COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence001 source 1..171687 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(339..3233) product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674070.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS complement(3448..5220) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642294.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS complement(5217..6938) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102016.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS complement(7173..7913) product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644365.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS complement(7989..9170) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016511714.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS complement(9193..9699) product DUF5590 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130291.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS complement(9744..12587) product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101529.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS 12822..13769 product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640469.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 gene mvk CDS 13766..14743 product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101527.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 gene mvaD CDS 14817..15890 product phosphomevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101526.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS 15920..16969 product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644359.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 gene fni CDS complement(17081..18316) product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642381.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS complement(18646..20022) product RsmF rRNA methyltransferase first C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640460.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS 20208..21020 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476106.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS complement(21086..22036) product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978667.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 gene adhP CDS complement(22194..23237) product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263364.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS complement(23448..24953) product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569146.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 gene glpK CDS complement(25140..25328) product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638693.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS complement(25405..26298) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381974.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS 26569..27984 product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101518.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS 28036..29541 product glutamate/gamma-aminobutyrate family transporter YjeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476411.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 gene yjeM CDS complement(29607..31607) product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643475.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS complement(31750..32574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS complement(32607..33413) product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566975.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS complement(33410..34483) product NADH-dependent flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292552.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS complement(34495..34839) product ethanolamine utilization microcompartment protein EutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721543.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 gene eutS CDS complement(34869..36056) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000040065.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS complement(36089..37210) product 1-propanol dehydrogenase PduQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989698.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS complement(37214..38641) product aldehyde dehydrogenase EutE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989697.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS complement(38644..39126) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00300 note possible pseudo, internal stop codon CDS complement(39130..39705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00310 note possible pseudo, internal stop codon CDS complement(39722..39967) product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003736331.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS complement(39976..40479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS complement(40525..41157) product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989695.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 gene pduL CDS complement(41189..41476) product propanediol utilization microcompartment protein PduJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057752.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 gene pduJ CDS complement(41492..42052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS complement(42067..42420) product glycerol dehydratase reactivase beta/small subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444012.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS complement(42410..44251) product diol dehydratase reactivase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931948.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS complement(44266..44784) product diol dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836574.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS complement(44797..45504) product propanediol/glycerol family dehydratase medium subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405037.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(45525..47201) product propanediol/glycerol family dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008947521.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS complement(47218..47934) product propanediol utilization microcompartment protein PduB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721551.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 gene pduB CDS complement(48056..48334) product propanediol utilization microcompartment protein PduA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183618.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 gene pduA CDS 48658..49764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS complement(49868..50575) product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548130.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS complement(50813..51247) product EutP/PduV family microcompartment system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836561.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS complement(51259..51963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS complement(51987..52961) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS complement(53046..53738) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044887.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS complement(53710..55398) product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225543.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS complement(55386..56288) product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181780.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS 56821..57732 product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644197.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(57790..58146) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640385.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 gene rplS CDS complement(58259..59032) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640384.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 gene trmD CDS complement(59032..59550) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640383.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 gene rimM CDS complement(59676..59936) product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640382.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS complement(59946..60221) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638633.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 gene rpsP CDS complement(60309..60605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS complement(60608..61930) product VWA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102172.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS complement(61935..63113) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643555.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(63145..65793) product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643866.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS complement(66025..67473) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101484.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 gene ffh CDS complement(67493..67834) product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640380.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS complement(67991..69478) product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101483.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 gene ftsY CDS complement(69478..73032) product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101482.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 gene smc CDS complement(73048..73740) product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640377.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 gene rnc CDS complement(73815..74063) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640376.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 gene acpP CDS complement(74142..75176) product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644323.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 gene plsX CDS complement(75196..77229) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645148.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 gene recG CDS complement(77330..79024) product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101481.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS complement(79057..79419) product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638623.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS 79653..79838 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638622.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 gene rpmB CDS complement(80256..80933) product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645150.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS complement(80933..81586) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101480.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 gene rpe CDS complement(81599..82495) product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101479.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 gene rsgA CDS complement(82581..84605) product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101478.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 gene pknB CDS complement(84605..85351) product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101477.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS complement(85362..86705) product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101476.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 gene rsmB CDS complement(86705..87649) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101475.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 gene fmt CDS complement(87679..90084) product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101474.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 gene priA CDS complement(90095..91303) product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640363.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 gene coaBC CDS complement(91374..91589) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640362.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 gene rpoZ CDS complement(91593..92207) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640361.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 gene gmk CDS 92420..92752 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS complement(92874..95582) product LPXTG cell wall anchor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989363.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS complement(95780..97474) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645158.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 gene recN CDS complement(97551..98006) product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640354.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS complement(98099..98914) product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640353.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS complement(98911..99822) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101471.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS complement(99812..100060) product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640351.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(100060..101406) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645161.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 gene xseA CDS complement(101393..102259) product tetrahydrofolate dehydrogenase/cyclohydrolase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645162.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS complement(102456..102890) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101470.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 gene nusB CDS complement(102887..103327) product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640347.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(103381..103941) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640346.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 gene efp CDS complement(104016..105083) product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101469.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS complement(105175..105474) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638594.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 gene rpmA CDS complement(105494..105832) product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640344.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS complement(105854..106162) product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640343.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 gene rplU CDS complement(106438..106980) product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644309.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS complement(106993..107934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640335.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS complement(107927..108811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645169.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS complement(109175..110515) product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640333.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 gene glnA CDS complement(110571..110957) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002388239.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS complement(111079..111996) product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640331.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 gene miaA CDS 112140..112316 product DUF3042 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640329.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS complement(112362..112775) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640328.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS complement(112815..113786) product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644304.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS complement(113791..114021) product YqgQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644303.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS complement(114065..114745) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564613.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS complement(114759..115310) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640322.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS complement(115435..115584) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638573.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 gene rpmG CDS complement(115711..117822) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640321.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS 117991..120657 product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101465.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS complement(120863..121165) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644301.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS complement(121346..121819) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640314.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 gene greA CDS complement(121916..122587) product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640313.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 gene udk CDS complement(122604..123740) product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640312.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 gene mltG CDS complement(123889..126297) product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101464.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 gene pheT CDS complement(126307..127353) product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700137.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 gene pheS CDS complement(127696..128070) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638562.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS complement(128106..128603) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640309.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS complement(128795..129565) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640308.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS 129680..129949 product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548299.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS 130055..130966 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101463.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 gene yidC CDS complement(131051..132688) product HAMP domain-containing histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645182.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS complement(132685..133371) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638551.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS 133778..134794 product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130326.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 gene adhP CDS complement(134877..136559) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254198.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS complement(136700..136888) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638547.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 gene rpmF CDS complement(136952..137503) product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640295.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS complement(137556..138725) product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101458.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS complement(138728..139471) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645186.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS complement(139468..139830) product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475792.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 gene rsfS CDS complement(139845..140450) product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640291.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 gene yqeK CDS complement(140443..141075) product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640290.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(141091..141399) product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640289.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 gene yhbY CDS complement(141417..142559) product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703227.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 gene yqeH CDS complement(142540..143082) product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640287.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS complement(143293..143652) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699795.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 gene rplT CDS complement(143736..143930) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638526.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 gene rpmI CDS complement(143981..144445) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705897.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 gene infC CDS complement(144770..146758) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644287.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 gene thrS CDS complement(147100..148026) product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644286.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 gene dnaI CDS complement(148026..149393) product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101453.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS complement(149412..149903) product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640274.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 gene nrdR CDS complement(149915..150535) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387006.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 gene coaE CDS complement(150528..151388) product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640272.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 gene mutM CDS complement(151439..154096) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101451.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 gene polA CDS complement(154138..154326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS complement(154444..155148) product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640270.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS 155513..156337 product DUF2785 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100861.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS complement(156388..157719) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101415.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 gene murC CDS complement(157860..160727) product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101414.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS complement(160934..161575) product DUF4479 and tRNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101413.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS complement(161598..161930) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699770.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS complement(162155..163948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS 164326..164652 product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640256.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS complement(164828..165331) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565021.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS complement(165371..166771) product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645262.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 gene pepV CDS 166914..167741 product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101353.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS complement(167806..168495) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082968.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS complement(168509..170152) product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101352.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS 170394..170717 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS 170819..171583 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015825263.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 sequence002 source 1..108518 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 762..1013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01660 note possible pseudo, internal stop codon CDS complement(1117..2949) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640703.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 gene lepA CDS complement(3064..4353) product D-alanyl-lipoteichoic acid biosynthesis protein DltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640704.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 gene dltD CDS complement(4357..4590) product D-alanine--poly(phosphoribitol) ligase subunit DltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644263.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 gene dltC CDS complement(4627..5838) product D-alanyl-lipoteichoic acid biosynthesis protein DltB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640706.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 gene dltB CDS complement(5838..7364) product D-alanine--poly(phosphoribitol) ligase subunit DltA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640707.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 gene dltA CDS complement(7407..7556) product teichoic acid D-Ala incorporation-associated protein DltX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564021.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS complement(7858..9003) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640710.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 gene dnaJ CDS complement(9120..10997) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101636.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 gene dnaK CDS complement(11035..11634) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101637.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 gene grpE CDS complement(11656..12693) product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640713.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 gene hrcA CDS complement(12937..13890) product riboflavin biosynthesis protein RibF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594636.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 gene ribF CDS complement(13913..14824) product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640716.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 gene truB CDS complement(14897..15250) product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101640.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 gene rbfA CDS complement(15272..17620) product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101641.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 gene infB CDS complement(17667..17972) product YlxQ-related RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357860.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS complement(17965..18261) product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640726.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS complement(18289..19539) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101642.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 gene nusA CDS complement(19561..20034) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699900.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 gene rimP CDS complement(20163..20435) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS complement(20653..24987) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640729.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(25062..26774) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640732.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS complement(26806..28083) product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640733.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 gene rseP CDS complement(28172..28960) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640734.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS complement(28987..29766) product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640735.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS complement(29868..30290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS complement(30319..30876) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640736.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 gene frr CDS complement(30882..31607) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640737.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 gene pyrH CDS complement(31762..32646) product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644498.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 gene tsf CDS complement(32797..33600) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565810.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 gene rpsB CDS 33837..34559 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640740.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS complement(34625..35620) product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640741.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS complement(35711..35986) product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660754.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS complement(35979..36728) product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644499.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS 36831..37478 product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645630.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS complement(37620..39362) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644847.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS complement(39383..41176) product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101957.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS complement(41320..41547) product YneF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699860.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS complement(41648..41896) product DUF896 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644501.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS 42095..42724 product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640747.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 gene lexA CDS complement(42897..45305) product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646028.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 gene ppsA CDS complement(45669..46109) product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293607.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS complement(46260..47438) product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101645.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS complement(47590..48456) product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642687.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS 48622..49284 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476528.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS 49306..49488 product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641730.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS 49610..50062 product transcriptional regulator SylA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359121.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 gene sylA CDS 50096..50620 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101563.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS 50863..52188 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644022.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS complement(52363..53265) product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644199.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 gene gnd CDS 53500..54168 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644030.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS complement(54209..54913) product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548130.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS 55255..55449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02180 tRNA complement(55567..55654) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS complement(55712..56110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS complement(56297..56818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS complement(56923..57978) product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643457.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS complement(58119..58637) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700501.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS complement(58656..60977) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101649.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 gene recJ CDS complement(61043..61420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS complement(61417..62367) product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640772.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 gene rnz CDS 62839..63588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS complement(63661..64962) product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476163.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 gene obgE CDS complement(65046..66866) product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640789.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 gene uvrC CDS 67018..67194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS complement(67248..67553) product nucleoside triphosphate pyrophosphohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699862.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS complement(67556..68149) product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640795.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 gene yihA CDS complement(68316..69575) product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640796.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 gene clpX CDS complement(69783..71087) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645655.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 gene tig CDS complement(71338..72528) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640798.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 gene tuf CDS complement(72700..73632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101658.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS complement(73710..75569) product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640800.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS complement(75852..76121) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701713.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 gene rpsO CDS 76400..76654 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645660.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 gene rpsT CDS complement(76738..77772) product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101660.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 gene holA CDS complement(77769..79169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02400 note possible pseudo, frameshifted CDS complement(79174..79998) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02410 note possible pseudo, frameshifted CDS complement(80037..80513) product ComE operon protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640806.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS complement(80553..81227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS complement(81316..82380) product SepM family pheromone-processing serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640808.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS complement(82382..82867) product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640809.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 gene coaD CDS complement(82864..83427) product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101663.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 gene rsmD CDS complement(83424..83711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS complement(83726..84907) product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645668.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS complement(85282..87126) product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644590.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 gene typA CDS complement(87266..88060) product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640819.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS complement(88062..88355) product UPF0223 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836813.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS complement(88356..89261) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS complement(89404..90831) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640822.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 gene lpdA CDS complement(90838..92154) product 2-oxo acid dehydrogenase subunit E2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101671.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS complement(92228..93205) product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674460.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS complement(93208..94323) product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101672.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 gene pdhA CDS 94601..95161 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645922.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 gene def CDS complement(95240..95737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640826.