus_tag LOCUS_46480 gene rpsK CDS complement(5579760..5580116) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070630.1 transl_table 11 codon_start 1 locus_tag LOCUS_46490 gene rpsM CDS complement(5580367..5581707) product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070629.1 transl_table 11 codon_start 1 locus_tag LOCUS_46500 gene secY CDS complement(5581715..5582149) product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070628.1 transl_table 11 codon_start 1 locus_tag LOCUS_46510 gene rplO CDS complement(5582152..5582334) product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006083582.1 transl_table 11 codon_start 1 locus_tag LOCUS_46520 gene rpmD CDS complement(5582341..5582844) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007644438.1 transl_table 11 codon_start 1 locus_tag LOCUS_46530 gene rpsE CDS complement(5582857..5583207) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070627.1 transl_table 11 codon_start 1 locus_tag LOCUS_46540 gene rplR CDS complement(5583218..5583748) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070626.1 transl_table 11 codon_start 1 locus_tag LOCUS_46550 gene rplF CDS complement(5583759..5584151) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007644434.1 transl_table 11 codon_start 1 locus_tag LOCUS_46560 gene rpsH CDS complement(5584176..5584481) product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070625.1 transl_table 11 codon_start 1 locus_tag LOCUS_46570 gene rpsN CDS complement(5584492..5585031) product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070624.1 transl_table 11 codon_start 1 locus_tag LOCUS_46580 gene rplE CDS complement(5585044..5585358) product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070623.1 transl_table 11 codon_start 1 locus_tag LOCUS_46590 gene rplX CDS complement(5585369..5585737) product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006083590.1 transl_table 11 codon_start 1 locus_tag LOCUS_46600 gene rplN CDS complement(5585915..5586163) product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070622.1 transl_table 11 codon_start 1 locus_tag LOCUS_46610 gene rpsQ CDS complement(5586163..5586354) product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007644429.1 transl_table 11 codon_start 1 locus_tag LOCUS_46620 gene rpmC CDS complement(5586354..5586764) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006083593.1 transl_table 11 codon_start 1 locus_tag LOCUS_46630 gene rplP CDS complement(5586776..5587465) product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070621.1 transl_table 11 codon_start 1 locus_tag LOCUS_46640 gene rpsC CDS complement(5587475..5587807) product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006083595.1 transl_table 11 codon_start 1 locus_tag LOCUS_46650 gene rplV CDS complement(5587823..5588101) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006083596.1 transl_table 11 codon_start 1 locus_tag LOCUS_46660 gene rpsS CDS complement(5588113..5588940) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070620.1 transl_table 11 codon_start 1 locus_tag LOCUS_46670 gene rplB CDS complement(5588957..5589256) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037421480.1 transl_table 11 codon_start 1 locus_tag LOCUS_46680 gene rplW CDS complement(5589253..5589858) product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070618.1 transl_table 11 codon_start 1 locus_tag LOCUS_46690 gene rplD CDS complement(5589875..5590513) product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070617.1 transl_table 11 codon_start 1 locus_tag LOCUS_46700 gene rplC CDS complement(5590529..5590840) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070616.1 transl_table 11 codon_start 1 locus_tag LOCUS_46710 gene rpsJ CDS complement(5591197..5592381) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070615.1 transl_table 11 codon_start 1 locus_tag LOCUS_46720 gene tuf CDS complement(5592465..5594561) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070614.1 transl_table 11 codon_start 1 locus_tag LOCUS_46730 gene fusA CDS complement(5594637..5595107) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070613.1 transl_table 11 codon_start 1 locus_tag LOCUS_46740 gene rpsG CDS complement(5595184..5595558) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070612.1 transl_table 11 codon_start 1 locus_tag LOCUS_46750 gene rpsL CDS complement(5595749..5599975) product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070611.1 transl_table 11 codon_start 1 locus_tag LOCUS_46760 gene rpoC CDS complement(5600056..5604087) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070610.1 transl_table 11 codon_start 1 locus_tag LOCUS_46770 gene rpoB CDS complement(5604326..5604694) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007644333.1 transl_table 11 codon_start 1 locus_tag LOCUS_46780 gene rplL CDS complement(5604741..5605289) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070609.1 transl_table 11 codon_start 1 locus_tag LOCUS_46790 gene rplJ CDS complement(5605508..5606209) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070608.1 transl_table 11 codon_start 1 locus_tag LOCUS_46800 gene rplA CDS complement(5606214..5606642) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070607.1 transl_table 11 codon_start 1 locus_tag LOCUS_46810 gene rplK CDS complement(5606769..5607320) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070606.1 