>Feature sequence01 1892 264 gene locus_tag LOCUS_00010 1892 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 4168 1946 gene locus_tag LOCUS_00020 4168 1946 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030282.1 protein_id gnl|my_center|LOCUS_00020 4690 4172 gene locus_tag LOCUS_00030 4690 4172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 5370 4687 gene locus_tag LOCUS_00040 5370 4687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 5536 6270 gene locus_tag LOCUS_00050 5536 6270 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225022.1 protein_id gnl|my_center|LOCUS_00050 6281 7750 gene locus_tag LOCUS_00060 gene phoR 6281 7750 CDS product sensory box histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403870.1 protein_id gnl|my_center|LOCUS_00060 8744 7821 gene locus_tag LOCUS_00070 8744 7821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 10231 8744 gene locus_tag LOCUS_00080 10231 8744 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063688.1 protein_id gnl|my_center|LOCUS_00080 10337 10759 gene locus_tag LOCUS_00090 10337 10759 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229549.1 protein_id gnl|my_center|LOCUS_00090 10967 11554 gene locus_tag LOCUS_00100 10967 11554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 11873 11511 gene locus_tag LOCUS_00110 11873 11511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 12109 12918 gene locus_tag LOCUS_00120 12109 12918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00120 12965 13738 gene locus_tag LOCUS_00130 12965 13738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113172.1 protein_id gnl|my_center|LOCUS_00130 15114 13753 gene locus_tag LOCUS_00140 15114 13753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 15312 16013 gene locus_tag LOCUS_00150 15312 16013 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030391327.1 protein_id gnl|my_center|LOCUS_00150 16010 16915 gene locus_tag LOCUS_00160 16010 16915 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224138.1 protein_id gnl|my_center|LOCUS_00160 16978 18096 gene locus_tag LOCUS_00170 16978 18096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 18093 18746 gene locus_tag LOCUS_00180 18093 18746 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140352.1 protein_id gnl|my_center|LOCUS_00180 18897 19508 gene locus_tag LOCUS_00190 18897 19508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 20138 19731 gene locus_tag LOCUS_00200 20138 19731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 20403 21362 gene locus_tag LOCUS_00210 20403 21362 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223295.1 protein_id gnl|my_center|LOCUS_00210 21359 22738 gene locus_tag LOCUS_00220 21359 22738 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223296.1 protein_id gnl|my_center|LOCUS_00220 22735 25545 gene locus_tag LOCUS_00230 22735 25545 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223297.1 protein_id gnl|my_center|LOCUS_00230 26892 25627 gene locus_tag LOCUS_00240 26892 25627 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929473.1 protein_id gnl|my_center|LOCUS_00240 28822 26903 gene locus_tag LOCUS_00250 28822 26903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 29151 29354 gene locus_tag LOCUS_00260 29151 29354 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974443.1 protein_id gnl|my_center|LOCUS_00260 29455 30450 gene locus_tag LOCUS_00270 29455 30450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 30741 31307 gene locus_tag LOCUS_00280 30741 31307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 31304 32761 gene locus_tag LOCUS_00290 31304 32761 CDS product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225544.1 protein_id gnl|my_center|LOCUS_00290 32766 33254 gene locus_tag LOCUS_00300 32766 33254 CDS product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225543.1 protein_id gnl|my_center|LOCUS_00300 33263 34039 gene locus_tag LOCUS_00310 33263 34039 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223631.1 protein_id gnl|my_center|LOCUS_00310 34562 34059 gene locus_tag LOCUS_00320 34562 34059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 34779 35489 gene locus_tag LOCUS_00330 34779 35489 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972533.1 protein_id gnl|my_center|LOCUS_00330 35503 36681 gene locus_tag LOCUS_00340 35503 36681 CDS product DUF3089 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918560.1 protein_id gnl|my_center|LOCUS_00340 39020 36843 gene locus_tag LOCUS_00350 39020 36843 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938554.1 protein_id gnl|my_center|LOCUS_00350 39241 40002 gene locus_tag LOCUS_00360 39241 40002 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111761.1 protein_id gnl|my_center|LOCUS_00360 40438 40046 gene locus_tag LOCUS_00370 40438 40046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 43666 40682 gene locus_tag LOCUS_00380 43666 40682 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028215.1 protein_id gnl|my_center|LOCUS_00380 44430 43663 gene locus_tag LOCUS_00390 44430 43663 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223128.1 protein_id gnl|my_center|LOCUS_00390 45782 44445 gene locus_tag LOCUS_00400 gene glnA 45782 44445 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976572.1 protein_id gnl|my_center|LOCUS_00400 47864 45813 gene locus_tag LOCUS_00410 47864 45813 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729965.1 protein_id gnl|my_center|LOCUS_00410 47959 48384 gene locus_tag LOCUS_00420 47959 48384 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224900.1 protein_id gnl|my_center|LOCUS_00420 49453 48437 gene locus_tag LOCUS_00430 49453 48437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 49542 50693 gene locus_tag LOCUS_00440 49542 50693 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727019.1 protein_id gnl|my_center|LOCUS_00440 52016 50709 gene locus_tag LOCUS_00450 52016 50709 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029546.1 protein_id gnl|my_center|LOCUS_00450 52276 53142 gene locus_tag LOCUS_00460 gene panB 52276 53142 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223113.1 protein_id gnl|my_center|LOCUS_00460 53704 53258 gene locus_tag LOCUS_00470 53704 53258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 53821 55323 gene locus_tag LOCUS_00480 53821 55323 CDS product peptidase S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229918.1 protein_id gnl|my_center|LOCUS_00480 55386 56561 gene locus_tag LOCUS_00490 55386 56561 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229955.1 protein_id gnl|my_center|LOCUS_00490 56992 56705 gene locus_tag LOCUS_00500 56992 56705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 57183 56989 gene locus_tag LOCUS_00510 57183 56989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 57263 58069 gene locus_tag LOCUS_00520 gene map 57263 58069 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976546.1 protein_id gnl|my_center|LOCUS_00520 58107 59723 gene locus_tag LOCUS_00530 58107 59723 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104123.1 protein_id gnl|my_center|LOCUS_00530 59717 60649 gene locus_tag LOCUS_00540 59717 60649 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060265.1 protein_id gnl|my_center|LOCUS_00540 60655 61500 gene locus_tag LOCUS_00550 60655 61500 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230919.1 protein_id gnl|my_center|LOCUS_00550 61507 62748 gene locus_tag LOCUS_00560 61507 62748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00560 63316 62738 gene locus_tag LOCUS_00570 63316 62738 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090472.1 protein_id gnl|my_center|LOCUS_00570 63355 63630 gene locus_tag LOCUS_00580 63355 63630 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090473.1 protein_id gnl|my_center|LOCUS_00580 64180 64821 gene locus_tag LOCUS_00590 64180 64821 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035335.1 protein_id gnl|my_center|LOCUS_00590 65710 64814 gene locus_tag LOCUS_00600 65710 64814 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206170.1 protein_id gnl|my_center|LOCUS_00600 66023 65757 gene locus_tag LOCUS_00610 66023 65757 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013354.1 protein_id gnl|my_center|LOCUS_00610 67084 66194 gene locus_tag LOCUS_00620 gene ppk2 67084 66194 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776404.1 protein_id gnl|my_center|LOCUS_00620 67672 67094 gene locus_tag LOCUS_00630 67672 67094 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225897.1 protein_id gnl|my_center|LOCUS_00630 67933 68847 gene locus_tag LOCUS_00640 67933 68847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 68856 69509 gene locus_tag LOCUS_00650 68856 69509 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028884.1 protein_id gnl|my_center|LOCUS_00650 69515 71011 gene locus_tag LOCUS_00660 69515 71011 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228824.1 protein_id gnl|my_center|LOCUS_00660 70978 71586 gene locus_tag LOCUS_00670 70978 71586 CDS product NADAR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166680960.1 protein_id gnl|my_center|LOCUS_00670 72099 72719 gene locus_tag LOCUS_00680 72099 72719 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971839.1 protein_id gnl|my_center|LOCUS_00680 73464 72724 gene locus_tag LOCUS_00690 gene cobM 73464 72724 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228819.1 protein_id gnl|my_center|LOCUS_00690 74675 73461 gene locus_tag LOCUS_00700 74675 73461 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228818.1 protein_id gnl|my_center|LOCUS_00700 74709 75275 gene locus_tag LOCUS_00710 74709 75275 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013557.1 protein_id gnl|my_center|LOCUS_00710 75438 77429 gene locus_tag LOCUS_00720 75438 77429 CDS product putative cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228817.1 protein_id gnl|my_center|LOCUS_00720 77426 78046 gene locus_tag LOCUS_00730 gene bluB 77426 78046 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228822.1 protein_id gnl|my_center|LOCUS_00730 78049 78663 gene locus_tag LOCUS_00740 gene cobO 78049 78663 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893997.1 protein_id gnl|my_center|LOCUS_00740 78660 80021 gene locus_tag LOCUS_00750 78660 80021 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228815.1 protein_id gnl|my_center|LOCUS_00750 80014 81024 gene locus_tag LOCUS_00760 gene cobC 80014 81024 CDS product Rv2231c family pyridoxal phosphate-dependent protein CobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897661.1 protein_id gnl|my_center|LOCUS_00760 81175 81384 gene locus_tag LOCUS_00770 81175 81384 CDS product CbtB-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897491.1 protein_id gnl|my_center|LOCUS_00770 81399 82160 gene locus_tag LOCUS_00780 81399 82160 CDS product CbtA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228806.1 protein_id gnl|my_center|LOCUS_00780 82157 83191 gene locus_tag LOCUS_00790 gene cobT 82157 83191 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228810.1 protein_id gnl|my_center|LOCUS_00790 83188 83898 gene locus_tag LOCUS_00800 83188 83898 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228811.1 protein_id gnl|my_center|LOCUS_00800 84410 83895 gene locus_tag LOCUS_00810 84410 83895 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899876.1 protein_id gnl|my_center|LOCUS_00810 84413 85327 gene locus_tag LOCUS_00820 84413 85327 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028006.1 protein_id gnl|my_center|LOCUS_00820 86006 85221 gene locus_tag LOCUS_00830 86006 85221 CDS product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228821.1 protein_id gnl|my_center|LOCUS_00830 87394 86009 gene locus_tag LOCUS_00840 87394 86009 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899877.1 protein_id gnl|my_center|LOCUS_00840 88403 87630 gene locus_tag LOCUS_00850 gene cobF 88403 87630 CDS product precorrin-6A synthase (deacetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267684.1 protein_id gnl|my_center|LOCUS_00850 92007 88405 gene locus_tag LOCUS_00860 gene cobN 92007 88405 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228832.1 protein_id gnl|my_center|LOCUS_00860 93253 92327 gene locus_tag LOCUS_00870 93253 92327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 94244 93687 gene locus_tag LOCUS_00880 94244 93687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 95005 94649 gene locus_tag LOCUS_00890 95005 94649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224779.1 protein_id gnl|my_center|LOCUS_00890 95550 95002 gene locus_tag LOCUS_00900 95550 95002 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484893.1 protein_id gnl|my_center|LOCUS_00900 95618 96277 gene locus_tag LOCUS_00910 95618 96277 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886771.1 protein_id gnl|my_center|LOCUS_00910 96822 96214 gene locus_tag LOCUS_00920 96822 96214 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027474.1 protein_id gnl|my_center|LOCUS_00920 96962 97441 gene locus_tag LOCUS_00930 96962 97441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 97904 97512 gene locus_tag LOCUS_00940 97904 97512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 100399 98000 gene locus_tag LOCUS_00950 gene ppsA 100399 98000 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222834.1 protein_id gnl|my_center|LOCUS_00950 101286 100396 gene locus_tag LOCUS_00960 101286 100396 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947257.1 protein_id gnl|my_center|LOCUS_00960 101665 101450 gene locus_tag LOCUS_00970 101665 101450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 101547 102761 gene locus_tag LOCUS_00980 101547 102761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 102908 104176 gene locus_tag LOCUS_00990 102908 104176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00990 104197 104799 gene locus_tag LOCUS_01000 104197 104799 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031718.1 protein_id gnl|my_center|LOCUS_01000 104811 105278 gene locus_tag LOCUS_01010 104811 105278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 106735 105275 gene locus_tag LOCUS_01020 106735 105275 CDS product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223097.1 protein_id gnl|my_center|LOCUS_01020 106754 107533 gene locus_tag LOCUS_01030 gene yaaA 106754 107533 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976516.1 protein_id gnl|my_center|LOCUS_01030 109597 107777 gene locus_tag LOCUS_01040 109597 107777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 109812 111002 gene locus_tag LOCUS_01050 109812 111002 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082424.1 protein_id gnl|my_center|LOCUS_01050 111007 112218 gene locus_tag LOCUS_01060 111007 112218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 113720 112563 gene locus_tag LOCUS_01070 113720 112563 CDS product bifunctional RNase H/acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729720.1 protein_id gnl|my_center|LOCUS_01070 114466 113723 gene locus_tag LOCUS_01080 114466 113723 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028262.1 protein_id gnl|my_center|LOCUS_01080 115649 114522 gene locus_tag LOCUS_01090 115649 114522 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110434.1 protein_id gnl|my_center|LOCUS_01090 117495 115930 gene locus_tag LOCUS_01100 117495 115930 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229396.1 protein_id gnl|my_center|LOCUS_01100 118048 117632 gene locus_tag LOCUS_01110 118048 117632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 119442 118045 gene locus_tag LOCUS_01120 119442 118045 CDS product DUF4331 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929156.1 protein_id gnl|my_center|LOCUS_01120 119692 119444 gene locus_tag LOCUS_01130 119692 119444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 119902 119976 gene locus_tag LOCUS_t00010 119902 119976 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 120758 120294 gene locus_tag LOCUS_01140 120758 120294 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976435.1 protein_id gnl|my_center|LOCUS_01140 122431 120755 gene locus_tag LOCUS_01150 122431 120755 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224962.1 protein_id gnl|my_center|LOCUS_01150 122911 122468 gene locus_tag LOCUS_01160 122911 122468 CDS product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060606.1 protein_id gnl|my_center|LOCUS_01160 123198 125945 gene locus_tag LOCUS_01170 gene aceE 123198 125945 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976432.1 protein_id gnl|my_center|LOCUS_01170 127139 126174 gene locus_tag LOCUS_01180 127139 126174 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900558.1 protein_id gnl|my_center|LOCUS_01180 127365 128582 gene locus_tag LOCUS_01190 gene fasR 127365 128582 CDS product fatty acid biosynthesis transcriptional regulator FasR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028321.1 protein_id gnl|my_center|LOCUS_01190 128635 129858 gene locus_tag LOCUS_01200 128635 129858 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028322.1 protein_id gnl|my_center|LOCUS_01200 129855 130862 gene locus_tag LOCUS_01210 129855 130862 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976418.1 protein_id gnl|my_center|LOCUS_01210 130938 131183 gene locus_tag LOCUS_01220 130938 131183 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976417.1 protein_id gnl|my_center|LOCUS_01220 131183 132433 gene locus_tag LOCUS_01230 131183 132433 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028323.1 protein_id gnl|my_center|LOCUS_01230 132453 133886 gene locus_tag LOCUS_01240 132453 133886 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729738.1 protein_id gnl|my_center|LOCUS_01240 134002 134436 gene locus_tag LOCUS_01250 134002 134436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 134972 134448 gene locus_tag LOCUS_01260 134972 134448 CDS product DUF3145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976415.1 protein_id gnl|my_center|LOCUS_01260 136013 135078 gene locus_tag LOCUS_01270 136013 135078 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406215.1 protein_id gnl|my_center|LOCUS_01270 136068 136577 gene locus_tag LOCUS_01280 136068 136577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 137533 136598 gene locus_tag LOCUS_01290 137533 136598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 >Feature sequence02 1115 888 gene locus_tag LOCUS_01300 1115 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 1335 1751 gene locus_tag LOCUS_01310 1335 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 1775 2383 gene locus_tag LOCUS_01320 1775 2383 CDS product maleylpyruvate isomerase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730704.1 protein_id gnl|my_center|LOCUS_01320 3100 2399 gene locus_tag LOCUS_01330 3100 2399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 3268 3744 gene locus_tag LOCUS_01340 3268 3744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 3947 3660 gene locus_tag LOCUS_01350 3947 3660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 3946 5961 gene locus_tag LOCUS_01360 3946 5961 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726765.1 protein_id gnl|my_center|LOCUS_01360 5972 6283 gene locus_tag LOCUS_01370 5972 6283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 6539 8209 gene locus_tag LOCUS_01380 6539 8209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 8235 8744 gene locus_tag LOCUS_01390 8235 8744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229818.1 protein_id gnl|my_center|LOCUS_01390 8946 8764 gene locus_tag LOCUS_01400 8946 8764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 9214 9026 gene locus_tag LOCUS_01410 9214 9026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 9437 11560 gene locus_tag LOCUS_01420 9437 11560 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228470.1 protein_id gnl|my_center|LOCUS_01420 11574 11915 gene locus_tag LOCUS_01430 11574 11915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 11890 12399 gene locus_tag LOCUS_01440 11890 