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS 95940..96158 product DNA-directed RNA polymerase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640827.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS 96155..97834 product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640828.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS 97964..98923 product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101673.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS complement(99056..99262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645925.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS complement(99418..101034) product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101674.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS complement(101489..102499) product DUF1002 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476277.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS complement(102606..103499) product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101812.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(103708..105735) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476679.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 gene tkt CDS complement(106044..106967) product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641546.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 gene rbsK CDS complement(107089..108102) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298484.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 sequence003 source 1..94387 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 316..1497 product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101013.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS complement(1571..2077) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905994.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS complement(2077..2652) product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642721.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS 2978..3274 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02720 note possible pseudo, internal stop codon CDS 3293..3712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02730 note possible pseudo, internal stop codon CDS 3807..4283 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101193.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS 4258..4761 product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428667.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS 4920..5813 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101600.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS 5951..8149 product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640903.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS 8302..8430 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295229.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS complement(8630..9694) product tyrosine recombinase XerS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262304.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 gene xerS CDS complement(9997..10758) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673992.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS complement(10733..11653) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592685.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS complement(11646..11870) product PLD nuclease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562727.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS complement(11857..12984) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673991.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS 13252..13452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS 14693..15583 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS complement(15657..15812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS complement(15920..16441) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640552.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 gene msrA CDS complement(16457..16909) product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475469.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 gene msrB CDS 17162..17890 product DUF2087 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644395.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS 17895..18146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS 18148..18525 product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645057.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS 18550..19218 product chloramphenicol acetyltransferase CAT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101551.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS complement(19293..19868) product M57 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643762.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS complement(20017..20646) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877031.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS complement(20759..21688) product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640554.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS complement(21729..22688) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644418.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS complement(22837..25284) product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640556.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 gene parC CDS complement(25315..27282) product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640557.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 gene parE CDS 27532..28158 product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644419.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 gene plsY CDS complement(28221..29096) product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101568.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS complement(29173..30585) product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640560.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 gene hslU CDS complement(30607..31149) product HslU--HslV peptidase proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638820.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 gene hslV CDS complement(31166..32098) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640561.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 gene xerC CDS complement(32213..34324) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645027.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 gene topA CDS complement(34458..35348) product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475884.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 gene dprA CDS complement(35402..36181) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645025.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS complement(36162..37037) product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644425.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 gene ylqF CDS complement(37281..38327) product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101497.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS complement(38779..39000) product YozE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640574.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS complement(39012..39614) product YpmS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101575.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS complement(39627..40553) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101576.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS complement(40623..41474) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640577.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS 41618..42259 product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357443.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS 42404..43600 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641738.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS complement(43692..44186) product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640578.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS complement(44201..45151) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640579.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS complement(45167..47071) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644431.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS complement(47089..48297) product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101577.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS 48536..49429 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475875.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS complement(49552..50811) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644434.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS complement(50924..51199) product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640587.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS complement(51439..52746) product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700239.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 gene der CDS complement(52861..54174) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640589.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 gene rpsA CDS complement(54248..54934) product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565355.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 gene cmk CDS complement(54973..55611) product LysM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101580.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS complement(55846..57294) product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101581.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS complement(57275..58333) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645009.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS complement(58431..59012) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674489.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS complement(59291..60016) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640595.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS complement(60016..60615) product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640596.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 gene scpB CDS complement(60593..61405) product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640597.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS complement(61326..61721) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644440.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS complement(61785..62681) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644441.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 gene xerD CDS complement(62710..63612) product S1 RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476057.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS complement(63942..65699) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700208.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 gene pyk CDS complement(65943..66677) product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986655.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS complement(66771..70112) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101583.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 gene dnaE CDS complement(70613..71257) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100869.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS 71357..72307 product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100868.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS complement(72338..73687) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101558.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS complement(73889..76498) product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101584.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 gene clpB CDS complement(76637..77878) product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644443.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 gene pepT CDS complement(77936..78742) product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475994.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS complement(78729..79436) product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644445.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS complement(79644..83168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS complement(83218..83724) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905440.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS complement(83928..84332) product YxeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101730.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS complement(84540..85664) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640674.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 gene rpoD CDS complement(85681..87531) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101607.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 gene dnaG CDS complement(87796..88674) product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439900.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS complement(88752..89126) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS 89567..91249 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS complement(91615..93696) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101402.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 sequence004 source 1..80598 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(79..1068) product choloylglycine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100864.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS complement(1240..4407) product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674239.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS complement(4404..5537) product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003577967.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS complement(5534..6073) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643720.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS 6339..7280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS 7425..8375 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS complement(8427..9557) product glycosyl hydrolase family 8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901727.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS complement(9569..10225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS 10517..11374 product histidinol-phosphatase HisJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732654.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 gene hisJ CDS 11585..12931 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644001.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS complement(12999..14288) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS 14768..15406 product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256153.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS complement(15517..17265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS complement(17473..18147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS complement(18508..19080) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101270.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS 19218..20663 product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286343.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS 20660..21409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS complement(21455..26746) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS complement(26727..28067) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS complement(28071..30485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS complement(30808..32163) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644022.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS 32410..33783 product multidrug efflux MFS transporter MdrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009926611.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 gene mdrM CDS complement(33886..34137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS complement(34156..34611) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013246141.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS complement(34877..35734) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS complement(35830..36300) product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003605799.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS complement(36346..37023) product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202734.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS 37109..37561 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563458.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS complement(37610..38101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS complement(38201..38701) product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702501.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS complement(38723..39259) product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966606.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS 39375..40277 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254320.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS complement(40340..41866) product ABC transporter permease/substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643770.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS complement(41841..42797) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386926.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS complement(42836..43789) product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101589.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS complement(43888..44082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS 43999..44277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS complement(44440..46950) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254312.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 repeat_region 47074..47531 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq agaatcacccccgcatacgcggggaatac CDS complement(47561..48451) product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674076.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 gene cas2e CDS complement(48448..49401) product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674075.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 gene cas1e CDS complement(49408..50082) product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674074.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 gene cas6e CDS complement(50100..50780) product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674073.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 gene cas5e CDS complement(50761..51879) product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674072.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 gene cas7e CDS complement(51879..52658) product type I-E CRISPR-associated protein Cse2/CasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003586648.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 gene casB CDS complement(52648..54384) product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674071.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS complement(54374..57178) product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674070.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS 58860..59192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS complement(59303..60178) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814758.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS complement(60503..61456) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644460.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS complement(61650..62681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04030 note possible pseudo, internal stop codon CDS complement(62712..64358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04040 note possible pseudo, internal stop codon CDS 64541..65068 product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643718.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS complement(65105..66148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS complement(66379..67104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS 67418..67636 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS 67723..68262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04090 note possible pseudo, frameshifted CDS complement(68313..68729) product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641176.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS complement(68757..69176) product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644046.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(69190..69378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641174.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS complement(69390..69932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS complement(69945..70196) product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003680323.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS complement(70418..71020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS complement(71025..71525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS complement(71545..71805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS complement(71896..72039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS 72038..72994 product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013877237.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS complement(73039..73638) product EcsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483174.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS complement(74075..74800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS complement(74797..75699) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS complement(76083..77483) product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101592.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS complement(77562..78872) product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674808.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS complement(79395..80141) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213021.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 sequence005 source 1..64958 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(531..956) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640479.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS 1174..2055 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101729.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS 2255..2755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS 2943..4895 product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102166.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS complement(5172..6203) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643067.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS complement(6236..7702) product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102180.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS complement(7702..8706) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102181.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 gene galE CDS complement(8790..9959) product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643061.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS complement(10188..11693) product glycoside-pentoside-hexuronide (GPH):cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286854.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS complement(11743..11982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS complement(12302..14035) product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646085.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS complement(14057..15085) product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643066.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS 15487..16608 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816049.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS 16621..17409 product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546330.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS 17423..18388 product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428573.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS complement(18484..19767) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101066.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS complement(20764..21006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS complement(21025..22749) product phosphoenolpyruvate carboxykinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948795.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS complement(22821..23705) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703257.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS 23870..25099 product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989913.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS 25103..25936 product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643073.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS 25973..26794 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674136.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS complement(26883..28298) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645463.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS 28497..28670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS 28842..29636 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705135.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 gene map CDS 29652..30371 product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102162.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS complement(30489..31118) product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101615.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS 31193..31585 product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643505.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS complement(31524..32216) product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641651.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 gene pgmB CDS complement(32310..32768) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641607.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS complement(32941..34521) product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642847.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS complement(34846..35463) product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922479.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS complement(35538..36038) product glyoxalase/bleomycin resistance/extradiol dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722084.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS complement(36073..36930) product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101840.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS 37212..37700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642842.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS 38268..38906 product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643361.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS complement(39133..40371) product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_117530778.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 gene codA CDS complement(40415..40711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS complement(40796..40957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS 40998..41828 product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289472.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 gene thiD CDS complement(42147..42323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS complement(42316..43011) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674243.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS complement(43358..43669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04680 tRNA 43793..43869 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS complement(43947..44528) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS 44690..46480 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003581516.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS complement(46557..47894) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143455604.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS complement(48051..48254) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563620.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS complement(48510..49130) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674582.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS complement(49145..49465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642958.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS complement(49479..50600) product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674242.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 gene mutY CDS 50742..52382 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643972.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS complement(52529..52843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS complement(52833..53879) product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356394.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS 54064..54447 product glycine cleavage system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100958.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS 54588..54803 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549087.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS complement(54943..55557) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646364.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS complement(55572..56537) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700189.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS complement(56819..57502) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101533.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS complement(57503..58567) product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356948.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS complement(58609..59430) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569974.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS complement(59930..60484) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642511.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS complement(60527..62167) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550020.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 sequence006 source 1..62288 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 259..546 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS 644..1123 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644650.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS complement(1239..2090) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641460.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS complement(2420..3721) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS complement(4076..5218) product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644652.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS complement(5292..6266) product DUF2785 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645413.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS complement(6297..7151) product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101510.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS complement(7258..7560) product glycine cleavage system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101722.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS complement(7577..8782) product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644656.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS complement(8912..9136) product DUF2969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564985.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS complement(9149..9445) product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564982.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 gene yidD CDS complement(9467..10471) product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644658.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS complement(10601..11914) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644659.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 gene murA CDS complement(11943..12173) product DUF1146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057889.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS complement(12384..12803) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641444.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS complement(12817..14232) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641443.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 gene atpD CDS complement(14255..15154) product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641442.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS complement(15185..16726) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475837.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 gene atpA CDS complement(16757..17299) product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641440.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 gene atpH CDS complement(17289..17804) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699938.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 gene atpF CDS complement(17851..18063) product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003639224.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 gene atpE CDS complement(18099..18815) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641438.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 gene atpB CDS complement(19166..19795) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003639227.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 gene upp CDS complement(19889..21130) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101725.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS complement(21219..22235) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641435.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS complement(22256..23104) product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641434.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 gene prmC CDS complement(23097..24182) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641433.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 gene prfA CDS complement(24204..24788) product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644660.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 24976..26325 product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641431.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS 26322..27026 product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699925.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS complement(27087..27503) product arsenate reductase (thioredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641672.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 gene arsC CDS complement(27528..28547) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475830.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS complement(28689..30527) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641422.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS complement(30520..32253) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644665.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS 32419..32748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644663.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS complement(32822..33028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS complement(33071..33649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05240 note possible pseudo, frameshifted CDS complement(33646..33870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS 34064..34219 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS 34473..35144 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101152.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS complement(35190..36236) product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641230.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS complement(36361..37383) product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101898.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS complement(37435..38850) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641320.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS complement(38994..39656) product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101677.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS complement(39669..41027) product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644601.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS 41212..41985 product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963683.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 gene kduD CDS complement(42050..42964) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547992.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS complement(43120..43512) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638099.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 gene rpsI CDS complement(43526..43969) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638098.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 gene rplM CDS complement(44118..44915) product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004563878.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 gene truA CDS complement(44929..45729) product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641277.