COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..330024 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(202..534) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00010 note possible pseudo, internal stop codon CDS complement(538..951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00020 note possible pseudo, internal stop codon CDS complement(974..3619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS complement(3639..4418) product WxL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355607.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS complement(4439..5167) product WxL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296745.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS complement(5164..5496) product LPXTG cell wall anchor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002370773.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS complement(5862..6365) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289559.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS complement(6485..7249) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002299518.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS 7355..7630 product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289551.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS 7804..8739 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304673.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 gene yidC CDS complement(8825..9229) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836305.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS complement(9243..10052) product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357254.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS complement(10039..10932) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357253.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS complement(10945..11424) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361968.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS complement(11516..12493) product tagatose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357245.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 gene lacD CDS complement(12513..13688) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357242.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS complement(13701..14432) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002301131.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS complement(14974..17049) product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288758.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 gene glyS CDS complement(17051..17968) product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002291706.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 gene glyQ CDS complement(17991..18233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS complement(18534..19394) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288755.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 gene recO CDS complement(19470..20369) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288753.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 gene era CDS complement(20388..20786) product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002330764.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS complement(20764..21240) product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288749.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 gene ybeY CDS complement(21275..23476) product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288747.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS complement(23500..24471) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288745.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS complement(24634..25080) product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002319218.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS complement(25107..25283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS complement(25446..25874) product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287322.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS 25965..26825 product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002326754.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS complement(26972..27265) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321425.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 note possible pseudo, frameshifted CDS complement(27338..29065) product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156264938.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS complement(29252..30184) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289179.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 gene trxB CDS complement(30323..31756) product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289178.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS complement(31812..32639) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061603534.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS complement(32651..34039) product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289176.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS 34285..35202 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289172.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS complement(35303..37081) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289169.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS complement(37081..38832) product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289168.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS complement(38962..39186) product YneF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294955.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS 39452..41029 product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002326755.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS complement(41564..42457) product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289444.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS 42701..45046 product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289443.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS complement(45522..46523) product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002291653.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 gene ccpA CDS 46734..47837 product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304593.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS complement(48305..48886) product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289576.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS complement(48889..49329) product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289575.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS complement(49489..50403) product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289574.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 gene galU CDS complement(50418..51449) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289572.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS complement(51489..52322) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289570.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 gene lgt CDS complement(52341..53276) product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289568.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 gene hprK CDS complement(53480..53833) product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289566.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(53833..54138) product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294972.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS complement(54311..55882) product daptomycin-sensing surface protein LiaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002330768.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 gene liaX CDS complement(56400..57077) product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289490.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 gene phoU CDS complement(57090..57848) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289489.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 gene pstB CDS complement(57864..58670) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289486.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 gene pstB CDS complement(58686..59570) product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292759.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 gene pstA CDS complement(59572..60492) product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002316421.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 gene pstC CDS complement(60607..61464) product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292763.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(61817..63265) product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304589.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 gene cls CDS complement(63438..64322) product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317241.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 gene ftsX CDS complement(64315..65001) product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292768.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 gene ftsE CDS complement(65112..66095) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096948712.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 gene prfB CDS complement(66364..68898) product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289770.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 gene secA CDS complement(69106..69660) product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289771.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 gene raiA CDS complement(69798..70181) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS complement(70502..71818) product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290048.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS complement(71907..72230) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292778.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS complement(72338..72625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294988.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS 72757..73404 product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303217.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS complement(73449..74156) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292782.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS complement(74338..78579) product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382252.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS 78756..79364 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357803.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS complement(79416..79586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288995.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 tRNA complement(79720..79793) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 tRNA complement(79802..79882) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS complement(79970..80203) product DUF2969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002316425.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS complement(80307..81191) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002302918.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS complement(81281..81742) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288999.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(81791..82063) product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289000.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 gene yidD CDS complement(82134..82310) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289019.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS complement(82323..83624) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289003.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 gene murA CDS complement(83721..83954) product DUF1146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289004.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS complement(84135..84557) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289005.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS complement(84571..85977) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289006.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 gene atpD CDS complement(86000..86902) product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289007.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS complement(86916..88472) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289008.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 gene atpA CDS complement(88495..89037) product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289009.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS complement(89024..89548) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289010.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 gene atpF CDS complement(89616..89828) product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289011.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 gene atpE CDS complement(89875..90594) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002300474.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 gene atpB CDS complement(90906..91370) product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289013.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 gene smpB CDS complement(91391..93751) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289014.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 gene rnr CDS complement(93748..94503) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002300470.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS complement(94615..94851) product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289017.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 gene secG CDS complement(95316..95591) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002300467.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS complement(95593..95865) product (4Fe-4S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356543.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS complement(96124..97098) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289477.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS complement(97249..97608) product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130423.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS complement(98016..98456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS complement(98456..99649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS complement(99681..100757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS complement(100791..101174) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS complement(101191..101967) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399351.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS complement(102644..103819) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693372.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS complement(103936..104493) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690638.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS complement(104758..105006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS complement(105013..106590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS complement(107427..107933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01080 note possible pseudo, internal stop codon, frameshifted CDS complement(108047..108232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS complement(108234..111023) product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476565.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS complement(111025..113130) product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869119.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS complement(113319..113519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS complement(113519..114451) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010753174.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS complement(114657..115955) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292812.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 gene eno CDS complement(116073..116828) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292815.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 gene tpiA CDS complement(116913..118103) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295135.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS complement(118207..119208) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292818.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 gene gap CDS complement(119249..120286) product central glycolytic genes regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321448.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS complement(120491..121822) product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295132.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 gene rpoN tRNA 121881..121954 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS complement(122252..122875) product DNA-directed RNA polymerase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304561.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 gene rpoE CDS complement(122950..123387) product DUF1934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295125.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS 123599..124441 product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295123.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS 124425..125792 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304556.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS 125813..126625 product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295119.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 gene yidA CDS complement(126966..127436) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002312217.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS 127557..127928 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002327753.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS complement(128101..129456) product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304549.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS complement(129561..130199) product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295103.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS complement(130199..131581) product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292842.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS complement(131574..133355) product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295101.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS complement(133377..133688) product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292844.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS complement(133678..134664) product V-type ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304547.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS complement(134676..135260) product V-type sodium ATP synthase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296452.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS complement(135280..135750) product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292848.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS complement(135772..137769) product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296453.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS complement(137756..138076) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002320976.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS 138439..139158 product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292852.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS complement(139580..141478) product fructose-bisphosphatase class III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290807.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS complement(141668..142930) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296456.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS complement(142923..143822) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295091.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS complement(144011..145789) product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296457.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 gene uvrC CDS complement(145933..146247) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290803.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 gene trxA CDS complement(146335..148695) product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296458.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS complement(149297..149845) product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295088.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS complement(149892..150338) product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295087.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 gene zapA CDS 150531..151445 product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295085.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 gene rnhC CDS complement(151892..152338) product spermine/spermidine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229879.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 gene bltD CDS complement(152654..153634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS complement(154215..155129) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295084.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS complement(155648..155806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS complement(155820..157964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS complement(158031..158363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS complement(158549..158992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS 159589..160488 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS complement(160709..160900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS complement(161133..161444) product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290887.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS complement(161466..161897) product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296503.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 gene ruvX CDS complement(161894..162160) product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290885.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS complement(162467..163192) product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296505.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 tRNA complement(163331..163401) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS 163526..164275 product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289867.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS 164294..164779 product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289868.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS complement(164989..165825) product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287743.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS complement(165837..166793) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287744.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS 166990..167349 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287745.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS complement(167835..168488) product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287746.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS 168712..170646 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287747.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS 171225..172838 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287759.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS complement(173302..173454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS complement(173433..173570) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS complement(174096..174272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS complement(174418..174876) product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288815.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS complement(174888..176216) product maltose-6'-phosphate glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288813.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS complement(176231..177646) product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321325.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS complement(177664..178428) product carbohydrate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288811.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS complement(178530..179351) product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288809.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS 179622..179756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS complement(180132..181322) product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303488.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS complement(181927..182175) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS complement(182436..183137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS 183546..184445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS complement(185114..186316) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287015.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS complement(186376..186579) product DUF3173 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296936.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS complement(186552..186767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS complement(186721..187953) product replication initiation factor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287016.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS 188115..188927 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287017.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS complement(189292..189507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304272.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(189744..189959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS complement(190278..191156) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304270.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS complement(191195..192313) product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287020.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS complement(192310..194409) product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287021.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS complement(194459..195280) product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287022.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS complement(195277..196086) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287024.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS complement(196107..196601) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287026.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS complement(196613..197035) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287029.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS complement(197178..199796) product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304269.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS complement(200302..201375) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287033.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS complement(201372..202199) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287036.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS complement(202199..203005) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287038.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS complement(203018..204103) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002320739.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS complement(204121..204663) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287040.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS 204937..205926 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287041.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS 205923..206669 product phosphopantothenate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287044.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS 206670..207221 product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287045.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 gene coaC CDS 207235..207870 product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287046.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS complement(208757..209431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS 209780..210415 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296930.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(210460..211626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS complement(211680..212969) product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369315.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS complement(212974..215610) product mannosylglycerate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861811.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 gene mngB CDS complement(215647..216990) product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617782.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 gene celB CDS 217149..217865 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704828.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS complement(218523..220037) product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287050.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS complement(220434..221360) product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287058.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 gene murB CDS complement(221433..222353) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287059.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS 222473..223228 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297274.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS 223304..223843 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002291442.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS complement(224322..224882) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287063.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS complement(224839..225312) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287066.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 gene tsaE CDS complement(225634..226614) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002320882.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 gene pta CDS complement(226766..227446) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287070.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS 227572..228444 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287072.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS 228471..228986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287073.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS complement(229092..229547) product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377988.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 gene tnpA CDS complement(229794..230333) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS complement(230467..231063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS 231538..231804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS 231804..232673 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674768.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS complement(232947..233510) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287074.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS complement(233571..233750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002291570.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS complement(233834..234352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS complement(234447..234827) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287076.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS 234969..236039 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675020.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS 236257..237006 product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287078.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 gene pnuC CDS complement(237517..238812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287080.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS complement(238891..239535) product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287081.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 gene pcp CDS complement(239552..240496) product DUF979 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287082.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS complement(240498..241187) product DUF969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287083.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS complement(241364..242188) product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130487.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS 242436..242756 product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287086.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS 242931..243647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS complement(243814..245241) product basic amino acid/polyamine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287090.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS 245450..245905 product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287091.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 gene nrdI CDS complement(246028..246342) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02430 note possible pseudo, internal stop codon, frameshifted CDS complement(246495..246845) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02440 note possible pseudo, internal stop codon, frameshifted CDS complement(247205..247492) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02450 note possible pseudo, internal stop codon CDS complement(247839..248021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS complement(247999..248478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS 248606..249046 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262616.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS complement(249507..249638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS complement(250144..250614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS complement(250630..250830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS complement(251109..251378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS complement(251412..251963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS complement(251935..253551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS 253878..254126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS complement(254348..256300) product glucose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287092.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS complement(256314..257210) product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287094.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 gene murQ CDS complement(257197..258273) product MupG family TIM beta-alpha barrel fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296173.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS complement(258433..258960) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304258.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS complement(259059..260564) product ABC-F type ribosomal protection-like protein Eat(A) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296175.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 gene eat(A) CDS complement(260819..261937) product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289891.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS 262095..263036 product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296177.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS complement(263089..264000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290034.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS 264259..265599 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399558.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS complement(266091..267494) product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296182.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 gene nhaC CDS complement(267879..269102) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293788.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS complement(269132..269974) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390147.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS complement(269990..270670) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293786.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS complement(270672..271745) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296186.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS complement(272392..273069) product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296187.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS complement(273307..274623) product glycoside hydrolase family 73 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287463.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS complement(274837..277485) product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296188.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 gene mgtA CDS 278234..278689 product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293327.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 gene ndk CDS complement(279206..280075) product Rgg/GadR/MutR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296189.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS complement(280271..282349) product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293776.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS complement(282446..282853) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566583.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS complement(282920..283504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293828.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS complement(283783..285180) product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293829.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS complement(285197..286177) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293830.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS 286378..286800 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296191.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS 287071..287256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS complement(287301..288002) product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293834.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS complement(288018..288458) product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293607.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS complement(288458..289033) product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293608.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS complement(289493..289999) product D-lyxose/D-mannose family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067485285.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS complement(290011..291108) product PTS fructose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002323374.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS complement(291125..291433) product PTS fructose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705652.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS complement(291448..292326) product ketose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431312.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS complement(292346..292807) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930923.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS complement(292891..293052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS complement(293707..294054) product DUF1831 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286736.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS complement(294195..295331) product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295158.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS complement(295520..296494) product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286741.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS complement(296572..297147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS 297321..299228 product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286747.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS complement(299874..300419) product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286753.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS complement(300431..301123) product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286756.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS complement(301140..301427) product cell wall synthase accessory phosphoprotein MacP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286760.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 gene macP CDS complement(301440..302003) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002325125.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS 302240..302899 product 5-bromo-4-chloroindolyl phosphate hydrolysis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286764.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS 303049..304248 product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286766.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS complement(304747..306132) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286768.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS complement(306169..307035) product GRP family sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286769.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS complement(307124..308149) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286770.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS complement(308169..308843) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002291233.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS complement(309024..309425) product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286825.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS complement(309500..309706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293677.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS complement(309923..310378) product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286829.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 gene argR CDS complement(310461..311084) product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002325134.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS complement(311155..311385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS 311340..312707 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286833.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS 312785..313897 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286834.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS complement(314081..315730) product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286835.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS complement(315951..316556) product LysM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286836.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS complement(316959..318122) product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286837.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 gene queG CDS complement(318183..318932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286840.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS complement(319192..320124) product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286843.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS complement(320111..320965) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286845.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS complement(320962..321705) product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286846.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS 321956..323329 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286847.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS complement(323412..324317) product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286848.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS complement(324426..324599) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286849.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS complement(324596..325264) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286851.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS 325420..325692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS complement(325777..326340) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289434.