12399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 12409 13284 gene locus_tag LOCUS_01450 12409 13284 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222172.1 protein_id gnl|my_center|LOCUS_01450 13370 14413 gene locus_tag LOCUS_01460 13370 14413 CDS product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727034.1 protein_id gnl|my_center|LOCUS_01460 14850 14422 gene locus_tag LOCUS_01470 14850 14422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 15008 17704 gene locus_tag LOCUS_01480 15008 17704 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030777.1 protein_id gnl|my_center|LOCUS_01480 17793 18422 gene locus_tag LOCUS_01490 17793 18422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 19127 18519 gene locus_tag LOCUS_01500 19127 18519 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283977.1 protein_id gnl|my_center|LOCUS_01500 20673 19147 gene locus_tag LOCUS_01510 20673 19147 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811563.1 protein_id gnl|my_center|LOCUS_01510 20773 21447 gene locus_tag LOCUS_01520 20773 21447 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225458.1 protein_id gnl|my_center|LOCUS_01520 21467 22987 gene locus_tag LOCUS_01530 21467 22987 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229661.1 protein_id gnl|my_center|LOCUS_01530 22987 24849 gene locus_tag LOCUS_01540 22987 24849 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229660.1 protein_id gnl|my_center|LOCUS_01540 24846 25778 gene locus_tag LOCUS_01550 24846 25778 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028581.1 protein_id gnl|my_center|LOCUS_01550 26295 25825 gene locus_tag LOCUS_01560 26295 25825 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727792.1 protein_id gnl|my_center|LOCUS_01560 27592 26558 gene locus_tag LOCUS_01570 27592 26558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 27728 28588 gene locus_tag LOCUS_01580 27728 28588 CDS product DUF1524 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390253.1 protein_id gnl|my_center|LOCUS_01580 28812 28540 gene locus_tag LOCUS_01590 28812 28540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 29177 30388 gene locus_tag LOCUS_01600 gene fdhA 29177 30388 CDS product formaldehyde dehydrogenase, glutathione-independent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118811.1 protein_id gnl|my_center|LOCUS_01600 30523 30987 gene locus_tag LOCUS_01610 30523 30987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 31822 31202 gene locus_tag LOCUS_01620 31822 31202 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257831.1 protein_id gnl|my_center|LOCUS_01620 31937 32010 gene locus_tag LOCUS_t00020 31937 32010 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 32056 32457 gene locus_tag LOCUS_01630 32056 32457 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893728.1 protein_id gnl|my_center|LOCUS_01630 32726 32463 gene locus_tag LOCUS_01640 32726 32463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 33262 32723 gene locus_tag LOCUS_01650 33262 32723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 33307 35871 gene locus_tag LOCUS_01660 33307 35871 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728610.1 protein_id gnl|my_center|LOCUS_01660 35871 36332 gene locus_tag LOCUS_01670 35871 36332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 36441 38585 gene locus_tag LOCUS_01680 36441 38585 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003902404.1 protein_id gnl|my_center|LOCUS_01680 38680 38592 gene locus_tag LOCUS_t00030 38680 38592 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 39876 38764 gene locus_tag LOCUS_01690 39876 38764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 39921 41006 gene locus_tag LOCUS_01700 39921 41006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 41041 42135 gene locus_tag LOCUS_01710 41041 42135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 42132 43406 gene locus_tag LOCUS_01720 42132 43406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 44059 43367 gene locus_tag LOCUS_01730 44059 43367 CDS product EcsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129999477.1 protein_id gnl|my_center|LOCUS_01730 44125 44817 gene locus_tag LOCUS_01740 gene aat 44125 44817 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938894.1 protein_id gnl|my_center|LOCUS_01740 44825 45298 gene locus_tag LOCUS_01750 44825 45298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 45658 45326 gene locus_tag LOCUS_01760 45658 45326 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897834.1 protein_id gnl|my_center|LOCUS_01760 46311 45655 gene locus_tag LOCUS_01770 46311 45655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 46439 46744 gene locus_tag LOCUS_01780 46439 46744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 47132 47593 gene locus_tag LOCUS_01790 47132 47593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 47790 48497 gene locus_tag LOCUS_01800 47790 48497 CDS product DUF4396 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227530.1 protein_id gnl|my_center|LOCUS_01800 49672 48767 gene locus_tag LOCUS_01810 49672 48767 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027460.1 protein_id gnl|my_center|LOCUS_01810 49695 49949 gene locus_tag LOCUS_01820 49695 49949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 49985 50764 gene locus_tag LOCUS_01830 49985 50764 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974967.1 protein_id gnl|my_center|LOCUS_01830 50776 51711 gene locus_tag LOCUS_01840 50776 51711 CDS product DUF5926 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974969.1 protein_id gnl|my_center|LOCUS_01840 52427 51732 gene locus_tag LOCUS_01850 52427 51732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 53353 52424 gene locus_tag LOCUS_01860 53353 52424 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119394.1 protein_id gnl|my_center|LOCUS_01860 54269 53388 gene locus_tag LOCUS_01870 54269 53388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01870 54754 54377 gene locus_tag LOCUS_01880 54754 54377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 56038 54878 gene locus_tag LOCUS_01890 gene arcA 56038 54878 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082883.1 protein_id gnl|my_center|LOCUS_01890 56257 56658 gene locus_tag LOCUS_01900 56257 56658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 57236 56682 gene locus_tag LOCUS_01910 57236 56682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 57439 59172 gene locus_tag LOCUS_01920 57439 59172 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142816.1 protein_id gnl|my_center|LOCUS_01920 59874 59182 gene locus_tag LOCUS_01930 59874 59182 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973149.1 protein_id gnl|my_center|LOCUS_01930 62417 59871 gene locus_tag LOCUS_01940 62417 59871 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030507.1 protein_id gnl|my_center|LOCUS_01940 63050 62433 gene locus_tag LOCUS_01950 63050 62433 CDS product potassium-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223787.1 protein_id gnl|my_center|LOCUS_01950 65058 63064 gene locus_tag LOCUS_01960 gene kdpB 65058 63064 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029187.1 protein_id gnl|my_center|LOCUS_01960 66728 65055 gene locus_tag LOCUS_01970 gene kdpA 66728 65055 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029188.1 protein_id gnl|my_center|LOCUS_01970 67026 67778 gene locus_tag LOCUS_01980 67026 67778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 68725 67823 gene locus_tag LOCUS_01990 68725 67823 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256667.1 protein_id gnl|my_center|LOCUS_01990 69128 68730 gene locus_tag LOCUS_02000 69128 68730 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965285.1 protein_id gnl|my_center|LOCUS_02000 70827 69160 gene locus_tag LOCUS_02010 70827 69160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 70952 72217 gene locus_tag LOCUS_02020 gene serS 70952 72217 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974982.1 protein_id gnl|my_center|LOCUS_02020 72214 73083 gene locus_tag LOCUS_02030 72214 73083 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804321.1 protein_id gnl|my_center|LOCUS_02030 73080 73604 gene locus_tag LOCUS_02040 73080 73604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 73612 74400 gene locus_tag LOCUS_02050 73612 74400 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974993.1 protein_id gnl|my_center|LOCUS_02050 74400 75137 gene locus_tag LOCUS_02060 74400 75137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 75816 75157 gene locus_tag LOCUS_02070 75816 75157 CDS product bacterial proteasome activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975113.1 protein_id gnl|my_center|LOCUS_02070 76865 75888 gene locus_tag LOCUS_02080 76865 75888 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975111.1 protein_id gnl|my_center|LOCUS_02080 77200 76862 gene locus_tag LOCUS_02090 77200 76862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 77853 77260 gene locus_tag LOCUS_02100 77853 77260 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226782.1 protein_id gnl|my_center|LOCUS_02100 77891 78670 gene locus_tag LOCUS_02110 77891 78670 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894754.1 protein_id gnl|my_center|LOCUS_02110 78682 79827 gene locus_tag LOCUS_02120 78682 79827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 79894 80124 gene locus_tag LOCUS_02130 79894 80124 CDS product biotin/lipoyl-binding carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416887.1 protein_id gnl|my_center|LOCUS_02130 80230 80145 gene locus_tag LOCUS_t00040 80230 80145 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 80746 80309 gene locus_tag LOCUS_02140 80746 80309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 80789 81247 gene locus_tag LOCUS_02150 80789 81247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 81337 81429 gene locus_tag LOCUS_t00050 81337 81429 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 81591 82913 gene locus_tag LOCUS_02160 81591 82913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 83139 83291 gene locus_tag LOCUS_02170 83139 83291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 84315 83311 gene locus_tag LOCUS_02180 84315 83311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 86282 84429 gene locus_tag LOCUS_02190 86282 84429 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230959.1 protein_id gnl|my_center|LOCUS_02190 86534 86607 gene locus_tag LOCUS_t00060 86534 86607 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 87053 88030 gene locus_tag LOCUS_02200 87053 88030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 89057 88188 gene locus_tag LOCUS_02210 89057 88188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 >Feature sequence03 890 381 gene locus_tag LOCUS_02220 890 381 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148616155.1 protein_id gnl|my_center|LOCUS_02220 2136 898 gene locus_tag LOCUS_02230 2136 898 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532846.1 protein_id gnl|my_center|LOCUS_02230 2731 2123 gene locus_tag LOCUS_02240 2731 2123 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003015443.1 protein_id gnl|my_center|LOCUS_02240 2874 4256 gene locus_tag LOCUS_02250 gene gabT 2874 4256 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892002.1 protein_id gnl|my_center|LOCUS_02250 4360 5862 gene locus_tag LOCUS_02260 4360 5862 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742166.1 protein_id gnl|my_center|LOCUS_02260 6110 6730 gene locus_tag LOCUS_02270 6110 6730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 7291 7581 gene locus_tag LOCUS_02280 7291 7581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 7657 10089 gene locus_tag LOCUS_02290 7657 10089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 10660 10091 gene locus_tag LOCUS_02300 10660 10091 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140910.1 protein_id gnl|my_center|LOCUS_02300 10759 11724 gene locus_tag LOCUS_02310 10759 11724 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730373.1 protein_id gnl|my_center|LOCUS_02310 11808 12437 gene locus_tag LOCUS_02320 11808 12437 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226185.1 protein_id gnl|my_center|LOCUS_02320 13176 12535 gene locus_tag LOCUS_02330 13176 12535 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819086.1 protein_id gnl|my_center|LOCUS_02330 13829 13173 gene locus_tag LOCUS_02340 13829 13173 CDS product 3-oxoacid CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929696.1 protein_id gnl|my_center|LOCUS_02340 15019 13832 gene locus_tag LOCUS_02350 15019 13832 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223752.1 protein_id gnl|my_center|LOCUS_02350 15702 15067 gene locus_tag LOCUS_02360 15702 15067 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529947.1 protein_id gnl|my_center|LOCUS_02360 15777 16745 gene locus_tag LOCUS_02370 15777 16745 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931027.1 protein_id gnl|my_center|LOCUS_02370 16912 17154 gene locus_tag LOCUS_02380 16912 17154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 17293 17562 gene locus_tag LOCUS_02390 17293 17562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 18864 18076 gene locus_tag LOCUS_02400 18864 18076 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899614.1 protein_id gnl|my_center|LOCUS_02400 19355 18864 gene locus_tag LOCUS_02410 19355 18864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 19611 19537 gene locus_tag LOCUS_t00070 19611 19537 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 19901 19710 gene locus_tag LOCUS_02420 19901 19710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 19966 20892 gene locus_tag LOCUS_02430 gene cynR 19966 20892 CDS product transcriptional regulator CynR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000952476.1 protein_id gnl|my_center|LOCUS_02430 20939 22018 gene locus_tag LOCUS_02440 20939 22018 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226781.1 protein_id gnl|my_center|LOCUS_02440 22015 22956 gene locus_tag LOCUS_02450 22015 22956 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728848.1 protein_id gnl|my_center|LOCUS_02450 22953 23942 gene locus_tag LOCUS_02460 22953 23942 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226779.1 protein_id gnl|my_center|LOCUS_02460 24563 23967 gene locus_tag LOCUS_02470 24563 23967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 26228 24636 gene locus_tag LOCUS_02480 26228 24636 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975395.1 protein_id gnl|my_center|LOCUS_02480 27460 26486 gene locus_tag LOCUS_02490 27460 26486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 28701 27556 gene locus_tag LOCUS_02500 28701 27556 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975394.1 protein_id gnl|my_center|LOCUS_02500 29455 28772 gene locus_tag LOCUS_02510 29455 28772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02510 32301 29566 gene locus_tag LOCUS_02520 gene topA 32301 29566 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029075.1 protein_id gnl|my_center|LOCUS_02520 32692 33096 gene locus_tag LOCUS_02530 32692 33096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 33114 33368 gene locus_tag LOCUS_02540 33114 33368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 33515 33760 gene locus_tag LOCUS_02550 33515 33760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02550 34253 33792 gene locus_tag LOCUS_02560 34253 33792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 35028 34276 gene locus_tag LOCUS_02570 35028 34276 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528424.1 protein_id gnl|my_center|LOCUS_02570 36547 35066 gene locus_tag LOCUS_02580 36547 35066 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975390.1 protein_id gnl|my_center|LOCUS_02580 36605 37603 gene locus_tag LOCUS_02590 36605 37603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 38425 37604 gene locus_tag LOCUS_02600 38425 37604 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804593.1 protein_id gnl|my_center|LOCUS_02600 40814 38493 gene locus_tag LOCUS_02610 40814 38493 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449634.1 protein_id gnl|my_center|LOCUS_02610 41371 41033 gene locus_tag LOCUS_02620 gene bldG 41371 41033 CDS product anti-sigma factor antagonist BldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975386.1 protein_id gnl|my_center|LOCUS_02620 41547 43943 gene locus_tag LOCUS_02630 41547 43943 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485160.1 protein_id gnl|my_center|LOCUS_02630 43953 44252 gene locus_tag LOCUS_02640 43953 44252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 44631 44272 gene locus_tag LOCUS_02650 44631 44272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 44993 44628 gene locus_tag LOCUS_02660 44993 44628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 45187 44990 gene locus_tag LOCUS_02670 45187 44990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 46056 45331 gene locus_tag LOCUS_02680 46056 45331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 46856 46053 gene locus_tag LOCUS_02690 46856 46053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 48019 46853 gene locus_tag LOCUS_02700 48019 46853 CDS product TadA family conjugal transfer-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897599.1 protein_id gnl|my_center|LOCUS_02700 49119 48016 gene locus_tag LOCUS_02710 49119 48016 CDS product septum site determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223396159.1 protein_id gnl|my_center|LOCUS_02710 49305 50102 gene locus_tag LOCUS_02720 49305 50102 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270110.1 protein_id gnl|my_center|LOCUS_02720 50192 50695 gene locus_tag LOCUS_02730 50192 50695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 50698 52059 gene locus_tag LOCUS_02740 50698 52059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777107.1 protein_id gnl|my_center|LOCUS_02740 52076 52432 gene locus_tag LOCUS_02750 52076 52432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 53219 52686 gene locus_tag LOCUS_02760 53219 52686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 53284 53664 gene locus_tag LOCUS_02770 53284 53664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 54389 53661 gene locus_tag LOCUS_02780 54389 53661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296309.1 protein_id gnl|my_center|LOCUS_02780 54490 55383 gene locus_tag LOCUS_02790 54490 55383 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417461.1 protein_id gnl|my_center|LOCUS_02790 55447 56574 gene locus_tag LOCUS_02800 55447 56574 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037667486.1 protein_id gnl|my_center|LOCUS_02800 56571 57323 gene locus_tag LOCUS_02810 56571 57323 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977611.1 protein_id gnl|my_center|LOCUS_02810 57408 57788 gene locus_tag LOCUS_02820 57408 57788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 57796 59304 gene locus_tag LOCUS_02830 57796 59304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 60103 59324 gene locus_tag LOCUS_02840 60103 59324 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080998.1 protein_id gnl|my_center|LOCUS_02840 61233 60100 gene locus_tag LOCUS_02850 61233 60100 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223031.1 protein_id gnl|my_center|LOCUS_02850 61708 61358 gene locus_tag LOCUS_02860 gene nirD 61708 61358 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223030.1 protein_id gnl|my_center|LOCUS_02860 64272 61705 gene locus_tag LOCUS_02870 gene nirB 64272 61705 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223029.1 protein_id gnl|my_center|LOCUS_02870 65726 64269 gene locus_tag LOCUS_02880 65726 64269 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223027.1 protein_id gnl|my_center|LOCUS_02880 67771 65723 gene locus_tag LOCUS_02890 67771 65723 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223026.1 protein_id gnl|my_center|LOCUS_02890 69296 67782 gene locus_tag LOCUS_02900 69296 