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS complement(45722..46597) product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641276.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS complement(46543..47412) product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003580999.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS complement(47688..48071) product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641268.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 gene rplQ CDS complement(48102..49052) product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641267.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS complement(49139..49528) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641266.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 gene rpsK CDS complement(49558..49923) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641265.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 gene rpsM CDS complement(49949..50068) product 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638083.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 gene rpmJ CDS complement(50099..50317) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689399.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 gene infA CDS complement(50481..51140) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101246.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS complement(51231..52541) product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644092.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 gene secY CDS complement(52541..52975) product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288687.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 gene rplO CDS complement(53011..53193) product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567529.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 gene rpmD CDS complement(53208..53711) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638077.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 gene rpsE CDS complement(53734..54090) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645500.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 gene rplR CDS complement(54137..54673) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641259.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 gene rplF CDS complement(54703..55101) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638074.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 gene rpsH CDS complement(55135..55320) product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701320.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS complement(55338..55880) product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356213.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 gene rplE CDS complement(55906..56217) product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641258.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 gene rplX CDS complement(56254..56622) product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615912.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 gene rplN CDS complement(56673..56939) product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701314.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 gene rpsQ CDS complement(56968..57162) product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701313.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 gene rpmC CDS complement(57152..57586) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641256.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 gene rplP CDS complement(57589..58245) product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638066.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 gene rpsC CDS complement(58249..58605) product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638065.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 gene rplV CDS complement(58619..58894) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638064.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 gene rpsS CDS complement(58974..59822) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641255.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 gene rplB CDS complement(59852..60139) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641254.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 gene rplW CDS complement(60139..60762) product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701303.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 gene rplD CDS complement(60784..61434) product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641252.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 gene rplC CDS complement(61478..61786) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638059.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 gene rpsJ sequence007 source 1..61724 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(33..386) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS complement(815..3184) product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645941.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS complement(3215..3727) product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644616.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS complement(3993..4841) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640871.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS complement(4828..6000) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640873.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS 6091..6705 product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644620.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS complement(6888..9266) product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101870.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS complement(9433..10257) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674952.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS complement(10406..10810) product HAD hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734011.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS complement(11045..11944) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640877.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS complement(11941..12744) product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640878.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS complement(12757..13398) product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640879.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS 13738..14376 product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101687.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS 14500..15360 product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102283.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS complement(15563..17377) product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101688.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 gene pepF CDS complement(17442..18539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS complement(18637..19290) product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644279.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 gene trmB CDS complement(19356..20147) product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640254.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS complement(20210..21436) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101412.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS complement(21433..22167) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644277.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS 22359..22817 product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640251.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS 22821..23147 product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645204.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS 23237..24163 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640249.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS complement(24124..24288) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS complement(24300..25274) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643103.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS complement(25288..27918) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101396.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS complement(27908..29128) product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645226.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS complement(29232..29576) product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101395.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS complement(29656..31743) product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643108.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS complement(31905..32402) product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644266.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 gene argR CDS complement(32680..34371) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475862.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 gene argS tRNA complement(34664..34734) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS complement(34810..35052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643130.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS 35392..36687 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS 36962..37303 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS complement(37377..38102) product amino acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702044.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS complement(38108..39364) product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475459.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS complement(39673..41553) product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703387.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 gene asnB CDS complement(41700..42404) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476586.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS 42614..44020 product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564915.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS 44095..44334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641910.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 tRNA complement(44427..44513) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS complement(44565..44858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643147.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS complement(44901..45398) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS 45915..46388 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569571.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS complement(47056..47733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS complement(47987..48208) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS 48349..49308 product 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562906.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS 49590..52304 product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100855.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS 52328..52999 product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641651.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 gene pgmB CDS complement(53091..53861) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641650.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 54022..54666 product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643169.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS complement(54738..55061) product DUF960 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594619.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS complement(55129..56610) product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643189.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS complement(56795..57991) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101345.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 gene metK CDS 58236..58940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 59041..59382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS complement(59419..60066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS 60415..60768 product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640765.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 tRNA complement(61231..61318) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 tRNA complement(61349..61419) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA complement(61473..61546) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 tRNA complement(61559..61631) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA complement(61635..61720) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 sequence008 source 1..61009 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(46..1746) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681029.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS complement(1872..3848) product beta-L-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068480.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 gene hypBA1 CDS complement(3930..5339) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989104.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS complement(5396..5674) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS 5937..6917 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891825.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS 7256..8662 product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641197.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS complement(8725..10194) product arginine-ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286721.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 gene arcD CDS 10097..10288 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS complement(10913..11527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06350 note possible pseudo, internal stop codon CDS complement(11590..12075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476598.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS 12251..12646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS complement(12674..13180) product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163283.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS complement(13317..15851) product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101213.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS complement(15954..17123) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS complement(17334..20981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS 21433..22035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS complement(22166..22711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS complement(22919..23578) product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549576.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(23614..24276) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549574.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS complement(24263..24739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS complement(24906..26462) product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644035.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 gene guaA CDS complement(26543..27121) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355832.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS complement(27191..28114) product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641152.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 gene coaA CDS complement(28274..30577) product RNA polymerase recycling motor HelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641150.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 gene helD CDS 30748..32604 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101195.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS complement(33716..33865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS 33867..35306 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288026.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS 35652..36314 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101194.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS complement(36404..37375) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101262.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS complement(37429..39063) product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101261.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS 39202..40089 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641317.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS 40214..40672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS 40803..41315 product DUF2798 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642653.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS complement(41532..43064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS complement(43236..43721) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816014.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS complement(43854..45926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS complement(46141..47097) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643241.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS complement(47097..48200) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643240.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS complement(48214..49242) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700958.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS complement(49254..50183) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644204.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS complement(50341..51849) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101336.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS 51773..52009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS complement(52287..53924) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101336.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS complement(54259..55890) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101336.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS 56278..57570 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641141.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 gene hflX CDS complement(57702..58358) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641128.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS complement(58372..59010) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644017.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS complement(59007..59843) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101188.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS complement(59861..60598) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641125.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 sequence009 source 1..55581 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 608..1057 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS 1139..2560 product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385351.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS complement(3203..4204) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS complement(4575..4754) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS 5100..6755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101598.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS complement(6870..7784) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479611.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS complement(7784..8464) product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100873.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS complement(8461..8796) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566249.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS complement(9001..9657) product elongation factor G-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100860.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS 9792..9977 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS 9998..10183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS complement(10261..10698) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS 10897..12780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS 12941..14317 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286868.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS complement(14410..14949) product DapH/DapD/GlmU-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022638457.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS complement(14960..15793) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642522.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS 15912..16790 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989461.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS complement(16756..17154) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193989.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS 17241..18254 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810847.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS 18274..18912 product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100859.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS 19081..19551 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS 19701..20204 product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775250.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS 20894..22855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS complement(22935..24104) product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100975.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS 24335..24844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS complement(24888..25730) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089316.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS complement(25737..26156) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS complement(26559..27857) product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294071.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS complement(27952..28482) product folate family ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613301.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS 28809..29783 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641333.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS complement(29886..31019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS 31225..31554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS 31748..32416 product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641684.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS complement(32482..33399) product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101137.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS complement(33726..34676) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054398098.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS complement(34842..35174) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814177.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS complement(35291..36172) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254160.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS 36296..36823 product DapH/DapD/GlmU-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022638457.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS 36840..37586 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642355.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS complement(37777..38067) product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005717331.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS complement(38180..39511) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645481.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS complement(39619..40035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643513.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS 40186..40707 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS 40825..41706 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209762.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS complement(41792..43321) product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101892.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 gene purH CDS complement(43352..43897) product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644211.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS complement(43901..44977) product guanine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645283.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS 45210..46052 product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642262.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS 46686..46847 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS complement(47003..49345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS 49798..51744 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673988.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS 51695..52036 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562714.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS 52217..53701 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640572.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS complement(53973..54326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS complement(54320..54586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS complement(54712..55272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640240.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 sequence010 source 1..53548 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(222..1712) product alpha-N-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287297.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS complement(1817..3094) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964838.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS complement(3112..4092) product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964837.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS 4366..5256 product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287299.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS 5352..6434 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102220.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS 6762..8135 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989104.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS 8167..9078 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891802.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS 9095..11461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS 11794..13398 product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102218.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS 13422..14150 product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642916.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS 14198..15622 product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642915.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 gene araA CDS complement(15766..16011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS complement(16263..16448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS 16624..17529 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004563850.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS 17526..18269 product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645047.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS 18452..19039 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642738.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS 19133..19537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS complement(19938..20270) product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641216.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS complement(20261..20965) product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641217.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS 21183..21419 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641218.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS complement(21588..22313) product DUF4811 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641222.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS complement(22310..23803) product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641223.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS 24011..24451 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641224.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS 24984..25550 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643199.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS 25853..26752 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317368.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 26811..27458 product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641226.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS 27603..28358 product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641228.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS 28371..28826 product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701235.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS 28928..29596 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641231.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS complement(29658..30449) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641232.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS 30539..31075 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641233.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS 31439..32950 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641236.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS 33157..33789 product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641239.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS 34071..35342 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644085.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 gene serS tRNA 35710..35785 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 tRNA 35820..35901 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 tRNA 35936..36010 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 tRNA 36035..36106 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 tRNA 36118..36205 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 tRNA 36226..36301 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 tRNA 36333..36408 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 tRNA 36454..36529 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS 36870..37337 product CtsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644086.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS 37355..39841 product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101242.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS 39975..40580 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101243.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS 40816..44439 product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644088.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 44461..48108 product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641247.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 gene rpoC CDS complement(48213..48878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102034.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS complement(48850..49197) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102033.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS complement(49301..49750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS 50248..50661 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641249.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 gene rpsL CDS 50738..51208 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699701.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 gene rpsG CDS 51396..53495 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645499.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 gene fusA sequence011 source 1..51741 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 534..698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS complement(877..1404) product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642633.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS complement(1493..3838) product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646275.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS 4046..4204 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS 4295..5143 product glyoxal/methylglyoxal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243374.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 gene pgoN CDS 5660..7123 product ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674210.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 gene abc-f CDS complement(7204..7632) product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254076.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS complement(7964..14473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS complement(14713..15771) product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475868.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS complement(16165..16305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS 16431..18821 product accessory Sec system translocase SecA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489793.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 gene secA2 CDS 18836..20071 product accessory Sec system protein translocase subunit SecY2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161877.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 gene secY2 CDS 20084..21622 product accessory Sec system protein Asp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468347.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 gene asp1 CDS 21612..23195 product accessory Sec system protein Asp2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836744.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 gene asp2 CDS 23192..23944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS 23941..25389 product accessory Sec system glycosyltransferase GtfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002437882.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 gene gtfA CDS 25379..26242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS complement(26205..26453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS complement(27192..27533) product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011241744.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS complement(27527..27790) product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001748109.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS complement(27999..46382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS 46288..46497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS 47449..47589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS 47608..47802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS 48571..48780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08010 sequence012 source 1..47413 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(236..2449) product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476111.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS complement(2433..3059) product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641962.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS complement(3150..3683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS complement(4031..5422) product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641832.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS complement(5924..7333) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989104.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS complement(7378..7578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS complement(7627..9687) product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116444.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS 9931..10836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS complement(10910..13369) product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906007.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS complement(13604..14332) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642638.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS complement(14785..16119) product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231203.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS complement(16243..17640) product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391926.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS complement(17662..18645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS 19009..20226 product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000975831.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS 20241..21368 product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287276.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS complement(21494..22384) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102052.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS 22913..24241 product glucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098522.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 gene gudD CDS complement(24391..26178) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102049.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 gene lepA CDS complement(26175..26837) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642363.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS complement(27089..27895) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793567.