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 gene efp CDS 326769..327686 product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209611891.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS 327698..328849 product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289438.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS 328966..329424 product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289439.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS 329520..329996 product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289440.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 sequence02 source 1..326842 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 349..783 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289110.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS 793..1119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295768.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS complement(1279..1536) product glucose uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321369.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS 1700..1963 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292935.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS 1981..2169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288067.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS complement(2779..2964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355504.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS 3214..3585 product YxeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288062.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 tRNA complement(3668..3742) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS complement(3805..4218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295776.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS complement(4285..5046) product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748663.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS 5435..5632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288059.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS 5770..6252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288056.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS complement(6504..7100) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288054.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS 7478..8944 product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288052.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS 9451..12984 product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288051.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS 12981..16694 product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288050.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 gene addA CDS 16759..17100 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303789.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS 17417..18460 product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288048.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 gene pheS CDS 18467..20884 product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288046.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 gene pheT CDS complement(21016..22026) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288045.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 gene trpS CDS 22281..23018 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288042.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS 23036..23851 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288041.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS 23863..24510 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288038.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS 24525..25181 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288036.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS 25348..26160 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317207.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 gene racE CDS 26164..27522 product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288032.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 gene rph CDS 27523..28035 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288030.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS 28147..28647 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295789.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS 28838..29416 product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292856.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS 29697..29843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS 29969..30178 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS complement(30433..31350) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295791.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS 31503..32516 product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321517.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS complement(32662..33417) product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295795.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 gene fabI CDS 33658..34098 product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295797.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 gene fabZ CDS complement(34174..34917) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295798.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS 35106..36200 product DUF871 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295800.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS 36556..37488 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289735.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS complement(37595..38611) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357638.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 gene gap CDS 38904..40217 product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002306800.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 gene obgE CDS 40563..41153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295807.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS 41309..42253 product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295809.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene rnz CDS 42250..43038 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002332402.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS 43047..43490 product lipopolysaccharide assembly protein LapA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303793.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS 43960..46257 product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002338264.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 gene recJ CDS 46271..46783 product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295813.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS 47430..49661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS complement(49949..50167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297436.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS complement(50304..50927) product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296572.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 gene lexA CDS 51073..51312 product DUF896 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295816.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS 51422..53416 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295818.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 gene tkt CDS 53651..54526 product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289538.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS 54692..55618 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296093.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 gene cysK CDS 55809..56255 product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289542.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS 56580..57932 product NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289543.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS 58080..58361 product DUF5960 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289544.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS 58621..59562 product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296674.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS 59618..60511 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296675.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS 60703..61422 product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289610.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS 61443..62108 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289608.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 gene nth CDS complement(62161..64494) product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289606.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS complement(64494..65126) product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289604.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 gene recU CDS 65199..65729 product DUF1273 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369608.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS 65824..66234 product cell division regulator GpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295835.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 gene gpsB CDS 66688..67851 product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289183.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS 67890..69386 product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289184.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS 69484..70134 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289185.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS complement(70234..70560) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289192.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS 70707..71846 product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289189.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS 71983..73332 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289190.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS complement(73836..74264) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289191.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS 74627..77269 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296111.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 gene alaS CDS 77436..78032 product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295844.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS 78078..79220 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295845.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS complement(79610..80020) product ribonuclease HI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295847.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS 80096..80548 product EbsA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295850.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS 80569..80703 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS complement(80687..80899) product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303804.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS 81073..82743 product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295854.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS 83358..83741 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295856.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS 83734..84432 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295857.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS 84437..84901 product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295859.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 gene lspA CDS 84898..85803 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295861.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS 86077..86616 product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295862.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 gene pyrR CDS 86627..87910 product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288870.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS 87922..88848 product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288872.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS 88867..90147 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288875.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS 90155..91231 product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288877.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS 91234..94419 product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288878.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 gene carB CDS 94600..95373 product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288879.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS 95370..96302 product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288880.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS 96299..97006 product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288882.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 gene pyrF CDS 97012..97641 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288884.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 gene pyrE CDS complement(97694..98218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS 98357..99307 product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964780.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS 99540..100187 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288886.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS 100220..100924 product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321477.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS 100921..101835 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288888.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS complement(102201..103661) product virulence factor transcriptional regulator MgaSpn inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205278.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 gene mgaSpn CDS 104345..104956 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS 105050..105577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS 105630..109511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS complement(109878..111581) product fibronectin-binding protein EfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288890.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 gene efbA CDS 111833..112432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295864.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS 112825..113874 product tryptophan ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289632.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 gene trpX CDS 113871..114755 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289631.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS 114756..115526 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289629.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS 115985..116842 product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289627.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 gene aroE CDS 116856..117881 product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289144.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 gene aroF CDS 117907..118980 product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382321.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 gene aroB CDS 118982..120148 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357582.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 gene aroC CDS 120203..121513 product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289139.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 gene aroA CDS 121506..122015 product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357579.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS 122231..123415 product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295866.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS complement(123591..124517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS 124623..124751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS 125020..125433 product DUF4231 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002305693.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS complement(125665..125922) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295273.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS 126085..127059 product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287105.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 gene bsh CDS complement(127598..127900) product DUF5960 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002329382.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS complement(128280..129902) product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002329642.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS 130113..131354 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733127.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS 131493..132386 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722208.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS 132400..133230 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003729785.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS 133243..135393 product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002391620.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS 135410..138721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386656.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS 138736..139695 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363772.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS complement(139837..140685) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288161.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS 140893..141360 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964081.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS 141512..142753 product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964080.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS complement(142811..143170) product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475565.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS 143289..144104 product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387903.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 gene menB CDS 144124..145563 product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387679.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS 145544..146926 product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364946.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS 146916..148643 product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387681.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 gene menD CDS 148717..149460 product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819179.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 gene menH CDS 149474..150580 product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387683.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 gene menC CDS 150746..152512 product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288160.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS 152621..153880 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288159.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS 153978..155282 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288157.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS 155286..156137 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288156.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS 156150..156971 product maltodextrose utilization protein MalA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295923.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS 157215..158684 product ABC-F type ribosomal protection protein Msr(C) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287458.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 gene msr(C) CDS 158868..159200 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429487.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS 159193..159546 product DUF1048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891986.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS complement(159742..160653) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906016.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS 160758..161291 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102040.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS 161473..162804 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721657.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS 162797..165091 product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990068.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS 165103..166089 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293830.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS 166321..167535 product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006741.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS 167929..168870 product dihydroorotate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295918.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS complement(168923..170431) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002311258.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS complement(170895..171806) product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287299.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS 172058..173320 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028349.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS 173366..174274 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356840.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS 174286..175122 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258534.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS 175153..175539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS 175555..177381 product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201936.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 177374..179140 product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201936.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS 179300..180733 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295917.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS 180763..181602 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295916.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS 181602..182264 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002347025.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS 182518..183555 product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674714.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS 183715..184404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298443.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS 184409..185365 product sce7725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295913.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS 185392..185901 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002302625.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS complement(186025..186585) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295911.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS complement(186741..187922) product nucleoside transporter C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295909.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS complement(188146..189648) product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002302627.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS 189877..190068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295907.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS 190301..191203 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295906.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS 191200..192306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295905.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS 192407..192925 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748669.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS 192906..193298 product DUF4430 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002302628.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS 193343..194278 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295900.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS 194419..195198 product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295898.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS 195191..195508 product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295896.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS 195810..196658 product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021722748.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS 196787..198685 product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905984.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS 198710..200134 product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964714.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS 200849..202444 product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286080.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS 202603..203451 product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286075.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS 203597..204076 product DUF6530 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286073.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS 204107..206344 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286072.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS 206506..208155 product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286071.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS complement(208341..208901) product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286070.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS complement(208927..209412) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286069.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS complement(209419..210216) product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286068.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS complement(210383..211906) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286067.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS complement(212095..213099) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286066.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS complement(213310..214629) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286064.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS complement(214634..215308) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286063.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS 215505..215921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS 215949..216515 product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296634.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS 216533..218728 product type IA DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002322737.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS 218818..219144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289718.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS 220156..221583 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476248.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS complement(221788..222069) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286049.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS complement(222175..223206) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286050.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS 223408..224280 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286051.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS complement(224320..225264) product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289717.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS complement(225395..226447) product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130092.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS 226650..227699 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288167.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS complement(228100..228906) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083599.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS 229151..229579 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009911769.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS complement(229643..230500) product Ebp pilus assembly class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379311.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 gene srtC CDS complement(230634..232493) product endocarditis and biofilm-associated pilus major subunit EbpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109477.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 gene ebpC CDS complement(232486..234090) product SpaH/EbpB family LPXTG-anchored major pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137604703.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS complement(234087..237677) product SpaA isopeptide-forming pilin-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286055.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS 238112..239599 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002328933.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS complement(239717..240691) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101851.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS complement(240905..241702) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721664.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS complement(241710..242810) product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009911777.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 gene aguA CDS complement(242925..244022) product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989327.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 gene aguA CDS complement(244009..245391) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732183.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS complement(245413..246447) product putrescine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721659.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 gene ptcA CDS 246719..247378 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288176.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS 247491..247853 product DUF2200 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288180.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS complement(247912..248925) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095327.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS complement(248943..250103) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095330.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS complement(250103..250969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS complement(250989..251885) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972783.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS complement(251888..252766) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311867.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS complement(252834..254126) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210835.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS 254390..255307 product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287299.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS complement(255358..255591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS complement(255663..255884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS complement(256062..256913) product Ebp pilus assembly class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379311.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 gene srtC CDS complement(257060..258943) product endocarditis and biofilm-associated pilus major subunit EbpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109477.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 gene ebpC CDS complement(258940..260364) product endocarditis and biofilm-associated pilus minor subunit EbpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379309.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 gene ebpB CDS complement(260368..263829) product endocarditis and biofilm-associated pilus tip protein EbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_154080969.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 gene ebpA CDS 263980..265404 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382000.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS 265519..266046 product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288181.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS 266142..267302 product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295931.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS complement(267378..269156) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990058.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS complement(269205..269957) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905524.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS complement(270464..272497) product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288183.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS complement(272698..274053) product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384702.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 gene celB CDS complement(274068..274394) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357981.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS complement(274424..275374) product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361636.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS complement(276015..277310) product Sapep family Mn(2+)-dependent dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386630.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS complement(277320..278048) product GntR family transcriptional regulator, LSA1692 subfamily inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357984.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS complement(278183..278815) product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295919.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 279053..279643 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101549.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS complement(279820..280029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287763.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS complement(280081..280689) product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287766.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS complement(280702..281595) product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412735.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS complement(281610..282569) product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381868.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS complement(282606..283028) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002366740.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS complement(283190..283762) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS complement(283856..284593) product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963408.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS complement(284907..285062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS complement(285205..286500) product GHKL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193577597.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS complement(286773..286973) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293303.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS complement(287161..288804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921770.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS complement(288808..289542) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774917.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS 289713..290015 product DUF2316 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721436.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS 290130..290279 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321680.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS complement(290717..292498) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360293.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS complement(292498..294240) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357553.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS 294376..295212 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357554.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS complement(295280..295840) product energy-coupled thiamine transporter ThiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287348.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 gene thiT CDS complement(296130..297449) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733949.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS complement(297620..298333) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723222.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS 298508..299932 product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989440.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 repeat_region 300136..300556 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttttagagctatgctgttttgaatg CDS complement(300613..300987) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966792.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS 301199..301636 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS complement(301702..302079) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476446.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS complement(302129..302983) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080532.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS complement(303523..304158) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185385.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS 304264..304623 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930407.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS complement(304704..306842) product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025189825.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS 307339..308166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS 308459..308848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS complement(308924..309640) product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922674.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS complement(309642..311012) product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358211.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS complement(311076..311357) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002982644.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS complement(311357..311824) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS 312088..313995 product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861602.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 repeat_region 314169..314798 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttttggaagcattcaaaacagcatagctctaaaac CDS complement(315065..316444) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286868.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS complement(316741..317610) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721303.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS complement(318108..319382) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131198.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 gene eno CDS complement(319598..319900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717610.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS complement(319973..320335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS complement(320436..321209) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383586.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS 321289..323007 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359874.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS 323012..324802 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002374418.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS complement(325151..325408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS complement(325506..326114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06180 sequence03 source 1..311687 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(190..960) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287492.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS complement(953..1888) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721785.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS complement(2035..2307) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222020.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS complement(2487..2636) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296119.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 gene rpmG CDS complement(2922..5072) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287654.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS complement(5378..6217) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287653.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS complement(6374..8314) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287651.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 gene thrS CDS complement(8635..8814) product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287649.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS complement(9814..10812) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989346.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS complement(10809..11984) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263552.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS complement(12105..12938) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431317.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS complement(13234..15012) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287647.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS 15243..17522 product RNA polymerase recycling motor HelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287644.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 gene helD CDS complement(17930..18574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287642.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS complement(18771..19490) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287641.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS complement(19625..20791) product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287640.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS complement(20870..21610) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287639.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS complement(21612..21995) product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033582077.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 gene rsfS CDS complement(21998..22585) product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287635.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 gene yqeK CDS complement(22575..23222) product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287632.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS complement(23236..23547) product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287630.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 gene yhbY CDS complement(23563..24672) product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287628.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 gene yqeH CDS complement(24669..25196) product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287626.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS complement(25403..26134) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263565.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS complement(26149..26835) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255158.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS complement(26850..27674) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014636396.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(27963..28748) product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287624.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS complement(28741..29610) product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287623.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 gene accD CDS complement(29611..30990) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287622.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS complement(30998..31417) product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287621.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 gene fabZ CDS complement(31432..31917) product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156264861.