67782 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085590.1 protein_id gnl|my_center|LOCUS_02900 69441 70442 gene locus_tag LOCUS_02910 69441 70442 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089460.1 protein_id gnl|my_center|LOCUS_02910 70912 70439 gene locus_tag LOCUS_02920 70912 70439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 71542 70952 gene locus_tag LOCUS_02930 71542 70952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 71633 71983 gene locus_tag LOCUS_02940 71633 71983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 72013 73506 gene locus_tag LOCUS_02950 72013 73506 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728196.1 protein_id gnl|my_center|LOCUS_02950 73648 74460 gene locus_tag LOCUS_02960 73648 74460 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729274.1 protein_id gnl|my_center|LOCUS_02960 76070 74637 gene locus_tag LOCUS_02970 76070 74637 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029246.1 protein_id gnl|my_center|LOCUS_02970 77063 76074 gene locus_tag LOCUS_02980 77063 76074 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230924.1 protein_id gnl|my_center|LOCUS_02980 78225 77065 gene locus_tag LOCUS_02990 gene pdhA 78225 77065 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230923.1 protein_id gnl|my_center|LOCUS_02990 78401 78883 gene locus_tag LOCUS_03000 78401 78883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 79082 79690 gene locus_tag LOCUS_03010 79082 79690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 79692 80123 gene locus_tag LOCUS_03020 79692 80123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 80187 80399 gene locus_tag LOCUS_03030 80187 80399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 80455 81054 gene locus_tag LOCUS_03040 80455 81054 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704818.1 protein_id gnl|my_center|LOCUS_03040 81399 81067 gene locus_tag LOCUS_03050 81399 81067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 >Feature sequence04 263 1261 gene locus_tag LOCUS_03060 263 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03060 1258 1806 gene locus_tag LOCUS_03070 1258 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03070 1858 3135 gene locus_tag LOCUS_03080 1858 3135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 4099 3101 gene locus_tag LOCUS_03090 4099 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 4188 5384 gene locus_tag LOCUS_03100 4188 5384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 6129 5458 gene locus_tag LOCUS_03110 6129 5458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 6746 6240 gene locus_tag LOCUS_03120 6746 6240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 6884 7396 gene locus_tag LOCUS_03130 6884 7396 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026920.1 protein_id gnl|my_center|LOCUS_03130 7393 9135 gene locus_tag LOCUS_03140 7393 9135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03140 9132 9659 gene locus_tag LOCUS_03150 9132 9659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03150 10198 9647 gene locus_tag LOCUS_03160 10198 9647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 10400 11548 gene locus_tag LOCUS_03170 10400 11548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 13860 12937 gene locus_tag LOCUS_03180 13860 12937 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148616319.1 protein_id gnl|my_center|LOCUS_03180 14183 14824 gene locus_tag LOCUS_03190 14183 14824 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029248.1 protein_id gnl|my_center|LOCUS_03190 14967 15572 gene locus_tag LOCUS_03200 14967 15572 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227281.1 protein_id gnl|my_center|LOCUS_03200 15889 15581 gene locus_tag LOCUS_03210 15889 15581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 16058 17035 gene locus_tag LOCUS_03220 gene adhP 16058 17035 CDS product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258663.1 protein_id gnl|my_center|LOCUS_03220 17089 17739 gene locus_tag LOCUS_03230 17089 17739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 18330 17788 gene locus_tag LOCUS_03240 18330 17788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03240 18783 18373 gene locus_tag LOCUS_03250 18783 18373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03250 19026 20201 gene locus_tag LOCUS_03260 19026 20201 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056143.1 protein_id gnl|my_center|LOCUS_03260 20326 21375 gene locus_tag LOCUS_03270 20326 21375 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978698.1 protein_id gnl|my_center|LOCUS_03270 21379 22947 gene locus_tag LOCUS_03280 21379 22947 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026894.1 protein_id gnl|my_center|LOCUS_03280 23497 22976 gene locus_tag LOCUS_03290 23497 22976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 23996 23559 gene locus_tag LOCUS_03300 23996 23559 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015196.1 protein_id gnl|my_center|LOCUS_03300 24571 23996 gene locus_tag LOCUS_03310 24571 23996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 24942 24787 gene locus_tag LOCUS_03320 24942 24787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03320 25755 25045 gene locus_tag LOCUS_03330 25755 25045 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029248.1 protein_id gnl|my_center|LOCUS_03330 26020 27021 gene locus_tag LOCUS_03340 26020 27021 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729429.1 protein_id gnl|my_center|LOCUS_03340 27160 27804 gene locus_tag LOCUS_03350 27160 27804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 28053 27838 gene locus_tag LOCUS_03360 28053 27838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 29205 28186 gene locus_tag LOCUS_03370 29205 28186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 29204 30088 gene locus_tag LOCUS_03380 29204 30088 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410060.1 protein_id gnl|my_center|LOCUS_03380 30090 31817 gene locus_tag LOCUS_03390 30090 31817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 31817 32326 gene locus_tag LOCUS_03400 31817 32326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 32812 32387 gene locus_tag LOCUS_03410 32812 32387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 33334 32900 gene locus_tag LOCUS_03420 33334 32900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 33808 34527 gene locus_tag LOCUS_03430 33808 34527 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326297.1 protein_id gnl|my_center|LOCUS_03430 34524 35870 gene locus_tag LOCUS_03440 34524 35870 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976000.1 protein_id gnl|my_center|LOCUS_03440 35992 36273 gene locus_tag LOCUS_03450 35992 36273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 36270 37220 gene locus_tag LOCUS_03460 36270 37220 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227736.1 protein_id gnl|my_center|LOCUS_03460 37217 37849 gene locus_tag LOCUS_03470 37217 37849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 37852 39120 gene locus_tag LOCUS_03480 37852 39120 CDS product NADH-quinone oxidoreductase subunit NuoF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326195.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03480 39117 39323 gene locus_tag LOCUS_03490 39117 39323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03490 39427 39846 gene locus_tag LOCUS_03500 39427 39846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 41442 40201 gene locus_tag LOCUS_03510 41442 40201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 42916 41591 gene locus_tag LOCUS_03520 42916 41591 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062145949.1 protein_id gnl|my_center|LOCUS_03520 43731 42979 gene locus_tag LOCUS_03530 43731 42979 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086558972.1 protein_id gnl|my_center|LOCUS_03530 45529 43826 gene locus_tag LOCUS_03540 45529 43826 CDS product two-component system sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026923.1 protein_id gnl|my_center|LOCUS_03540 46243 45560 gene locus_tag LOCUS_03550 46243 45560 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029248.1 protein_id gnl|my_center|LOCUS_03550 47060 46587 gene locus_tag LOCUS_03560 47060 46587 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222673.1 protein_id gnl|my_center|LOCUS_03560 47830 47057 gene locus_tag LOCUS_03570 47830 47057 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112715.1 protein_id gnl|my_center|LOCUS_03570 47811 48566 gene locus_tag LOCUS_03580 47811 48566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 49741 48557 gene locus_tag LOCUS_03590 49741 48557 CDS product ArsO family NAD(P)H-dependent flavin-containing monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043376805.1 protein_id gnl|my_center|LOCUS_03590 49968 50210 gene locus_tag LOCUS_03600 49968 50210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 50587 50402 gene locus_tag LOCUS_03610 50587 50402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 50820 51233 gene locus_tag LOCUS_03620 50820 51233 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895387.1 protein_id gnl|my_center|LOCUS_03620 52383 51313 gene locus_tag LOCUS_03630 52383 51313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 53620 52394 gene locus_tag LOCUS_03640 53620 52394 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899401.1 protein_id gnl|my_center|LOCUS_03640 53826 54710 gene locus_tag LOCUS_03650 53826 54710 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227298.1 protein_id gnl|my_center|LOCUS_03650 55284 54754 gene locus_tag LOCUS_03660 55284 54754 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943062.1 protein_id gnl|my_center|LOCUS_03660 55631 55317 gene locus_tag LOCUS_03670 55631 55317 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393134.1 protein_id gnl|my_center|LOCUS_03670 56911 55628 gene locus_tag LOCUS_03680 56911 55628 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461847.1 protein_id gnl|my_center|LOCUS_03680 57165 59345 gene locus_tag LOCUS_03690 57165 59345 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031731.1 protein_id gnl|my_center|LOCUS_03690 60424 59630 gene locus_tag LOCUS_03700 60424 59630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 61188 60421 gene locus_tag LOCUS_03710 61188 60421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 62333 61365 gene locus_tag LOCUS_03720 62333 61365 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225050.1 protein_id gnl|my_center|LOCUS_03720 63647 62472 gene locus_tag LOCUS_03730 63647 62472 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975333.1 protein_id gnl|my_center|LOCUS_03730 64642 63752 gene locus_tag LOCUS_03740 64642 63752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 64835 66214 gene locus_tag LOCUS_03750 64835 66214 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889602.1 protein_id gnl|my_center|LOCUS_03750 66851 66222 gene locus_tag LOCUS_03760 66851 66222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115937.1 protein_id gnl|my_center|LOCUS_03760 67757 66996 gene locus_tag LOCUS_03770 67757 66996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 >Feature sequence05 188 601 gene locus_tag LOCUS_03780 188 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 771 2015 gene locus_tag LOCUS_03790 771 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 3669 2815 gene locus_tag LOCUS_03800 3669 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03800 4842 3964 gene locus_tag LOCUS_03810 4842 3964 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226941.1 protein_id gnl|my_center|LOCUS_03810 4955 5680 gene locus_tag LOCUS_03820 4955 5680 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027419.1 protein_id gnl|my_center|LOCUS_03820 7113 5650 gene locus_tag LOCUS_03830 7113 5650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 7654 7154 gene locus_tag LOCUS_03840 7654 7154 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226147.1 protein_id gnl|my_center|LOCUS_03840 8784 7795 gene locus_tag LOCUS_03850 8784 7795 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209763.1 protein_id gnl|my_center|LOCUS_03850 9282 8878 gene locus_tag LOCUS_03860 9282 8878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 9989 9402 gene locus_tag LOCUS_03870 9989 9402 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974105.1 protein_id gnl|my_center|LOCUS_03870 10671 9982 gene locus_tag LOCUS_03880 10671 9982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 11682 10807 gene locus_tag LOCUS_03890 11682 10807 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225309.1 protein_id gnl|my_center|LOCUS_03890 11765 12508 gene locus_tag LOCUS_03900 11765 12508 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226429.1 protein_id gnl|my_center|LOCUS_03900 12611 12817 gene locus_tag LOCUS_03910 12611 12817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 15016 12854 gene locus_tag LOCUS_03920 15016 12854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 15806 15171 gene locus_tag LOCUS_03930 15806 15171 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224283.1 protein_id gnl|my_center|LOCUS_03930 17268 15811 gene locus_tag LOCUS_03940 17268 15811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 17380 17697 gene locus_tag LOCUS_03950 17380 17697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 17706 18242 gene locus_tag LOCUS_03960 17706 18242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 18322 18732 gene locus_tag LOCUS_03970 18322 18732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 18772 19680 gene locus_tag LOCUS_03980 18772 19680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 19747 20964 gene locus_tag LOCUS_03990 19747 20964 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896567.1 protein_id gnl|my_center|LOCUS_03990 20984 22351 gene locus_tag LOCUS_04000 20984 22351 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730270.1 protein_id gnl|my_center|LOCUS_04000 22918 24012 gene locus_tag LOCUS_04010 22918 24012 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225984036.1 protein_id gnl|my_center|LOCUS_04010 24119 25324 gene locus_tag LOCUS_04020 24119 25324 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729017.1 protein_id gnl|my_center|LOCUS_04020 26353 25388 gene locus_tag LOCUS_04030 26353 25388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 26454 27377 gene locus_tag LOCUS_04040 26454 27377 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228627.1 protein_id gnl|my_center|LOCUS_04040 27370 28404 gene locus_tag LOCUS_04050 27370 28404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 29209 28409 gene locus_tag LOCUS_04060 29209 28409 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078164.1 protein_id gnl|my_center|LOCUS_04060 29525 31357 gene locus_tag LOCUS_04070 29525 31357 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973998.1 protein_id gnl|my_center|LOCUS_04070 31527 34625 gene locus_tag LOCUS_04080 31527 34625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 34745 36313 gene locus_tag LOCUS_04090 34745 36313 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922023.1 protein_id gnl|my_center|LOCUS_04090 36318 37097 gene locus_tag LOCUS_04100 36318 37097 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256896.1 protein_id gnl|my_center|LOCUS_04100 37158 38012 gene locus_tag LOCUS_04110 37158 38012 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529223.1 protein_id gnl|my_center|LOCUS_04110 39326 38043 gene locus_tag LOCUS_04120 39326 38043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 40510 39392 gene locus_tag LOCUS_04130 40510 39392 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228044.1 protein_id gnl|my_center|LOCUS_04130 41418 40507 gene locus_tag LOCUS_04140 41418 40507 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391255.1 protein_id gnl|my_center|LOCUS_04140 43205 41415 gene locus_tag LOCUS_04150 43205 41415 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039705.1 protein_id gnl|my_center|LOCUS_04150 44107 43325 gene locus_tag LOCUS_04160 44107 43325 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256973.1 protein_id gnl|my_center|LOCUS_04160 44886 44095 gene locus_tag LOCUS_04170 44886 44095 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256968.1 protein_id gnl|my_center|LOCUS_04170 45114 46379 gene locus_tag LOCUS_04180 45114 46379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 46422 47306 gene locus_tag LOCUS_04190 46422 47306 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971490.1 protein_id gnl|my_center|LOCUS_04190 47612 48466 gene locus_tag LOCUS_04200 47612 48466 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975956.1 protein_id gnl|my_center|LOCUS_04200 48463 49617 gene locus_tag LOCUS_04210 48463 49617 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226315.1 protein_id gnl|my_center|LOCUS_04210 51302 49614 gene locus_tag LOCUS_04220 51302 49614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 51568 51299 gene locus_tag LOCUS_04230 51568 51299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 51452 52189 gene locus_tag LOCUS_04240 51452 52189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 53177 52197 gene locus_tag LOCUS_04250 gene egtD 53177 52197 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731156.1 protein_id gnl|my_center|LOCUS_04250 54466 53174 gene locus_tag LOCUS_04260 gene egtB 54466 53174 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812990.1 protein_id gnl|my_center|LOCUS_04260 54632 55510 gene locus_tag LOCUS_04270 54632 55510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 55669 56994 gene locus_tag LOCUS_04280 55669 56994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 57039 57530 gene locus_tag LOCUS_04290 gene tpx 57039 57530 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776224.1 protein_id gnl|my_center|LOCUS_04290 59224 57644 gene locus_tag LOCUS_04300 59224 57644 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225256.1 protein_id gnl|my_center|LOCUS_04300 59344 61653 gene locus_tag LOCUS_04310 59344 61653 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533482.1 protein_id gnl|my_center|LOCUS_04310 61650 62420 gene locus_tag LOCUS_04320 61650 62420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 62480 63484 gene locus_tag LOCUS_04330 62480 63484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 63486 63980 gene locus_tag LOCUS_04340 63486 63980 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897886.1 protein_id gnl|my_center|LOCUS_04340 64047 64460 gene locus_tag LOCUS_04350 64047 64460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 64457 64942 gene locus_tag LOCUS_04360 64457 64942 CDS product PGPGW domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223206.1 protein_id gnl|my_center|LOCUS_04360 65294 65590 gene locus_tag LOCUS_04370 65294 65590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 66253 65696 gene locus_tag LOCUS_04380 66253 65696 CDS product DUF2625 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978775.1 protein_id gnl|my_center|LOCUS_04380 66134 66382 gene locus_tag LOCUS_04390 66134 66382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 >Feature sequence06 1603 395 gene locus_tag LOCUS_04400 1603 395 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055032204.1 protein_id gnl|my_center|LOCUS_04400 1736 3610 gene locus_tag LOCUS_04410 1736 3610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 5451 5251 gene locus_tag LOCUS_04420 5451 5251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 5673 6164 gene locus_tag LOCUS_04430 5673 6164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 6672 14420 gene locus_tag LOCUS_04440 6672 14420 CDS product RHS repeat-associated core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109036422.1 protein_id gnl|my_center|LOCUS_04440 14422 14826 gene locus_tag LOCUS_04450 14422 14826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 16942 16475 gene locus_tag LOCUS_04460 16942 16475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 17923 19446 gene locus_tag