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS complement(28111..33546) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS complement(33569..34009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08230 tRNA complement(34632..34706) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA 34874..34950 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS complement(35095..37419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS complement(37955..39301) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699746.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS complement(39435..40304) product GRP family sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642758.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS complement(40497..41645) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101808.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS complement(41689..43155) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642756.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS complement(43152..43886) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646617.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 tmRNA 44150..44518 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS 44766..45152 product YxeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358048.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS 46988..47368 product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640442.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 sequence013 source 1..45491 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 66..1469 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641110.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS 2302..3231 product ribosylpyrimidine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415455.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 gene rihB CDS 3336..4154 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101369.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS complement(4294..4695) product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102021.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS 4937..5758 product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102051.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 gene nudC CDS complement(5853..7193) product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379675.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 gene guaD CDS 7423..7905 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675005.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS complement(8307..10631) product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476055.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS complement(10672..11277) product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644374.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 gene recU CDS 11466..12035 product DUF1273 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640485.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS 12090..12443 product cell division regulator GpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638751.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 gene gpsB CDS 13050..14207 product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644375.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS 14245..14577 product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642555.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS complement(14639..15448) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728951.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS 15761..17089 product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100972.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS 17215..17400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS 17509..17982 product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028534.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS 18122..18463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS complement(18545..19210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS 19402..19968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS 20070..20672 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575135.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS 20817..21941 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644384.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS complement(21917..22324) product ribonuclease HI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640505.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(22324..22545) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS 22438..22782 product EbsA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644385.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS 22782..24440 product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101546.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS complement(24532..24759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS 24913..25386 product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640508.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 gene lspA CDS 25376..26299 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101547.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS 26434..26970 product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704375.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 gene pyrR CDS 27004..28077 product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101548.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS 28081..30651 product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645061.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS complement(30752..32467) product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640521.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS 32665..33099 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640522.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS 33188..34402 product ectonucleotide pyrophosphatase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101973.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS 34413..35660 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644782.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS 35724..36590 product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101553.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS 37033..37464 product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476244.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS 37814..39025 product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398763.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 gene ribD CDS 39006..39602 product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123705.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS 39599..40807 product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101406.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS 40813..41280 product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101407.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 gene ribH CDS complement(41328..41849) product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101176.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS complement(42076..43119) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643477.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS complement(43238..43687) product DUF3021 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793164.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS complement(43684..44118) product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700966.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS 44351..44578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS complement(44664..45137) product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674531.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 sequence014 source 1..45465 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 112..1221 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641518.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 gene dinB CDS 1316..2275 product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101704.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS 2277..3635 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641520.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS 3910..6549 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101703.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 gene alaS CDS 6854..7126 product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703962.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS 7123..7560 product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641524.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 gene ruvX CDS 7569..7880 product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674279.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS 8002..8310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS 8324..8842 product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642519.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS 8864..11227 product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101700.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS 11345..11662 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641528.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 gene trxA CDS complement(11730..12257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS 12456..13301 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644631.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 gene racE CDS 13302..13904 product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641531.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS 13908..14441 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645445.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 14449..14934 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295789.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS complement(14983..15864) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641536.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS 16072..16476 product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641537.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS 16500..16907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS complement(17033..18130) product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101698.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS 18336..19337 product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475743.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 gene ccpA CDS 19487..20314 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS complement(20409..20840) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476083.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS 21012..21584 product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644741.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS 21917..25744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS complement(25820..26560) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640790.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS complement(26553..28025) product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640791.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS 28299..29036 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641545.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS 29318..29713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS 29832..29981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS 29923..30891 product competence type IV pilus ATPase ComGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101696.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 gene comGA CDS 30821..31882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS 31879..32181 product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475747.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS 32174..32650 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS 32598..32831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS 32828..33268 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS 33220..33468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS 33658..34563 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101695.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS 34580..35776 product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645437.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS 35988..37430 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101694.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS 37574..38422 product methylglyoxal reductase YeaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186361.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 gene yeaE CDS 38434..39042 product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641558.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS 39102..40514 product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101693.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS 40504..41193 product YutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641560.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS 41206..42000 product TIGR01457 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641561.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS 41993..42622 product TIGR01906 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101692.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS complement(42674..43357) product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641563.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS complement(43443..43949) product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566812.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS 44075..44662 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355150.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS 44695..45084 product CvfD/Ygs/GSP13 family RNA-binding post-transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644624.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 sequence015 source 1..44564 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(41..820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475562.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS complement(1128..1301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS 1361..1684 product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706751.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS 1688..2002 product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461707.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS 2162..3778 product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254617.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS complement(3872..4225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS complement(4674..5507) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732658.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS complement(5866..8070) product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102206.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS complement(8100..9152) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101236.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS complement(9218..10084) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102222.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS complement(10068..11501) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641212.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS complement(11885..12487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS 13088..15910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS 16146..17012 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS complement(17155..17613) product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646330.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS complement(17700..19280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS complement(19288..19494) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS complement(19632..20258) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641608.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS 20334..20876 product phenolic acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641609.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS 20930..21394 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100891.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS 21642..22721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS 22741..23181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS 23193..24710 product zinc-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642216.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS 24725..25636 product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203642643.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS 25738..26277 product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642615.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS complement(26474..27037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS complement(27048..28526) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102053.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS 28687..29607 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102052.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS complement(29717..30967) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS complement(31001..32011) product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321171.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS 32384..33040 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642202.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS complement(33115..33579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS 34214..35860 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254634.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS 36401..38053 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254634.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS complement(38118..39788) product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641787.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS complement(39827..41230) product SLC45 family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830488.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS complement(41489..42496) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102263.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS 42726..44402 product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641787.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 sequence016 source 1..43973 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 127..2019 product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102182.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS 2000..2974 product beta-galactosidase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102183.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS 3245..3550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS 3760..4944 product putative hydroxymethylpyrimidine transporter CytX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100888.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 gene cytX CDS complement(5016..5588) product cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258897.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS 5812..6321 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003583259.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS 6340..7398 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674102.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS 7403..8077 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003593002.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS complement(8206..9450) product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757481.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS 9742..10326 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641616.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 gene lepB CDS 10447..10902 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573425.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS 10997..11740 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642546.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS 11718..12881 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101912.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS 12883..13533 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642548.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS 13689..15020 product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102285.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS 15247..16077 product AAC(3) family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549308.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS complement(16969..17508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS 17738..18556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS complement(18628..18783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS 18898..20349 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015381020.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 gene cls CDS 20685..23783 product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101706.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS 24009..24638 product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002940685.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 gene pcp CDS 24827..25219 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS 25244..25495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS complement(25672..25905) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641706.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS 26215..26934 product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643656.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS complement(27072..28382) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294686.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS complement(28604..29587) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289101.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS 29748..30350 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005049763.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS 30437..30799 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS 30956..31969 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS complement(32186..33328) product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368474.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS 33521..37168 product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101883.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS 37161..40934 product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101882.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 gene addA CDS complement(40993..41184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS complement(41278..42447) product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575992.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS 42674..43630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10040 sequence017 source 1..42277 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(417..692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS complement(773..2848) product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101608.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 gene glyS CDS complement(2848..3774) product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700278.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 gene glyQ CDS complement(4061..4849) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644472.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 gene recO CDS complement(4924..5829) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640679.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 gene era CDS complement(5839..6234) product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382764.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS complement(6218..6706) product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003710168.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 gene ybeY CDS complement(6706..7692) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594580.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS complement(7937..8383) product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640683.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS 8530..9540 product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101455.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS complement(9657..9845) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS 10027..10854 product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640684.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS complement(10940..11881) product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101610.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS complement(11874..13106) product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100945.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS complement(13129..13938) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641920.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS complement(13960..15039) product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101611.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS complement(15455..15652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS complement(15810..16685) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640688.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS complement(16790..17347) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640552.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 gene msrA CDS complement(17479..19281) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101612.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 gene aspS CDS complement(19295..20590) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640691.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 gene hisS CDS 20951..21802 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640692.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS 21827..22669 product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644479.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS complement(22756..23400) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101613.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS complement(23461..23907) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475975.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 gene dtd CDS complement(23919..26147) product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640696.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS complement(26165..26506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS complement(26590..27333) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640698.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS complement(27336..28283) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101614.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 gene prmA CDS complement(28376..28693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640701.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS 29036..29416 product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254148.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 gene mscL CDS 29615..29977 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS complement(30029..30457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS complement(30485..32338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS complement(32356..34194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS complement(34232..36223) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861594.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS complement(36213..37301) product bifunctional glycosyltransferase family 2/GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918104.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS complement(37779..38060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS complement(38257..40794) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS 41236..41457 product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003680381.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 sequence018 source 1..41268 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(102..659) product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528197.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS 780..1208 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705747.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS 1575..2423 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646328.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS 2956..4299 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225277.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS 4435..5151 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225279.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 tRNA complement(5357..5443) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS complement(5530..6738) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642330.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS 7101..9866 product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100894.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS 10259..10468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS complement(10608..11963) product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012898121.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS 12384..12575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS 12762..12998 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS 12964..13353 product endoribonuclease MazF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240418.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 gene mazF CDS complement(13468..14661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS 14840..16873 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS 17445..17684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS 17764..19188 product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100925.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS complement(19628..20143) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837224.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS complement(20261..22387) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102125.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS complement(22384..22830) product CopY/TcrY family copper transport repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594864.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS 23059..24327 product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101338.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS complement(24601..25452) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS complement(25860..26684) product phage integrase N-terminal SAM-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644416.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS complement(26772..27800) product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368573.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 gene add CDS 28260..30221 product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101182.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS 30456..31346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS 31574..33268 product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641742.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS complement(33356..33940) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641616.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 gene lepB CDS 34218..35081 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS 35226..36524 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002267735.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS 36537..37697 product glycosyl hydrolase family 8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002267197.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS 37941..38291 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813646.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS 38294..39823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS complement(40162..40392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS 40643..41191 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641069.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 sequence019 source 1..40375 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(267..1106) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS complement(1112..1489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(1452..2804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS complement(3026..3880) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101600.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS 4061..4747 product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120609.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS complement(4813..6207) product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948326.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 gene asnS CDS complement(6589..8514) product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102022.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS complement(8511..8786) product cupredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642309.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS complement(8800..9171) product cupredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642310.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS complement(9384..9791) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837254.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS complement(9991..10890) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100872.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS 11520..12080 product ECF-type riboflavin transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641748.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS 12084..13790 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100903.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS 13787..14626 product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641746.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS complement(14655..15287) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674047.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 gene thiE CDS 15646..15846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS 15857..16507 product sulfur carrier protein ThiS adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966206.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 gene thiF CDS 16520..17290 product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015814.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS 17287..18522 product allantoate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383320.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 gene allC CDS 18519..19772 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358375.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS 19985..20203 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS complement(20163..21977) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101402.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS 22045..22461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS complement(22519..24504) product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100870.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS complement(24672..25130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS 25346..27973 product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102147.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS 28101..28337 product PLDc N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643468.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS complement(28425..29780) product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641680.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS complement(30115..31170) product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877764.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS 31387..32103 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013355958.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS complement(32188..32715) product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646171.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 repeat_region 32839..34026 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gaatcacccccacacatgtggggaatac CDS complement(34133..35035) product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674076.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 gene cas2e CDS complement(35054..35602) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11110 note possible pseudo, frameshifted CDS complement(35990..36661) product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674074.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 gene cas6e CDS complement(36664..37374) product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674073.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 gene cas5e CDS complement(37355..38431) product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674072.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 gene cas7e CDS complement(38431..39033) product type I-E CRISPR-associated protein Cse2/CasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003586648.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 gene casB misc_feature complement(39040..>40375) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011674071.1:type I-E CRISPR-associated protein Cse1/CasA locus_tag LOCUS_11160 sequence020 source 1..38941 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(360..791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS complement(863..2302) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642454.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 gene rlmD CDS 2492..3328 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100978.