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 gene accB CDS complement(31920..33155) product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287619.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 gene fabF CDS complement(33174..33911) product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287617.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 gene fabG CDS complement(33914..34840) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287616.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 gene fabD CDS complement(34945..35169) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287614.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(35230..36192) product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287612.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS complement(36202..36642) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287610.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS 36948..37871 product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287608.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS complement(37988..38218) product YkuJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287607.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS complement(38304..39191) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287606.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS complement(39268..40491) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287605.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS complement(40509..41558) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287604.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS complement(41747..43474) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287603.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 gene ptsP CDS complement(43474..43740) product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287602.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS 44456..46555 product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287598.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS 46775..47098 product DUF1827 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290825.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS complement(47262..47522) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287661.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS complement(47771..48652) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002302695.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS complement(48783..49325) product ClbS/DfsB family four-helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837148.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS complement(49507..49884) product HsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453603.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS complement(49903..50322) product DUF2871 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111798.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS complement(50332..50742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111796.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS complement(50787..51341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS complement(51605..51979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS complement(52185..53762) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748648.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS complement(53926..55302) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295395.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS complement(55429..56547) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290821.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS 56703..57146 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290819.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS complement(57200..57733) product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290817.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS complement(57827..59014) product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296955.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 gene mutY CDS complement(59007..59807) product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002318634.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 gene recX CDS 59915..61291 product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295399.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 gene rlmD CDS complement(61386..62633) product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295400.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS complement(63026..64030) product DUF916 and DUF3324 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361272.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS complement(64064..64672) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS complement(64697..66061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS complement(66095..67582) product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458188.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 gene murF CDS complement(67612..67851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS complement(67851..69536) product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101347.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS complement(69608..71566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS 72049..73497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS complement(73634..73834) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292860.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS complement(73971..74579) product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295401.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS complement(74694..75152) product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292862.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS 75398..76207 product DUF1189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289147.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS 76330..77277 product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289148.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS complement(77413..77712) product iron-sulfur cluster biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289149.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS complement(77731..78396) product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289151.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS 78518..78754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS 79059..80834 product DUF6056 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774225.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS complement(81322..81954) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289153.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS complement(81961..83028) product two-component system sensor histidine kinase LiaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289154.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 gene liaS CDS complement(83025..83756) product cell wall-active antibiotics response protein LiaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002327152.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 gene liaF CDS complement(83919..84398) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289156.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 gene greA CDS complement(84533..85705) product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289159.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 gene mltG CDS 85875..87032 product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289161.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS complement(87103..88053) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289372.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS complement(88154..89368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS complement(89378..89971) product YveK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659683.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS 90292..90696 product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646390.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 gene tagD CDS complement(90746..92170) product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254175.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS complement(92167..93315) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS complement(93324..94319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS complement(94320..95375) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383751.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS complement(95387..96088) product IspD/TarI family cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002380521.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS complement(96085..96960) product LicD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379609.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS complement(97010..97834) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107948.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS complement(97905..99293) product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289073.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS complement(99529..101667) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289076.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS complement(101703..103283) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289078.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS complement(103273..104493) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289079.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS complement(104505..105311) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289081.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS complement(105560..106822) product EpaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294529.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS complement(106875..108875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002302719.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS complement(108922..109773) product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286428.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 gene rfbD CDS complement(109853..110881) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292882.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 gene rfbB CDS complement(110904..111476) product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286442.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 gene rfbC CDS complement(111490..112356) product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286449.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 gene rfbA CDS complement(112457..113164) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321540.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS complement(113169..113996) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286453.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS complement(113996..114796) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286455.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS complement(114797..115927) product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286457.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS complement(116017..116940) product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286461.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS complement(116964..117728) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286463.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 gene map CDS 117892..118335 product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286465.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS complement(118636..119208) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286467.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS 119469..120701 product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286469.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS 121521..122621 product DUF4950 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025873024.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 tRNA complement(122823..122894) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS 123121..123279 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS complement(123387..124568) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286589.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS complement(124697..125110) product DUF3284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286592.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS complement(125110..125289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS complement(125320..125541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286598.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS complement(125618..127075) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286601.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS complement(127217..127537) product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287579.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS complement(127567..127884) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286606.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS complement(128049..130748) product sigma-54-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286607.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS complement(130812..132092) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286608.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS complement(132092..133105) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286612.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS complement(133124..133861) product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002318601.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 gene sfsA CDS 134033..134389 product DUF4828 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286678.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS 134609..135256 product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286616.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS 135271..136794 product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286618.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 gene zwf CDS complement(136937..139729) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286621.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 gene ileS CDS complement(139984..140688) product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286622.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS complement(140709..141491) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286624.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS complement(141510..141764) product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355902.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS complement(141794..142387) product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286627.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 gene sepF CDS complement(142401..143078) product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286628.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS complement(143096..144334) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286629.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 gene ftsZ CDS complement(144357..145679) product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286631.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 gene ftsA CDS complement(145830..146969) product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286633.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS complement(146985..148076) product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286637.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 gene murG CDS complement(148097..149458) product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286638.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 gene murD CDS complement(149472..150434) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286639.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 gene mraY CDS complement(150461..152626) product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286640.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS complement(152657..153049) product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294542.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 gene ftsL CDS complement(153054..154016) product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286642.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 gene rsmH CDS complement(154036..154467) product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286645.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 gene mraZ CDS complement(154634..155002) product DUF3397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286647.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS complement(155524..157212) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286651.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 gene recN CDS complement(157229..157678) product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286653.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS complement(157760..158578) product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286655.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS complement(158587..159477) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286656.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS complement(159477..159701) product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286657.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS complement(159705..161045) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286658.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 gene xseA CDS complement(161046..161900) product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286660.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS complement(161995..162444) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286662.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 gene nusB CDS complement(162437..162862) product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286664.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS complement(162881..163438) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226377.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 gene efp CDS complement(163596..164660) product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286665.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS complement(164856..165101) product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286666.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS complement(165236..165610) product DUF956 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286668.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS complement(165732..166391) product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101064.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS complement(166388..168817) product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101063.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS complement(168882..169793) product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101062.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 gene yqeK CDS complement(169796..170191) product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101061.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS complement(170192..186079) product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101060.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS complement(186149..187063) product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286670.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS complement(187081..187890) product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890752.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS complement(187939..188904) product mannose/fructose/sorbose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890751.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS complement(189002..189493) product mannose/fructose/sorbose PTS transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289455.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS complement(189699..192512) product sigma-54-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289453.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS complement(193108..193263) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS complement(193398..193625) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459149.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS 193881..194588 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355690.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS complement(194721..195014) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289452.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 gene rpmA CDS complement(195027..195371) product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289451.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS complement(195400..195708) product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289450.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 gene rplU CDS 195935..196612 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289449.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS complement(196648..198276) product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294025.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS complement(198530..199081) product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145144.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS complement(199078..199434) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08010 tRNA complement(199805..199878) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS complement(200153..200848) product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288107.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS complement(200962..201474) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002320930.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS 201688..203520 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288103.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS complement(203586..204590) product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288102.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS complement(204601..205341) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288100.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS complement(205404..206216) product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288098.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS complement(206220..207299) product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288096.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS complement(207564..208826) product D-alanyl-lipoteichoic acid biosynthesis protein DltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288094.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 gene dltD CDS complement(208826..209059) product D-alanine--poly(phosphoribitol) ligase subunit DltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288092.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 gene dltC CDS complement(209110..210315) product D-alanyl-lipoteichoic acid biosynthesis protein DltB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288090.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 gene dltB CDS complement(210312..211826) product D-alanine--poly(phosphoribitol) ligase subunit DltA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288089.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 gene dltA CDS complement(211837..211986) product teichoic acid D-Ala incorporation-associated protein DltX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288113.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS complement(212305..214389) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288087.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS complement(214379..215146) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288085.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS 215451..217634 product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288083.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 gene nrdD CDS 217780..218382 product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288081.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 gene nrdG CDS complement(218467..219987) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906066.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS complement(220008..221423) product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906065.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 gene uxaC CDS complement(221525..222598) product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288173.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 gene uxuA CDS complement(222601..224229) product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288175.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS complement(224778..225893) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294035.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 gene dinB CDS complement(226462..227334) product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288078.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 gene rsmI CDS complement(227419..227766) product DNA replication initiation control protein YabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288076.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS complement(227759..228583) product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288073.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS complement(228613..229557) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288071.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 gene holB CDS complement(229566..229895) product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292340.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS complement(229910..230554) product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294039.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 gene tmk CDS complement(230619..231215) product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296223.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 gene recR CDS complement(231240..231554) product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292337.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS complement(231576..233324) product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294042.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 gene dnaX CDS 233542..234789 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289234.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS 234809..236002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289233.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS 235999..236799 product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289232.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS complement(236857..237771) product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048289.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS complement(237780..239228) product aryl-phospho-beta-d-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243232.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 gene bglH CDS 239461..239766 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS 239794..241140 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363934.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS complement(241525..242181) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290319.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS 242375..242659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289230.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS 242678..243865 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294047.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS complement(244030..244674) product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379300.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS complement(244703..245092) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687566.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS complement(245161..245796) product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262698.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS complement(246059..248902) product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100911.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS complement(249401..250078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS complement(250445..251329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS complement(251390..251863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS complement(252265..253005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS complement(253007..253771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS complement(253921..255657) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116957511.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS complement(255650..256822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS complement(257062..259959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS complement(260265..260450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS 260588..260806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS complement(261067..261261) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS complement(261251..261886) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS complement(262216..262434) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS complement(262422..263141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS complement(263155..263583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS complement(263770..264255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS 264380..264844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS 265247..265597 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381040.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS 265805..266557 product Rep protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387574.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS 266630..266848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS 266943..267374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08660 note possible pseudo, internal stop codon CDS 267402..268166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08670 note possible pseudo, internal stop codon CDS complement(268198..268461) product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290330.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS complement(268560..269855) product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290332.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 gene rho CDS complement(269852..271123) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294056.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS complement(271347..272279) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101006.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS complement(272284..272910) product YesL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994403.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS complement(273226..274869) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357899.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS complement(274882..275796) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357901.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS complement(275813..276757) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382199.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS complement(276800..277819) product HTH-type transcriptional repressor PurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165644.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 gene purR CDS complement(277994..280111) product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002391620.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS complement(280128..281555) product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131549.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS complement(281731..282456) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721899.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS complement(282692..282844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS complement(282865..283734) product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290335.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS complement(284073..285683) product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286999.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 repeat_region 285890..286323 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttttggaagcattctaaacaacatagctctaaaac CDS complement(286508..287848) product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287001.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 gene glnA CDS complement(287890..288282) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287002.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS complement(288446..289699) product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460292.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS complement(289683..290936) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289406.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 gene hflX CDS complement(290933..291862) product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289405.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 gene miaA CDS complement(291870..292601) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289404.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS complement(292846..293373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289403.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS 293556..294149 product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289402.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 gene clpP CDS complement(294547..295023) product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289401.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS complement(295159..295332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355495.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS complement(295301..295483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS complement(295440..297200) product multidrug efflux ABC transporter subunit EfrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289400.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 gene efrB CDS complement(297197..298927) product multidrug efflux ABC transporter subunit EfrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748727.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 gene efrA CDS 299310..299522 product DNA-directed RNA polymerase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287947.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS 299524..301206 product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287948.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS complement(301406..301606) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355121.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS complement(301756..302370) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294069.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 gene radC note possible pseudo, frameshifted CDS complement(302514..303164) product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287951.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS complement(303154..304467) product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294071.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS complement(304723..307368) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287953.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS complement(307709..308362) product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287954.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS complement(309019..310230) product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287955.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 gene thiI CDS complement(310247..311389) product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287956.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 sequence04 source 1..211458 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(12..290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS complement(614..835) product hemolysin XhlA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379918.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS complement(890..2272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS complement(2322..2972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS 3065..3394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09100 note possible pseudo, frameshifted CDS complement(3459..5294) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288355.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 gene lepA CDS 5442..6662 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288353.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS 6689..7180 product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288352.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS 7177..7848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321495.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS complement(7926..10535) product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288348.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 gene clpB CDS complement(10708..11766) product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288347.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS complement(11777..12049) product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288344.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS complement(12111..13007) product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288343.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS complement(13205..14443) product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288340.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 gene pepT CDS complement(14459..15580) product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288338.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS complement(15577..16278) product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288335.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS complement(16875..17294) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288333.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS complement(17324..18250) product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288331.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 gene dnaI CDS complement(18250..19632) product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288329.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS complement(19646..20146) product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288327.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 gene nrdR CDS complement(20416..20748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288325.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS complement(20935..21576) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288324.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 gene coaE CDS complement(21540..22376) product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288323.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 gene mutM CDS complement(22401..25046) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748675.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 gene polA CDS complement(25166..25849) product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296397.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS complement(25842..26327) product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296398.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS complement(26485..27819) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296400.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 gene murC CDS complement(27949..28710) product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296401.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS complement(28738..29208) product SprT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296402.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS complement(29212..31392) product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296403.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS complement(31552..32286) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296404.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS complement(32402..33343) product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296405.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS complement(33537..33908) product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296407.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS complement(34213..35604) product L-cystine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295194.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS complement(35821..36207) product DUF1149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002291995.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS complement(36263..36883) product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295196.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS complement(36923..37591) product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295197.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS complement(37604..38053) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002322028.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS complement(38105..38776) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295199.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS complement(38974..39174) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS 39221..39439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS complement(39721..40572) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383582.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS complement(40584..41480) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356840.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS complement(41584..42861) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359868.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS complement(42898..44031) product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359867.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS complement(44019..45833) product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359866.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS complement(45838..46179) product membrane lipoprotein lipid attachment site-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359865.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS 46385..47464 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356832.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS complement(47625..49298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS complement(49301..50149) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369000.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS complement(50307..52313) product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254470.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS 52425..53222 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009909131.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS complement(53403..53531) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295229.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS complement(53776..54711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS complement(55944..56579) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902228.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS complement(56572..58467) product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989614.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS complement(58522..59964) product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930652.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS complement(60007..60348) product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721484.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS complement(60389..61660) product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721483.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS complement(61664..61969) product PTS lactose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732400.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS complement(62280..63776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS complement(63769..64629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS complement(65010..66383) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288467.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 gene rlmD CDS complement(66501..67544) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288471.