LOCUS_04470 17923 19446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 19804 21834 gene locus_tag LOCUS_04480 19804 21834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 21897 22268 gene locus_tag LOCUS_04490 21897 22268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 22879 23232 gene locus_tag LOCUS_04500 22879 23232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 24630 23704 gene locus_tag LOCUS_04510 24630 23704 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226532.1 protein_id gnl|my_center|LOCUS_04510 24847 25587 gene locus_tag LOCUS_04520 24847 25587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 27962 25593 gene locus_tag LOCUS_04530 27962 25593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 28057 28434 gene locus_tag LOCUS_04540 28057 28434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 28444 29883 gene locus_tag LOCUS_04550 28444 29883 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030470.1 protein_id gnl|my_center|LOCUS_04550 29979 30428 gene locus_tag LOCUS_04560 29979 30428 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977090.1 protein_id gnl|my_center|LOCUS_04560 30521 31891 gene locus_tag LOCUS_04570 30521 31891 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405217.1 protein_id gnl|my_center|LOCUS_04570 32086 33075 gene locus_tag LOCUS_04580 32086 33075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 33671 33072 gene locus_tag LOCUS_04590 33671 33072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 35632 33668 gene locus_tag LOCUS_04600 35632 33668 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089263.1 protein_id gnl|my_center|LOCUS_04600 35964 35629 gene locus_tag LOCUS_04610 35964 35629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 36105 36692 gene locus_tag LOCUS_04620 36105 36692 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198059.1 protein_id gnl|my_center|LOCUS_04620 36671 37324 gene locus_tag LOCUS_04630 36671 37324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 37321 37803 gene locus_tag LOCUS_04640 37321 37803 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036604.1 protein_id gnl|my_center|LOCUS_04640 37821 38288 gene locus_tag LOCUS_04650 37821 38288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 39790 38285 gene locus_tag LOCUS_04660 39790 38285 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063688.1 protein_id gnl|my_center|LOCUS_04660 39912 40511 gene locus_tag LOCUS_04670 39912 40511 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027025.1 protein_id gnl|my_center|LOCUS_04670 40538 41926 gene locus_tag LOCUS_04680 40538 41926 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975860.1 protein_id gnl|my_center|LOCUS_04680 42710 41943 gene locus_tag LOCUS_04690 42710 41943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 42791 44257 gene locus_tag LOCUS_04700 42791 44257 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228182.1 protein_id gnl|my_center|LOCUS_04700 44259 44468 gene locus_tag LOCUS_04710 44259 44468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 44486 45067 gene locus_tag LOCUS_04720 44486 45067 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228181.1 protein_id gnl|my_center|LOCUS_04720 45141 46373 gene locus_tag LOCUS_04730 45141 46373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 47208 46357 gene locus_tag LOCUS_04740 47208 46357 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731587.1 protein_id gnl|my_center|LOCUS_04740 47689 47258 gene locus_tag LOCUS_04750 47689 47258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 47789 48763 gene locus_tag LOCUS_04760 47789 48763 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893402.1 protein_id gnl|my_center|LOCUS_04760 48750 49568 gene locus_tag LOCUS_04770 48750 49568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 50971 49547 gene locus_tag LOCUS_04780 50971 49547 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887198.1 protein_id gnl|my_center|LOCUS_04780 51135 52451 gene locus_tag LOCUS_04790 51135 52451 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416051.1 protein_id gnl|my_center|LOCUS_04790 52948 52547 gene locus_tag LOCUS_04800 52948 52547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 53468 53010 gene locus_tag LOCUS_04810 53468 53010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 >Feature sequence07 294 671 gene locus_tag LOCUS_04820 294 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 1767 589 gene locus_tag LOCUS_04830 1767 589 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027979.1 protein_id gnl|my_center|LOCUS_04830 1832 2839 gene locus_tag LOCUS_04840 1832 2839 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027978.1 protein_id gnl|my_center|LOCUS_04840 2850 3026 gene locus_tag LOCUS_04850 2850 3026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 3029 3868 gene locus_tag LOCUS_04860 3029 3868 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027974.1 protein_id gnl|my_center|LOCUS_04860 3865 4830 gene locus_tag LOCUS_04870 3865 4830 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027973.1 protein_id gnl|my_center|LOCUS_04870 4875 6524 gene locus_tag LOCUS_04880 gene recN 4875 6524 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325905.1 protein_id gnl|my_center|LOCUS_04880 6554 8248 gene locus_tag LOCUS_04890 6554 8248 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027968.1 protein_id gnl|my_center|LOCUS_04890 10752 8284 gene locus_tag LOCUS_04900 gene pepN 10752 8284 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228585.1 protein_id gnl|my_center|LOCUS_04900 10843 11424 gene locus_tag LOCUS_04910 10843 11424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 11511 12638 gene locus_tag LOCUS_04920 gene ald 11511 12638 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868159.1 protein_id gnl|my_center|LOCUS_04920 12652 13593 gene locus_tag LOCUS_04930 gene xerD 12652 13593 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729303.1 protein_id gnl|my_center|LOCUS_04930 13622 16237 gene locus_tag LOCUS_04940 13622 16237 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027613.1 protein_id gnl|my_center|LOCUS_04940 16489 17478 gene locus_tag LOCUS_04950 16489 17478 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977053.1 protein_id gnl|my_center|LOCUS_04950 17463 17873 gene locus_tag LOCUS_04960 17463 17873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227803.1 protein_id gnl|my_center|LOCUS_04960 17893 18750 gene locus_tag LOCUS_04970 17893 18750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04970 18747 19445 gene locus_tag LOCUS_04980 gene scpB 18747 19445 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027964.1 protein_id gnl|my_center|LOCUS_04980 19442 20191 gene locus_tag LOCUS_04990 19442 20191 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813203.1 protein_id gnl|my_center|LOCUS_04990 20365 20871 gene locus_tag LOCUS_05000 20365 20871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 21058 22401 gene locus_tag LOCUS_05010 21058 22401 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230185.1 protein_id gnl|my_center|LOCUS_05010 22486 22872 gene locus_tag LOCUS_05020 gene aroH 22486 22872 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977062.1 protein_id gnl|my_center|LOCUS_05020 22884 23564 gene locus_tag LOCUS_05030 gene cmk 22884 23564 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027958.1 protein_id gnl|my_center|LOCUS_05030 23561 24322 gene locus_tag LOCUS_05040 23561 24322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 24319 25704 gene locus_tag LOCUS_05050 gene der 24319 25704 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977066.1 protein_id gnl|my_center|LOCUS_05050 25775 26413 gene locus_tag LOCUS_05060 25775 26413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 26445 27440 gene locus_tag LOCUS_05070 26445 27440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682355.1 protein_id gnl|my_center|LOCUS_05070 27512 28195 gene locus_tag LOCUS_05080 27512 28195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229209.1 protein_id gnl|my_center|LOCUS_05080 28192 29772 gene locus_tag LOCUS_05090 28192 29772 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285994.1 protein_id gnl|my_center|LOCUS_05090 29772 33167 gene locus_tag LOCUS_05100 29772 33167 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156997904.1 protein_id gnl|my_center|LOCUS_05100 33272 33346 gene locus_tag LOCUS_t00080 33272 33346 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 33598 34542 gene locus_tag LOCUS_05110 33598 34542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 35216 34539 gene locus_tag LOCUS_05120 35216 34539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 >Feature sequence08 1395 166 gene locus_tag LOCUS_05130 1395 166 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228689.1 protein_id gnl|my_center|LOCUS_05130 3860 1395 gene locus_tag LOCUS_05140 3860 1395 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942321.1 protein_id gnl|my_center|LOCUS_05140 4714 3857 gene locus_tag LOCUS_05150 4714 3857 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064726614.1 protein_id gnl|my_center|LOCUS_05150 4881 7325 gene locus_tag LOCUS_05160 4881 7325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 7322 8062 gene locus_tag LOCUS_05170 7322 8062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 8059 8262 gene locus_tag LOCUS_05180 8059 8262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 8296 9399 gene locus_tag LOCUS_05190 8296 9399 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087973.1 protein_id gnl|my_center|LOCUS_05190 9408 11504 gene locus_tag LOCUS_05200 9408 11504 CDS product glycogen debranching N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730677.1 protein_id gnl|my_center|LOCUS_05200 11693 11568 gene locus_tag LOCUS_05210 11693 11568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 13262 12234 gene locus_tag LOCUS_05220 13262 12234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 13753 14046 gene locus_tag LOCUS_05230 13753 14046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 14051 14329 gene locus_tag LOCUS_05240 14051 14329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 15385 14342 gene locus_tag LOCUS_05250 15385 14342 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067528888.1 protein_id gnl|my_center|LOCUS_05250 15841 15479 gene locus_tag LOCUS_05260 15841 15479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 16689 16249 gene locus_tag LOCUS_05270 16689 16249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 16928 20182 gene locus_tag LOCUS_05280 16928 20182 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982246.1 protein_id gnl|my_center|LOCUS_05280 20606 20199 gene locus_tag LOCUS_05290 20606 20199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 20915 20703 gene locus_tag LOCUS_05300 20915 20703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 22042 21023 gene locus_tag LOCUS_05310 22042 21023 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822893.1 protein_id gnl|my_center|LOCUS_05310 22463 22044 gene locus_tag LOCUS_05320 22463 22044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 22536 23129 gene locus_tag LOCUS_05330 22536 23129 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093953615.1 protein_id gnl|my_center|LOCUS_05330 24425 23112 gene locus_tag LOCUS_05340 24425 23112 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225213.1 protein_id gnl|my_center|LOCUS_05340 24536 25138 gene locus_tag LOCUS_05350 24536 25138 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085145692.1 protein_id gnl|my_center|LOCUS_05350 25153 26034 gene locus_tag LOCUS_05360 25153 26034 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728421.1 protein_id gnl|my_center|LOCUS_05360 26097 26780 gene locus_tag LOCUS_05370 26097 26780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 28077 26794 gene locus_tag LOCUS_05380 28077 26794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 31180 28241 gene locus_tag LOCUS_05390 31180 28241 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170213355.1 protein_id gnl|my_center|LOCUS_05390 31273 32838 gene locus_tag LOCUS_05400 31273 32838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 32920 33432 gene locus_tag LOCUS_05410 32920 33432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 33772 34317 gene locus_tag LOCUS_05420 33772 34317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 >Feature sequence09 547 311 gene locus_tag LOCUS_05430 547 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05430 771 514 gene locus_tag LOCUS_05440 771 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 1227 1090 gene locus_tag LOCUS_05450 1227 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 1512 2414 gene locus_tag LOCUS_05460 1512 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 2944 2762 gene locus_tag LOCUS_05470 2944 2762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 3122 4729 gene locus_tag LOCUS_05480 3122 4729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 5337 4711 gene locus_tag LOCUS_05490 5337 4711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 5511 6206 gene locus_tag LOCUS_05500 5511 6206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 7188 6538 gene locus_tag LOCUS_05510 7188 6538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 8770 7181 gene locus_tag LOCUS_05520 8770 7181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 10202 8988 gene locus_tag LOCUS_05530 10202 8988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 10848 10513 gene locus_tag LOCUS_05540 10848 10513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 11256 11056 gene locus_tag LOCUS_05550 11256 11056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 11478 11876 gene locus_tag LOCUS_05560 11478 11876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 >Feature sequence10 <1 1119 gene locus_tag LOCUS_05570 <1 1119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_141270575.1:ISL3-like element ISAar39 family transposase 1257 1069 gene locus_tag LOCUS_05580 1257 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 1278 1526 gene locus_tag LOCUS_05590 1278 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 1906 1523 gene locus_tag LOCUS_05600 1906 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 2694 7451 gene locus_tag LOCUS_05610 2694 7451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 7464 8036 gene locus_tag LOCUS_05620 7464 8036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 >Feature sequence11 811 224 gene locus_tag LOCUS_05630 811 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 1374 862 gene locus_tag LOCUS_05640 1374 862 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223641.1 protein_id gnl|my_center|LOCUS_05640 1423 2541 gene locus_tag LOCUS_05650 gene serC 1423 2541 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029607.1 protein_id gnl|my_center|LOCUS_05650 3630 2620 gene locus_tag LOCUS_05660 3630 2620 CDS product DNA topoisomerase IB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727903.1 protein_id gnl|my_center|LOCUS_05660 4667 3666 gene locus_tag LOCUS_05670 4667 3666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 5902 4694 gene locus_tag LOCUS_05680 5902 4694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 6816 6034 gene locus_tag LOCUS_05690 6816 6034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 7045 6830 gene locus_tag LOCUS_05700 7045 6830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 7428 7168 gene locus_tag LOCUS_05710 7428 7168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 7967 7632 gene locus_tag LOCUS_05720 7967 7632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 9255 7987 gene locus_tag LOCUS_05730 9255 7987 CDS product hydroxyacid-oxoacid transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222287.1 protein_id gnl|my_center|LOCUS_05730 9445 9720 gene locus_tag LOCUS_05740 9445 9720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 9717 11945 gene locus_tag LOCUS_05750 9717 11945 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228162.1 protein_id gnl|my_center|LOCUS_05750 11942 13654 gene locus_tag LOCUS_05760 11942 13654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 13651 14511 gene locus_tag LOCUS_05770 13651 14511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 15418 14540 gene locus_tag LOCUS_05780 15418 14540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 16213 15428 gene locus_tag LOCUS_05790 16213 15428 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222170.1 protein_id gnl|my_center|LOCUS_05790 17462 16233 gene locus_tag LOCUS_05800 17462 16233 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112101.1 protein_id gnl|my_center|LOCUS_05800 18041 17526 gene locus_tag LOCUS_05810 18041 17526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 17983 18201 gene locus_tag LOCUS_05820 17983 18201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 22076 18189 gene locus_tag LOCUS_05830 22076 18189 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974308.1 protein_id gnl|my_center|LOCUS_05830 25717 22199 gene locus_tag LOCUS_05840 gene rpoB 25717 22199 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029792.1 protein_id gnl|my_center|LOCUS_05840 26775 25933 gene locus_tag LOCUS_05850 26775 25933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 27908 26772 gene locus_tag LOCUS_05860 27908 26772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 29170 27875 gene locus_tag LOCUS_05870 29170 27875 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224306.1 protein_id gnl|my_center|LOCUS_05870 30630 29167 gene locus_tag LOCUS_05880 30630 29167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 31784 30627 gene locus_tag LOCUS_05890 31784 30627 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222537.1 protein_id gnl|my_center|LOCUS_05890 32779 31784 gene locus_tag LOCUS_05900 32779 31784 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222536.1 protein_id gnl|my_center|LOCUS_05900 33837 32776 gene locus_tag LOCUS_05910 33837 32776 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222535.1 protein_id gnl|my_center|LOCUS_05910 35120 33834 gene locus_tag LOCUS_05920 35120 33834 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222534.1 protein_id gnl|my_center|LOCUS_05920 35952 35125 gene locus_tag LOCUS_05930 35952 35125 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223674.1 protein_id gnl|my_center|LOCUS_05930 36740 35955 gene locus_tag LOCUS_05940 36740 35955 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976385.1 protein_id gnl|my_center|LOCUS_05940 37704 36748 gene locus_tag LOCUS_05950 37704 36748 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222531.