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS 3606..4394 product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100886.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 gene thiM CDS 4421..5236 product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646310.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 gene thiD CDS 5236..5883 product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100887.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 gene thiE CDS 5969..7894 product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101807.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS complement(8686..9768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS 10062..10613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS 10719..10916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS 10939..11175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS complement(11272..12180) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642437.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS 12345..13556 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642438.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS complement(13620..15371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS complement(15943..16176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS 16773..18146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS 18287..18907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS 19072..20448 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS 20675..21106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS complement(21281..21919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS 22254..23063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS 23309..23692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(23751..24008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS complement(24137..24757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS 25100..25369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS 25507..26148 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674892.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS 27390..28214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS 28473..29741 product nucleoside transporter C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642434.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS 29996..31330 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476122.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS 31412..32326 product ribonucleoside hydrolase RihC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100977.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 gene rihC CDS 32852..33697 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102094.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS 33887..34576 product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563099.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 gene deoC CDS 34598..35785 product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674037.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS 35810..36514 product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563103.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 gene deoD CDS 36558..37514 product DNA-binding transcriptional repressor DeoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227124.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 gene deoR CDS 37548..38846 product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242311.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 sequence021 source 1..38643 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(83..532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS 864..1766 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563571.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 tRNA 2016..2088 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS 2158..2715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11550 note possible pseudo, frameshifted CDS 2741..3061 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11560 note possible pseudo, frameshifted CDS complement(3123..3479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS complement(3476..3859) product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641806.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS complement(3870..4472) product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052445.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS complement(4492..4902) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644790.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS 5088..6275 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089891.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS 6357..7544 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002037401.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS 7620..8459 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131024.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS 8616..9113 product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646371.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS 9155..9832 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003662275.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS 9915..10670 product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385631.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS complement(10875..11843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS 12121..12903 product tyrosine/lipid phosphatase LipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989815.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 gene lipA CDS complement(12936..13469) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS complement(13497..14135) product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368017.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS complement(14142..14591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS complement(14626..15534) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101970.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS 15668..16933 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101909.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS 16993..18327 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011241776.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS 18546..19493 product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254272.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS 19621..20799 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100995.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(20872..21777) product tyrosine/lipid phosphatase LipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989815.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 gene lipA CDS complement(21979..22983) product tyrosine/lipid phosphatase LipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989815.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 gene lipA CDS complement(23168..25471) product RNA polymerase recycling motor HelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101002.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 gene helD CDS 26269..27288 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101004.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 gene trpS CDS 27309..28229 product Ppx/GppA family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101010.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS 28247..29506 product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101011.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS 29526..30491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642010.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS 30631..31329 product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646490.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS 31340..31666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS 31705..32553 product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642012.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS 32696..34732 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643823.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 gene metG CDS 34884..35660 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643825.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS 35647..36222 product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101014.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 gene rnmV CDS 36212..37102 product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475602.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 gene rsmA CDS 37201..37437 product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642020.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS 37550..38404 product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643828.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 gene ispE sequence022 source 1..38319 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 56..1009 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642346.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS 1210..2166 product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102161.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS complement(2273..2710) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476083.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS complement(2724..3599) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102090.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS 3770..4531 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722299.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS complement(4720..6954) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS 7303..8808 product alpha-N-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287297.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS complement(10130..12874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS 13512..14333 product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101331.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS complement(14411..15361) product anti-sigma factor C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906352.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS complement(15339..15851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS complement(16067..16495) product transcriptional regulator Spx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263835.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 gene spx CDS complement(17031..18872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS complement(19020..19403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS 19739..20557 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101579.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS complement(20593..21417) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475603.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS 21709..22743 product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476378.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS 22929..23198 product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640872.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 gene rpsN CDS 23416..23931 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS complement(24413..26668) product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640464.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS complement(26834..28204) product SLC45 family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703075.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS complement(28765..29733) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643677.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS complement(30077..31408) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563815.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS complement(31398..32090) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563812.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS 32797..35523 product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101404.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS complement(35695..36066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS complement(36212..36403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS complement(36545..37750) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101927.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS 38006..38203 product YjzD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640606.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 sequence023 source 1..37897 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(548..1831) product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476151.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS complement(1853..2314) product YueI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101715.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS 2472..2993 product DUF1054 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594296.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS complement(3054..3659) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641475.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 gene rpsD CDS complement(3857..4324) product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703982.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS 4507..6255 product septation ring formation regulator EzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641477.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 gene ezrA CDS 6415..7560 product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644645.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS 7581..8798 product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641480.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 gene thiI CDS 9068..9577 product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644643.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 gene tpx CDS 9881..12547 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101712.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS 12731..14056 product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101711.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS 14292..15296 product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644642.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS 15378..16229 product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641488.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 gene mreC CDS 16242..16763 product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641489.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 gene mreD CDS 16782..17453 product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476147.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS 17456..18262 product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641491.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 gene minD CDS 18745..19389 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641492.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS 19409..20047 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641493.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS 20062..20925 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641494.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS 21146..22426 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287428.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS 22416..23723 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644640.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS 23815..24756 product DUF4115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641501.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS 24837..25424 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641502.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 gene pgsA CDS 25602..26855 product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101709.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS 26945..28114 product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641504.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 gene recA CDS 28310..29869 product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644638.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 gene rny CDS 29997..30794 product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641506.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS 30830..33511 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101708.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 gene mutS CDS 33541..35547 product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101707.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 gene mutL CDS 35624..36226 product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700560.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 gene ruvA CDS 36245..37261 product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641514.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 gene ruvB CDS 37423..37869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12530 sequence024 source 1..37605 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 24..99 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS 340..660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS complement(1029..1217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS 2451..3929 product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643855.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS 4007..4822 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640888.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 tRNA 4903..4987 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 tRNA 4993..5067 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS 5241..7205 product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674605.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS 7207..8007 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101054.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 gene proC CDS 8083..9225 product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644997.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 gene nagA CDS 9262..9963 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640897.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS complement(10073..10801) product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101055.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS 10961..12427 product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101056.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS 12456..13289 product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660553.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 gene nadE CDS 13308..13742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640902.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS 13811..14293 product SprT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640904.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS 14310..15194 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640906.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 gene thrB tRNA 15274..15358 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS 15684..17108 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643131.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS 17201..17821 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930809.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS 17898..18317 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640913.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS 18314..18823 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640914.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS 18901..19707 product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356031.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS 19720..20541 product PTS mannose transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293411.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 gene manZ CDS 20835..23495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS complement(23562..24218) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642202.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS complement(24307..25230) product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102107.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS complement(25418..26515) product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101070.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS 26884..27831 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643925.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS 28018..28689 product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640923.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS 28790..30034 product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101633.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS complement(30097..31431) product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101072.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS 31705..32628 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102068.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS complement(32999..33685) product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706781.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 gene rpiA CDS complement(33886..34218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS 34388..34930 product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567256.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS 35018..36397 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643928.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 gene radA CDS 36433..37581 product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640931.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 sequence025 source 1..36129 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 160..321 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101358.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS 540..1367 product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019565706.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS complement(1356..1895) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906406.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS 2050..2658 product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003588841.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS complement(2766..3221) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101382.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS 3478..3981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254493.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS complement(4090..5193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS 5489..6190 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644830.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS 6200..8776 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112297324.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS 8852..9829 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252564.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS complement(10493..11290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS complement(11672..12466) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705135.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 gene map CDS complement(12570..13187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS complement(13200..13628) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS 13809..14651 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101829.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS complement(14743..15960) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288985.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS complement(16291..17247) product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067939.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS 17622..17873 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS complement(17938..18834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS 18996..19244 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS complement(19349..20146) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS complement(20315..21436) product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699301.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS complement(21784..23424) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100878.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS 24095..25297 product PrsW family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002467821.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS complement(25364..26920) product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102148.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS complement(26920..27732) product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003606005.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 gene phnE CDS complement(27732..28526) product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576383.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 gene phnE CDS complement(28529..29305) product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567449.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 gene phnC CDS complement(29384..30337) product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567447.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS complement(30740..31471) product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224298.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS 31675..31839 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS complement(32081..33538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS complement(33557..35032) product alpha-N-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287297.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 sequence026 source 1..35632 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(55..861) product antiholin-like protein LrgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421724.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 gene lrgB CDS complement(907..1350) product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683316.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS 1763..2857 product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640988.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS complement(2896..3564) product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476442.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS 3643..4953 product DNA/RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101146.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS 4950..5627 product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643951.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS 5765..6325 product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003637821.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 gene raiA CDS 6575..8938 product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643952.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 gene secA CDS 9160..9306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS 9446..10549 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096641376.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 gene prfB CDS 10664..11818 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640996.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS 11822..12529 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640997.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS 12522..13883 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643953.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS 14191..15075 product phosphate ABC transporter substrate-binding protein PstS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674324.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS 15075..16016 product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643955.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 gene pstC CDS 16016..16903 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641001.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 gene pstA CDS 16916..17743 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641002.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 gene pstB CDS 17759..18517 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641003.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 gene pstB CDS 18529..19206 product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641004.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 gene phoU CDS 19455..19790 product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101151.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS 19791..20162 product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641006.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS 20251..21192 product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643956.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 gene hprK CDS 21287..22066 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646080.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 gene lgt CDS 22080..23093 product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646081.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS 23123..24028 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641010.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 gene galU CDS 24097..25038 product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641020.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 gene trxB CDS 25334..25978 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641028.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS 25981..26508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS 26627..28633 product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641029.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 gene uvrB CDS 28653..31511 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643969.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 gene uvrA CDS 31675..32220 product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101155.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS 32426..33310 product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641036.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 gene rapZ CDS 33307..34320 product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641037.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS 34322..35263 product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641038.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 gene whiA sequence027 source 1..35299 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 176..598 product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700457.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 gene mraZ CDS 635..1591 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644613.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 gene rsmH CDS 1623..2012 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS 2012..4168 product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101681.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS 4244..5161 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640859.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 gene mraY CDS 5441..6778 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644611.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 gene murD CDS 6780..7871 product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640857.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 gene murG CDS 7907..8764 product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101680.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS 8905..10245 product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640855.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 gene ftsA CDS 10267..11544 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640854.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 gene ftsZ CDS 11581..12015 product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640853.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 gene sepF CDS 12028..12312 product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700446.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS 12332..13111 product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640851.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS 13131..13835 product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640850.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS 14187..17000 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101679.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 gene ileS CDS 17157..17381 product cold-shock protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193054.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 gene cspD CDS 17384..17926 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704380.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS 17937..18242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS 18261..18956 product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644605.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS 18981..20147 product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101678.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS 20149..20490 product DUF1831 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700201.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS 20787..21917 product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644602.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 gene mnmA CDS 22077..22733 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640836.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS 22747..23430 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640835.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS 23436..25955 product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101675.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS 26051..27037 product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644596.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS 27100..28170 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033099039.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS complement(28191..28877) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611499.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS complement(28898..29644) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295916.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS complement(29604..29759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS 29919..31403 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674845.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS 31419..33068 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101336.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS 33279..34187 product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568123.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 gene murQ CDS 34271..35260 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033099007.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 sequence028 source 1..34838 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(65..214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS complement(462..941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS complement(1101..2057) product linear amide C-N hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101831.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS 2284..2910 product LVIS_2131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549837.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS 2958..3437 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381091.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(3575..3703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS complement(3792..4730) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101884.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS complement(4825..5376) product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641026.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS complement(5492..5932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS 6075..6515 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393392.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS 6528..6935 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS complement(7004..7651) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS complement(7695..8150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS 8287..8613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS 8660..10006 product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640299.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 tRNA 10062..10133 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS complement(10715..11980) product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101077.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS 12442..12780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS 12773..13861 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS 13981..14508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS 14659..15201 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102007.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS 15305..15502 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643747.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS 15515..16423 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643746.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS 16857..17741 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS 17851..18084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS 18110..19471 product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288744.