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS complement(67555..68985) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288473.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 gene gatB CDS complement(68982..70454) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288475.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 gene gatA CDS complement(70454..70759) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288477.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 gene gatC CDS complement(70859..72901) product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002323115.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 gene ligA CDS complement(72918..75155) product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002319708.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 gene pcrA CDS 75320..76855 product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288482.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS complement(76889..77131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS complement(77183..77785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS complement(77807..78334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS complement(78331..80556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS complement(80767..82698) product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288483.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS complement(82717..83631) product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288484.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 gene pfkB CDS complement(83628..84380) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002323503.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS complement(84549..84737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294422.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS complement(84748..86076) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288487.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS 86210..86374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS complement(87059..87580) product folate family ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289509.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS complement(87727..88488) product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367595.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS complement(88540..89418) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357090.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS complement(89658..91211) product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922740.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 gene hutH CDS complement(91254..92624) product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898305.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS complement(92662..93066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS complement(93224..94900) product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922737.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS complement(94919..95545) product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836510.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS complement(95557..96456) product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922735.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 gene ftcD CDS 97145..98524 product methylaspartate mutase accessory protein GlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945203.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 gene glmL CDS complement(98638..101679) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836506.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS complement(101866..103131) product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836513.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 gene hutI CDS 103341..105365 product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836512.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS complement(105577..106170) product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288491.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 gene yihA CDS complement(106235..107485) product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288492.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 gene clpX CDS complement(107721..109007) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292069.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 gene tig CDS complement(109171..110106) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296313.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS complement(110364..111044) product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296311.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS complement(111046..112074) product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296309.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 gene sppA CDS complement(112098..112388) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287827.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS 112803..114611 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287825.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 gene glmS CDS complement(114798..116153) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287824.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 gene glmM CDS complement(116223..117362) product CdaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287822.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS complement(117359..118246) product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287821.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 gene cdaA CDS complement(118436..122119) product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287819.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 gene nifJ CDS 122324..122839 product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287818.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS complement(122927..123862) product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289698.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 gene whiA CDS complement(123895..124893) product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289697.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS complement(124890..125774) product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289695.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 gene rapZ CDS complement(125968..126690) product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296517.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS complement(126693..127955) product D-aspartate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294441.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS complement(128223..131048) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296519.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 gene uvrA CDS complement(131065..133059) product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294444.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 gene uvrB CDS 133318..134811 product amino acid ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296521.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS 134813..135550 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292113.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS complement(135815..136987) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289374.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 gene dnaJ CDS complement(137249..139078) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292134.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 gene dnaK CDS complement(139125..139688) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296525.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 gene grpE CDS complement(139785..140828) product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289532.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 gene hrcA CDS complement(141059..142240) product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289534.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 gene hemW CDS complement(142342..142626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS complement(142727..143560) product Rgg/GadR/MutR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002911924.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS 143796..144449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS 144469..144771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS complement(144876..145037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298811.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS complement(145082..145300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS complement(145316..145978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS 146880..147596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289536.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS complement(147833..149173) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131380.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS complement(149173..149682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131379.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS complement(149852..151174) product 2-hydroxycarboxylate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002308483.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS complement(151274..152917) product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296476.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS complement(153417..154370) product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706765.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS complement(154602..155540) product riboflavin biosynthesis protein RibF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288521.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 gene ribF CDS complement(155544..156467) product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294474.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 gene truB CDS complement(156812..157315) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS complement(157518..158384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS complement(158566..158784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS complement(158772..158924) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS 159250..159585 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132198.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS complement(159737..160084) product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288513.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 gene rbfA CDS complement(160111..162357) product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288511.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 gene infB CDS complement(162370..162681) product YlxQ-related RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288509.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS complement(162678..162971) product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288501.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS complement(162991..164187) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288500.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 gene nusA CDS complement(164209..164682) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288499.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 gene rimP CDS complement(164987..169339) product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288497.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS complement(169481..171190) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288495.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS complement(171257..172525) product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294136.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 gene rseP CDS complement(172814..173614) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296531.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS complement(173611..174423) product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294134.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS complement(174615..175172) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293875.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 gene frr CDS complement(175175..175897) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293877.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 gene pyrH CDS complement(176035..176916) product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293878.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 gene tsf CDS complement(177017..177799) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293880.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 gene rpsB CDS 178157..178627 product ArgR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293881.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS complement(178722..180413) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288432.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 gene argS CDS complement(180856..181803) product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288434.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 gene arcC CDS complement(181905..182924) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288437.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 gene argF CDS complement(183041..184270) product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288439.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 gene arcA CDS 184742..185452 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288442.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS complement(185760..186770) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288444.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 gene tsaD CDS complement(186767..187237) product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288445.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 gene rimI CDS complement(187241..187783) product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288446.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 gene rimI CDS complement(187767..188489) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002326250.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 gene tsaB CDS complement(188686..189663) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288449.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS complement(189692..191116) product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288451.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 gene galT CDS complement(191077..191268) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS complement(191280..192269) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293897.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 gene galE CDS 192525..192692 product DUF3042 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288457.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS complement(192749..194581) product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293899.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS complement(194601..194966) product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362343.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS complement(195087..195479) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288461.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS complement(195495..196457) product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288462.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS complement(196457..196669) product YqgQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293902.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(196690..197388) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289885.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS complement(197413..197952) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289886.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS complement(198213..199202) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296124.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS complement(199199..200188) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293904.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS complement(200185..200988) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002325771.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS 201155..202111 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293906.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS complement(202275..202769) product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296121.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS complement(202842..205034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS complement(205031..205777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS complement(205777..206121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS complement(206111..207580) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317943.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS complement(207702..208583) product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905507.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS complement(208580..208861) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS complement(208863..210074) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905506.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS complement(210052..211110) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129606.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 sequence05 source 1..201752 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1012..1251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS complement(1587..2843) product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876134.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS 2982..5408 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS 5408..8887 product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861850.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS 8896..10809 product DUF1998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861851.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS 10784..11770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS 12318..13055 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359827.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS 13250..14437 product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359828.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS 14460..14963 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359829.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS 14983..15798 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383564.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS 15788..16603 product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359831.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS 16747..18672 product alginate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010741495.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS 18694..19116 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773786.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS complement(19280..19447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002315615.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS complement(19521..19964) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289317.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS complement(19981..20808) product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289318.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS 20956..22380 product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294157.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 gene pepV CDS complement(22459..23412) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289860.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS complement(23601..23963) product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289862.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS 24159..25238 product glutamyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294156.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 gene pepA CDS 25391..25711 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287837.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS 25733..26194 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287838.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS 26389..26994 product DUF4479 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287839.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS complement(27065..28345) product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290101.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS 28581..28736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS 28779..29258 product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002329688.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 gene rlmH CDS 29343..29852 product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296569.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS 29952..30602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296570.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS 31055..31993 product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002291914.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS 32006..33058 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002291912.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS 33322..33957 product DUF998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296392.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS 34148..34939 product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296391.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 gene msrA CDS 35335..37257 product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439865.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS 37258..37704 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989459.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS 37724..38038 product PTS fructose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722977.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS 38061..39110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11310 note possible pseudo, frameshifted CDS 39131..41749 product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861780.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS 42035..42892 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025189838.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS 43317..44240 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390124.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS 44298..44903 product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357907.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS 44923..46143 product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360528.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS 46335..47075 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294728.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 gene truA CDS 47250..48641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(48872..49588) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS 49747..50559 product carbohydrate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288811.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS 50606..52171 product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966695.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS 52193..53518 product 6-phospho-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038001995.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS 53782..54621 product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287471.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS 54641..56608 product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287473.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 gene nagE CDS 57246..57953 product mannosyl-D-glycerate transport/metabolism system transcriptional repressor MngR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000509906.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 gene mngR CDS complement(58436..59635) product D-galactonate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770856.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS 59885..61708 product PTS beta-glucoside transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242943.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 gene bglP CDS complement(61787..62953) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644879.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS complement(62969..63571) product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289293.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 gene dhaL CDS complement(63605..64594) product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363860.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 gene dhaK CDS complement(64596..64994) product dihydroxyacetone kinase phosphoryl donor subunit DhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289295.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 gene dhaM CDS complement(65011..66147) product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363858.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS 66319..67338 product PocR ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382271.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS 67674..68732 product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082374.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 gene ribD CDS 68734..69330 product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493840.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 gene ribE CDS 69347..70525 product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101406.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS 70540..71010 product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230895.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 gene ribH CDS 71367..72185 product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219862.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS 72298..74127 product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296194.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS 74148..74927 product ChbG/HpnK family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002394716.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS complement(74954..75310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS 75414..76160 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721237.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS 76164..77549 product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255195.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 gene gntK CDS 77723..78169 product DUF3290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355544.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS 78181..78816 product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906307.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS 79091..79411 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287582.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS 79446..79763 product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287579.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS 79790..81037 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287577.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS 81430..86073 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286778.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS 86070..87365 product pilin N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286776.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS 87375..89036 product SpaH/EbpB family LPXTG-anchored major pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286774.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS 89128..90366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS complement(90437..91039) product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837539.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS 91292..91723 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942966.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS complement(91824..93518) product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287570.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS complement(93574..93702) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287569.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS 93936..94316 product DUF1622 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287567.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS 94297..94668 product DUF1622 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287564.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS 95233..99216 product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263549.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 gene cas9 CDS 99221..100087 product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929489.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 gene cas1 CDS 100099..100431 product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002989951.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 gene cas2 CDS 100412..101068 product type II-A CRISPR-associated protein Csn2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289642.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 gene csn2 repeat_region 101186..101815 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttttagagctatgttgttttgaatgcttccaaaac CDS 102076..102543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS complement(102999..103328) product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906059.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS complement(103315..104022) product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287482.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS 104214..104810 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294695.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS 104947..105399 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294693.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS 105418..105954 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029744075.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS 105956..106669 product phenylalanine--tRNA ligase beta subunit-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296773.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS 106859..108172 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294686.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS 108329..108892 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382413.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS 109238..110851 product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002329642.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS 111362..112327 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11930 note possible pseudo, internal stop codon CDS 112481..112663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11940 note possible pseudo, internal stop codon CDS 112653..114113 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296783.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS 114262..115758 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292557.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 gene glpK CDS 115772..117604 product type 1 glycerol-3-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044382762.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 gene glpO CDS 117601..118317 product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292560.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS 118467..119348 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358647.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS 119728..121659 product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_134860105.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS 121745..122308 product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294657.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS complement(122629..122898) product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294653.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS 123071..123385 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294651.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS 123387..125036 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294648.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS 125029..125325 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355066.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS 125578..126423 product LPXTG cell wall anchor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294641.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS complement(126974..127294) product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289297.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS 127440..128096 product glucose-6-phosphate 1-dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289292.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS 128212..128442 product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944153.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS 128442..129767 product DUF438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906058.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS 129896..131803 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102165.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS 131830..132060 product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024272221.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS 132062..132592 product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645583.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS 132605..133264 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289290.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS complement(133326..134936) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289289.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS complement(134958..135839) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289288.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS 136061..136657 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294634.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS complement(136631..136825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS 136908..138902 product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371849.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 gene nagE CDS complement(139250..140545) product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296829.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS 141153..142409 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286405.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 gene tyrS CDS 142700..144577 product tyrosine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286400.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 gene tdc CDS 144816..146273 product tyrosine-tyramine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286392.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 gene tyrP CDS 146353..147720 product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286385.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 gene nhaC CDS complement(147810..148082) product SemiSWEET family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291476.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS complement(148363..149376) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286379.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS complement(149401..150408) product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294627.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS complement(150401..151066) product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355844.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 gene pgmB CDS complement(151059..153353) product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286373.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS 153645..155813 product PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286368.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS 155850..156680 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002370688.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS 157126..157401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS complement(157631..159298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002322202.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS 159458..160612 product class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286364.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS 160778..162292 product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906011.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 gene xylB CDS complement(162400..162873) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286344.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS 163012..164490 product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286343.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS 164487..165194 product DUF4811 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286342.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS 165370..165666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296825.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS complement(165746..168082) product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286325.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS 168225..168899 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286323.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS 168896..169960 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296820.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS complement(170203..171093) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286319.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS 171250..171978 product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286317.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS complement(172605..173600) product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288548.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS 173923..174240 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286315.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS 174233..174859 product DUF1700 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286313.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS 174865..175809 product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002322196.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS 175947..176435 product DUF5348 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286309.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS 176480..177358 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286307.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS 177557..177922 product YxeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286306.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS 177931..178683 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286304.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS 178696..180507 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286302.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(180634..181539) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286852.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS 181692..182726 product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286298.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS 182745..183914 product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286858.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS 184118..184288 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS complement(184381..186489) product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286297.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS complement(186820..188193) product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286296.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS complement(188193..188588) product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286295.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 gene rbsD CDS complement(188629..189540) product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286294.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 gene rbsK CDS complement(189649..190662) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298484.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS 190914..192545 product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286285.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 gene treC CDS complement(192601..193776) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286282.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS complement(193927..194655) product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286278.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS 195121..195333 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286271.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS 195502..196212 product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321450.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS complement(196287..196970) product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286265.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS 197161..199359 product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286261.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS 199480..199890 product Spx/MgsR family RNA polymerase-binding regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286258.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS 199917..200273 product Spx/MgsR family RNA polymerase-binding regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286247.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS 200492..201424 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948255.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 sequence06 source 1..166285 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 129..1016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS complement(1053..1412) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289310.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 gene rplT CDS complement(1470..1670) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289309.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 gene rpmI CDS complement(1742..2266) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293357.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 gene infC CDS 2578..3210 product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294161.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS complement(3212..4117) product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294163.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS complement(4207..4866) product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294164.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS 5196..6146 product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288231.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 gene mvk CDS 6139..7116 product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288232.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 gene mvaD CDS 7129..8214 product phosphomevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288233.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS 8211..9254 product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288234.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 gene fni CDS complement(9359..10162) product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002320630.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS complement(10185..11027) product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288239.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 gene kduI CDS complement(11042..12052) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288240.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS complement(12056..12700) product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288242.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS complement(12799..13560) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294170.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS complement(14090..16687) product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296567.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 gene adhE CDS complement(17001..17378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS complement(17478..18623) product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748618.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 gene tgt CDS 18835..19008 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12920 note possible pseudo, internal stop codon CDS 19096..19548 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12930 note possible pseudo, internal stop codon CDS complement(19615..22257) product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289743.