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05950 38412 38020 gene locus_tag LOCUS_05960 gene rplL 38412 38020 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403353.1 protein_id gnl|my_center|LOCUS_05960 39171 38491 gene locus_tag LOCUS_05970 gene rplJ 39171 38491 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974311.1 protein_id gnl|my_center|LOCUS_05970 40182 39463 gene locus_tag LOCUS_05980 gene rplA 40182 39463 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974314.1 protein_id gnl|my_center|LOCUS_05980 40686 40258 gene locus_tag LOCUS_05990 gene rplK 40686 40258 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974315.1 protein_id gnl|my_center|LOCUS_05990 41730 40804 gene locus_tag LOCUS_06000 gene nusG 41730 40804 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029791.1 protein_id gnl|my_center|LOCUS_06000 42049 41792 gene locus_tag LOCUS_06010 42049 41792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 42211 42138 gene locus_tag LOCUS_t00090 42211 42138 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 42356 43585 gene locus_tag LOCUS_06020 42356 43585 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029790.1 protein_id gnl|my_center|LOCUS_06020 43589 44635 gene locus_tag LOCUS_06030 43589 44635 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974319.1 protein_id gnl|my_center|LOCUS_06030 44643 45110 gene locus_tag LOCUS_06040 44643 45110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 46175 45117 gene locus_tag LOCUS_06050 46175 45117 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776154.1 protein_id gnl|my_center|LOCUS_06050 46539 46168 gene locus_tag LOCUS_06060 46539 46168 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222518.1 protein_id gnl|my_center|LOCUS_06060 46943 46536 gene locus_tag LOCUS_06070 46943 46536 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029784.1 protein_id gnl|my_center|LOCUS_06070 47209 47039 gene locus_tag LOCUS_06080 gene rpmG 47209 47039 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114322.1 protein_id gnl|my_center|LOCUS_06080 47333 47257 gene locus_tag LOCUS_t00100 47333 47257 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 47423 47350 gene locus_tag LOCUS_t00110 47423 47350 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 48953 47544 gene locus_tag LOCUS_06090 48953 47544 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728400.1 protein_id gnl|my_center|LOCUS_06090 49549 48965 gene locus_tag LOCUS_06100 49549 48965 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015424.1 protein_id gnl|my_center|LOCUS_06100 49442 50479 gene locus_tag LOCUS_06110 49442 50479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 51620 50466 gene locus_tag LOCUS_06120 51620 50466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 52588 51617 gene locus_tag LOCUS_06130 52588 51617 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027140.1 protein_id gnl|my_center|LOCUS_06130 55007 52617 gene locus_tag LOCUS_06140 55007 52617 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028088.1 protein_id gnl|my_center|LOCUS_06140 55203 55994 gene locus_tag LOCUS_06150 55203 55994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 56070 56537 gene locus_tag LOCUS_06160 56070 56537 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893397.1 protein_id gnl|my_center|LOCUS_06160 56591 57535 gene locus_tag LOCUS_06170 gene cpdA 56591 57535 CDS product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404120.1 protein_id gnl|my_center|LOCUS_06170 59249 57981 gene locus_tag LOCUS_06180 59249 57981 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074038115.1 protein_id gnl|my_center|LOCUS_06180 61916 59658 gene locus_tag LOCUS_06190 61916 59658 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776169.1 protein_id gnl|my_center|LOCUS_06190 63103 61913 gene locus_tag LOCUS_06200 63103 61913 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776170.1 protein_id gnl|my_center|LOCUS_06200 64077 63103 gene locus_tag LOCUS_06210 64077 63103 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929980.1 protein_id gnl|my_center|LOCUS_06210 70345 64088 gene locus_tag LOCUS_06220 70345 64088 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193495474.1 protein_id gnl|my_center|LOCUS_06220 70415 71548 gene locus_tag LOCUS_06230 70415 71548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 71545 72966 gene locus_tag LOCUS_06240 71545 72966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 73782 72982 gene locus_tag LOCUS_06250 gene map 73782 72982 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222621.1 protein_id gnl|my_center|LOCUS_06250 74385 73810 gene locus_tag LOCUS_06260 74385 73810 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776356.1 protein_id gnl|my_center|LOCUS_06260 75692 74388 gene locus_tag LOCUS_06270 gene secY 75692 74388 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974248.1 protein_id gnl|my_center|LOCUS_06270 76291 75851 gene locus_tag LOCUS_06280 gene rplO 76291 75851 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974249.1 protein_id gnl|my_center|LOCUS_06280 76475 76293 gene locus_tag LOCUS_06290 gene rpmD 76475 76293 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974250.1 protein_id gnl|my_center|LOCUS_06290 77110 76475 gene locus_tag LOCUS_06300 gene rpsE 77110 76475 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974251.1 protein_id gnl|my_center|LOCUS_06300 77528 77145 gene locus_tag LOCUS_06310 gene rplR 77528 77145 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776361.1 protein_id gnl|my_center|LOCUS_06310 78071 77532 gene locus_tag LOCUS_06320 gene rplF 78071 77532 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222612.1 protein_id gnl|my_center|LOCUS_06320 78501 78100 gene locus_tag LOCUS_06330 gene rpsH 78501 78100 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854344.1 protein_id gnl|my_center|LOCUS_06330 78763 78578 gene locus_tag LOCUS_06340 78763 78578 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948630.1 protein_id gnl|my_center|LOCUS_06340 79339 78767 gene locus_tag LOCUS_06350 gene rplE 79339 78767 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974255.1 protein_id gnl|my_center|LOCUS_06350 79716 79342 gene locus_tag LOCUS_06360 gene rplX 79716 79342 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222610.1 protein_id gnl|my_center|LOCUS_06360 80084 79716 gene locus_tag LOCUS_06370 gene rplN 80084 79716 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974257.1 protein_id gnl|my_center|LOCUS_06370 80442 80164 gene locus_tag LOCUS_06380 gene rpsQ 80442 80164 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974258.1 protein_id gnl|my_center|LOCUS_06380 80681 80439 gene locus_tag LOCUS_06390 gene rpmC 80681 80439 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974259.1 protein_id gnl|my_center|LOCUS_06390 81100 80681 gene locus_tag LOCUS_06400 gene rplP 81100 80681 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558864.1 protein_id gnl|my_center|LOCUS_06400 81934 81104 gene locus_tag LOCUS_06410 gene rpsC 81934 81104 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974261.1 protein_id gnl|my_center|LOCUS_06410 82356 81934 gene locus_tag LOCUS_06420 gene rplV 82356 81934 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055650.1 protein_id gnl|my_center|LOCUS_06420 82637 82356 gene locus_tag LOCUS_06430 gene rpsS 82637 82356 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776373.1 protein_id gnl|my_center|LOCUS_06430 83489 82653 gene locus_tag LOCUS_06440 gene rplB 83489 82653 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974264.1 protein_id gnl|my_center|LOCUS_06440 83821 83516 gene locus_tag LOCUS_06450 gene rplW 83821 83516 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776375.1 protein_id gnl|my_center|LOCUS_06450 84471 83818 gene locus_tag LOCUS_06460 gene rplD 84471 83818 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222605.1 protein_id gnl|my_center|LOCUS_06460 85130 84474 gene locus_tag LOCUS_06470 gene rplC 85130 84474 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776377.1 protein_id gnl|my_center|LOCUS_06470 85453 85145 gene locus_tag LOCUS_06480 gene rpsJ 85453 85145 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948644.1 protein_id gnl|my_center|LOCUS_06480 85969 86406 gene locus_tag LOCUS_06490 85969 86406 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229261.1 protein_id gnl|my_center|LOCUS_06490 86517 87614 gene locus_tag LOCUS_06500 86517 87614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 87633 88238 gene locus_tag LOCUS_06510 87633 88238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 88235 89368 gene locus_tag LOCUS_06520 88235 89368 CDS product DUF4350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776084.1 protein_id gnl|my_center|LOCUS_06520 89365 90372 gene locus_tag LOCUS_06530 89365 90372 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897409.1 protein_id gnl|my_center|LOCUS_06530 90383 91675 gene locus_tag LOCUS_06540 90383 91675 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223048.1 protein_id gnl|my_center|LOCUS_06540 92861 91866 gene locus_tag LOCUS_06550 92861 91866 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975791.1 protein_id gnl|my_center|LOCUS_06550 92917 93750 gene locus_tag LOCUS_06560 92917 93750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 93756 94565 gene locus_tag LOCUS_06570 93756 94565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 95853 94549 gene locus_tag LOCUS_06580 95853 94549 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223123.1 protein_id gnl|my_center|LOCUS_06580 95936 96652 gene locus_tag LOCUS_06590 95936 96652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 97530 96610 gene locus_tag LOCUS_06600 97530 96610 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391305.1 protein_id gnl|my_center|LOCUS_06600 98325 97585 gene locus_tag LOCUS_06610 gene trmB 98325 97585 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230974.1 protein_id gnl|my_center|LOCUS_06610 98725 98318 gene locus_tag LOCUS_06620 98725 98318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 100012 98819 gene locus_tag LOCUS_06630 gene tuf 100012 98819 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029795.1 protein_id gnl|my_center|LOCUS_06630 102221 100107 gene locus_tag LOCUS_06640 gene fusA 102221 100107 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055595.1 protein_id gnl|my_center|LOCUS_06640 102769 102299 gene locus_tag LOCUS_06650 gene rpsG 102769 102299 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974303.1 protein_id gnl|my_center|LOCUS_06650 103143 102769 gene locus_tag LOCUS_06660 gene rpsL 103143 102769 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948652.1 protein_id gnl|my_center|LOCUS_06660 104770 103478 gene locus_tag LOCUS_06670 104770 103478 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974638.1 protein_id gnl|my_center|LOCUS_06670 105216 104767 gene locus_tag LOCUS_06680 105216 104767 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063625.1 protein_id gnl|my_center|LOCUS_06680 105321 105593 gene locus_tag LOCUS_06690 105321 105593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 107063 106266 gene locus_tag LOCUS_06700 107063 106266 CDS product DUF3027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974645.1 protein_id gnl|my_center|LOCUS_06700 107165 108658 gene locus_tag LOCUS_06710 107165 108658 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029582.1 protein_id gnl|my_center|LOCUS_06710 109361 108966 gene locus_tag LOCUS_06720 109361 108966 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974650.1 protein_id gnl|my_center|LOCUS_06720 110042 109431 gene locus_tag LOCUS_06730 110042 109431 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230218.1 protein_id gnl|my_center|LOCUS_06730 110219 112321 gene locus_tag LOCUS_06740 110219 112321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 112341 112922 gene locus_tag LOCUS_06750 112341 112922 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888173.1 protein_id gnl|my_center|LOCUS_06750 114539 112923 gene locus_tag LOCUS_06760 114539 112923 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730684.1 protein_id gnl|my_center|LOCUS_06760 114691 115524 gene locus_tag LOCUS_06770 114691 115524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 116047 115631 gene locus_tag LOCUS_06780 116047 115631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 117180 116044 gene locus_tag LOCUS_06790 117180 116044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 118606 117191 gene locus_tag LOCUS_06800 118606 117191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06800 119436 118603 gene locus_tag LOCUS_06810 119436 118603 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776167.1 protein_id gnl|my_center|LOCUS_06810 119603 121873 gene locus_tag LOCUS_06820 119603 121873 CDS product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230251.1 protein_id gnl|my_center|LOCUS_06820 121976 123616 gene locus_tag LOCUS_06830 121976 123616 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063651.1 protein_id gnl|my_center|LOCUS_06830 126234 123709 gene locus_tag LOCUS_06840 126234 123709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031530.1 protein_id gnl|my_center|LOCUS_06840 125997 126093 gene locus_tag LOCUS_t00120 125997 126093 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 126964 128163 gene locus_tag LOCUS_06850 gene serA 126964 128163 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054393.1 protein_id gnl|my_center|LOCUS_06850 128228 129073 gene locus_tag LOCUS_06860 128228 129073 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113910.1 protein_id gnl|my_center|LOCUS_06860 129143 130267 gene locus_tag LOCUS_06870 129143 130267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 130293 130901 gene locus_tag LOCUS_06880 130293 130901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974662.1 protein_id gnl|my_center|LOCUS_06880 131216 130959 gene locus_tag LOCUS_06890 131216 130959 CDS product DUF4031 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974664.1 protein_id gnl|my_center|LOCUS_06890 131908 131213 gene locus_tag LOCUS_06900 131908 131213 CDS product copper homeostasis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230268.1 protein_id gnl|my_center|LOCUS_06900 132044 132394 gene locus_tag LOCUS_06910 132044 132394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974665.1 protein_id gnl|my_center|LOCUS_06910 133224 132514 gene locus_tag LOCUS_06920 133224 132514 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862621.1 protein_id gnl|my_center|LOCUS_06920 135880 133331 gene locus_tag LOCUS_06930 135880 133331 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028773.1 protein_id gnl|my_center|LOCUS_06930 136647 135877 gene locus_tag LOCUS_06940 136647 135877 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975722.1 protein_id gnl|my_center|LOCUS_06940 136721 137155 gene locus_tag LOCUS_06950 136721 137155 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226310.1 protein_id gnl|my_center|LOCUS_06950 137152 137904 gene locus_tag LOCUS_06960 137152 137904 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053237.1 protein_id gnl|my_center|LOCUS_06960 138023 138637 gene locus_tag LOCUS_06970 138023 138637 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225286.1 protein_id gnl|my_center|LOCUS_06970 138689 140131 gene locus_tag LOCUS_06980 gene gndA 138689 140131 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222331.1 protein_id gnl|my_center|LOCUS_06980 140136 141023 gene locus_tag LOCUS_06990 140136 141023 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228409.1 protein_id gnl|my_center|LOCUS_06990 141235 142269 gene locus_tag LOCUS_07000 141235 142269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 143997 142306 gene locus_tag LOCUS_07010 gene thiC 143997 142306 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014273.1 protein_id gnl|my_center|LOCUS_07010 144815 143997 gene locus_tag LOCUS_07020 gene thiD 144815 143997 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088646.1 protein_id gnl|my_center|LOCUS_07020 145396 144812 gene locus_tag LOCUS_07030 145396 144812 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024266003.1 protein_id gnl|my_center|LOCUS_07030 146148 145393 gene locus_tag LOCUS_07040 146148 145393 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174265951.1 protein_id gnl|my_center|LOCUS_07040 146366 146154 gene locus_tag LOCUS_07050 146366 146154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 147490 146312 gene locus_tag LOCUS_07060 gene thiO 147490 146312 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230302.1 protein_id gnl|my_center|LOCUS_07060 148125 147487 gene locus_tag LOCUS_07070 gene thiE 148125 147487 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941250.1 protein_id gnl|my_center|LOCUS_07070 148322 149647 gene locus_tag LOCUS_07080 148322 149647 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029449.1 protein_id gnl|my_center|LOCUS_07080 150297 149737 gene locus_tag LOCUS_07090 150297 149737 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728791.1 protein_id gnl|my_center|LOCUS_07090 152098 150326 gene locus_tag LOCUS_07100 152098 150326 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728790.1 protein_id gnl|my_center|LOCUS_07100 152215 152598 gene locus_tag LOCUS_07110 152215 152598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 153501 152800 gene locus_tag LOCUS_07120 153501 152800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 154347 153505 gene locus_tag LOCUS_07130 154347 153505 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223765.1 protein_id gnl|my_center|LOCUS_07130 156824 154344 gene locus_tag LOCUS_07140 156824 154344 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223764.1 protein_id gnl|my_center|LOCUS_07140 157348 156821 gene locus_tag LOCUS_07150 157348 156821 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223763.1 protein_id gnl|my_center|LOCUS_07150 157679 158305 gene locus_tag LOCUS_07160 157679 158305 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084104.1 protein_id gnl|my_center|LOCUS_07160 158367 159239 gene locus_tag LOCUS_07170 158367 159239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 160499 159255 gene locus_tag LOCUS_07180 160499 159255 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119349.1 protein_id gnl|my_center|LOCUS_07180 161670 160534 gene locus_tag LOCUS_07190 161670 160534 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727161.1 protein_id gnl|my_center|LOCUS_07190 162781 161663 gene locus_tag LOCUS_07200 162781 161663 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223761.1 protein_id gnl|my_center|LOCUS_07200 163672 162788 gene locus_tag LOCUS_07210 163672 162788 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223759.1 protein_id gnl|my_center|LOCUS_07210 164258 163683 gene locus_tag LOCUS_07220 164258 163683 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223758.1 protein_id gnl|my_center|LOCUS_07220 164947 164258 gene locus_tag LOCUS_07230 164947 164258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 165489 164944 gene locus_tag LOCUS_07240 165489 164944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 165801 167339 gene locus_tag LOCUS_07250 165801 167339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07250 169151 167523 gene locus_tag LOCUS_07260 gene groL 169151 167523 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974678.1 protein_id gnl|my_center|LOCUS_07260 170208 169375 gene locus_tag LOCUS_07270 170208 169375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224688.1 protein_id gnl|my_center|LOCUS_07270 170555 170205 gene locus_tag LOCUS_07280 170555 170205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 171415 170552 gene locus_tag LOCUS_07290 171415 170552 CDS product TylF/MycF family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296730.1 protein_id gnl|my_center|LOCUS_07290 172263 171427 gene locus_tag LOCUS_07300 172263 171427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 172439 173728 gene locus_tag LOCUS_07310 172439 173728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 173826 174440 gene locus_tag LOCUS_07320 173826 174440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 174516 175235 gene locus_tag LOCUS_07330 174516 175235 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729763.1 protein_id gnl|my_center|LOCUS_07330 175641 175366 gene locus_tag LOCUS_07340 175641 175366 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974680.1 protein_id gnl|my_center|LOCUS_07340 176982 175681 gene locus_tag LOCUS_07350 gene thrC 176982 175681 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228462.1 protein_id gnl|my_center|LOCUS_07350 178064 177219 gene locus_tag LOCUS_07360 gene otsB 178064 177219 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029558.1 protein_id gnl|my_center|LOCUS_07360 178834 178298 gene locus_tag LOCUS_07370 178834 178298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 179142 178840 gene locus_tag LOCUS_07380 179142 178840 CDS product DUF3263 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062316.1 protein_id gnl|my_center|LOCUS_07380 179276 180343 gene locus_tag LOCUS_07390 179276 180343 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403126.1 protein_id gnl|my_center|LOCUS_07390 180377 181807 gene locus_tag LOCUS_07400 180377 181807 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730872.1 