transl_table 11 codon_start 1 locus_tag LOCUS_46820 gene nusG CDS complement(5607330..5607701) product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070605.1 transl_table 11 codon_start 1 locus_tag LOCUS_46830 gene secE CDS complement(5607966..5609150) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070615.1 transl_table 11 codon_start 1 locus_tag LOCUS_46840 gene tuf tRNA complement(5609341..5609414) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t01160 tRNA complement(5609449..5609533) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t01170 tRNA complement(5609541..5609616) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t01180 CDS 5609848..5610798 product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070603.1 transl_table 11 codon_start 1 locus_tag LOCUS_46850 gene coaA CDS complement(5610813..5611775) product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070602.1 transl_table 11 codon_start 1 locus_tag LOCUS_46860 gene birA CDS complement(5611768..5612799) product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070601.1 transl_table 11 codon_start 1 locus_tag LOCUS_46870 gene murB tRNA complement(5613374..5613450) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t01190 rRNA complement(5613562..5613664) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00350 rRNA complement(5613822..5616723) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00360 tRNA complement(5617139..5617214) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t01200 tRNA complement(5617344..5617420) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t01210 rRNA complement(5617496..5619038) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00370 CDS 5619819..5620286 product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070600.1 transl_table 11 codon_start 1 locus_tag LOCUS_46880 CDS complement(5620386..5621198) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070599.1 transl_table 11 codon_start 1 locus_tag LOCUS_46890 gene murI CDS 5621374..5622471 product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070598.1 transl_table 11 codon_start 1 locus_tag LOCUS_46900 gene trmA CDS complement(5622595..5623212) product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070594.1 transl_table 11 codon_start 1 locus_tag LOCUS_46910 gene fabR CDS 5623364..5624470 product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070593.1 transl_table 11 codon_start 1 locus_tag LOCUS_46920 CDS 5624661..5625701 product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070592.1 transl_table 11 codon_start 1 locus_tag LOCUS_46930 gene selD CDS 5625701..5626807 product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070591.1 transl_table 11 codon_start 1 locus_tag LOCUS_46940 gene mnmH CDS complement(5626848..5628617) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070590.1 transl_table 11 codon_start 1 locus_tag LOCUS_46950 CDS complement(5628710..5629525) product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070587.1 transl_table 11 codon_start 1 locus_tag LOCUS_46960 gene cysQ CDS complement(5629581..5630126) product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070586.1 transl_table 11 codon_start 1 locus_tag LOCUS_46970 gene nudE CDS 5630572..5631240 product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070574.1 transl_table 11 codon_start 1 locus_tag LOCUS_46980 gene yrfG CDS complement(5631330..5632148) product type II secretion system protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070573.1 transl_table 11 codon_start 1 locus_tag LOCUS_46990 CDS complement(5632120..5632596) product type II secretion system protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070572.1 transl_table 11 codon_start 1 locus_tag LOCUS_47000 CDS complement(5632598..5633791) product type II secretion system protein GspL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070571.1 transl_table 11 codon_start 1 locus_tag LOCUS_47010 gene gspL CDS complement(5633882..5634874) product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070570.1 transl_table 11 codon_start 1 locus_tag LOCUS_47020 gene gspK CDS complement(5634939..5635580) product type II secretion system minor pseudopilin GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070569.1 transl_table 11 codon_start 1 locus_tag LOCUS_47030 gene gspJ CDS complement(5635561..5635956) product type II secretion system minor pseudopilin GspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070568.1 transl_table 11 codon_start 1 locus_tag LOCUS_47040 gene gspI CDS complement(5635953..5636540) product type II secretion system minor pseudopilin GspH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070567.1 transl_table 11 codon_start 1 locus_tag LOCUS_47050 gene gspH CDS complement(5636640..5637074) product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070566.1 transl_table 11 codon_start 1 locus_tag LOCUS_47060 gene gspG CDS complement(5637160..5638383) product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070565.1 transl_table 11 codon_start 1 locus_tag LOCUS_47070 gene gspF CDS complement(5638387..5639958) product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070564.1 transl_table 11 codon_start 1 locus_tag LOCUS_47080 gene gspE CDS complement(5639951..5642125) product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070563.1 