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 gene brnQ CDS complement(19468..20301) product aminoglycoside nucleotidyltransferase ANT(6)-Ia inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255864.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 gene ant(6) CDS 20796..21995 product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943131.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS 22438..23787 product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053874.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 gene xylA CDS 24152..25660 product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245233.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 gene xylB CDS 25897..27285 product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012898121.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS 27524..28429 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS 28604..29710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14200 note possible pseudo, internal stop codon CDS 29738..30076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14210 note possible pseudo, internal stop codon CDS 30125..31750 product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906008.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS 31989..32768 product (S)-acetoin forming diacetyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905614.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS complement(33481..33999) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644733.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS complement(34009..34518) product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003581145.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 sequence029 source 1..32653 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 46..528 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100924.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 gene greA CDS 599..1558 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101341.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 gene hemH CDS 1548..2870 product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101340.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS 3056..3247 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS complement(3557..5947) product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254199.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS complement(6652..7377) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642638.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS 7528..8031 product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101872.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 gene ybaK CDS 8035..8838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101873.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS 8955..9704 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568116.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS 9821..11017 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101811.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS 11001..11846 product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229689.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 gene nadC CDS complement(11943..13337) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566217.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS 13636..14067 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS complement(14221..14880) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101874.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS complement(14877..15524) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181808.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS 15755..16645 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100907.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS 16652..18274 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100908.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS complement(18402..19529) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643729.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS complement(19818..20141) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643543.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS complement(20465..20785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS complement(21050..21736) product LysM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641877.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS complement(21984..22232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS complement(22365..22952) product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703661.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS complement(23684..26296) product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355775.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 gene adhE CDS 26639..28432 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642695.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS complement(28913..30733) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680887.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS complement(30736..32301) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682372.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 sequence030 source 1..32614 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 197..901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS 901..1158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS complement(1506..1856) product DUF5388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222016.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS complement(1858..2658) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222015.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS 3522..3794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225423878.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS 4114..4407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS 4813..5634 product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011241755.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS complement(5624..5902) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222046.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS complement(5925..6134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011241756.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS 6406..8469 product MobQ family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035454417.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 gene mobQ CDS 8814..10589 product type IA DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222029.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 note possible pseudo, internal stop codon, frameshifted CDS 10712..10882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS complement(11057..12202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS complement(12202..13035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS 13244..13603 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766756.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS 13605..13883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS 14004..16769 product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613294.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS complement(16820..17206) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS 17409..17996 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674185.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS 18334..21345 product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101706.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS 21427..21705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS 21853..22008 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14740 note possible pseudo, internal stop codon CDS 22288..22782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14750 note possible pseudo, internal stop codon CDS 22904..23119 product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003680381.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS 23736..23987 product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002816285.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS 24260..24883 product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010620872.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS 24943..25350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS 25483..26841 product SLC45 family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644357.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS 26857..29115 product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640464.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS 29172..30155 product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101525.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS 30158..30829 product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643642.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 gene pgmB CDS complement(31003..31212) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS complement(31261..32436) product IS256-like element ISEfm2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081133701.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 sequence031 source 1..30513 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(160..786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS 993..1856 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228550.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS complement(1914..2303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS 2553..3089 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905072.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS 3202..3354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS 3437..4894 product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643687.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 gene nhaC CDS complement(5330..5467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS complement(5762..6244) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100964.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS complement(6410..6754) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS 7211..8845 product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642253.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS 8842..9273 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642254.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS 9678..11294 product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642253.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS 11324..11755 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642254.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS complement(12221..13207) product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024272289.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS complement(13226..14521) product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700902.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS 14794..16101 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102100.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 gene purB CDS 16235..17716 product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101215.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS complement(17793..19481) product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399551.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS complement(19493..19807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS complement(20244..21191) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102098.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS complement(21321..22115) product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566975.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS 22284..23171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS 23239..23433 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS complement(23739..24323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS 24310..26862 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS complement(26947..27603) product DUF6198 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102236.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS 27851..28096 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS 28202..28849 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642467.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS 28984..30501 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101174.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 gene glpK sequence032 source 1..29843 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 217..513 product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003637271.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 gene rpsF CDS 554..1129 product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100851.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 gene ssb CDS 1159..1395 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701427.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 gene rpsR CDS complement(1444..2091) product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100859.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS 2272..2733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS complement(3003..3767) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596147.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS 4022..6034 product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643610.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS 6095..6556 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641637.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 gene rplI CDS 7090..8490 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641638.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 gene dnaB CDS 8889..10016 product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095342080.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS complement(10121..10681) product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497633.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS 10819..11994 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674406.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS 12066..12338 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS 12826..14433 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102292.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS complement(14504..15172) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003662275.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 tRNA complement(15288..15363) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 tRNA complement(15534..15609) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS 16247..16963 product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100856.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 gene yycF CDS 17008..18864 product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641656.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 gene walK CDS 18851..20143 product two-component system activity regulator YycH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646176.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 gene yycH CDS 20166..21017 product two-component system regulatory protein YycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646175.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS 22041..22856 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641659.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS 22990..24366 product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641660.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS 24897..25376 product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643636.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 gene rlmH CDS complement(25500..26507) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020472.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS complement(26509..26721) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS 26837..27718 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS complement(27968..28777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS 29031..29720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15410 sequence033 source 1..28714 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 186..1979 product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101139.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 gene dnaX CDS 2002..2319 product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640956.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS 2344..2943 product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003637790.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 gene recR CDS 2960..3211 product YaaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476227.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS 3368..4495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476120.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS 4529..6025 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476119.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS 6022..7593 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355763.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS 7598..8851 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702271.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS 8868..10952 product cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476116.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS 10942..11799 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS 11792..11950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS 12793..13461 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101140.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 gene tmk CDS 13475..13804 product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640965.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS 13814..14830 product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640966.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 gene holB CDS 14857..15195 product DNA replication initiation control protein YabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356372.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS 15205..16095 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643942.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 gene rsmI CDS 16092..16829 product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640969.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS 17006..17728 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640977.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 gene tsaB CDS 17712..18305 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101142.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 gene rimI CDS 18332..19375 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101143.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 gene tsaD CDS complement(19442..21397) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643947.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS 21641..22276 product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640983.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS 22504..22788 product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640985.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 gene groES CDS 22851..24479 product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640986.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 gene groL CDS 25214..27049 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640987.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS complement(27110..27679) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001224187.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS 27875..28546 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072535403.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 sequence034 source 1..28125 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(367..1398) product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642089.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 gene dusB CDS complement(1403..2290) product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642088.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 gene hslO CDS complement(2440..4584) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643854.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 gene ftsH CDS complement(4698..5240) product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642086.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 gene hpt CDS complement(5224..6621) product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642085.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 gene tilS CDS complement(6701..7255) product S1 domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101050.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS complement(7468..7881) product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642083.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS complement(7985..8266) product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642082.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS complement(8268..9848) product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642081.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS complement(9964..13512) product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101049.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 gene mfd CDS complement(13600..14157) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476306.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 gene pth CDS 14467..15423 product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642078.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS 15897..17279 product peptidoglycan binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101047.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS complement(17347..17499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS 17601..18242 product cyclic di-AMP binding protein CbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643849.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 gene cbpA CDS complement(18403..18816) product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003637688.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS complement(18830..19081) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS complement(19165..20292) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596242.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 gene alr CDS complement(20295..20654) product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642061.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 gene acpS CDS 21002..21715 product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003604400.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS complement(21848..23386) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642058.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS complement(23585..24970) product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643844.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS complement(25185..25970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646517.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS complement(26042..26941) product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101040.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 gene htpX CDS complement(26950..27522) product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642054.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS 27630..28091 product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289814.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 sequence035 source 1..26869 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(34..1365) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362058.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS complement(1576..2934) product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643223.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS complement(3100..4653) product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563002.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 gene gntK CDS 4965..5834 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644133.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS 5958..6656 product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101272.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS complement(6800..7174) product DUF4828 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641352.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS 7337..8341 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101273.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS 8356..9696 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101274.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 tRNA 9750..9824 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS 9888..10091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS 10331..11245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS 11351..11803 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642165.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS 11967..13322 product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643223.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS complement(13852..14706) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645635.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS 15022..16143 product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646267.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 gene wecB CDS 16158..17009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS 17027..17926 product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101278.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS complement(18069..18518) product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642531.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS 18712..19512 product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101330.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 gene recX CDS 19622..20806 product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101633.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS complement(20882..21127) product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642841.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS 21289..21840 product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643214.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS 21933..23060 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643221.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS 23326..23763 product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643222.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 gene tagD CDS 23834..24721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS 24736..26760 product teichoic acid poly(glycerol phosphate) polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243463.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 gene tagF sequence036 source 1..26757 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(211..528) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296337.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS complement(531..947) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296336.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS complement(968..1711) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642284.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS complement(1711..2244) product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068495.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS complement(2394..3287) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906179.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS complement(3315..4751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS 4905..5102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS complement(5013..5879) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101921.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS complement(5876..6766) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642522.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS 6883..7752 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101922.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS complement(7822..9213) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673958.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS complement(9327..9605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16310 repeat_region 9797..10129 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gaatcacccccacacacgcggggaacac CDS 10317..10592 product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222012.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS 10585..10932 product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748798.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS complement(11492..12022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS complement(12208..12474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254095.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS complement(12471..12794) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548967.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS complement(13547..13765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS complement(13824..14438) product DUF3841 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459262.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS complement(14686..15549) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287475.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS complement(15561..15788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS 15956..16498 product dihydroxyacetone kinase transcriptional activator DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009910868.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 gene dhaS repeat_region 16676..17118 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gaatcacccccgtacacacggggaacac CDS complement(17335..18705) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101269.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 gene rlmD CDS complement(18786..19817) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641344.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS complement(19838..21259) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641343.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 gene gatB CDS complement(21259..22728) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476296.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 gene gatA CDS complement(22732..23037) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641341.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 gene gatC CDS complement(23214..24356) product CamS family sex pheromone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641340.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS complement(24373..26424) product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101267.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 gene ligA sequence037 source 1..26449 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 718..1857 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642427.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS complement(2015..2581) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS 3754..4443 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642424.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS 4430..5632 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642423.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS 5712..7037 product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642422.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS 7451..10570 product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674061.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS 10971..11774 product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642420.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS 11793..12143 product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102072.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS complement(12325..12867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS complement(12949..13125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS complement(13218..14411) product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102067.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS 14612..15523 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS 15898..17082 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102065.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS 17263..18387 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642406.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS 18637..19935 product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641437.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS 20181..22115 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS 22467..24656 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS 24799..25491 product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642405.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS complement(26140..26412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16670 sequence038 source 1..25340 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(837..911) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS complement(1076..1447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704291.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS complement(1465..2685) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644757.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS complement(2678..3574) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101934.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS complement(3737..5104) product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645874.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS 5131..5340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS complement(5402..5572) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS 5665..6639 product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567083.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS 6720..7883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100969.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS 7937..8281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS 8296..8556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS 8562..9074 product RNase III inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645538.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS complement(9134..9334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS 9575..9766 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS complement(9979..10746) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467026.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS complement(10904..11266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS complement(11343..11987) product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379778.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 gene tenA CDS complement(12005..12658) product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100921.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS complement(12648..14072) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100922.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS complement(14089..14655) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643692.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS 15142..16332 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS 16464..17285 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101579.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS 17425..18714 product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101271.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS 18711..19535 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643303.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS 19591..20394 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645847.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS 20473..21129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS complement(21242..22201) product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644692.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS 22358..23398 product PrsW family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002467821.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS complement(23390..24145) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642691.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS 24187..25191 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642692.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 sequence039 source 1..23267 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(445..2508) product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644210.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS complement(2647..2883) product YkuJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643297.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS complement(2958..3992) product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704264.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS complement(3995..5017) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643293.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS complement(5030..6208) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643292.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS complement(6392..8122) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646541.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 gene ptsP CDS complement(8122..8388) product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638282.