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS complement(22956..23339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS complement(23750..24781) product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296565.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 gene queA CDS 24993..26168 product betaine/proline/choline family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294192.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS 26172..26813 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293405.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS 26810..27730 product osmoprotectant ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296564.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS 27735..28394 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002302663.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS complement(28733..30556) product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294202.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS complement(30768..33473) product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296556.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS complement(33781..34095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS complement(34126..35070) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294206.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS 35255..35524 product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293413.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 gene rpsN CDS complement(35838..36200) product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289874.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS complement(36211..37332) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296555.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 gene alr CDS complement(37348..37698) product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296554.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 gene acpS CDS complement(37828..39342) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296553.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS 39781..40071 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS complement(40109..40318) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974621.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS complement(40372..40845) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS complement(40983..42332) product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002311357.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS complement(42448..43524) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293424.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS complement(43785..44234) product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296550.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS complement(44218..45591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296549.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS complement(45925..46419) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296548.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS complement(46475..47074) product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294220.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS complement(47226..47855) product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289751.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 gene udk CDS complement(47940..48635) product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289749.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS complement(48653..49369) product 16S rRNA pseudouridine(516) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289747.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS 49689..50300 product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289745.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS 50740..51063 product DUF960 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289744.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS 51221..52585 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289277.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS complement(52625..54625) product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321207.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS complement(54855..55109) product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289280.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS complement(55285..57408) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297086.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 gene pnp CDS complement(57593..57862) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289282.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 gene rpsO CDS 58114..58677 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289284.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 gene def CDS 58934..59437 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360979.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS 59456..60343 product RsiV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387401.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS complement(60409..60930) product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294232.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS complement(60933..61778) product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294234.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS complement(61765..62496) product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297083.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS 62820..63113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293448.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS 63718..65310 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297081.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS 65323..66063 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294240.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS 66325..67677 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294242.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS complement(67724..68332) product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297079.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS 68485..69846 product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294246.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 gene brnQ CDS complement(70123..70497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289815.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS complement(70629..71096) product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289814.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS complement(71134..71715) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289813.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS complement(71753..72754) product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289812.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 gene ruvB CDS complement(72767..73369) product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290528.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 gene ruvA CDS complement(73547..73996) product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294252.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 gene msrB CDS complement(74076..74789) product trehalose operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294254.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 gene treR CDS 75023..77005 product PTS system trehalose-specific EIIBC component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297133.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 gene treP CDS complement(77084..77644) product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294256.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS complement(77666..79768) product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297134.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 gene mutL CDS complement(79786..82404) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297135.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 gene mutS CDS complement(82352..82771) product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297137.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS complement(82781..83578) product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297139.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS complement(83765..84538) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294261.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS complement(84558..85196) product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297142.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS 85588..86199 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294265.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 gene rpsD CDS 86342..86893 product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354975.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS complement(87009..87446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS complement(87595..88104) product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297147.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS complement(88239..89000) product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297149.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS complement(88997..89218) product DUF2829 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290506.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS complement(89208..90743) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321200.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS complement(90806..91507) product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294273.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS complement(91500..91901) product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297153.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS 92219..92953 product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290500.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS complement(93238..94137) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287911.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS complement(94166..94522) product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287910.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS complement(94540..95109) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387373.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS 95341..95637 product phenylalanyl-tRNA synthetase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287909.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS complement(95875..96822) product siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287908.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS complement(96847..97602) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287907.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS complement(97599..98558) product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287906.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS complement(98555..99502) product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287905.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS 99650..100096 product YueI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287902.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS complement(100165..102462) product bifunctional glutamate--cysteine ligase GshA/glutathione synthetase GshB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287901.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 gene gshAB CDS complement(102645..103646) product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287900.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 gene ftsY CDS complement(103658..104467) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287898.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS complement(104477..108055) product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287897.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 gene smc CDS complement(108072..108764) product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287896.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 gene rnc CDS complement(109066..110844) product oligopeptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287894.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS complement(110868..111782) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287893.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS complement(111812..112774) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287892.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS complement(112774..113718) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287891.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS complement(113719..114723) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287889.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS complement(115025..115267) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294295.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 gene acpP CDS complement(115390..116391) product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289721.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 gene plsX CDS complement(116439..118472) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289722.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 gene recG CDS complement(118589..120268) product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289723.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS complement(120320..120682) product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294298.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS 120955..121143 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354928.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 gene rpmB CDS 121698..124322 product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288728.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS complement(124411..125157) product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288727.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 gene truA CDS complement(125250..126047) product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288724.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(126037..126906) product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288722.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS complement(126882..127721) product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288720.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS complement(127993..128373) product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288716.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 gene rplQ CDS complement(128401..129339) product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288715.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS complement(129419..129808) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288714.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 gene rpsK CDS complement(129836..130201) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288713.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 gene rpsM CDS complement(130368..130586) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356224.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 gene infA CDS complement(130777..131424) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288690.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS complement(131488..132783) product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288688.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 gene secY CDS complement(132783..133223) product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288687.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 gene rplO CDS complement(133262..133441) product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288686.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 gene rpmD CDS complement(133456..133956) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288681.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 gene rpsE CDS complement(133977..134333) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288679.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 gene rplR CDS complement(134397..134933) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288677.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 gene rplF CDS complement(134965..135363) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288675.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 gene rpsH CDS complement(135400..135585) product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356214.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS complement(135604..136143) product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288671.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 gene rplE CDS complement(136172..136480) product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288670.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 gene rplX CDS complement(136517..136885) product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288669.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 gene rplN CDS complement(136943..137209) product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288668.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 gene rpsQ CDS complement(137234..137422) product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288664.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 gene rpmC CDS complement(137412..137846) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288661.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 gene rplP CDS complement(137849..138505) product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356207.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 gene rpsC CDS complement(138519..138866) product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288657.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 gene rplV CDS complement(138889..139167) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288655.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 gene rpsS CDS complement(139210..140043) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005880801.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 gene rplB CDS complement(140084..140374) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290449.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 gene rplW CDS complement(140374..140997) product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290446.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 gene rplD CDS complement(141025..141654) product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290445.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 gene rplC CDS complement(141681..141989) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290443.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 gene rpsJ CDS complement(142325..143512) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290442.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 gene tuf CDS complement(143685..145772) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294317.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 gene fusA CDS complement(145863..146333) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356191.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 gene rpsG CDS complement(146426..146839) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294318.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 gene rpsL CDS 147150..147839 product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296865.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 gene rpiA CDS 147957..148538 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294320.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS 148695..149381 product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294321.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 gene gpmA CDS complement(149440..150624) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379231.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS complement(150700..151407) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289197.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 gene deoD CDS complement(151446..152264) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289198.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS complement(152299..153465) product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289199.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 gene deoB CDS complement(153568..154524) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289200.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS complement(154524..155657) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289201.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS complement(155650..157212) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289202.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS complement(157427..158518) product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289203.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS complement(158580..158981) product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289205.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS complement(158983..159645) product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289206.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 gene deoC CDS complement(159660..160961) product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289207.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS complement(161102..162118) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294322.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS complement(162286..162891) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304012.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS 163142..164065 product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288627.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 gene coaA CDS 164123..165688 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288629.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 gene guaA sequence07 source 1..154463 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(71..772) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293839.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS complement(1218..2660) product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293840.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS complement(2683..4539) product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002291140.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS complement(4665..5513) product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002291144.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS complement(5806..6552) product class A sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296196.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS complement(6648..6974) product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293844.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS complement(7010..7468) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905994.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS 7543..8274 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905995.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS complement(8806..9177) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721437.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS 9455..10696 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706833.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS complement(10782..11600) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289254.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS 11759..12448 product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358533.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS 12460..13974 product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289252.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS complement(14065..14784) product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296656.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS complement(15046..15705) product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354907.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS complement(15736..16800) product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296654.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 gene uxuA CDS complement(16818..17261) product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354905.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS complement(17255..18181) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS complement(18267..18773) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354904.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS complement(18795..19661) product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296647.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS complement(19683..20528) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296646.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS complement(20609..21607) product D-isomer specific 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387386.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS complement(21621..22532) product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321675.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 gene gnd note possible pseudo, frameshifted CDS 22668..23516 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296639.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS complement(23779..24006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362220.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS complement(24233..25069) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369253.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS complement(25081..26208) product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359867.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS complement(26222..28177) product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775183.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS complement(28189..29955) product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025189855.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS complement(29978..30802) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287754.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS complement(30792..31682) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287755.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS complement(31758..33098) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055690.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS complement(33449..34450) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475724.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS complement(34460..35077) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389905.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS complement(35502..38525) product polysaccharide lyase 8 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399773.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS complement(38790..39242) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294693.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS complement(39246..39719) product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294466.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS complement(39926..40600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS 41586..42524 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS complement(43009..44703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016495.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS complement(44684..45766) product DUF4297 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224168998.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS 45946..47385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14870 note possible pseudo, frameshifted CDS 47505..48638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14880 note possible pseudo, frameshifted CDS 48698..49018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365226.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS 49034..49432 product DUF961 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010708071.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS 49449..50885 product cell division protein FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010708073.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS 51260..52561 product replication initiation factor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010708075.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS 52574..53059 product antirestriction protein ArdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002324555.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS 53056..53430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS 53435..54454 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS 54455..54793 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS 54796..55485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS 55500..58022 product VirB4-like ATPase ConE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119122844.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 gene conE CDS 58035..59804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS 59791..60816 product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768246.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS 61645..63801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS 63789..64106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS complement(64711..64908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15030 note possible pseudo, frameshifted CDS complement(66353..67066) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434049.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS complement(67059..67208) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS complement(67201..67896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS complement(67875..68732) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS complement(68725..69660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS complement(69661..71016) product subtilosin maturase AlbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242599.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 gene albA CDS complement(71152..71283) product subtilosin A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222002.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 gene sboA CDS complement(71318..71449) product subtilosin A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222002.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 gene sboA CDS 71902..72633 product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399975.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS 72635..73912 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860860.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS 74014..74148 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS 74152..74736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS 75193..75651 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010767732.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS 75670..76071 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS 76142..76330 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095443901.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS 76948..77154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS 77228..78418 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010707087.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS complement(78516..79907) product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287686.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 gene sufB CDS complement(79912..80382) product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287684.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS complement(80369..81601) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287683.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS complement(81598..82887) product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287681.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 gene sufD CDS complement(82900..83673) product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287679.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 gene sufC CDS complement(84324..85169) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287678.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS complement(85194..85880) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287674.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS complement(85873..86907) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304234.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS complement(87310..87648) product glycine cleavage system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002291179.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS complement(87650..88006) product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295166.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS complement(88011..89198) product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002291183.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS complement(89305..89832) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256461.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS complement(89816..90691) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371452.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS 90852..91895 product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289776.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS complement(91986..92450) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289775.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS 92737..93681 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289773.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS complement(93804..94040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294094.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 tRNA 94163..94237 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS 94502..94786 product DUF1905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286335.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS complement(94876..96366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS complement(96439..98352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS complement(98587..99216) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294095.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 gene upp CDS complement(99768..101012) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294099.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS complement(101083..102105) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294101.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS complement(102302..103138) product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303629.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 gene prmC CDS complement(103131..104204) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289676.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 gene prfA CDS complement(104207..104797) product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289675.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS 105045..105644 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289673.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS complement(105751..105924) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS complement(106168..106740) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294105.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 gene lepB CDS complement(106988..107764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002302142.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS complement(107761..108222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294107.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS complement(108318..109043) product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287242.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS 109200..110600 product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287243.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS 110789..112141 product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287244.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS 112134..112829 product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287245.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS complement(112922..113878) product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287262.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 gene manA CDS complement(113917..114942) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287263.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS complement(115174..116010) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287264.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS complement(116650..118539) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287265.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS complement(118536..120263) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287267.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS complement(120279..120932) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287269.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS 121654..122274 product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287272.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS complement(122384..123553) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287273.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS complement(123563..123916) product PTS glucitol/sorbitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294113.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS 124082..125098 product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287276.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS 125131..125481 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS 125532..125693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287277.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS complement(126371..126805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287278.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS complement(126899..128761) product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287279.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS complement(128895..130052) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287280.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS complement(130185..131021) product fructose-phosphate phosphohydrolase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263015.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 gene sppA CDS complement(131344..132168) product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287302.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 gene nadE CDS complement(132194..133666) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287304.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS 133924..134154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS complement(134293..134649) product DUF1827 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287305.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS complement(134673..135521) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930487.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS 135644..136405 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287306.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS complement(136648..137571) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321047.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS complement(137590..137859) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287308.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS complement(138014..139426) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003725004.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS complement(139851..141476) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288864.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 gene groL CDS complement(141517..141801) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288862.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 gene groES CDS 142037..142690 product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288860.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS complement(142748..144181) product 6-phospho-beta-glucosidase GenA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355206.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 gene genA CDS complement(144218..145549) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355207.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 gene genB CDS complement(145741..146490) product transcriptional regulator GenR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362941.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 gene genR CDS 146638..147267 product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288856.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS complement(147657..148466) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288854.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS complement(148522..149394) product two-component system regulatory protein YycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288853.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS complement(149395..150714) product two-component system activity regulator YycH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288852.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 gene yycH CDS complement(150711..152546) product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288851.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 gene walK CDS complement(152550..153254) product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288850.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 gene yycF sequence08 source 1..149215 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 17..92 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 tRNA 146..221 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS 366..833 product CtsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289036.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS 840..3326 product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289035.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS 3499..4422 product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289033.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS 4442..5686 product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304804.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS 5723..7069 product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289031.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 gene gor CDS complement(7134..8120) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289380.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS complement(8142..8708) product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289378.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS complement(8720..9130) product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294810.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS complement(9230..11164) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289023.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS 11441..12373 product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321666.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS 12500..13597 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294811.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS 13608..14561 product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289029.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 gene menA CDS complement(14615..15583) product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304811.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS complement(15682..16485) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289388.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS complement(16482..17387) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289390.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS complement(17410..18381) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289394.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS 19100..22717 product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295964.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 gene rpoB CDS 22797..26453 product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288141.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 gene rpoC CDS 26770..27315 product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288119.