transl_table 11 codon_start 1 locus_tag LOCUS_47090 gene gspD CDS complement(5642226..5643134) product type II secretion system protein GspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070562.1 transl_table 11 codon_start 1 locus_tag LOCUS_47100 gene gspC CDS 5643402..5643800 product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070561.1 transl_table 11 codon_start 1 locus_tag LOCUS_47110 gene hslR CDS 5643914..5644774 product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070560.1 transl_table 11 codon_start 1 locus_tag LOCUS_47120 gene hslO CDS 5645042..5646583 product phosphoenolpyruvate carboxykinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070559.1 transl_table 11 codon_start 1 locus_tag LOCUS_47130 CDS complement(5647074..5647502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47140 CDS 5648126..5649982 product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070554.1 transl_table 11 codon_start 1 locus_tag LOCUS_47150 CDS complement(5650016..5650897) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223047.1 transl_table 11 codon_start 1 locus_tag LOCUS_47160 CDS complement(5650993..5651784) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070553.1 transl_table 11 codon_start 1 locus_tag LOCUS_47170 CDS 5652043..5652798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070552.1 transl_table 11 codon_start 1 locus_tag LOCUS_47180 CDS complement(5652927..5653778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47190 CDS complement(5653884..5654147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47200 CDS complement(5654266..5656476) product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070546.1 transl_table 11 codon_start 1 locus_tag LOCUS_47210 CDS 5657140..5657793 product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070545.1 transl_table 11 codon_start 1 locus_tag LOCUS_47220 gene ribB CDS 5658151..5661360 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070544.1 transl_table 11 codon_start 1 locus_tag LOCUS_47230 CDS complement(5661435..5661962) product non-heme ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070543.1 transl_table 11 codon_start 1 locus_tag LOCUS_47240 gene ftnA CDS 5662229..5665351 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705254.1 transl_table 11 codon_start 1 locus_tag LOCUS_47250 CDS 5665351..5666451 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705255.1 transl_table 11 codon_start 1 locus_tag LOCUS_47260 CDS complement(5666530..5667339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47270 note possible pseudo, frameshifted CDS complement(5667387..5667701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47280 CDS 5667997..5669241 product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070542.1 transl_table 11 codon_start 1 locus_tag LOCUS_47290 CDS 5669287..5670054 product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070541.1 transl_table 11 codon_start 1 locus_tag LOCUS_47300 gene moeB CDS 5670352..5670789 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47310 CDS 5671126..5672052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47320 CDS 5672087..5673106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47330 CDS complement(5673193..5673879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47340 CDS complement(5673876..5674355) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236074025.1 transl_table 11 codon_start 1 locus_tag LOCUS_47350 CDS complement(5674356..5675117) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47360 CDS complement(5675108..5675974) product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444160.1 transl_table 11 codon_start 1 locus_tag LOCUS_47370 CDS complement(5675974..5676258) product DUF2282 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946406.1 transl_table 11 codon_start 1 locus_tag LOCUS_47380 CDS complement(5676358..5677581) product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072828.1 transl_table 11 codon_start 1 locus_tag LOCUS_47390 gene gltS CDS complement(5677982..5678179) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47400 CDS 5678584..5680740 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074066.1 transl_table 11 codon_start 1 locus_tag LOCUS_47410 CDS complement(5680890..5681054) product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262271.1 transl_table 11 codon_start 1 locus_tag LOCUS_47420 CDS complement(5681076..5681750) product TIGR01621 family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074068.1 transl_table 11 codon_start 1 locus_tag LOCUS_47430 CDS complement(5681820..5683043) product HAMP domain-containing histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074069.1 transl_table 11 codon_start 1 locus_tag LOCUS_47440 CDS complement(5683126..5683803) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074070.1 transl_table 11 codon_start 1 locus_tag LOCUS_47450 CDS complement(5683813..5684349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074071.1 transl_table 11 codon_start 1 locus_tag LOCUS_47460 CDS complement(5684507..5684857) product NirD/YgiW/YdeI family stress tolerance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454158.1 transl_table 11 codon_start 1 locus_tag LOCUS_47470 CDS complement(5684990..5686108) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074078.1 transl_table 11 