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS complement(8553..8753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS 9236..11296 product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101337.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS 11468..12580 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS complement(12680..14119) product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475567.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS 14381..15721 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643033.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS complement(15802..17943) product cell surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102168.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS complement(18362..20488) product cell surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102168.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS complement(20661..22241) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643227.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS 22479..23039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17120 sequence040 source 1..21715 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 71..835 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643984.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS 862..1398 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101164.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS complement(1463..1999) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775687.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS complement(1992..2468) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101163.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 gene tsaE CDS complement(2570..3547) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641060.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 gene pta CDS complement(3579..4310) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643980.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS 4479..5048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101162.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS complement(5090..5563) product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641053.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 gene smpB CDS complement(5579..7981) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101159.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 gene rnr CDS complement(7995..8744) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641051.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS complement(8864..9100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS complement(9188..10744) product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641049.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS complement(10801..12021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS complement(12136..13455) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643976.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 gene eno CDS complement(13561..14319) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643975.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 gene tpiA CDS complement(14463..15665) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641045.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS complement(15851..16861) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564265.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 gene gap CDS complement(16930..17958) product central glycolytic genes regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641043.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 tRNA complement(18237..18309) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS 18634..19230 product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644117.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 tRNA complement(19316..19388) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS complement(19484..20221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640317.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS complement(20228..20677) product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640318.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS 20983..21579 product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641041.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 gene clpP sequence041 source 1..21456 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 451..1257 product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674138.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS 1279..2196 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003577893.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 gene cysK CDS 2371..4107 product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101264.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 gene cydD CDS 4104..5849 product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641327.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 gene cydC CDS 5965..6975 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476436.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 gene rfbB CDS 6995..7732 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS 8182..8982 product GNVR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101298.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS 8992..9747 product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476420.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS 9744..10526 product tyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570845.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS 10544..11230 product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986980.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS 11272..12009 product DUF4422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549870.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS 12031..12939 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254560.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS 13149..14417 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS 14422..15540 product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476416.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 gene glf CDS 15549..16973 product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101324.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS 17145..18296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS 18293..19405 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101286.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS 19669..20700 product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641230.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS 20847..20987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17530 sequence042 source 1..20342 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(540..776) product cytochrome b5 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475717.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS complement(907..1506) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674780.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS complement(1666..2997) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674807.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS 3281..3697 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721389.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS complement(3790..4806) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643068.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS complement(4986..6173) product NADH-dependent flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003588846.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS complement(6179..6475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS complement(6622..7014) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476515.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS 7157..8245 product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592702.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS 8435..9076 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025022919.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS complement(9151..10134) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475591.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS complement(10167..10928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002397245.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS 11303..12475 product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644879.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS complement(12619..12939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS 13297..13920 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS 14465..15472 product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641196.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 gene asnA CDS complement(15952..17055) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640893.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS complement(17159..17983) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025015513.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS complement(18079..19281) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101930.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS complement(19425..19961) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17730 sequence043 source 1..17461 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(20..709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS complement(953..1657) product matrixin family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642249.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS 2129..6082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS complement(6174..7109) product pyrimidine-specific ribonucleoside hydrolase RihA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097582.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 gene rihA CDS complement(7203..7742) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674847.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS complement(7752..10004) product ribonucleoside-triphosphate reductase, adenosylcobalamin-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674848.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 gene nrdJ CDS complement(10233..10949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17800 tRNA complement(11133..11207) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS 11461..12435 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS complement(12552..13634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS complement(13987..14376) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289210.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS complement(14380..15126) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475562.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS complement(15210..16220) product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583055.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS complement(16247..17122) product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262656.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 sequence044 source 1..16984 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 263..1546 product cation:dicarboxylase symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644750.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS 2649..3212 product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567571.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 gene ahpC CDS complement(3271..3615) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS 3903..4544 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642616.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS 4580..5056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645282.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS complement(5067..5687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS complement(5870..7312) product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645183.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 gene gndA CDS complement(7571..9058) product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644713.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 gene zwf CDS 9734..10564 product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642327.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS complement(10641..11636) product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548569.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS complement(11863..13764) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102165.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS complement(14724..15278) product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645583.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS complement(15310..15537) product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024272221.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS 15769..16941 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645896.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 sequence045 source 1..16442 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(251..499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641854.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS complement(572..1957) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643713.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS complement(1954..2649) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643714.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS 2885..3172 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS complement(3315..3974) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642616.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS 4288..5490 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100962.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS 5945..6511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS 6820..8238 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642338.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS 8563..9312 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410047.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS complement(9653..11029) product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033099006.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS 11455..12309 product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288847.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS 12774..13397 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18120 note possible pseudo, internal stop codon CDS 13422..13676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18130 note possible pseudo, internal stop codon CDS 14228..15634 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101153.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS 15776..16105 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641827.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 gene trxA CDS 16102..16362 product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294653.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 sequence046 source 1..15815 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..978 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003721659.1:putrescine carbamoyltransferase locus_tag LOCUS_18170 CDS 1044..2435 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732183.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS 2477..3571 product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989327.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 gene aguA CDS 3667..4611 product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288434.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 gene arcC CDS 4654..5781 product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009911777.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 gene aguA CDS 5778..6587 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721664.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS complement(6642..7985) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732183.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS complement(8301..8495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS complement(8606..9343) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101161.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS complement(9343..10782) product amino acid ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643977.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS complement(11021..12532) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475458.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS complement(12554..14065) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701392.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 gene lysS CDS 14268..15482 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674406.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 sequence047 source 1..15796 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 211..1032 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS 1132..2079 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705389.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS 2226..2414 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027655.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS 2452..3000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS 3044..3544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS complement(3619..4650) product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476545.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS 4766..5659 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476544.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS 5795..6928 product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641027.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS 7525..8385 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641965.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS 8587..10221 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644778.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS complement(11615..12553) product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085964407.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS 12721..12942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS complement(13103..14824) product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645241.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS 15050..15766 product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675047.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 sequence048 source 1..15744 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(29..382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS complement(474..1454) product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643830.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS complement(1543..2919) product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642031.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 gene glmU CDS complement(2932..3771) product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642030.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 gene purR CDS complement(4265..6028) product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060684316.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS complement(6308..7108) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646500.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS complement(7101..7793) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101016.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS complement(7790..8674) product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102107.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS complement(8904..9845) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642022.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS complement(10026..10949) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732924.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS complement(10930..12408) product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642002.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS complement(12513..13670) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102065.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS complement(13695..15095) product glycoside-pentoside-hexuronide (GPH):cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003591692.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 sequence049 source 1..15610 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(396..794) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS complement(875..2341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS complement(2414..2656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS 2892..4118 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905506.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS 4122..4424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS 4421..5317 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905507.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS complement(5757..7172) product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102128.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS complement(7204..7644) product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101401.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS 7996..8469 product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003662387.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS 8456..9904 product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675048.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS complement(10215..11138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS complement(11150..12103) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS complement(12116..13006) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645985.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS complement(13007..13378) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645984.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS 13558..14343 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475984.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 gene murI CDS complement(14415..15290) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459799.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 sequence050 source 1..15211 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(383..790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS complement(1015..1440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS complement(1612..3009) product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101592.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS complement(3028..3441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS complement(4176..5093) product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475999.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS complement(5211..5990) product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641839.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 gene pnuC CDS complement(6341..6811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS complement(7032..8672) product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044735.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS complement(9352..10746) product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100951.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS 10898..11377 product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058223026.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS complement(11532..12197) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641873.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS complement(12210..13652) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643721.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS complement(13836..15050) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563871.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 sequence051 source 1..14678 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(92..439) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594511.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS 756..1652 product phosphate ABC transporter substrate-binding protein PstS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357425.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS 1724..2677 product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643955.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 gene pstC CDS 2667..3554 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564208.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 gene pstA CDS 3567..4370 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613297.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 gene pstB CDS complement(4573..5643) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641891.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS complement(5640..6440) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564363.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS complement(6437..7252) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643740.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS complement(7239..8351) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564358.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS 8339..8557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS 8630..9151 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040531169.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS 9381..9971 product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905546.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS 10074..10460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674558.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS complement(10464..11210) product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100877.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 gene yaaA CDS complement(11323..11697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS complement(11974..12918) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS 13045..13200 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS complement(13197..13937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19030 sequence052 source 1..14197 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 127..2394 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057717560.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS 2888..4426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100902.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS 4552..6060 product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102011.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS 6057..6509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102010.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS 6693..8426 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964060.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS complement(8793..10139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101560.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS complement(10297..10959) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673961.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS complement(10962..11894) product osmoprotectant ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640358.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS complement(11904..12530) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644316.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS complement(12530..13732) product betaine/proline/choline family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016527072.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 sequence053 source 1..13762 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(132..986) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731587.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS 1128..1499 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642671.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS 1496..2218 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642672.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS 2205..2981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS complement(3099..4001) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS complement(4240..5067) product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262299.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS complement(5210..5407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS 6367..10497 product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057865751.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 gene cas9 CDS 10698..11603 product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475521.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 gene cas1 CDS 11581..11886 product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475522.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 gene cas2 CDS 11883..12185 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS 12231..12548 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19250 note possible pseudo, internal stop codon repeat_region 12584..13477 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaaatgagtggtaaatctataaggtcaatacc sequence054 source 1..13660 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(235..2865) product bifunctional lysylphosphatidylglycerol flippase/synthetase MprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101138.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 gene mprF CDS complement(3154..3519) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003637775.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 gene rplL CDS complement(3577..4083) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643933.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 gene rplJ CDS complement(4306..5010) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700678.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 gene rplA CDS complement(5109..5534) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640942.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 gene rplK CDS complement(5681..6115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS complement(6112..6315) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795762.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS complement(6482..7030) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643932.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 gene nusG CDS complement(7153..7329) product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640939.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 gene secE CDS complement(7371..7520) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003637768.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 gene rpmG CDS complement(7594..8157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS complement(8232..8693) product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700683.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS complement(8825..9583) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643931.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 gene rlmB CDS complement(9583..9993) product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567219.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS complement(9993..11405) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101074.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 gene cysS CDS complement(11582..11800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS complement(11739..11948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS complement(12001..13491) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640932.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 gene gltX sequence055 source 1..13511 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(226..1251) product DUF916 and DUF3324 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643035.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS complement(1410..2117) product WxL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102169.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS complement(2152..2808) product WxL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643037.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS complement(2830..3282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS complement(3787..4491) product class A sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642053.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS complement(4660..4911) product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699599.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS complement(5012..6301) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642050.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS complement(6745..8352) product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642042.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS complement(8614..9267) product DNA-directed RNA polymerase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101020.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 gene rpoE CDS complement(9312..9752) product DUF1934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642040.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS 9940..10773 product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643833.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS 10787..12151 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101018.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS 12156..12965 product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646508.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 gene yidA CDS complement(13034..13192) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS complement(13152..13328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19580 sequence056 source 1..13129 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(92..1087) product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101007.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS complement(1188..2159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS complement(2156..2791) product DUF1700 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102079.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS complement(2784..3101) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643453.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS 3321..3875 product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642674.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS 4052..4885 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS 4906..5940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS 6217..7971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS complement(8054..9181) product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931414.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS complement(9206..10153) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS 10551..12272 product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645241.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS complement(12373..13023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19700 sequence057 source 1..12660 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 128..1243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19710 CDS complement(1246..1440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS complement(1575..3866) product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964400.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 gene yicI CDS 4299..5594 product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101275.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS 5584..6474 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643303.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS 6499..7356 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673990.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS 7688..8539 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702329.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS 8536..8913 product DUF1634 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722429.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS 9202..10419 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102145.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS 10430..11128 product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641867.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS complement(11208..12122) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644751.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 sequence058 source 1..12368 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(80..274) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS complement(268..828) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS complement(847..1623) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674620.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS complement(1610..2329) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642672.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS complement(2326..2700) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642671.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS 3015..3473 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645906.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS 3562..4443 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101869.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS complement(5266..6003) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918135.