protein_id gnl|my_center|LOCUS_07400 181804 182472 gene locus_tag LOCUS_07410 181804 182472 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976477.1 protein_id gnl|my_center|LOCUS_07410 182520 183491 gene locus_tag LOCUS_07420 182520 183491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 183521 184741 gene locus_tag LOCUS_07430 183521 184741 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229652.1 protein_id gnl|my_center|LOCUS_07430 185669 184749 gene locus_tag LOCUS_07440 185669 184749 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225340.1 protein_id gnl|my_center|LOCUS_07440 186325 185666 gene locus_tag LOCUS_07450 186325 185666 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742240.1 protein_id gnl|my_center|LOCUS_07450 186969 186322 gene locus_tag LOCUS_07460 186969 186322 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225259.1 protein_id gnl|my_center|LOCUS_07460 187058 188566 gene locus_tag LOCUS_07470 187058 188566 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225339.1 protein_id gnl|my_center|LOCUS_07470 188563 189609 gene locus_tag LOCUS_07480 188563 189609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 189726 190448 gene locus_tag LOCUS_07490 189726 190448 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804387.1 protein_id gnl|my_center|LOCUS_07490 190511 191284 gene locus_tag LOCUS_07500 190511 191284 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231012.1 protein_id gnl|my_center|LOCUS_07500 191418 192257 gene locus_tag LOCUS_07510 191418 192257 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228350.1 protein_id gnl|my_center|LOCUS_07510 192573 192289 gene locus_tag LOCUS_07520 192573 192289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 192685 193143 gene locus_tag LOCUS_07530 gene hsp18 192685 193143 CDS product molecular chaperone Hsp18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908539.1 protein_id gnl|my_center|LOCUS_07530 194214 193249 gene locus_tag LOCUS_07540 194214 193249 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203754103.1 protein_id gnl|my_center|LOCUS_07540 195900 194341 gene locus_tag LOCUS_07550 195900 194341 CDS product succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225959.1 protein_id gnl|my_center|LOCUS_07550 197554 195905 gene locus_tag LOCUS_07560 197554 195905 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225958.1 protein_id gnl|my_center|LOCUS_07560 197673 198524 gene locus_tag LOCUS_07570 gene pdxY 197673 198524 CDS product pyridoxal kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349874.1 protein_id gnl|my_center|LOCUS_07570 198560 199597 gene locus_tag LOCUS_07580 198560 199597 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229198.1 protein_id gnl|my_center|LOCUS_07580 199684 199610 gene locus_tag LOCUS_t00130 199684 199610 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 200453 199725 gene locus_tag LOCUS_07590 200453 199725 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404822.1 protein_id gnl|my_center|LOCUS_07590 201091 200504 gene locus_tag LOCUS_07600 201091 200504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 201220 201648 gene locus_tag LOCUS_07610 gene soxR 201220 201648 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977128.1 protein_id gnl|my_center|LOCUS_07610 201689 202909 gene locus_tag LOCUS_07620 201689 202909 CDS product DUF4032 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804886.1 protein_id gnl|my_center|LOCUS_07620 203539 202961 gene locus_tag LOCUS_07630 203539 202961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 205328 203541 gene locus_tag LOCUS_07640 205328 203541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 206032 205325 gene locus_tag LOCUS_07650 206032 205325 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889519.1 protein_id gnl|my_center|LOCUS_07650 206871 206029 gene locus_tag LOCUS_07660 206871 206029 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075839.1 protein_id gnl|my_center|LOCUS_07660 208939 206852 gene locus_tag LOCUS_07670 208939 206852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 210481 208970 gene locus_tag LOCUS_07680 210481 208970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 211683 210727 gene locus_tag LOCUS_07690 gene rlmB 211683 210727 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230407.1 protein_id gnl|my_center|LOCUS_07690 213070 211673 gene locus_tag LOCUS_07700 gene cysS 213070 211673 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284151.1 protein_id gnl|my_center|LOCUS_07700 213218 214396 gene locus_tag LOCUS_07710 213218 214396 CDS product peptidase C39 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742198.1 protein_id gnl|my_center|LOCUS_07710 215194 214451 gene locus_tag LOCUS_07720 gene fabG 215194 214451 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807992.1 protein_id gnl|my_center|LOCUS_07720 216711 215191 gene locus_tag LOCUS_07730 216711 215191 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222413.1 protein_id gnl|my_center|LOCUS_07730 216758 217306 gene locus_tag LOCUS_07740 gene ispF 216758 217306 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029522.1 protein_id gnl|my_center|LOCUS_07740 217665 217303 gene locus_tag LOCUS_07750 217665 217303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 217810 218499 gene locus_tag LOCUS_07760 217810 218499 CDS product IspD/TarI family cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224063.1 protein_id gnl|my_center|LOCUS_07760 219006 218452 gene locus_tag LOCUS_07770 219006 218452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 219582 219097 gene locus_tag LOCUS_07780 219582 219097 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003953493.1 protein_id gnl|my_center|LOCUS_07780 219770 220615 gene locus_tag LOCUS_07790 219770 220615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 220780 221469 gene locus_tag LOCUS_07800 220780 221469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 221466 222209 gene locus_tag LOCUS_07810 221466 222209 CDS product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222392.1 protein_id gnl|my_center|LOCUS_07810 222909 222250 gene locus_tag LOCUS_07820 gene phoU 222909 222250 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974747.1 protein_id gnl|my_center|LOCUS_07820 223030 224214 gene locus_tag LOCUS_07830 223030 224214 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974746.1 protein_id gnl|my_center|LOCUS_07830 224211 224888 gene locus_tag LOCUS_07840 224211 224888 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974745.1 protein_id gnl|my_center|LOCUS_07840 224987 225910 gene locus_tag LOCUS_07850 224987 225910 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027928.1 protein_id gnl|my_center|LOCUS_07850 226019 226597 gene locus_tag LOCUS_07860 226019 226597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 226768 226496 gene locus_tag LOCUS_07870 226768 226496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 226713 227258 gene locus_tag LOCUS_07880 226713 227258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 227379 227894 gene locus_tag LOCUS_07890 227379 227894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 227878 229596 gene locus_tag LOCUS_07900 227878 229596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 229593 230264 gene locus_tag LOCUS_07910 229593 230264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 230276 231682 gene locus_tag LOCUS_07920 230276 231682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 232267 231773 gene locus_tag LOCUS_07930 232267 231773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 234109 232319 gene locus_tag LOCUS_07940 234109 232319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 234562 234167 gene locus_tag LOCUS_07950 234562 234167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 235134 234697 gene locus_tag LOCUS_07960 235134 234697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 235774 235349 gene locus_tag LOCUS_07970 235774 235349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 236423 236001 gene locus_tag LOCUS_07980 236423 236001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 237905 236679 gene locus_tag LOCUS_07990 237905 236679 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583240.1 protein_id gnl|my_center|LOCUS_07990 239691 238000 gene locus_tag LOCUS_08000 239691 238000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 241510 239780 gene locus_tag LOCUS_08010 241510 239780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 242746 241637 gene locus_tag LOCUS_08020 242746 241637 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887087.1 protein_id gnl|my_center|LOCUS_08020 243037 244152 gene locus_tag LOCUS_08030 gene pilM 243037 244152 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887416.1 protein_id gnl|my_center|LOCUS_08030 244154 245011 gene locus_tag LOCUS_08040 244154 245011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 245008 245697 gene locus_tag LOCUS_08050 245008 245697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 245902 247167 gene locus_tag LOCUS_08060 245902 247167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 248138 247344 gene locus_tag LOCUS_08070 248138 247344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 249606 248239 gene locus_tag LOCUS_08080 249606 248239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 249809 252028 gene locus_tag LOCUS_08090 249809 252028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 252730 252047 gene locus_tag LOCUS_08100 252730 252047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 252942 252727 gene locus_tag LOCUS_08110 252942 252727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 253457 252939 gene locus_tag LOCUS_08120 253457 252939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 254149 253589 gene locus_tag LOCUS_08130 254149 253589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 254148 254705 gene locus_tag LOCUS_08140 254148 254705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 255477 254776 gene locus_tag LOCUS_08150 255477 254776 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223860.1 protein_id gnl|my_center|LOCUS_08150 256157 255654 gene locus_tag LOCUS_08160 256157 255654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 256353 257723 gene locus_tag LOCUS_08170 256353 257723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 257919 258731 gene locus_tag LOCUS_08180 257919 258731 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226289.1 protein_id gnl|my_center|LOCUS_08180 258988 259422 gene locus_tag LOCUS_08190 258988 259422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 259458 260798 gene locus_tag LOCUS_08200 259458 260798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 261356 260829 gene locus_tag LOCUS_08210 261356 260829 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974766.1 protein_id gnl|my_center|LOCUS_08210 262587 261346 gene locus_tag LOCUS_08220 gene mshA 262587 261346 CDS product D-inositol-3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326818.1 protein_id gnl|my_center|LOCUS_08220 263127 262630 gene locus_tag LOCUS_08230 263127 262630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 263039 263836 gene locus_tag LOCUS_08240 263039 263836 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031214.1 protein_id gnl|my_center|LOCUS_08240 263909 264598 gene locus_tag LOCUS_08250 263909 264598 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265932.1 protein_id gnl|my_center|LOCUS_08250 265957 264683 gene locus_tag LOCUS_08260 265957 264683 CDS product M4 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039930.1 protein_id gnl|my_center|LOCUS_08260 266192 268081 gene locus_tag LOCUS_08270 gene typA 266192 268081 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973866.1 protein_id gnl|my_center|LOCUS_08270 268092 269480 gene locus_tag LOCUS_08280 268092 269480 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031600.1 protein_id gnl|my_center|LOCUS_08280 269490 269822 gene locus_tag LOCUS_08290 269490 269822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 270777 269836 gene locus_tag LOCUS_08300 270777 269836 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229514.1 protein_id gnl|my_center|LOCUS_08300 270760 271677 gene locus_tag LOCUS_08310 270760 271677 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226531.1 protein_id gnl|my_center|LOCUS_08310 271692 272696 gene locus_tag LOCUS_08320 271692 272696 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104523.1 protein_id gnl|my_center|LOCUS_08320 272867 273565 gene locus_tag LOCUS_08330 gene frnE 272867 273565 CDS product protein disulfide isomerase FrnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887304.1 protein_id gnl|my_center|LOCUS_08330 273580 275169 gene locus_tag LOCUS_08340 273580 275169 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877518.1 protein_id gnl|my_center|LOCUS_08340 275866 275270 gene locus_tag LOCUS_08350 275866 275270 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084689.1 protein_id gnl|my_center|LOCUS_08350 277166 275844 gene locus_tag LOCUS_08360 277166 275844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 278078 277176 gene locus_tag LOCUS_08370 278078 277176 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896372.1 protein_id gnl|my_center|LOCUS_08370 280754 278148 gene locus_tag LOCUS_08380 280754 278148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 280937 281671 gene locus_tag LOCUS_08390 280937 281671 CDS product pyrimidine reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030623.1 protein_id gnl|my_center|LOCUS_08390 281677 282567 gene locus_tag LOCUS_08400 281677 282567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 283757 282564 gene locus_tag LOCUS_08410 283757 282564 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027852.1 protein_id gnl|my_center|LOCUS_08410 284720 283809 gene locus_tag LOCUS_08420 284720 283809 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480227.1 protein_id gnl|my_center|LOCUS_08420 285490 284798 gene locus_tag LOCUS_08430 285490 284798 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191312799.1 protein_id gnl|my_center|LOCUS_08430 286632 285628 gene locus_tag LOCUS_08440 gene galE 286632 285628 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992438.1 protein_id gnl|my_center|LOCUS_08440 286908 286768 gene locus_tag LOCUS_08450 286908 286768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 287882 287007 gene locus_tag LOCUS_08460 gene rfbA 287882 287007 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730948.1 protein_id gnl|my_center|LOCUS_08460 288062 289507 gene locus_tag LOCUS_08470 288062 289507 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803920.1 protein_id gnl|my_center|LOCUS_08470 289551 290552 gene locus_tag LOCUS_08480 gene rfbB 289551 290552 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803926.1 protein_id gnl|my_center|LOCUS_08480 290673 292055 gene locus_tag LOCUS_08490 290673 292055 CDS product bifunctional dTDP-4-dehydrorhamnose 3,5-epimerase family protein/NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803927.1 protein_id gnl|my_center|LOCUS_08490 293454 292021 gene locus_tag LOCUS_08500 293454 292021 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013584.1 protein_id gnl|my_center|LOCUS_08500 293902 293549 gene locus_tag LOCUS_08510 293902 293549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 294337 294056 gene locus_tag LOCUS_08520 294337 294056 CDS product DUF2516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062110.1 protein_id gnl|my_center|LOCUS_08520 295106 294483 gene locus_tag LOCUS_08530 295106 294483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 295528 295112 gene locus_tag LOCUS_08540 295528 295112 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222362.1 protein_id gnl|my_center|LOCUS_08540 296715 295612 gene locus_tag LOCUS_08550 296715 295612 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113397.1 protein_id gnl|my_center|LOCUS_08550 298130 296715 gene locus_tag LOCUS_08560 298130 296715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 299262 298132 gene locus_tag LOCUS_08570 299262 298132 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257552.1 protein_id gnl|my_center|LOCUS_08570 299352 300500 gene locus_tag LOCUS_08580 299352 300500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 301618 300509 gene locus_tag LOCUS_08590 301618 300509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 302418 301615 gene locus_tag LOCUS_08600 302418 301615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 303554 302415 gene locus_tag LOCUS_08610 303554 302415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 304687 303551 gene locus_tag LOCUS_08620 304687 303551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 306267 304684 gene locus_tag LOCUS_08630 306267 304684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 307310 306261 gene locus_tag LOCUS_08640 307310 306261 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_08640 308581 307217 gene locus_tag LOCUS_08650 308581 307217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 309981 308578 gene locus_tag LOCUS_08660 309981 308578 CDS product exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229159.1 protein_id gnl|my_center|LOCUS_08660 310372 311451 gene locus_tag LOCUS_08670 310372 311451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 312417 311476 gene locus_tag LOCUS_08680 312417 311476 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974786.1 protein_id gnl|my_center|LOCUS_08680 312458 314320 gene locus_tag LOCUS_08690 312458 314320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 314324 315355 gene locus_tag LOCUS_08700 314324 315355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 315360 316601 gene locus_tag LOCUS_08710 gene manA 315360 316601 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417054.1 protein_id gnl|my_center|LOCUS_08710 316799 317071 gene locus_tag LOCUS_08720 316799 317071 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119905.1 protein_id gnl|my_center|LOCUS_08720 317116 317331 gene locus_tag LOCUS_08730 317116 317331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 317427 319778 gene locus_tag LOCUS_08740 317427 319778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 319911 319750 gene locus_tag LOCUS_08750 319911 319750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 320094 321008 gene locus_tag LOCUS_08760 gene cysD 320094 321008 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730229.1 protein_id gnl|my_center|LOCUS_08760 321008 322297 gene locus_tag LOCUS_08770 321008 322297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 322664 322467 gene locus_tag LOCUS_08780 322664 322467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 322569 323735 gene locus_tag LOCUS_08790 322569 323735 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013598.1 protein_id gnl|my_center|LOCUS_08790 323791 324978 gene locus_tag LOCUS_08800 323791 324978 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124212.1 protein_id gnl|my_center|LOCUS_08800 324975 326210 gene locus_tag LOCUS_08810 324975 326210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 326264 327274 gene locus_tag LOCUS_08820 326264 327274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 327271 328317 gene locus_tag LOCUS_08830 327271 328317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 329347 328295 gene locus_tag LOCUS_08840 329347 328295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 329566 330909 gene locus_tag LOCUS_08850 329566 330909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 331888 330872 gene locus_tag LOCUS_08860 331888 330872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 332880 331948 gene locus_tag LOCUS_08870 332880 331948 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258544.1 protein_id gnl|my_center|LOCUS_08870 333909 332893 gene locus_tag LOCUS_08880 gene gmd 333909 332893 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284917.1 protein_id gnl|my_center|LOCUS_08880 335111 333906 gene locus_tag