codon_start 1 locus_tag LOCUS_47480 CDS complement(5686171..5686851) product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074079.1 transl_table 11 codon_start 1 locus_tag LOCUS_47490 gene modB CDS complement(5686852..5687655) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074080.1 transl_table 11 codon_start 1 locus_tag LOCUS_47500 gene modA CDS complement(5687684..5688148) product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074081.1 transl_table 11 codon_start 1 locus_tag LOCUS_47510 gene moaE CDS complement(5688150..5688401) product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074082.1 transl_table 11 codon_start 1 locus_tag LOCUS_47520 gene moaD CDS complement(5688430..5688906) product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074083.1 transl_table 11 codon_start 1 locus_tag LOCUS_47530 gene moaC CDS complement(5688983..5689504) product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000509705.1 transl_table 11 codon_start 1 locus_tag LOCUS_47540 gene moaB CDS complement(5689702..5690526) product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925796.1 transl_table 11 codon_start 1 locus_tag LOCUS_47550 gene moaA CDS 5691029..5692678 product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074085.1 transl_table 11 codon_start 1 locus_tag LOCUS_47560 CDS 5693049..5694959 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074086.1 transl_table 11 codon_start 1 locus_tag LOCUS_47570 CDS complement(5695045..5695434) product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074087.1 transl_table 11 codon_start 1 locus_tag LOCUS_47580 CDS complement(5695517..5696209) product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074088.1 transl_table 11 codon_start 1 locus_tag LOCUS_47590 CDS complement(5696267..5697724) product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074089.1 transl_table 11 codon_start 1 locus_tag LOCUS_47600 CDS complement(5698106..5698942) product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074090.1 transl_table 11 codon_start 1 locus_tag LOCUS_47610 CDS complement(5699167..5699604) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035584.1 transl_table 11 codon_start 1 locus_tag LOCUS_47620 CDS complement(5699604..5700176) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521511.1 transl_table 11 codon_start 1 locus_tag LOCUS_47630 CDS complement(5700214..5700492) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47640 CDS 5700839..5701024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47650 CDS complement(5701316..5702653) product coproporphyrinogen III oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074137.1 transl_table 11 codon_start 1 locus_tag LOCUS_47660 CDS complement(5702973..5703950) product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074134.1 transl_table 11 codon_start 1 locus_tag LOCUS_47670 CDS complement(5704155..5704724) product formate dehydrogenase FDH3 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074133.1 transl_table 11 codon_start 1 locus_tag LOCUS_47680 gene fdh3B CDS complement(5704743..5707598) product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074132.1 transl_table 11 codon_start 1 locus_tag LOCUS_47690 CDS complement(5707616..5707813) product twin-arginine translocation signal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074131.1 transl_table 11 codon_start 1 locus_tag LOCUS_47700 CDS complement(5708486..5709499) product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074130.1 transl_table 11 codon_start 1 locus_tag LOCUS_47710 CDS complement(5709558..5710148) product formate dehydrogenase FDH3 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074129.1 transl_table 11 codon_start 1 locus_tag LOCUS_47720 gene fdh3B CDS complement(5710176..5713025) product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074128.1 transl_table 11 codon_start 1 locus_tag LOCUS_47730 CDS complement(5713089..5713289) product twin-arginine translocation signal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074127.1 transl_table 11 codon_start 1 locus_tag LOCUS_47740 CDS complement(5713443..5714129) product molecular chaperone TorD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074126.1 transl_table 11 codon_start 1 locus_tag LOCUS_47750 CDS complement(5714140..5715768) product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925937.1 transl_table 11 codon_start 1 locus_tag LOCUS_47760 CDS complement(5716031..5716660) product DUF3306 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074124.1 transl_table 11 codon_start 1 locus_tag LOCUS_47770 CDS complement(5716650..5717129) product DUF3305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074123.1 transl_table 11 codon_start 1 locus_tag LOCUS_47780 CDS 5717525..5718328 product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074122.1 transl_table 11 codon_start 1 locus_tag LOCUS_47790 CDS 5718383..5719300 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074121.1 transl_table 11 codon_start 1 locus_tag LOCUS_47800 CDS complement(5719792..5720577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47810 CDS complement(5720668..5721141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47820 CDS complement(5721483..5722244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47830 CDS 5722470..5723078 product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000040020.1 