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 gene msrA CDS 28296..28763 product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297290.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS complement(28880..30274) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989893.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 gene argH CDS complement(30361..31575) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731945.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS 31939..32382 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295975.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 gene rplM CDS 32398..32790 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287505.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 gene rpsI CDS complement(32965..34200) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205010568.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS complement(34269..34544) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196077.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS complement(34561..35592) product replication initiation factor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483441.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS complement(35567..36079) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS complement(36612..37298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS 37510..37725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS complement(37859..38599) product two-component system response regulator RgbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438019.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 gene rgbR CDS 38772..40184 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083362.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS 40185..41864 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948315.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS 42141..42308 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS 42605..43123 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS 43166..43846 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357457.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS 43846..45108 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357458.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS complement(45572..47215) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS 47766..47981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS 47974..48582 product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460586.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS complement(48870..49919) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254116.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS complement(50025..50222) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775147.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS complement(50312..51568) product replication initiation factor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287016.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS 51730..52542 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287017.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS complement(52763..54880) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989665.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS complement(54877..55236) product Cd(II)-sensing metalloregulatory transcriptional repressor CadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989667.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 gene cadC CDS 55594..56001 product arsenate reductase (thioredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288294.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 gene arsC CDS 57302..57565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS 58281..58721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS 58826..59242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS 59242..59832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS 59829..60326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS complement(60413..61153) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS complement(61720..61878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS complement(61875..62447) product accessory gene regulator AgrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369249.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 note possible pseudo, frameshifted CDS complement(62541..63257) product response regulator FsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109506.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 gene fsrA CDS 63820..65268 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025189887.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS complement(65281..67833) product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387348.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS 68017..68346 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356136.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS 68348..69025 product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100873.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS 69281..69721 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002302683.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS 69723..70352 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287459.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS 70531..70920 product DUF2798 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287457.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS complement(70961..71476) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287456.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS 71598..72785 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296013.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS 73281..73610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287453.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS complement(73746..74090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287507.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS complement(74207..75454) product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287452.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS complement(75512..76312) product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287451.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 gene proB CDS 76552..77085 product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287450.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS 77126..78499 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293096.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 gene radA CDS 78529..79680 product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287448.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS 79856..81316 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287447.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 gene gltX CDS 81604..82140 product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287446.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 gene cysE CDS 82137..83549 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287445.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 gene cysS CDS 83546..83941 product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293091.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS 83934..84791 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287441.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 gene rlmB CDS 84796..85326 product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287439.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS 85402..85983 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287436.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS 86091..86336 product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287434.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS 86423..86854 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287432.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS complement(86894..87355) product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287431.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 gene mscL CDS 87507..88775 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287428.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS 88768..90060 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287425.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS 90062..90787 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569514.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS 90810..91694 product DUF4115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287423.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS 91849..92427 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296025.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 gene pgsA CDS 92524..93768 product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296026.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS 93873..94919 product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287328.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 gene recA CDS 95406..96962 product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287336.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 gene rny CDS complement(97005..97820) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303638.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 gene proC CDS 97964..100537 product bifunctional lysylphosphatidylglycerol flippase/synthetase MprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287340.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 gene mprF CDS 100719..101570 product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321008.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 gene ispE CDS 101974..102930 product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287342.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS 102963..103643 product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287343.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS 103616..104443 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287344.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS 104607..105428 product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287345.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 gene purR CDS 105586..106959 product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287346.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 gene glmU CDS 107052..108020 product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287347.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS complement(108132..108908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287349.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS 109174..110886 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287350.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS 110856..111074 product YdbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287352.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS 111091..111981 product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287354.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS 112014..112298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002305543.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS 112533..113147 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287358.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 gene gmk CDS 113152..113457 product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287365.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 gene rpoZ CDS 113640..116048 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287367.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 gene priA CDS 116062..116553 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287369.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 gene def CDS 116546..117487 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287372.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 gene fmt CDS 117487..118845 product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287374.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 gene rsmB CDS 118858..119598 product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287376.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS 119595..121631 product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287377.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 gene pknB CDS 121801..122697 product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287379.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 gene rsgA CDS 122709..123359 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287380.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 gene rpe CDS 123361..123999 product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287382.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS 124167..125024 product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287383.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 gene mreC CDS 125028..125537 product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287385.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 gene mreD CDS 125722..127260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS complement(127384..129186) product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287387.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS 129306..129812 product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287389.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS 129881..130606 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287391.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS complement(130657..132057) product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287397.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS complement(132258..133229) product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287399.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS 133575..134135 product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287401.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 gene pth CDS 134150..137671 product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287403.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 gene mfd CDS 137687..139285 product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287405.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS 139295..139561 product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287407.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS 139633..140058 product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287409.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS 140103..140585 product S1 domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287412.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS 140745..142160 product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287414.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 gene tilS CDS 142141..142686 product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287415.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 gene hpt CDS 142775..144934 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287418.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 gene ftsH CDS 145169..146056 product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296053.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 gene hslO CDS 146057..147055 product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290055.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 gene dusB CDS 147172..148668 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296055.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 gene lysS sequence09 source 1..136457 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(536..898) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287172.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS complement(978..1358) product CvfD/Ygs/GSP13 family RNA-binding post-transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287231.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS 1450..2619 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002311494.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS complement(2844..3428) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287167.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS 3604..4605 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287165.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS 4709..5218 product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287163.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS complement(5481..6125) product TIGR01906 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287161.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS complement(6126..6890) product TIGR01457 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287159.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS complement(6893..7588) product YutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287156.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS complement(7626..9011) product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287155.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS complement(9490..9987) product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287154.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 gene tadA CDS 10115..10987 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287150.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS complement(11062..11397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287147.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS complement(11483..12028) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287143.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS 12496..14040 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287140.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS complement(14092..14796) product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287139.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS complement(14872..15207) product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287137.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS complement(15373..16344) product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287135.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS complement(16359..17690) product DRTGG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287134.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS complement(17698..18378) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287133.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS complement(18853..19335) product aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287132.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS complement(19466..21145) product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287130.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS 21811..23328 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287129.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS 23342..24019 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287128.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS 24391..25377 product DUF1002 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643525.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS complement(25460..25678) product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287127.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS complement(25783..26967) product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287126.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 gene iadA CDS complement(27045..28784) product putative basic amino acid antiporter YfcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294022.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 gene yfcC CDS complement(28980..29231) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS complement(29265..29477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS complement(29491..29703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS complement(29817..30341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS 30506..31237 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS 31356..31526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS complement(31683..32642) product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390188.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS complement(33099..33716) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287124.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS complement(34354..34713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294021.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS complement(34874..35473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS complement(35918..36793) product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357314.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 gene galU CDS complement(36953..37963) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287121.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS complement(38027..38641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS complement(38669..39319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS complement(39332..40141) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722701.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS complement(40134..41498) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706558.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS complement(41576..43450) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025727141.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS complement(43458..46457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS complement(46457..50224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS complement(50268..52625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS complement(52666..53061) product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646390.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 gene tagD CDS complement(53058..54236) product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362618.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS complement(54233..55042) product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360559.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS complement(55017..56141) product teichoic acid biosynthesis protein TagB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363731.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 gene tagB CDS complement(56599..58335) product glycosyl hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103132.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS 58556..59398 product Rgg/GadR/MutR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101021.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS 59523..60167 product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906226.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS complement(60233..61345) product 3D domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355830.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS complement(61533..62369) product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387023.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS 62544..64259 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294013.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS 64261..66024 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289511.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS complement(66073..66609) product folate family ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289509.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS complement(66907..67338) product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289508.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 gene mgsA CDS 67543..68652 product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289507.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 gene ugpC CDS complement(68935..69447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS complement(69465..70205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS complement(71020..71628) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289506.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS complement(72057..72944) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294004.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 gene rsmA CDS complement(72937..73500) product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002305490.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 gene rnmV CDS complement(73497..74270) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294001.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS complement(74574..75884) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002328947.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS complement(76710..78719) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289325.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 gene metG CDS 78979..79257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS 79351..80184 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289327.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS complement(80357..81367) product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289328.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS complement(81381..82334) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289330.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS complement(82309..83385) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289332.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS complement(83391..84434) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289334.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS complement(84435..85376) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293573.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS complement(85889..87553) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289796.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS complement(87874..88419) product aminoglycoside N-acetyltransferase AAC(6')-Ii inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289795.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 gene aac(6') CDS complement(88565..89641) product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293986.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 gene rlmN CDS complement(89831..92278) product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289244.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS complement(92538..93977) product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289243.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS complement(94394..94744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224434963.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS complement(94737..96065) product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969590.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS 96473..97672 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181867.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS complement(97954..98163) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS complement(98426..101017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS complement(101192..102349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS complement(102358..103356) product DUF916 and DUF3324 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989514.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS complement(103461..104138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS complement(104234..104911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS complement(105223..105435) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS complement(106089..107282) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288985.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS complement(108031..109035) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774220.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS complement(109038..110111) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383119.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS complement(110127..110951) product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287116.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS complement(110938..111723) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287115.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS complement(111742..112212) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287114.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS complement(112239..112655) product PTS mannose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287112.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS complement(112734..115505) product sigma-54-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287111.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS complement(115873..117219) product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674709.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS complement(117447..118259) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289242.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS complement(118280..118915) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289241.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS complement(118927..119568) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303625.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS 120053..120538 product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289239.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS complement(121135..123105) product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304230.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS complement(123140..123517) product DUF1033 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286704.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS complement(123647..124228) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286706.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS 124380..125678 product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286708.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS complement(126159..127280) product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286726.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 gene mnmA CDS complement(127466..128077) product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286728.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS 128236..129006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706768.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS complement(129305..129478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS complement(129589..130605) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379155.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS complement(130607..131347) product KDGP aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378063.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS complement(131372..132466) product DgaE family pyridoxal phosphate-dependent ammonia lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706694.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS complement(132450..133562) product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288305.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS complement(133572..134660) product MupG family TIM beta-alpha barrel fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379152.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS complement(134657..134920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS complement(134991..136334) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358780.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 sequence10 source 1..125475 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(513..2018) product HAMP domain-containing histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298265.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS complement(2015..2701) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290973.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS complement(2893..4314) product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295350.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 gene gndA CDS complement(4482..4661) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290970.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 gene rpmF CDS complement(4731..5291) product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295352.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS 5697..6602 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295354.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS complement(6633..8417) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295355.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 gene pyk CDS complement(8548..9510) product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304759.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 gene pfkA CDS complement(9677..12991) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002311576.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 gene dnaE CDS 13110..13298 product YjzD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295359.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS complement(13364..14560) product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390196.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS complement(14774..16210) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295362.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS 16487..17296 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296740.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS complement(17488..19383) product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288533.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 gene asnB tRNA complement(19801..19888) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS complement(20017..20583) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296332.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS 21065..21661 product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287776.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS 21765..23564 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287775.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS complement(23813..24025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297633.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS 24528..24677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293931.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS complement(24847..26193) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288574.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS complement(26303..27652) product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288575.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 gene gdhA CDS 27769..29031 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288576.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS complement(29123..29608) product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288577.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 gene ybaK CDS complement(29675..30424) product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288579.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 gene aroD CDS complement(30442..31617) product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288581.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS 31855..33987 product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288584.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS 34141..34869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296838.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS 34853..35365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288586.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS complement(35459..36919) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288588.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS complement(36919..37635) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288590.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS complement(37616..37966) product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288595.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS 38111..38884 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288592.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS 39117..39539 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101606.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS 39567..40334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18810 tmRNA 40549..40913 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(41605..42111) product phospholipase A2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003577315.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS complement(42114..42575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS complement(43549..46170) product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476565.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS complement(46173..48080) product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034528504.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS complement(48272..48850) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273859.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS complement(49133..49570) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290819.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS complement(49724..49960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS complement(50134..50628) product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289618.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS complement(50695..51357) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948057.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS 51597..52973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS complement(53093..53803) product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289619.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 gene budA CDS complement(53823..55487) product acetolactate synthase AlsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289620.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 gene alsS CDS 55974..58316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS 59031..60530 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383114.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS 60531..61898 product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137253.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS complement(62082..63140) product transmembrane protein ElrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387174.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 gene elrE CDS complement(63234..63836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS complement(63887..64453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS complement(64437..64742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS complement(64755..67664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS 68020..68526 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181746.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 note possible pseudo, frameshifted CDS complement(68586..68837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS complement(68755..69102) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286913.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 gene rplS CDS complement(69243..69989) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293717.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 gene trmD CDS complement(69976..70500) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293716.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 gene rimM CDS complement(70769..71017) product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290277.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS complement(71029..71304) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290274.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 gene rpsP CDS 71534..72088 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293714.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS complement(72417..72938) product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297192.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS complement(72966..73559) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293710.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS complement(73657..75075) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293709.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 gene ffh CDS complement(75109..75447) product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293708.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS complement(75448..75933) product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297194.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS 76062..76766 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293705.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS 76763..78490 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297195.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS complement(78559..79443) product phosphate ABC transporter substrate-binding protein PstS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289807.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS 79644..80381 product DUF2087 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674750.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS complement(80575..81039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289809.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS 81399..81662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS complement(81738..82334) product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294835.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS complement(82408..83718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS 84039..84995 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304700.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS 84998..86065 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS 86078..88249 product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095443517.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS complement(88365..89516) product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287246.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS complement(89529..89966) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287247.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS complement(89981..91744) product PTS mannitol-specific transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287250.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS complement(92289..92729) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287254.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS complement(92763..94799) product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287256.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS complement(94765..96489) product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287257.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS 96717..96869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS complement(96896..99214) product copper/silver-translocating P-type ATPase CopB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296533.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 gene copB CDS complement(99237..101420) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289041.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS complement(101417..101629) product copper chaperone CopZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289040.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 gene copZ CDS complement(101643..102077) product CopY/TcrY family copper transport repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289038.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS complement(102151..102696) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289037.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS complement(102858..104324) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288779.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS complement(104437..104688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS complement(104685..106784) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002327795.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS complement(106956..107339) product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288776.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS complement(107575..108873) product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288767.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 gene asnS CDS complement(108907..110103) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296294.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS complement(110123..110626) product DUF5590 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321579.