LOCUS_08890 335111 333906 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966352.1 protein_id gnl|my_center|LOCUS_08890 336853 335102 gene locus_tag LOCUS_08900 336853 335102 CDS product DUF4012 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060618734.1 protein_id gnl|my_center|LOCUS_08900 337358 336939 gene locus_tag LOCUS_08910 337358 336939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 337976 337503 gene locus_tag LOCUS_08920 337976 337503 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974790.1 protein_id gnl|my_center|LOCUS_08920 338469 337978 gene locus_tag LOCUS_08930 338469 337978 CDS product FABP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230723.1 protein_id gnl|my_center|LOCUS_08930 339560 338679 gene locus_tag LOCUS_08940 339560 338679 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408456.1 protein_id gnl|my_center|LOCUS_08940 340264 339566 gene locus_tag LOCUS_08950 340264 339566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 341032 340358 gene locus_tag LOCUS_08960 341032 340358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 342217 341465 gene locus_tag LOCUS_08970 342217 341465 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407647.1 protein_id gnl|my_center|LOCUS_08970 342820 343245 gene locus_tag LOCUS_08980 gene dtd 342820 343245 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029487.1 protein_id gnl|my_center|LOCUS_08980 343665 345164 gene locus_tag LOCUS_08990 343665 345164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 345161 346552 gene locus_tag LOCUS_09000 345161 346552 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731141.1 protein_id gnl|my_center|LOCUS_09000 346549 347625 gene locus_tag LOCUS_09010 346549 347625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 347622 348419 gene locus_tag LOCUS_09020 347622 348419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 348851 348552 gene locus_tag LOCUS_09030 348851 348552 CDS product DUF1416 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974805.1 protein_id gnl|my_center|LOCUS_09030 349705 348851 gene locus_tag LOCUS_09040 349705 348851 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730790.1 protein_id gnl|my_center|LOCUS_09040 350213 349734 gene locus_tag LOCUS_09050 350213 349734 CDS product DUF4395 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230720.1 protein_id gnl|my_center|LOCUS_09050 350481 351497 gene locus_tag LOCUS_09060 gene gmd 350481 351497 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284917.1 protein_id gnl|my_center|LOCUS_09060 351951 351517 gene locus_tag LOCUS_09070 351951 351517 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977746.1 protein_id gnl|my_center|LOCUS_09070 352292 351990 gene locus_tag LOCUS_09080 gene moaD2 352292 351990 CDS product molybdopterin synthase subunit MoaD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404559.1 protein_id gnl|my_center|LOCUS_09080 352340 353125 gene locus_tag LOCUS_09090 gene glnR 352340 353125 CDS product two-component system response regulator GlnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029474.1 protein_id gnl|my_center|LOCUS_09090 353690 353241 gene locus_tag LOCUS_09100 353690 353241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 354744 353812 gene locus_tag LOCUS_09110 354744 353812 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974789.1 protein_id gnl|my_center|LOCUS_09110 354823 355185 gene locus_tag LOCUS_09120 354823 355185 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974797.1 protein_id gnl|my_center|LOCUS_09120 355185 356012 gene locus_tag LOCUS_09130 gene mshD 355185 356012 CDS product mycothiol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092494.1 protein_id gnl|my_center|LOCUS_09130 356056 358212 gene locus_tag LOCUS_09140 356056 358212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 358220 358915 gene locus_tag LOCUS_09150 358220 358915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 359934 358912 gene locus_tag LOCUS_09160 359934 358912 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230588.1 protein_id gnl|my_center|LOCUS_09160 359987 362191 gene locus_tag LOCUS_09170 359987 362191 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270140.1 protein_id gnl|my_center|LOCUS_09170 362292 362909 gene locus_tag LOCUS_09180 362292 362909 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974832.1 protein_id gnl|my_center|LOCUS_09180 362914 363945 gene locus_tag LOCUS_09190 gene pitH 362914 363945 CDS product low-affinity phosphate transporter PitH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029459.1 protein_id gnl|my_center|LOCUS_09190 364328 364041 gene locus_tag LOCUS_09200 364328 364041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 365083 364247 gene locus_tag LOCUS_09210 365083 364247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 366013 365234 gene locus_tag LOCUS_09220 gene pstB 366013 365234 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974830.1 protein_id gnl|my_center|LOCUS_09220 367093 366032 gene locus_tag LOCUS_09230 gene pstA 367093 366032 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782854.1 protein_id gnl|my_center|LOCUS_09230 368046 367090 gene locus_tag LOCUS_09240 gene pstC 368046 367090 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068423.1 protein_id gnl|my_center|LOCUS_09240 369245 368154 gene locus_tag LOCUS_09250 gene pstS 369245 368154 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776547.1 protein_id gnl|my_center|LOCUS_09250 370270 369461 gene locus_tag LOCUS_09260 370270 369461 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776549.1 protein_id gnl|my_center|LOCUS_09260 370427 371494 gene locus_tag LOCUS_09270 370427 371494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 371695 371522 gene locus_tag LOCUS_09280 371695 371522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 372099 371896 gene locus_tag LOCUS_09290 372099 371896 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974443.1 protein_id gnl|my_center|LOCUS_09290 372352 372531 gene locus_tag LOCUS_09300 372352 372531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 372522 372597 gene locus_tag LOCUS_t00140 372522 372597 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 372706 373101 gene locus_tag LOCUS_09310 372706 373101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 375145 373106 gene locus_tag LOCUS_09320 375145 373106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 376074 375145 gene locus_tag LOCUS_09330 376074 375145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 376243 376788 gene locus_tag LOCUS_09340 376243 376788 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223459.1 protein_id gnl|my_center|LOCUS_09340 378110 376803 gene locus_tag LOCUS_09350 gene paaF 378110 376803 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329391.1 protein_id gnl|my_center|LOCUS_09350 378528 378112 gene locus_tag LOCUS_09360 gene paaI 378528 378112 CDS product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965794.1 protein_id gnl|my_center|LOCUS_09360 379612 378521 gene locus_tag LOCUS_09370 gene paaK 379612 378521 CDS product phenylacetate-CoA oxygenase/reductase subunit PaaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086838237.1 protein_id gnl|my_center|LOCUS_09370 380122 379613 gene locus_tag LOCUS_09380 gene paaJ 380122 379613 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223466.1 protein_id gnl|my_center|LOCUS_09380 381080 380130 gene locus_tag LOCUS_09390 gene paaC 381080 380130 CDS product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083205.1 protein_id gnl|my_center|LOCUS_09390 381377 381093 gene locus_tag LOCUS_09400 gene paaB 381377 381093 CDS product 1,2-phenylacetyl-CoA epoxidase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167454960.1 protein_id gnl|my_center|LOCUS_09400 382327 381374 gene locus_tag LOCUS_09410 gene paaA 382327 381374 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223463.1 protein_id gnl|my_center|LOCUS_09410 382428 384476 gene locus_tag LOCUS_09420 gene paaZ 382428 384476 CDS product phenylacetic acid degradation bifunctional protein PaaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113323.1 protein_id gnl|my_center|LOCUS_09420 385489 384605 gene locus_tag LOCUS_09430 385489 384605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 386242 385559 gene locus_tag LOCUS_09440 386242 385559 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222118.1 protein_id gnl|my_center|LOCUS_09440 387492 386338 gene locus_tag LOCUS_09450 387492 386338 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900742.1 protein_id gnl|my_center|LOCUS_09450 388766 387492 gene locus_tag LOCUS_09460 388766 387492 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876667.1 protein_id gnl|my_center|LOCUS_09460 388959 389885 gene locus_tag LOCUS_09470 388959 389885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 389920 390594 gene locus_tag LOCUS_09480 389920 390594 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729168.1 protein_id gnl|my_center|LOCUS_09480 392592 391075 gene locus_tag LOCUS_09490 392592 391075 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296549.1 protein_id gnl|my_center|LOCUS_09490 392816 393832 gene locus_tag LOCUS_09500 392816 393832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 393829 394221 gene locus_tag LOCUS_09510 gene crcB 393829 394221 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969203.1 protein_id gnl|my_center|LOCUS_09510 394218 394538 gene locus_tag LOCUS_09520 gene crcB 394218 394538 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031399.1 protein_id gnl|my_center|LOCUS_09520 394917 394561 gene locus_tag LOCUS_09530 394917 394561 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087492.1 protein_id gnl|my_center|LOCUS_09530 395091 395017 gene locus_tag LOCUS_t00150 395091 395017 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 395284 395209 gene locus_tag LOCUS_t00160 395284 395209 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 395407 396690 gene locus_tag LOCUS_09540 395407 396690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 396702 398240 gene locus_tag LOCUS_09550 396702 398240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 398314 398389 gene locus_tag LOCUS_t00170 398314 398389 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 400989 398410 gene locus_tag LOCUS_09560 400989 398410 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728362.1 protein_id gnl|my_center|LOCUS_09560 402047 400986 gene locus_tag LOCUS_09570 402047 400986 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529417.1 protein_id gnl|my_center|LOCUS_09570 403600 402044 gene locus_tag LOCUS_09580 403600 402044 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503777.1 protein_id gnl|my_center|LOCUS_09580 404616 403612 gene locus_tag LOCUS_09590 404616 403612 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815879.1 protein_id gnl|my_center|LOCUS_09590 405565 404693 gene locus_tag LOCUS_09600 405565 404693 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218045413.1 protein_id gnl|my_center|LOCUS_09600 405522 405707 gene locus_tag LOCUS_09610 405522 405707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 405870 406655 gene locus_tag LOCUS_09620 405870 406655 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226182.1 protein_id gnl|my_center|LOCUS_09620 408350 407058 gene locus_tag LOCUS_09630 408350 407058 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929473.1 protein_id gnl|my_center|LOCUS_09630 409950 408361 gene locus_tag LOCUS_09640 409950 408361 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063852.1 protein_id gnl|my_center|LOCUS_09640 410216 412150 gene locus_tag LOCUS_09650 410216 412150 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287279.1 protein_id gnl|my_center|LOCUS_09650 412129 413487 gene locus_tag LOCUS_09660 412129 413487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 413563 413730 gene locus_tag LOCUS_09670 413563 413730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 413882 414160 gene locus_tag LOCUS_09680 413882 414160 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806049.1 protein_id gnl|my_center|LOCUS_09680 414303 417557 gene locus_tag LOCUS_09690 414303 417557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 417703 418791 gene locus_tag LOCUS_09700 417703 418791 CDS product Glu/Leu/Phe/Val dehydrogenase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228727.1 protein_id gnl|my_center|LOCUS_09700 419264 419082 gene locus_tag LOCUS_09710 419264 419082 CDS product DUF3073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230732.1 protein_id gnl|my_center|LOCUS_09710 420483 419413 gene locus_tag LOCUS_09720 gene purM 420483 419413 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974885.1 protein_id gnl|my_center|LOCUS_09720 421945 420494 gene locus_tag LOCUS_09730 gene purF 421945 420494 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872463.1 protein_id gnl|my_center|LOCUS_09730 422154 423932 gene locus_tag LOCUS_09740 422154 423932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 425397 423958 gene locus_tag LOCUS_09750 425397 423958 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527331.1 protein_id gnl|my_center|LOCUS_09750 426033 425554 gene locus_tag LOCUS_09760 426033 425554 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224858.1 protein_id gnl|my_center|LOCUS_09760 428428 426056 gene locus_tag LOCUS_09770 428428 426056 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224857.1 protein_id gnl|my_center|LOCUS_09770 429778 428573 gene locus_tag LOCUS_09780 429778 428573 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027309.1 protein_id gnl|my_center|LOCUS_09780 431130 429790 gene locus_tag LOCUS_09790 431130 429790 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878135.1 protein_id gnl|my_center|LOCUS_09790 431583 431224 gene locus_tag LOCUS_09800 431583 431224 CDS product sterol carrier family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804521.1 protein_id gnl|my_center|LOCUS_09800 432485 431523 gene locus_tag LOCUS_09810 432485 431523 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225862.1 protein_id gnl|my_center|LOCUS_09810 433558 432482 gene locus_tag LOCUS_09820 433558 432482 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225860.1 protein_id gnl|my_center|LOCUS_09820 435123 433555 gene locus_tag LOCUS_09830 435123 433555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 436532 435120 gene locus_tag LOCUS_09840 436532 435120 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225861.1 protein_id gnl|my_center|LOCUS_09840 437263 436529 gene locus_tag LOCUS_09850 437263 436529 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225859.1 protein_id gnl|my_center|LOCUS_09850 438339 437287 gene locus_tag LOCUS_09860 438339 437287 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225858.1 protein_id gnl|my_center|LOCUS_09860 439040 438384 gene locus_tag LOCUS_09870 439040 438384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 439097 440371 gene locus_tag LOCUS_09880 439097 440371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 440381 441229 gene locus_tag LOCUS_09890 440381 441229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223088.1 protein_id gnl|my_center|LOCUS_09890 441754 441239 gene locus_tag LOCUS_09900 441754 441239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 441809 442657 gene locus_tag LOCUS_09910 441809 442657 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030437.1 protein_id gnl|my_center|LOCUS_09910 442796 443509 gene locus_tag LOCUS_09920 442796 443509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922325.1 protein_id gnl|my_center|LOCUS_09920 444364 443528 gene locus_tag LOCUS_09930 444364 443528 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927833.1 protein_id gnl|my_center|LOCUS_09930 446707 444416 gene locus_tag LOCUS_09940 gene purL 446707 444416 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974893.1 protein_id gnl|my_center|LOCUS_09940 448129 446762 gene locus_tag LOCUS_09950 448129 446762 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287964.1 protein_id gnl|my_center|LOCUS_09950 448695 448141 gene locus_tag LOCUS_09960 448695 448141 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463838.1 protein_id gnl|my_center|LOCUS_09960 448819 450291 gene locus_tag LOCUS_09970 448819 450291 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224359.1 protein_id gnl|my_center|LOCUS_09970 450537 450382 gene locus_tag LOCUS_09980 450537 450382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 450704 451846 gene locus_tag LOCUS_09990 450704 451846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 451959 453380 gene locus_tag LOCUS_10000 451959 453380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 453429 454277 gene locus_tag LOCUS_10010 453429 454277 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921324.1 protein_id gnl|my_center|LOCUS_10010 455783 454299 gene locus_tag LOCUS_10020 455783 454299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 455697 456005 gene locus_tag LOCUS_10030 455697 456005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 456145 456486 gene locus_tag LOCUS_10040 456145 456486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 456983 456537 gene locus_tag LOCUS_10050 456983 456537 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804014.1 protein_id gnl|my_center|LOCUS_10050 457651 456983 gene locus_tag LOCUS_10060 gene purQ 457651 456983 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974894.1 protein_id gnl|my_center|LOCUS_10060 457905 457648 gene locus_tag LOCUS_10070 gene purS 457905 457648 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776336.1 protein_id gnl|my_center|LOCUS_10070 458080 458547 gene locus_tag LOCUS_10080 458080 458547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 458752 458561 gene locus_tag LOCUS_10090 458752 458561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 460339 458762 gene locus_tag LOCUS_10100 460339 458762 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228252.1 protein_id gnl|my_center|LOCUS_10100 462414 460354 gene locus_tag LOCUS_10110 462414 460354 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876865.1 protein_id gnl|my_center|LOCUS_10110 462507 463010 gene locus_tag LOCUS_10120 462507 463010 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870904.1 protein_id gnl|my_center|LOCUS_10120 463437 463018 gene locus_tag LOCUS_10130 463437 463018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 464336 463440 gene locus_tag LOCUS_10140 464336 463440 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974901.1 protein_id gnl|my_center|LOCUS_10140 464867 464379 gene locus_tag LOCUS_10150 464867 464379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227099.1 protein_id gnl|my_center|LOCUS_10150 464948 465577 gene locus_tag LOCUS_10160 464948 465577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 465697 465846 gene locus_tag LOCUS_10170 465697 465846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 466464 465886 gene locus_tag LOCUS_10180 466464 465886 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346204.1 protein_id gnl|my_center|LOCUS_10180 467975 466557 gene locus_tag LOCUS_10190 gene purB 467975 466557 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230775.1 protein_id gnl|my_center|LOCUS_10190 468684 468109 gene locus_tag LOCUS_10200 468684 468109 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392680.1 protein_id gnl|my_center|LOCUS_10200 470019 468781 gene locus_tag LOCUS_10210 gene purD 470019 468781 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029417.1 protein_id gnl|my_center|LOCUS_10210 470071 472329 gene locus_tag LOCUS_10220 470071 472329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 473318 473181 gene locus_tag LOCUS_10230 473318 473181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 473296 474498 gene locus_tag LOCUS_10240 473296 474498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 475818 474529 gene locus_tag LOCUS_10250 475818 474529 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975310.1 