transl_table 11 codon_start 1 locus_tag LOCUS_47840 CDS 5723080..5723694 product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073626.1 transl_table 11 codon_start 1 locus_tag LOCUS_47850 CDS 5723870..5725648 product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073628.1 transl_table 11 codon_start 1 locus_tag LOCUS_47860 CDS 5725757..5726467 product outer membrane protein OmpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073629.1 transl_table 11 codon_start 1 locus_tag LOCUS_47870 CDS complement(5726702..5727964) product 23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070538.1 transl_table 11 codon_start 1 locus_tag LOCUS_47880 gene rlmF CDS complement(5728034..5728489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47890 CDS 5728591..5729154 product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070536.1 transl_table 11 codon_start 1 locus_tag LOCUS_47900 CDS complement(5729232..5732150) product immune inhibitor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070535.1 transl_table 11 codon_start 1 locus_tag LOCUS_47910 CDS complement(5732174..5732506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47920 CDS complement(5732700..5734913) product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387456.1 transl_table 11 codon_start 1 locus_tag LOCUS_47930 gene ygjK CDS complement(5734982..5735587) product YhgN family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070534.1 transl_table 11 codon_start 1 locus_tag LOCUS_47940 CDS 5735865..5737424 product metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070533.1 transl_table 11 codon_start 1 locus_tag LOCUS_47950 CDS 5737578..5738339 product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070532.1 transl_table 11 codon_start 1 locus_tag LOCUS_47960 CDS complement(5738385..5738807) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070531.1 transl_table 11 codon_start 1 locus_tag LOCUS_47970 CDS 5738919..5739470 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070530.1 transl_table 11 codon_start 1 locus_tag LOCUS_47980 CDS 5739572..5740207 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070529.1 transl_table 11 codon_start 1 locus_tag LOCUS_47990 CDS complement(5740259..5741515) product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070528.1 transl_table 11 codon_start 1 locus_tag LOCUS_48000 CDS 5741713..5742249 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070527.1 transl_table 11 codon_start 1 locus_tag LOCUS_48010 CDS 5742493..5743155 product DUF3157 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070522.1 transl_table 11 codon_start 1 locus_tag LOCUS_48020 CDS complement(5743292..5744824) product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070508.1 transl_table 11 codon_start 1 locus_tag LOCUS_48030 gene hutH CDS complement(5744827..5746503) product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070507.1 transl_table 11 codon_start 1 locus_tag LOCUS_48040 CDS complement(5746636..5747337) product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070506.1 transl_table 11 codon_start 1 locus_tag LOCUS_48050 gene hutC CDS 5747557..5748783 product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070505.1 transl_table 11 codon_start 1 locus_tag LOCUS_48060 gene hutI CDS complement(5749825..5750388) product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074102.1 transl_table 11 codon_start 1 locus_tag LOCUS_48070 CDS complement(5751347..5753725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48080 CDS complement(5753715..5754422) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002982458.1 transl_table 11 codon_start 1 locus_tag LOCUS_48090 CDS complement(5754415..5755605) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228370.1 transl_table 11 codon_start 1 locus_tag LOCUS_48100 CDS 5756058..5756537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48110 CDS complement(5756597..5757796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48120 CDS 5758052..5758729 product acireductone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070497.1 transl_table 11 codon_start 1 locus_tag LOCUS_48130 gene mtnC CDS 5758883..5759326 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070493.1 transl_table 11 codon_start 1 locus_tag LOCUS_48140 CDS complement(5759413..5759820) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070490.1 transl_table 11 codon_start 1 locus_tag LOCUS_48150 CDS complement(5760217..5762013) product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070488.1 transl_table 11 codon_start 1 locus_tag LOCUS_48160 CDS complement(5762143..5763462) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070487.1 transl_table 11 codon_start 1 locus_tag LOCUS_48170 CDS complement(5763459..5764316) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070486.1 transl_table 11 codon_start 1 locus_tag LOCUS_48180 CDS complement(5764348..5764716) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070485.1 transl_table 11 codon_start 1 locus_tag LOCUS_48190 CDS 5764808..5766415 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070484.1 transl_table 11 codon_start 1 locus_tag LOCUS_48200 CDS 5766408..5767142 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070483.1 transl_table 11 codon_start 1 locus_tag LOCUS_48210 CDS 5767216..5768379 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070482.1 