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS complement(110703..113483) product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288763.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS complement(113858..114058) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288762.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS complement(114760..115881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288760.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS 116065..116250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS 116384..117691 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002299522.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS 117862..119061 product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289548.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS complement(119390..120655) product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289547.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS complement(120815..121462) product elongation factor G-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289561.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS complement(121914..123338) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358731.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS complement(123345..123794) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363200.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS complement(123796..124551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19550 misc_feature complement(124532..>125475) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002311353.1:DUF916 and DUF3324 domain-containing protein locus_tag LOCUS_19560 sequence11 source 1..111874 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(200..892) product MIP family channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377790.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS complement(965..1825) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288847.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS complement(1818..2384) product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002322652.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS complement(2857..3549) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383568.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS 3594..4211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387231.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS 4224..5522 product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359847.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 tRNA 6109..6181 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS 6844..7266 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295867.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS complement(7376..9103) product ABC transporter permease/substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287807.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS complement(9096..10289) product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287805.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS complement(10431..11063) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287801.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS complement(11191..11328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290587.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS complement(11330..13471) product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287799.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 gene feoB CDS complement(13468..13941) product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287797.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS 14352..14576 product glutaredoxin-like protein NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287795.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 gene nrdH CDS 14701..16860 product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287793.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 gene nrdE CDS 16906..17871 product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287792.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 gene nrdF CDS complement(18307..19017) product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287788.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS complement(19130..19930) product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819258.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS complement(19923..20717) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358771.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS complement(20737..21663) product PTS mannose/fructose/sorbose transporter subunit IIAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383065.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS 21893..22600 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355690.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS 22729..23934 product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706698.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS 23947..25746 product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369229.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS complement(26207..27040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386984.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS complement(27027..28769) product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025189820.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS complement(29462..30163) product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287787.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 gene nagB CDS 30400..31956 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290558.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS complement(32046..33227) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303471.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS complement(33296..33991) product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296327.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS complement(34702..35070) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294588.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 gene rplL CDS complement(35121..35624) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002291634.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 gene rplJ CDS complement(35951..36640) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294587.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 gene rplA CDS complement(36749..37171) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002291638.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 gene rplK CDS 37498..38166 product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294585.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 gene sdaAB CDS 38184..39056 product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294584.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 gene sdaAA CDS complement(39299..39775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS 39901..40446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS 40470..40655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS complement(40927..42027) product lactate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294583.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS complement(42179..43084) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289897.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS complement(43181..43726) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294580.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 gene nusG CDS complement(43826..43996) product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294579.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 gene secE CDS complement(44018..44170) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294578.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 gene rpmG CDS 44330..44968 product cyclic di-AMP binding protein CbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294577.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 gene cbpA CDS complement(45255..45752) product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294548.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS 46241..47218 product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294549.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS complement(47312..49882) product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289594.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS complement(49901..50557) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289593.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS complement(50615..51118) product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289592.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 gene trmL CDS complement(51350..52207) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294559.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS 52311..52949 product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294560.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS complement(53170..54531) product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294561.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 gene mgtE CDS complement(54549..55448) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294562.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS complement(55450..56247) product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289847.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS complement(56244..56930) product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002309982.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS 57063..57638 product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289849.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS 57757..58434 product ClpXP adapter SpxH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289850.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS complement(58633..60444) product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288947.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 gene pepF CDS complement(60554..61570) product competence protein CoiA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288958.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS complement(61687..62343) product adaptor protein MecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288948.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS complement(62635..63033) product transcriptional regulator SpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296384.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 gene spxA CDS 63801..64508 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294563.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS complement(64619..67813) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288952.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS complement(67830..70985) product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288954.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS complement(70989..72107) product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288955.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS complement(72260..72877) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288956.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS 73010..73744 product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288957.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS 73734..74009 product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304776.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS complement(74091..76070) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748733.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS complement(76364..77239) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293644.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS complement(77366..79135) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289105.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 gene aspS CDS complement(79151..80449) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289103.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 gene hisS CDS 80874..81821 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289101.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS complement(82020..82190) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296289.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS complement(82606..83052) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289097.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 gene dtd CDS complement(83075..85288) product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289096.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS complement(85594..86223) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS complement(86213..86980) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289095.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS complement(86981..87928) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289093.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 gene prmA CDS complement(87942..88433) product DUF3013 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289091.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS complement(88420..89079) product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289090.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS 89219..90499 product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289088.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS 90844..91128 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293648.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS 91205..91681 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293649.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS complement(91808..92458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS complement(92641..93825) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286171.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS complement(93851..94858) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286175.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS complement(95030..95443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS complement(95376..95798) product competence type IV pilus minor pilin ComGF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286176.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 gene comGF CDS complement(95758..96060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS complement(96086..96538) product competence type IV pilus minor pilin ComGD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317395.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 gene comGD CDS complement(96519..96830) product competence type IV pilus major pilin ComGC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286179.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 gene comGC CDS complement(96827..97837) product competence type IV pilus assembly protein ComGB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286180.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 gene comGB CDS complement(97821..98822) product competence type IV pilus ATPase ComGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293666.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 gene comGA CDS 98954..100681 product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286185.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 gene ade CDS complement(100970..101620) product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286189.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 gene trmB CDS complement(101685..102479) product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286194.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS complement(102756..103967) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286197.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS complement(103964..104698) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286199.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS 104844..105278 product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286201.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS 105271..105621 product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286203.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS 105806..106816 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286208.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS complement(106898..107842) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286211.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS complement(107844..110537) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286213.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS complement(110534..111751) product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286214.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 sequence12 source 1..101546 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1426..1905 product DUF3955 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775247.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS complement(2114..2548) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367049.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS complement(2699..3043) product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289113.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS complement(3185..4123) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289114.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 CDS 4290..4781 product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289115.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS complement(5189..7534) product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289116.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS 7878..8504 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289118.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS 8528..9232 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289120.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS 9398..10231 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289121.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS 10427..12355 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289122.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS 12555..13010 product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289123.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS complement(13089..13736) product DUF1361 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386206.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS 13878..14006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295511.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS 14186..14455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289125.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS 14878..15132 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292188.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 gene rpsT CDS complement(15368..16417) product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002320835.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 gene holA CDS complement(16446..18746) product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002322120.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS complement(18733..19215) product ComE operon protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295503.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS complement(19234..19902) product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002320838.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS complement(20106..21149) product SepM family pheromone-processing serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295493.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS complement(21139..21630) product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295492.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 gene coaD CDS complement(21627..22187) product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295491.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 gene rsmD CDS complement(22313..22651) product YlbG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297107.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS complement(22641..23081) product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002305283.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS complement(23062..24189) product CAP-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295486.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS complement(24217..27645) product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288741.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS complement(27667..28833) product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288740.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS complement(28836..29138) product YlaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288739.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS complement(29328..31076) product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288736.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 gene recQ CDS complement(31324..33153) product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288735.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 gene typA CDS complement(33354..34118) product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295483.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS complement(34124..34399) product UPF0223 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292206.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS complement(34592..35203) product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303626.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS 35377..36273 product Rgg/GadR/MutR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721398.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS complement(36387..38534) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS complement(38849..39169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS complement(39179..39946) product class A sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722751.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS complement(39933..40262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS complement(40259..41680) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379356.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS complement(41708..42775) product DUF916 and DUF3324 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642360.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS complement(42846..43430) product WxL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355609.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS complement(43432..43824) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS complement(43839..46007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS complement(46177..46323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21050 CDS complement(46307..47635) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964998.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS complement(47867..49333) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS complement(49759..51681) product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321387.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS complement(51769..53712) product PTS fructose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288299.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS complement(53920..54924) product tagatose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357245.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 gene lacD CDS complement(54968..55900) product tagatose-6-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775547.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 gene lacC CDS complement(55916..56431) product galactose-6-phosphate isomerase subunit LacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837291.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 gene lacB CDS complement(56455..56883) product galactose-6-phosphate isomerase subunit LacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357188.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 gene lacA CDS complement(56901..57686) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288637.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS 57858..58343 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357187.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS 58358..58660 product PTS fructose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357185.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS 58678..58980 product PTS fructose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357185.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS 59021..60430 product PTS glucitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357183.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS complement(60876..61628) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369238.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS complement(61778..63184) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382270.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 gene lpdA CDS complement(63192..64817) product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363856.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS complement(64837..65814) product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289688.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS complement(65817..66926) product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289692.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 gene pdhA CDS complement(67370..68794) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002300392.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS complement(68856..69992) product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365185.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 gene wecB CDS complement(70170..71147) product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005876481.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 gene guaC CDS complement(71433..72347) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288005.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS complement(72425..73714) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288007.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 gene purD CDS complement(73739..75274) product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288009.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 gene purH CDS complement(75271..75849) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288010.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 gene purN CDS complement(75846..76889) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288011.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 gene purM CDS complement(76912..78351) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288013.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 gene purF CDS complement(78336..80558) product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288015.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 gene purL CDS complement(80559..81236) product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002302316.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 gene purQ CDS complement(81238..81492) product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295474.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 gene purS CDS complement(81537..82253) product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288021.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS 82510..82881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297115.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS complement(83006..84301) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288023.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 gene purB CDS complement(84315..85436) product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288025.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 gene purK CDS complement(85429..85911) product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303771.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 gene purE CDS complement(86084..87391) product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295470.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS complement(87394..87975) product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295469.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS complement(88503..89186) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295463.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS complement(89207..89824) product glycoside hydrolase family 73 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295461.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS complement(89833..90669) product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321179.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS complement(90692..91222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295457.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS 91396..92352 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016628808.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS complement(92540..93505) product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297121.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS 93614..94204 product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295450.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS complement(94272..95765) product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297122.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS complement(95779..96303) product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295447.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS 96487..97167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS 97176..97538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS complement(97629..98777) product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289803.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 gene nagA CDS complement(98853..99689) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297129.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS complement(99913..101130) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303757.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS complement(101272..101448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303756.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 sequence13 source 1..92893 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(425..1399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS complement(1588..2142) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294418.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 gene lepB CDS complement(2242..2469) product YozE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288398.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS complement(2466..2984) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288397.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 gene msrA CDS complement(3021..3701) product YpmS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288396.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS complement(3698..4591) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288395.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 CDS complement(4761..5603) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288394.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS 5733..6386 product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288393.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS complement(6482..6976) product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288392.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS complement(6991..7938) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298126.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 CDS complement(7950..9836) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288390.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS complement(9992..12094) product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288388.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS complement(12107..12382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290188.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 CDS complement(12692..13147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290187.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS complement(13715..14923) product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298132.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS complement(14962..15309) product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290045.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS 15461..16351 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294412.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS complement(16630..17205) product ReoY family proteolytic degradation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289878.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS complement(17218..18471) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289879.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS complement(18472..19521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298135.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS 20239..20826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS complement(21051..22034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS complement(22034..22438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS complement(22512..25220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS complement(25234..25989) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS complement(26001..27749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS complement(27867..30815) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS complement(30812..31600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS complement(31610..33235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS complement(33251..33565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002988428.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS complement(33589..33936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS complement(34026..34529) product phage major tail protein, TP901-1 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071876606.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS complement(34782..35189) product RinA family phage transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379371.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS 35456..35791 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385633.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS 35804..36148 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS 36235..36840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS complement(37220..37495) product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290178.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS complement(37739..39049) product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296982.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 gene der CDS complement(39238..40470) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294406.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 gene rpsA CDS complement(40620..41297) product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303123.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 gene cmk CDS complement(41339..41956) product LysM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294404.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS complement(42023..43432) product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002311164.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS complement(43416..44450) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294402.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS 44482..44703 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294401.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS complement(44893..45633) product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294400.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS complement(45822..47162) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294399.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS complement(47293..48813) product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290168.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS complement(49204..49809) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296977.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 CDS complement(50142..50858) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294391.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS complement(50858..51433) product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296975.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 gene scpB CDS complement(51417..52178) product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296973.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS complement(52205..52555) product protein RibT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294387.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS complement(52574..53461) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294386.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 gene xerD CDS complement(53567..54025) product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294385.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS complement(54134..54997) product virulence factor B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290060.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS complement(55169..57409) product cell division site-positioning protein MapZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002341496.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS complement(57664..58773) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289498.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 gene rpoD CDS complement(58797..60635) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289497.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 gene dnaG CDS complement(60817..63144) product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303731.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS complement(63309..63941) product lysozyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289460.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 CDS 64153..64869 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289461.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS 64882..67476 product bifunctional lysylphosphatidylglycerol flippase/synthetase MprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002300997.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 gene mprF CDS complement(67547..68734) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289463.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 gene tuf CDS 69027..69380 product YxeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289464.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 CDS complement(69485..70489) product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294378.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS 70671..71522 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289273.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS 71539..71784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289275.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS 72038..72754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289272.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 CDS complement(72847..74226) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS complement(74451..76898) product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317658.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS 77083..78243 product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289270.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS complement(78384..79115) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289269.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS complement(79211..81886) product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294372.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 CDS 82236..83687 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321394.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 gene cls CDS complement(83796..84236) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289467.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS complement(84303..85709) product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641197.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS complement(85862..87256) product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156264865.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS 87407..88675 product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748651.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 gene celB CDS 88802..89521 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296966.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 CDS 89653..90624 product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288275.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS 90655..91254 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288276.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 tRNA complement(91461..91547) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 tRNA complement(91571..91644) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 tRNA complement(91652..91725) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 tRNA complement(91784..91870) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 tRNA complement(91889..91959) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 tRNA complement(91993..92066) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA complement(92074..92147) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 tRNA complement(92150..92223) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA complement(92233..92315) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 tRNA complement(92316..92391) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 tRNA complement(92422..92497) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 tRNA complement(92505..92579) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 tRNA complement(92591..92664) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 tRNA complement(92677..92767) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 tRNA complement(92806..92881) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 sequence14 source 1..65504 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1181..1333) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS complement(1392..1751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS complement(1755..2042) product PrgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298753.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 CDS complement(2178..3677) product primase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298755.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 CDS complement(3835..4029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS 4334..5191 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582622.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS 5193..5549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS complement(6007..6996) product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674809.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS 7133..8512 product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287940.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS 8496..8885 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287939.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS 9093..9683 product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071130048.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS complement(9699..9920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748756.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS complement(10527..11981) product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964717.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS complement(12000..13361) product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359847.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS complement(13369..13674) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002924730.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS complement(13678..14013) product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895529.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS complement(14169..16094) product transcriptional regulator LicR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243034.