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS complement(6666..7979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS complement(8009..9010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS complement(9084..9329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS complement(9326..10654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS complement(10651..11424) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101371.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS complement(11827..12240) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19950 sequence059 source 1..12315 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(29..1045) product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130326.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 gene adhP CDS 1399..2634 product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642132.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS 2659..3153 product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861681.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS complement(3220..5328) product cell surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102168.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS complement(5348..6367) product DUF916 and DUF3324 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643035.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS complement(6498..7127) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS complement(7319..7981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100892.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS complement(8018..9382) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641725.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS 9808..10275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS complement(10382..10930) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643199.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS complement(10948..11400) product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356885.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS complement(11809..12084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20070 sequence060 source 1..12118 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(311..2872) product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641633.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 gene gyrA CDS complement(2947..4893) product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641632.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 gene gyrB CDS complement(4914..6056) product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641631.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 gene recF CDS complement(6056..6283) product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641630.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 gene yaaA CDS complement(6569..6775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS complement(6777..7916) product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641629.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 gene dnaN CDS complement(8201..9550) product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641628.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 gene dnaA CDS 10087..10221 product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640225.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 gene rpmH CDS 10356..10712 product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640224.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 gene rnpA CDS 10715..11548 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641627.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 gene yidC sequence061 source 1..11714 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 694..1002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476265.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS complement(1067..2011) product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641094.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 gene ppx CDS complement(2008..4176) product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641095.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS complement(4173..5702) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641096.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS complement(5774..6595) product LicD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641097.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS 6812..7255 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101178.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS 7310..7486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS complement(7544..7996) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641108.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS 8383..8562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS complement(9014..9385) product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592713.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS 9602..10099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641754.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS 10276..11658 product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476283.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 sequence062 source 1..11165 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(179..2611) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643180.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 gene leuS CDS 3010..3648 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674303.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS 3648..4214 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644228.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS complement(4312..5028) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086454.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS 5180..5425 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS complement(5480..6223) product adaptor protein MecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640883.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS complement(6368..6775) product transcriptional regulator Spx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245483.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 gene spx CDS complement(6879..7616) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644623.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS 7738..8241 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS 8501..9547 product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100975.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS complement(9619..9828) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20400 tRNA complement(10142..10219) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 tRNA complement(10222..10298) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 tRNA complement(10308..10397) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 tRNA complement(10433..10508) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 tRNA complement(10522..10597) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 tRNA complement(10625..10698) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA complement(10704..10779) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 tRNA complement(10812..10883) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 tRNA complement(10888..10963) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 tRNA complement(11010..11084) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 tRNA complement(11085..11159) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 sequence063 source 1..11145 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 127..915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS 912..1103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS 1155..2546 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641622.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 gene mnmE CDS 2697..4607 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102289.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 gene mnmG CDS 4744..5169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS complement(5540..6886) product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101684.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 gene brnQ CDS complement(7021..7668) product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101683.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS complement(7976..8512) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101506.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS 8691..9899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS 10127..10378 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS 10475..10684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS 10685..11119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20520 sequence064 source 1..11060 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(169..432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS complement(554..1321) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101987.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS complement(1254..2219) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646058.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS complement(2254..3216) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101988.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS complement(3624..4520) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101816.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS 4932..5927 product tryptophan ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674603.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 gene trpX CDS 5924..6823 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642727.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS 6816..7586 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101822.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS complement(7675..8550) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642723.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS complement(8656..9426) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704313.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS 9619..10941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20630 sequence065 source 1..10857 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 307..1035 product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102076.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 gene rsmG CDS 1056..1889 product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642432.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 gene noc CDS 1904..2671 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102075.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS 2661..3545 product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642430.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS 3582..3791 product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003639829.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS 3797..4897 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642429.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 gene ychF CDS 4912..5637 product DUF1129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642428.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS 5974..6516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS 6713..7147 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS 7380..9089 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS 9108..10841 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296909.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 sequence066 source 1..10786 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(209..730) product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643467.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS 1009..1695 product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642969.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS 1713..2423 product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642968.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS 2715..4310 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254096.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS complement(4427..4873) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102167.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS 5011..6054 product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101686.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS complement(6173..7102) product sce7725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100959.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS complement(7099..7791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641880.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS complement(7788..10151) product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100960.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS 10312..10575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20840 sequence067 source 1..10631 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(132..1931) product oligopeptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547891.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS complement(2054..3004) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002938141.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS complement(3017..3976) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547894.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS complement(3976..4956) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660720.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS complement(4953..5972) product oligopeptide ABC transporter ATP-binding protein Opp2D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365359.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 gene opp2D CDS 6550..7038 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646440.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS 7338..8351 product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642650.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS 8466..8876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101862.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS 8892..9536 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS 10007..10168 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS 10319..10522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20950 sequence068 source 1..10562 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 268..543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS complement(771..1169) product transcriptional regulator SpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565949.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 gene spxA CDS 2244..3815 product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674485.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS complement(4166..4399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS complement(5216..5614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS complement(5628..6050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS complement(6610..7506) product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125982402.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS complement(7503..7814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21030 note possible pseudo, internal stop codon CDS complement(8022..8186) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS complement(8261..9868) product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644638.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 gene rny sequence069 source 1..10427 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 246..1160 product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641067.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 gene murB CDS 1182..3320 product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101165.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS complement(3631..4320) product DUF1361 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700593.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS 4545..5393 product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643987.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 gene cdaA CDS 5393..6358 product CdaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641072.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS 6393..7748 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101166.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 gene glmM CDS 8085..9899 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641075.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 gene glmS sequence070 source 1..10319 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(15..2243) product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644128.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 gene pcrA CDS complement(2443..2862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS complement(2875..3141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS complement(3148..3696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS complement(3739..4905) product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641337.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS complement(5022..5597) product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641335.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS complement(5699..6610) product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566887.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS 6716..7693 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644123.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS complement(7806..8321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS 8624..9001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS 9247..9636 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS complement(9699..10067) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21240 sequence071 source 1..9986 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(109..942) product DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675241.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS complement(945..2240) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884296.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS 2350..3348 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793607.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 gene argF CDS 3362..4288 product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074357.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 gene arcC CDS 4475..6031 product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456314.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS 6211..7797 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254623.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS complement(7856..9025) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101954.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS complement(9015..9692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21320 note possible pseudo, internal stop codon CDS complement(9711..9875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21330 note possible pseudo, internal stop codon sequence072 source 1..9838 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 279..728 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS complement(1044..1730) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288442.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS complement(1822..3291) product arginine-ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503400.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 gene arcD CDS complement(3426..4370) product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288434.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 gene arcC CDS complement(4587..5618) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254507.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 gene argF CDS complement(5675..6907) product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288439.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 gene arcA CDS 7236..7946 product B3/4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906362.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS complement(8421..8555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS 8520..9758 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643663.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 sequence073 source 1..9812 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(618..1031) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102131.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS complement(1028..1372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS complement(1378..1752) product prophage P3 protein 11, DNA replication inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102132.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS complement(1990..3399) product virulence-associated E family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101797.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS complement(3404..4183) product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102136.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS complement(4195..4419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS complement(4412..4768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS complement(5079..5363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS complement(5377..6054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS complement(6116..6301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS 6444..7268 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102002.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS 7326..8480 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101803.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS complement(9033..9356) product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292678.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 sequence074 source 1..9325 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(318..1067) product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566209.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS complement(1060..1521) product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642628.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 gene nrdI CDS 1857..3377 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100919.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS 3467..4909 product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548236.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 CDS 5100..5369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS complement(5534..6919) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101876.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 CDS 7306..7668 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642630.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 sequence075 source 1..8926 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 549..4181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21630 CDS 4334..4738 product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644577.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS 4891..6270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS 6484..8022 product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003585581.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS 8161..8844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21670 sequence076 source 1..8622 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(85..993) product proline-specific peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644004.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS complement(1076..3514) product Xaa-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101183.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS complement(3569..4960) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641110.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 CDS 5212..5631 product bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644009.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS 5628..6188 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101185.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS 6272..6730 product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641116.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS 6803..7345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS 7366..8313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641118.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 sequence077 source 1..8215 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1967..2980) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645220.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS 3515..4711 product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101542.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS 4760..5392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644748.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS 5761..7116 product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101542.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS 7128..7784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644748.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 sequence078 source 1..6924 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(656..2476) product oligopeptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547891.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS complement(2612..3562) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002938141.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS complement(3577..4536) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547894.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS complement(4536..5510) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547895.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS complement(5507..6526) product oligopeptide ABC transporter ATP-binding protein Opp2D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365359.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 gene opp2D sequence079 source 1..6286 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(151..702) product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640954.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 gene tadA CDS complement(718..1332) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640953.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS 1533..1760 product redoxin NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640952.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS 1871..4036 product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643938.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 gene nrdE CDS 4070..5080 product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640950.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 gene nrdF CDS 5251..5520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS 5614..6192 product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643936.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 sequence080 source 1..6227 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(50..604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS 794..1777 product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152580630.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS complement(1769..2746) product choloylglycine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475798.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS complement(2767..3000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS 3200..5992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21970 sequence081 source 1..5436 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(273..2405) product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101835.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS 2637..3302 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055085.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS 3320..3757 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130314.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS complement(3920..4402) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS 4606..5076 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102089.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 sequence082 source 1..4916 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 98..1465 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646086.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS complement(1613..2872) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642093.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 gene tyrS CDS complement(3172..4554) product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369213.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 sequence083 source 1..4809 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(75..773) product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101204.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS complement(793..1176) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101813.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS 1371..2924 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034535214.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS 3021..3614 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475532.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS 3742..4359 product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130078.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS 4390..4515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22110 sequence084 source 1..4364 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(205..1290) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641921.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS complement(1467..2912) product peptidoglycan hydrolase Auto inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732702.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 gene aut CDS complement(3014..3739) product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476356.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 gene nagB sequence085 source 1..4260 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 136..1083 product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355148.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS 1379..1693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS complement(2221..4170) product glycoside-pentoside-hexuronide (GPH):cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643065.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 sequence086 source 1..4148 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 173..1006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS complement(1066..2070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22190 CDS 2270..2743 product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700626.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS 2895..3989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22210 sequence087 source 1..3878 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(100..1869) product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101229.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 gene recQ CDS 2088..2876 product acetoin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026965.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS 3075..3863 product acetoin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026965.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 sequence088 source 1..3723 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(176..301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22250 CDS 594..1634 product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101233.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS 1631..2425 product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101234.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS complement(2584..3654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22280 sequence089 source 1..3582 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(157..525) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642574.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS complement(556..2379) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101901.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 CDS complement(2392..3147) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642577.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 sequence090 source 1..3578 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 89..679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS 757..1275 product DUF1440 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642103.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS 1292..2635 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643745.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS complement(2718..3113) product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102029.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 sequence091 source 1..3562 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(58..477) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642665.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 CDS complement(545..2368) product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101855.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS 2545..3492 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563927.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 sequence092 source 1..3548 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 172..1329 product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989388.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS 1576..3420 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22400 sequence093 source 1..3220 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA complement(11..94) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 70 percent of the 5S ribosomal RNA locus_tag LOCUS_r00010 rRNA complement(163..3074) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 sequence094 source 1..2930 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 804..1937 product vitamin B12 independent methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102105.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 CDS 2087..2794 product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101356.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 sequence095 source 1..2781 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 251..1702 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641324.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS 1695..2705 product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641325.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 gene cydB sequence096 source 1..2298 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 134..2116 product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674605.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 sequence097 source 1..2131 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(58..795) product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391832.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 gene istB CDS complement(805..2028) product IS21-like element ISMac9 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023062.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 gene istA sequence098 source 1..1720 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA complement(72..1632) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 sequence099 source 1..1701 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(56..952) product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125982402.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS complement(949..1632) product helix-turn-helix domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645636.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 sequence100 source 1..1616 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 128..1432 product IS1380-like element ISEcp1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608644.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 sequence101 source 1..1371 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 236..1090 product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640533.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 sequence102 source 1..1313 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence103 source 1..1110 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(69..920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645914.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 sequence104 source 1..1042 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(28..948) product IS30-like element ISLpl1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003561810.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 sequence105 source 1..918 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(147..830) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643965.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 sequence106 source 1..769 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(154..609) product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475483.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 gene tnpA sequence107 source 1..657 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(200..631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22560 sequence108 source 1..647 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(193..621) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22570 sequence109 source 1..593 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@