transl_table 11 codon_start 1 locus_tag LOCUS_48220 CDS 5768454..5768690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48230 CDS complement(5768764..5769777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48240 CDS 5769992..5770171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48250 CDS complement(5770185..5771843) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073766.1 transl_table 11 codon_start 1 locus_tag LOCUS_48260 CDS complement(5772208..5772741) product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070478.1 transl_table 11 codon_start 1 locus_tag LOCUS_48270 gene mog CDS complement(5772926..5773270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48280 CDS complement(5773680..5774138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48290 CDS complement(5774984..5776168) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070468.1 transl_table 11 codon_start 1 locus_tag LOCUS_48300 CDS complement(5776283..5777302) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070467.1 transl_table 11 codon_start 1 locus_tag LOCUS_48310 gene gpsA CDS complement(5777410..5777904) product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070466.1 transl_table 11 codon_start 1 locus_tag LOCUS_48320 gene secB CDS complement(5778016..5778450) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070465.1 transl_table 11 codon_start 1 locus_tag LOCUS_48330 CDS 5778659..5780203 product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070464.1 transl_table 11 codon_start 1 locus_tag LOCUS_48340 gene gpmM CDS 5780211..5781347 product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070463.1 transl_table 11 codon_start 1 locus_tag LOCUS_48350 CDS 5781380..5782597 product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070462.1 transl_table 11 codon_start 1 locus_tag LOCUS_48360 CDS 5782642..5783403 product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070461.1 transl_table 11 codon_start 1 locus_tag LOCUS_48370 CDS complement(5783423..5783878) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070460.1 transl_table 11 codon_start 1 locus_tag LOCUS_48380 CDS complement(5783900..5784151) product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070459.1 transl_table 11 codon_start 1 locus_tag LOCUS_48390 tRNA complement(5784974..5785050) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t01220 rRNA complement(5785163..5785264) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00380 rRNA complement(5785420..5788321) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00390 rRNA complement(5788649..5790191) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00400 CDS 5790597..5790812 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48400 CDS complement(5790802..5792232) product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074321.1 transl_table 11 codon_start 1 locus_tag LOCUS_48410 gene ccoG CDS 5792321..5792674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48420 CDS 5792797..5793702 product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074323.1 transl_table 11 codon_start 1 locus_tag LOCUS_48430 CDS complement(5793699..5793920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48440 CDS 5793871..5794071 product DUF2061 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074324.1 transl_table 11 codon_start 1 locus_tag LOCUS_48450 CDS 5794535..5795344 product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073955.1 transl_table 11 codon_start 1 locus_tag LOCUS_48460 CDS 5795450..5796355 product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073954.1 transl_table 11 codon_start 1 locus_tag LOCUS_48470 gene pstC CDS 5796355..5797215 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925923.1 transl_table 11 codon_start 1 locus_tag LOCUS_48480 gene pstA CDS 5797230..5797979 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073952.1 transl_table 11 codon_start 1 locus_tag LOCUS_48490 gene pstB CDS 5798117..5798395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48500 CDS 5798531..5799727 product flagellin lysine-N-methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073855.1 transl_table 11 codon_start 1 locus_tag LOCUS_48510 gene fliB CDS complement(5799800..5801629) product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074325.1 transl_table 11 codon_start 1 locus_tag LOCUS_48520 gene glmS CDS complement(5801681..5802385) product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074326.1 transl_table 11 codon_start 1 locus_tag LOCUS_48530 CDS complement(5802656..5804803) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074327.1 transl_table 11 codon_start 1 locus_tag LOCUS_48540 CDS complement(5805078..5806460) product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074328.1 transl_table 11 codon_start 1 locus_tag LOCUS_48550 gene glmU CDS complement(5806809..5807165) product DsrE/DsrF/TusD sulfur relay family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707068.1 transl_table 11 codon_start 1 locus_tag LOCUS_48560 CDS complement(5807829..5808257) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074329.1 transl_table 11 codon_start 1 locus_tag LOCUS_48570 CDS complement(5808317..5809693) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074330.1 transl_table 11 codon_start 1 locus_tag LOCUS_48580 gene atpD CDS