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 gene licR CDS complement(16283..17035) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272822.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 CDS 17134..17919 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809521.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS 18456..19070 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287936.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS 19367..20047 product IS6-like element IS1216 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015311.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS complement(20198..22408) product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002391620.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS complement(22433..23899) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS complement(23973..25250) product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748651.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 gene celB CDS 25427..26416 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476555.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 CDS complement(27102..27452) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS 27514..27867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22650 note possible pseudo, frameshifted CDS 27875..28195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22660 note possible pseudo, frameshifted CDS complement(28935..29834) product DUF2382 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286065.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 CDS 30173..30505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS 30477..30791 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS 30942..31247 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS complement(31464..31844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS 32294..32788 product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296667.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS complement(32992..34323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS 34486..35166 product IS6-like element IS1216 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015311.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS complement(35371..35727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS complement(36328..37107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS complement(37186..37536) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS complement(37563..38540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS complement(38557..39489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS complement(39489..40412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS 40547..41227 product IS6-like element IS1216 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015311.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS 41342..41878 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS complement(42077..44989) product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028020.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 CDS complement(45218..46231) product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475456.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 CDS complement(46228..46755) product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775404.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS complement(46752..49100) product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775403.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS 49361..50068 product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775405.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS 50069..51373 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775459.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS complement(51407..52507) product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922747.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 gene glf CDS complement(52725..53999) product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292559.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 gene ltrA CDS 54458..54748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22910 note possible pseudo, frameshifted CDS 54784..54978 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22920 note possible pseudo, frameshifted CDS complement(55028..55231) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS complement(55255..57174) product MobQ family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035454417.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 gene mobQ CDS 57531..57830 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22950 CDS 57833..58090 product DUF3847 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997674.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS complement(58113..58418) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS complement(58637..58954) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245899.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS complement(59394..60257) product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284311.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS complement(60259..60531) product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301765.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS complement(60549..60758) product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001835296.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS complement(60856..61710) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002334978.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS complement(61837..63981) product type IA DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002322737.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS complement(63981..64598) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002406536.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS complement(64612..64782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23050 sequence15 source 1..55845 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 582..1271 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295268.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS 1258..2448 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295267.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS 2756..4027 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295265.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 gene serS CDS complement(4096..5580) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295264.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 gene guaB CDS complement(5770..6465) product DUF1129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296943.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 CDS complement(6555..7655) product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293105.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 gene ychF CDS complement(7664..7855) product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293106.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS complement(7873..8763) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288806.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS complement(8750..9517) product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288805.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 CDS complement(9529..10242) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288804.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 gene rsmG CDS complement(11132..14281) product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287735.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS complement(14295..15476) product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072584.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 CDS complement(15466..17061) product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287732.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS complement(17552..18325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS complement(18506..18835) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048604340.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS complement(18872..19237) product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298396.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS complement(19274..19588) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS complement(19683..20402) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS complement(20741..21001) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS 21258..21860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS 21945..23108 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287705.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS complement(23185..25080) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288799.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 gene mnmG CDS complement(25095..26492) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295261.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 gene mnmE CDS complement(26949..27713) product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295258.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS complement(27728..28549) product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295256.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS complement(28546..28902) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295255.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 gene rnpA CDS complement(29020..29154) product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293121.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 gene rpmH CDS 29673..31007 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288360.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 gene dnaA CDS 31177..32307 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288361.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 gene dnaN CDS 32532..32774 product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295251.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 gene yaaA CDS 32761..33885 product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288363.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 gene recF CDS 33882..35828 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288364.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 gene gyrB CDS 35850..38342 product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288365.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 gene gyrA CDS 38525..38824 product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288366.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 gene rpsF CDS 38872..39384 product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288368.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 gene ssb CDS 39409..39645 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288370.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 gene rpsR CDS 39813..41786 product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288371.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS 41792..42244 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288372.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 gene rplI CDS 42429..43796 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288373.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 gene dnaB CDS 44008..45300 product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288375.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 CDS 45530..46393 product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288377.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS complement(46463..48085) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288381.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS 48313..48837 product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002309892.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 CDS complement(48889..50616) product pyruvate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288384.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 gene spxB CDS 50771..51589 product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294342.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS complement(51742..51942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS 52107..52682 product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288651.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS 53047..53289 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459149.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS 53519..53674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23540 CDS 53817..54182 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23550 CDS complement(54420..55031) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23560 sequence16 source 1..40369 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(35..376) product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285994.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS complement(442..2613) product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285990.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS 2810..3664 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321119.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS complement(3866..4729) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285988.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS complement(4730..7417) product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285985.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS complement(7428..8717) product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285982.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS complement(8736..8939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS 8869..9936 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002302559.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS 9917..12058 product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285980.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS complement(12263..13705) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304851.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 CDS complement(13698..15440) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285976.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS complement(15433..16047) product DUF624 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285975.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS complement(16133..17590) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285974.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 CDS complement(17623..18543) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285972.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 CDS complement(18556..19503) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285971.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS complement(19758..20477) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285969.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 CDS complement(20558..22204) product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285966.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 CDS 22494..24005 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285962.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 CDS complement(24104..24337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294687.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS complement(24513..26927) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285916.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 gene leuS CDS complement(27316..29349) product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285913.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 CDS 29694..30326 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285911.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS 30353..31309 product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285909.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 CDS 31310..31894 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285906.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 CDS complement(31960..33729) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285885.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 CDS complement(33733..35445) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285883.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS 35560..36216 product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285876.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS complement(36267..37055) product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295567.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS complement(37074..38549) product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295566.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS complement(38683..39876) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289731.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 gene metK tRNA complement(40166..40240) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA complement(40261..40350) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 sequence17 source 1..39648 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 542..1111 product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643749.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS 1108..2418 product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438725.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS 2420..3565 product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096753.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 gene pcaF CDS 3562..3909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS 3860..4186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS 4173..4973 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906137.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS 4966..5742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS 6198..7079 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906179.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS 7240..7653 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296336.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 CDS 7669..7983 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565067.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS 8028..8885 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132680.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS complement(9065..9655) product DUF4352 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286584.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS complement(10855..11406) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673938.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS 11573..12274 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286289.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS 12285..15023 product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286287.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 CDS 15786..16934 product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002331743.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS 16906..18084 product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357833.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 CDS 18101..19666 product phosphatase PAP2/LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379014.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS complement(19817..20566) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860824.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 CDS 20687..22372 product sugar phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990053.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 CDS 22369..23526 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289891.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 CDS 23513..25489 product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990051.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 CDS 25505..28156 product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990052.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 CDS 28176..29894 product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989905.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 CDS 29933..30076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24110 CDS 30076..31059 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140402.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 CDS 31195..32598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS 32631..34016 product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096552.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 CDS 34355..34513 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24150 CDS 34603..35172 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840007.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 CDS 35169..36560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS 37098..37799 product YcjF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384134.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 CDS 38290..38646 product YxeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289464.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 sequence18 source 1..35986 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(923..1942) product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989947.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS complement(1951..2772) product phage tail family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989948.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 CDS complement(2780..8344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24220 CDS complement(8668..9075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24230 CDS complement(9345..10142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS complement(10297..10908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS complement(10923..11081) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS complement(11102..11413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS complement(11472..11807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS complement(11884..12468) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS complement(12542..12952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24300 CDS complement(12949..13353) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24310 CDS complement(13370..13753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24320 CDS complement(13743..14021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24330 CDS complement(14094..15266) product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286525.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 CDS complement(15271..15981) product Clp protease ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337208.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 CDS complement(15956..17134) product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025274.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 CDS complement(17171..18856) product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625088.1 transl_table 11 codon_start 1 locus_tag LOCUS_24370 CDS complement(18859..19404) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24380 CDS complement(19569..19838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24390 CDS complement(19835..20569) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24400 CDS complement(20550..20867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24410 CDS complement(20864..21151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24420 CDS complement(21148..21375) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002366354.1 transl_table 11 codon_start 1 locus_tag LOCUS_24430 tRNA complement(21790..21863) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS complement(22189..22602) product autolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286542.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 CDS complement(22681..22977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286693.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS complement(22974..23144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24460 CDS complement(23141..23329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24470 CDS complement(23326..23592) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24480 CDS complement(23592..23999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24490 CDS complement(23996..24424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24500 CDS complement(24421..24957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24510 CDS complement(24950..25126) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24520 CDS complement(25123..25998) product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168747012.1 transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS complement(25999..26496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24540 CDS complement(26575..26850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24550 CDS complement(26847..27158) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24560 CDS complement(27155..27478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286694.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 CDS complement(27483..27662) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377565.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 CDS complement(27659..27868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24590 CDS complement(27885..28109) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24600 CDS complement(28081..28608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24610 CDS complement(28614..28931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24620 CDS complement(28935..29738) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS complement(29970..30719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922062.1 transl_table 11 codon_start 1 locus_tag LOCUS_24640 CDS complement(30732..31154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003574018.1 transl_table 11 codon_start 1 locus_tag LOCUS_24650 CDS complement(31237..31497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24660 CDS complement(31475..31663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS complement(31660..31800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24680 CDS 31903..32193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24690 CDS complement(32178..32318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24700 CDS complement(32349..32564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24710 CDS 32741..33211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS 33222..33695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24730 CDS 33777..34472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989965.1 transl_table 11 codon_start 1 locus_tag LOCUS_24740 CDS 34585..35949 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861760.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 sequence19 source 1..30195 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 22..360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24760 CDS 405..812 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24770 CDS 891..1091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24780 note possible pseudo, internal stop codon CDS 1155..1283 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24790 CDS 1302..3074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24800 note possible pseudo, internal stop codon CDS 3096..4184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS 4199..4780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS 4993..5415 product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048604071.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS 5408..5653 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288964.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 CDS 6050..6280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24850 CDS 6383..7906 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179343.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 CDS 8002..8862 product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296988.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 gene ylqF CDS 8855..9619 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296990.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS 9679..10536 product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002323421.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 gene dprA CDS 10666..12744 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298115.1 transl_table 11 codon_start 1 locus_tag LOCUS_24900 gene topA CDS 12763..14085 product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002320953.1 transl_table 11 codon_start 1 locus_tag LOCUS_24910 gene trmFO CDS 14321..15220 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288415.1 transl_table 11 codon_start 1 locus_tag LOCUS_24920 gene xerC CDS 15253..15801 product HslU--HslV peptidase proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288419.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 gene hslV CDS 15814..17211 product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288421.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 gene hslU CDS 17228..18019 product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290223.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 gene codY CDS 18082..18957 product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296994.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 CDS complement(19013..19648) product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296995.1 transl_table 11 codon_start 1 locus_tag LOCUS_24970 gene plsY CDS 19743..20171 product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296996.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 CDS 20356..22401 product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138821006.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 gene parE CDS 22413..24860 product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296998.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 gene parC CDS 25139..27367 product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721911.1 transl_table 11 codon_start 1 locus_tag LOCUS_25010 gene pflB CDS 27449..28210 product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357530.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 gene pflA CDS 28297..29223 product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289263.1 transl_table 11 codon_start 1 locus_tag LOCUS_25030 CDS 29314..30180 product DUF1803 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289262.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 sequence20 source 1..21032 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ repeat_region <1..490 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttttggaagcattcaaaacagcatagctctaaaac CDS 783..1574 product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987086.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 CDS complement(1625..3148) product zinc ABC transporter substrate-binding protein AdcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387410.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 CDS complement(3167..3286) product putative metal homeostasis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818733.1 transl_table 11 codon_start 1 locus_tag LOCUS_25070 CDS complement(3300..4346) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387409.1 transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS complement(4375..4524) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354818.1 transl_table 11 codon_start 1 locus_tag LOCUS_25090 gene rpmG CDS complement(4547..4924) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095803611.1 transl_table 11 codon_start 1 locus_tag LOCUS_25100 CDS complement(4937..5110) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358539.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 gene rpmF CDS complement(5143..5412) product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354822.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 gene rpsN CDS complement(5739..6122) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383105.1 transl_table 11 codon_start 1 locus_tag LOCUS_25130 CDS 6457..7494 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100874.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS complement(7662..8696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25150 CDS complement(8856..10085) product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003597374.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 CDS complement(10093..11247) product YhfX family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674095.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 CDS complement(11249..11602) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25180 CDS complement(11663..12586) product GntR family transcriptional regulator YhfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674092.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 gene yhfZ CDS complement(12597..13694) product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674094.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 CDS complement(13707..14579) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003597368.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS complement(14595..15911) product YhfT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573503.1 transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS complement(15933..16295) product DUF2620 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573501.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS 16790..17272 product MepB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830560.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS 17399..18856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25250 CDS complement(18879..20717) product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002291140.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 sequence21 source 1..19104 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(41..655) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289266.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 CDS complement(815..1357) product DUF2179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289260.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 CDS 1495..1893 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297001.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 CDS 1890..2666 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289259.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 CDS 2938..3885 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289258.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 CDS 4003..4764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289257.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 CDS 5199..6227 product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287486.1 transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS complement(6343..7023) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297002.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 CDS 7161..7448 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289767.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 CDS 8729..10270 product ABC transporter permease/substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289765.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 CDS 10267..11211 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289763.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 CDS 11216..12541 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289757.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 CDS 12798..13544 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297003.1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 CDS 13558..14553 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297008.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 CDS 14565..15302 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297010.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 CDS 15292..16011 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297012.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 CDS 16291..16725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25430 CDS 17066..17215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS 17523..19034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25450 sequence22 source 1..11612 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(89..334) product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002291278.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 CDS complement(378..926) product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356090.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 CDS complement(939..1127) product DUF2273 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002291274.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 CDS complement(1139..1699) product alkaline shock response membrane anchor protein AmaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295947.1 transl_table 11 codon_start 1 locus_tag LOCUS_25490 gene amaP CDS complement(1979..2740) product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367595.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 CDS complement(2954..8731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25510 CDS complement(8798..9313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25520 CDS complement(9398..10018) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25530 CDS 10611..10910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS 11025..11222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25550 sequence23 source 1..11372 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(541..2262) product septation ring formation regulator EzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287957.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 CDS complement(2495..3031) product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287958.1 transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS complement(3066..3911) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287959.1 transl_table 11 codon_start 1 locus_tag LOCUS_25580 CDS complement(3929..4762) product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287960.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 CDS 5010..5978 product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287961.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 CDS complement(6042..6779) product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287962.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 CDS complement(6795..7628) product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287963.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 CDS complement(7865..9193) product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287964.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 tRNA complement(9344..9419) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 tRNA 9680..9752 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS 10089..10721 product CadD family cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485755.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 CDS complement(10789..11151) product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287966.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 tRNA complement(11285..11360) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 sequence24 source 1..9649 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(461..745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25660 CDS complement(747..1205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25670 CDS complement(1207..1707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931584.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 CDS complement(1727..2200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931585.1 transl_table 11 codon_start 1 locus_tag LOCUS_25690 CDS complement(2211..4103) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25700 CDS 4913..5650 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861381.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS 5872..6894 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288292.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 CDS complement(7118..7789) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906419.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 CDS complement(7799..8869) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296464.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 CDS complement(9030..9437) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361287.1 transl_table 11 codon_start 1 locus_tag LOCUS_25750 sequence25 source 1..8686 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 35..118 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS 245..541 product DUF5960 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002329382.1 transl_table 11 codon_start 1 locus_tag LOCUS_25760 CDS 547..819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295437.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 CDS 916..1050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25780 CDS 1216..1665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25790 CDS 1678..2115 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25800 CDS 2141..2773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS complement(2805..3116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25820 CDS complement(3106..3651) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25830 CDS complement(3782..4273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS complement(4389..5420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25850 CDS complement(5420..5821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25860 CDS complement(5891..6013) product XkdX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296594.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 CDS complement(6015..6455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390600.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 CDS complement(6474..8558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25890 sequence26 source 1..3102 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA complement(37..2946) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 sequence27 source 1..2323 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(12..287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS 533..1948 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289668.1 transl_table 11 codon_start 1 locus_tag LOCUS_25910 sequence28 source 1..1771 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 144..1701 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 sequence29 source 1..1491 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(60..857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25920 note possible pseudo, frameshifted CDS complement(899..1453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25930 note possible pseudo, frameshifted sequence30 source 1..1366 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(130..966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25940 note possible pseudo, frameshifted CDS complement(1002..1292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25950 note possible pseudo, frameshifted sequence31 source 1..1248 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(44..865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25960 note possible pseudo, frameshifted CDS complement(916..1170) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199136.1 transl_table 11 codon_start 1 locus_tag LOCUS_25970 sequence32 source 1..870 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(40..>870) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099835063.1:IS3 family transposase locus_tag LOCUS_25980 sequence33 source 1..790 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(86..171) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 tRNA complement(188..259) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 tRNA complement(270..342) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 tRNA complement(364..447) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 tRNA complement(453..527) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA complement(529..603) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 rRNA complement(619..729) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 sequence34 source 1..621 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence35 source 1..614 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..614 product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289111.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 sequence36 source 1..605 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@