complement(5809729..5810589) product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074331.1 transl_table 11 codon_start 1 locus_tag LOCUS_48590 gene atpG CDS complement(5810638..5812179) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074332.1 transl_table 11 codon_start 1 locus_tag LOCUS_48600 gene atpA CDS complement(5812194..5812727) product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074333.1 transl_table 11 codon_start 1 locus_tag LOCUS_48610 gene atpH CDS complement(5812744..5813214) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074334.1 transl_table 11 codon_start 1 locus_tag LOCUS_48620 gene atpF CDS complement(5813252..5813503) product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006083840.1 transl_table 11 codon_start 1 locus_tag LOCUS_48630 gene atpE CDS complement(5813570..5814406) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074335.1 transl_table 11 codon_start 1 locus_tag LOCUS_48640 gene atpB CDS complement(5814419..5814802) product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074336.1 transl_table 11 codon_start 1 locus_tag LOCUS_48650 CDS complement(5815028..5815915) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074337.1 transl_table 11 codon_start 1 locus_tag LOCUS_48660 CDS complement(5815931..5816719) product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074338.1 transl_table 11 codon_start 1 locus_tag LOCUS_48670 CDS complement(5816810..5817430) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074339.1 transl_table 11 codon_start 1 locus_tag LOCUS_48680 gene rsmG CDS complement(5817550..5819442) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074340.1 transl_table 11 codon_start 1 locus_tag LOCUS_48690 gene mnmG CDS complement(5819900..5820340) product FMN-binding protein MioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070417.1 transl_table 11 codon_start 1 locus_tag LOCUS_48700 gene mioC CDS 5820884..5821441 product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082253.1 transl_table 11 codon_start 1 locus_tag LOCUS_48710 CDS 5821963..5823132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48720 CDS 5823129..5824919 product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086565.1 transl_table 11 codon_start 1 locus_tag LOCUS_48730 CDS 5824919..5825599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48740 CDS 5825611..5826315 product heme-copper oxidase subunit III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086563.1 transl_table 11 codon_start 1 locus_tag LOCUS_48750 CDS 5826615..5826749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48760 CDS 5826909..5827544 product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946162.1 transl_table 11 codon_start 1 locus_tag LOCUS_48770 CDS complement(5827573..5828976) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490568.1 transl_table 11 codon_start 1 locus_tag LOCUS_48780 CDS 5829283..5830254 product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706748.1 transl_table 11 codon_start 1 locus_tag LOCUS_48790 CDS complement(5830388..5831062) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461971.1 transl_table 11 codon_start 1 locus_tag LOCUS_48800 CDS 5831925..5832125 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48810 CDS 5832515..5833444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48820 CDS complement(5833455..5833739) product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464459.1 transl_table 11 codon_start 1 locus_tag LOCUS_48830 CDS complement(5833739..5833990) product YoeB-YefM toxin-antitoxin system antitoxin YefM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815401.1 transl_table 11 codon_start 1 locus_tag LOCUS_48840 gene yefM CDS complement(5834365..5834541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48850 CDS 5834737..5835489 product TdeIII family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682206.1 transl_table 11 codon_start 1 locus_tag LOCUS_48860 CDS complement(5835517..5836779) product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946968.1 transl_table 11 codon_start 1 locus_tag LOCUS_48870 gene dcm CDS 5837137..5837430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48880 CDS complement(5838048..5839082) product IS110-like element IS1111A family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041952483.1 transl_table 11 codon_start 1 locus_tag LOCUS_48890 CDS complement(5839353..5840462) product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070730.1 transl_table 11 codon_start 1 locus_tag LOCUS_48900 CDS complement(5841683..5842966) product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268088.1 transl_table 11 codon_start 1 locus_tag LOCUS_48910 CDS complement(5842956..5843255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48920 CDS 5843666..5846200 product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483542.1 transl_table 11 codon_start 1 locus_tag LOCUS_48930 CDS complement(5847008..5848369) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070419.1 transl_table 11 codon_start 1 locus_tag LOCUS_48940 gene mnmE CDS complement(5848503..5850116) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070420.1 transl_table 11 codon_start 1 locus_tag LOCUS_48950 gene yidC CDS complement(5850365..5850727) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070422.1 transl_table 11 codon_start 1 locus_tag LOCUS_48960 gene rnpA