protein_id gnl|my_center|LOCUS_10250 475934 476851 gene locus_tag LOCUS_10260 475934 476851 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027281.1 protein_id gnl|my_center|LOCUS_10260 476862 478376 gene locus_tag LOCUS_10270 gene lysS 476862 478376 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230454.1 protein_id gnl|my_center|LOCUS_10270 478556 479611 gene locus_tag LOCUS_10280 478556 479611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 480168 479752 gene locus_tag LOCUS_10290 480168 479752 CDS product DUF3151 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975291.1 protein_id gnl|my_center|LOCUS_10290 480262 481788 gene locus_tag LOCUS_10300 480262 481788 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730278.1 protein_id gnl|my_center|LOCUS_10300 482841 481810 gene locus_tag LOCUS_10310 gene fbaA 482841 481810 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230818.1 protein_id gnl|my_center|LOCUS_10310 482882 483379 gene locus_tag LOCUS_10320 482882 483379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 483475 484248 gene locus_tag LOCUS_10330 483475 484248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 484983 484258 gene locus_tag LOCUS_10340 484983 484258 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892159.1 protein_id gnl|my_center|LOCUS_10340 485016 485780 gene locus_tag LOCUS_10350 485016 485780 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230830.1 protein_id gnl|my_center|LOCUS_10350 486333 485794 gene locus_tag LOCUS_10360 gene pyrE 486333 485794 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417034.1 protein_id gnl|my_center|LOCUS_10360 486352 487521 gene locus_tag LOCUS_10370 486352 487521 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029150.1 protein_id gnl|my_center|LOCUS_10370 487587 490439 gene locus_tag LOCUS_10380 487587 490439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 490441 490794 gene locus_tag LOCUS_10390 490441 490794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 491880 490834 gene locus_tag LOCUS_10400 491880 490834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 494576 491955 gene locus_tag LOCUS_10410 gene clpB 494576 491955 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975278.1 protein_id gnl|my_center|LOCUS_10410 494788 495489 gene locus_tag LOCUS_10420 494788 495489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 495486 496118 gene locus_tag LOCUS_10430 495486 496118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 496118 497581 gene locus_tag LOCUS_10440 496118 497581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 497626 498369 gene locus_tag LOCUS_10450 497626 498369 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804566.1 protein_id gnl|my_center|LOCUS_10450 498366 500903 gene locus_tag LOCUS_10460 498366 500903 CDS product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804565.1 protein_id gnl|my_center|LOCUS_10460 501911 500955 gene locus_tag LOCUS_10470 501911 500955 CDS product DUF4393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064586.1 protein_id gnl|my_center|LOCUS_10470 503215 501911 gene locus_tag LOCUS_10480 503215 501911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082818.1 protein_id gnl|my_center|LOCUS_10480 504823 503345 gene locus_tag LOCUS_10490 504823 503345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 505323 504820 gene locus_tag LOCUS_10500 505323 504820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 505406 507193 gene locus_tag LOCUS_10510 505406 507193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 507576 507109 gene locus_tag LOCUS_10520 507576 507109 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136562995.1 protein_id gnl|my_center|LOCUS_10520 508555 507578 gene locus_tag LOCUS_10530 508555 507578 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064509752.1 protein_id gnl|my_center|LOCUS_10530 508791 509909 gene locus_tag LOCUS_10540 508791 509909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 509911 510276 gene locus_tag LOCUS_10550 509911 510276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 510494 510366 gene locus_tag LOCUS_10560 510494 510366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 510905 510558 gene locus_tag LOCUS_10570 510905 510558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 512134 510830 gene locus_tag LOCUS_10580 512134 510830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 512183 512674 gene locus_tag LOCUS_10590 512183 512674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 513410 512808 gene locus_tag LOCUS_10600 513410 512808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 513875 513456 gene locus_tag LOCUS_10610 513875 513456 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975271.1 protein_id gnl|my_center|LOCUS_10610 515056 513872 gene locus_tag LOCUS_10620 gene dnaJ 515056 513872 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401821.1 protein_id gnl|my_center|LOCUS_10620 515673 515083 gene locus_tag LOCUS_10630 515673 515083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 517535 515670 gene locus_tag LOCUS_10640 gene dnaK 517535 515670 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975268.1 protein_id gnl|my_center|LOCUS_10640 518563 517667 gene locus_tag LOCUS_10650 518563 517667 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803876.1 protein_id gnl|my_center|LOCUS_10650 518629 519363 gene locus_tag LOCUS_10660 518629 519363 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461579.1 protein_id gnl|my_center|LOCUS_10660 519440 520291 gene locus_tag LOCUS_10670 519440 520291 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228550.1 protein_id gnl|my_center|LOCUS_10670 520822 520325 gene locus_tag LOCUS_10680 520822 520325 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742221.1 protein_id gnl|my_center|LOCUS_10680 520862 521776 gene locus_tag LOCUS_10690 520862 521776 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028478.1 protein_id gnl|my_center|LOCUS_10690 521797 523002 gene locus_tag LOCUS_10700 521797 523002 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814398.1 protein_id gnl|my_center|LOCUS_10700 523582 522989 gene locus_tag LOCUS_10710 523582 522989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 524128 523628 gene locus_tag LOCUS_10720 524128 523628 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466832.1 protein_id gnl|my_center|LOCUS_10720 524582 524145 gene locus_tag LOCUS_10730 524582 524145 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893800.1 protein_id gnl|my_center|LOCUS_10730 524799 525653 gene locus_tag LOCUS_10740 524799 525653 CDS product TIGR03619 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404819.1 protein_id gnl|my_center|LOCUS_10740 525658 526806 gene locus_tag LOCUS_10750 525658 526806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224715.1 protein_id gnl|my_center|LOCUS_10750 526893 527726 gene locus_tag LOCUS_10760 526893 527726 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419223.1 protein_id gnl|my_center|LOCUS_10760 527741 528898 gene locus_tag LOCUS_10770 527741 528898 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224717.1 protein_id gnl|my_center|LOCUS_10770 528895 529998 gene locus_tag LOCUS_10780 528895 529998 CDS product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204250320.1 protein_id gnl|my_center|LOCUS_10780 530070 530528 gene locus_tag LOCUS_10790 530070 530528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 531283 530555 gene locus_tag LOCUS_10800 531283 530555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 531558 532145 gene locus_tag LOCUS_10810 531558 532145 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225943.1 protein_id gnl|my_center|LOCUS_10810 533409 532105 gene locus_tag LOCUS_10820 533409 532105 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028234.1 protein_id gnl|my_center|LOCUS_10820 534790 533468 gene locus_tag LOCUS_10830 534790 533468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 535248 534790 gene locus_tag LOCUS_10840 535248 534790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 535423 535995 gene locus_tag LOCUS_10850 535423 535995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 537416 536022 gene locus_tag LOCUS_10860 537416 536022 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401650.1 protein_id gnl|my_center|LOCUS_10860 540487 537518 gene locus_tag LOCUS_10870 540487 537518 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224347.1 protein_id gnl|my_center|LOCUS_10870 540815 540675 gene locus_tag LOCUS_10880 540815 540675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 542125 540968 gene locus_tag LOCUS_10890 gene hutI 542125 540968 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028748.1 protein_id gnl|my_center|LOCUS_10890 543399 542122 gene locus_tag LOCUS_10900 543399 542122 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028749.1 protein_id gnl|my_center|LOCUS_10900 544586 543396 gene locus_tag LOCUS_10910 544586 543396 CDS product allantoate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892540.1 protein_id gnl|my_center|LOCUS_10910 544608 545222 gene locus_tag LOCUS_10920 544608 545222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 545267 545551 gene locus_tag LOCUS_10930 545267 545551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 546327 545584 gene locus_tag LOCUS_10940 546327 545584 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971784.1 protein_id gnl|my_center|LOCUS_10940 546379 546930 gene locus_tag LOCUS_10950 546379 546930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 549023 546927 gene locus_tag LOCUS_10960 549023 546927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 549124 550230 gene locus_tag LOCUS_10970 549124 550230 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222030.1 protein_id gnl|my_center|LOCUS_10970 550227 551093 gene locus_tag LOCUS_10980 550227 551093 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222029.1 protein_id gnl|my_center|LOCUS_10980 551265 551858 gene locus_tag LOCUS_10990 551265 551858 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767065.1 protein_id gnl|my_center|LOCUS_10990 552744 551896 gene locus_tag LOCUS_11000 552744 551896 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878082.1 protein_id gnl|my_center|LOCUS_11000 552855 553406 gene locus_tag LOCUS_11010 552855 553406 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228455.1 protein_id gnl|my_center|LOCUS_11010 553959 553426 gene locus_tag LOCUS_11020 553959 553426 CDS product cysteine dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730438.1 protein_id gnl|my_center|LOCUS_11020 554876 553956 gene locus_tag LOCUS_11030 554876 553956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 554928 555701 gene locus_tag LOCUS_11040 554928 555701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 556728 555718 gene locus_tag LOCUS_11050 556728 555718 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078330037.1 protein_id gnl|my_center|LOCUS_11050 557802 556756 gene locus_tag LOCUS_11060 557802 556756 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775843.1 protein_id gnl|my_center|LOCUS_11060 558587 557799 gene locus_tag LOCUS_11070 558587 557799 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728089.1 protein_id gnl|my_center|LOCUS_11070 559367 558609 gene locus_tag LOCUS_11080 gene modA 559367 558609 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728090.1 protein_id gnl|my_center|LOCUS_11080 559790 559416 gene locus_tag LOCUS_11090 559790 559416 CDS product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775840.1 protein_id gnl|my_center|LOCUS_11090 561459 559783 gene locus_tag LOCUS_11100 561459 559783 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727477.1 protein_id gnl|my_center|LOCUS_11100 563003 561456 gene locus_tag LOCUS_11110 gene hutH 563003 561456 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727479.1 protein_id gnl|my_center|LOCUS_11110 563290 564582 gene locus_tag LOCUS_11120 563290 564582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 564741 567317 gene locus_tag LOCUS_11130 564741 567317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 567473 570814 gene locus_tag LOCUS_11140 567473 570814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 570991 571569 gene locus_tag LOCUS_11150 570991 571569 CDS product toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228091.1 protein_id gnl|my_center|LOCUS_11150 571646 572470 gene locus_tag LOCUS_11160 571646 572470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 572509 572670 gene locus_tag LOCUS_11170 572509 572670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 573268 572693 gene locus_tag LOCUS_11180 gene dcd 573268 572693 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975261.1 protein_id gnl|my_center|LOCUS_11180 573362 574132 gene locus_tag LOCUS_11190 573362 574132 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742086.1 protein_id gnl|my_center|LOCUS_11190 574148 574223 gene locus_tag LOCUS_t00180 574148 574223 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 574386 575042 gene locus_tag LOCUS_11200 574386 575042 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224341.1 protein_id gnl|my_center|LOCUS_11200 575805 575029 gene locus_tag LOCUS_11210 575805 575029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 576325 575798 gene locus_tag LOCUS_11220 576325 575798 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973981.1 protein_id gnl|my_center|LOCUS_11220 576466 576918 gene locus_tag LOCUS_11230 576466 576918 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467525.1 protein_id gnl|my_center|LOCUS_11230 577021 577791 gene locus_tag LOCUS_11240 577021 577791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 578634 578176 gene locus_tag LOCUS_11250 578634 578176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 578812 580566 gene locus_tag LOCUS_11260 gene phaC 578812 580566 CDS product class II poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095864.1 protein_id gnl|my_center|LOCUS_11260 580556 581401 gene locus_tag LOCUS_11270 gene phaZ 580556 581401 CDS product poly(3-hydroxyalkanoate) depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228251.1 protein_id gnl|my_center|LOCUS_11270 581398 582594 gene locus_tag LOCUS_11280 581398 582594 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228249.1 protein_id gnl|my_center|LOCUS_11280 582766 584640 gene locus_tag LOCUS_11290 582766 584640 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230903.1 protein_id gnl|my_center|LOCUS_11290 585568 584708 gene locus_tag LOCUS_11300 585568 584708 CDS product ArgP/LysG family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014240.1 protein_id gnl|my_center|LOCUS_11300 585638 586237 gene locus_tag LOCUS_11310 585638 586237 CDS product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038077.1 protein_id gnl|my_center|LOCUS_11310 586270 586875 gene locus_tag LOCUS_11320 586270 586875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 586900 587715 gene locus_tag LOCUS_11330 586900 587715 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416111.1 protein_id gnl|my_center|LOCUS_11330 587712 588665 gene locus_tag LOCUS_11340 587712 588665 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899798.1 protein_id gnl|my_center|LOCUS_11340 591109 588761 gene locus_tag LOCUS_11350 591109 588761 CDS product DUF6351 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225776.1 protein_id gnl|my_center|LOCUS_11350 591220 592872 gene locus_tag LOCUS_11360 gene pgm 591220 592872 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728182.1 protein_id gnl|my_center|LOCUS_11360 594189 592945 gene locus_tag LOCUS_11370 594189 592945 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191279629.1 protein_id gnl|my_center|LOCUS_11370 595336 594218 gene locus_tag LOCUS_11380 595336 594218 CDS product NADPH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950854.1 protein_id gnl|my_center|LOCUS_11380 595421 596620 gene locus_tag LOCUS_11390 595421 596620 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229362.1 protein_id gnl|my_center|LOCUS_11390 596617 597546 gene locus_tag LOCUS_11400 596617 597546 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228493.1 protein_id gnl|my_center|LOCUS_11400 597576 598532 gene locus_tag LOCUS_11410 597576 598532 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228493.1 protein_id gnl|my_center|LOCUS_11410 600148 598619 gene locus_tag LOCUS_11420 600148 598619 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804270.1 protein_id gnl|my_center|LOCUS_11420 600201 600890 gene locus_tag LOCUS_11430 600201 600890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 602449 600905 gene locus_tag LOCUS_11440 602449 600905 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229897.1 protein_id gnl|my_center|LOCUS_11440 602486 603079 gene locus_tag LOCUS_11450 602486 603079 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284042.1 protein_id gnl|my_center|LOCUS_11450 603239 603592 gene locus_tag LOCUS_11460 603239 603592 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976999.1 protein_id gnl|my_center|LOCUS_11460 603592 605211 gene locus_tag LOCUS_11470 603592 605211 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977000.1 protein_id gnl|my_center|LOCUS_11470 605366 607396 gene locus_tag LOCUS_11480 gene acs 605366 607396 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975373.1 protein_id gnl|my_center|LOCUS_11480 607526 608698 gene locus_tag LOCUS_11490 607526 608698 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089721.1 protein_id gnl|my_center|LOCUS_11490 609836 608727 gene locus_tag LOCUS_11500 609836 608727 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031039.1 protein_id gnl|my_center|LOCUS_11500 609965 611263 gene locus_tag LOCUS_11510 gene nhaA 609965 611263 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081951.1 protein_id gnl|my_center|LOCUS_11510 611324 611728 gene locus_tag LOCUS_11520 611324 611728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 611732 612592 gene locus_tag LOCUS_11530 611732 612592 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349593.1 protein_id gnl|my_center|LOCUS_11530 613830 612634 gene locus_tag LOCUS_11540 613830 612634 CDS product MarP family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136209493.1 protein_id gnl|my_center|LOCUS_11540 614555 613827 gene locus_tag LOCUS_11550 614555 613827 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029090.1 protein_id gnl|my_center|LOCUS_11550 615151 614552 gene locus_tag LOCUS_11560 615151 614552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 615804 615148 gene locus_tag LOCUS_11570 615804 615148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11570 616057 616734 gene locus_tag LOCUS_11580 616057 616734 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975365.1 protein_id gnl|my_center|LOCUS_11580 618704 616821 gene locus_tag LOCUS_11590 618704 616821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 618873 619367 gene locus_tag LOCUS_11600 618873 619367 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089004579.1 protein_id gnl|my_center|LOCUS_11600 619364 620728 gene locus_tag LOCUS_11610 619364 620728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 621522 620707 gene locus_tag LOCUS_11620 621522 620707 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975364.1 protein_id gnl|my_center|LOCUS_11620 622397 621519 gene locus_tag LOCUS_11630 622397 621519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975363.1 protein_id gnl|my_center|LOCUS_11630 622870 622394 gene locus_tag LOCUS_11640 622870 622394 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975361.1 protein_id gnl|my_center|LOCUS_11640 623025 622870 gene locus_tag LOCUS_11650 623025 622870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 623991 623119 gene locus_tag LOCUS_11660 gene sigJ 623991 623119 CDS product RNA polymerase sigma factor SigJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978451.1 protein_id gnl|my_center|LOCUS_11660 624725 623988 gene locus_tag LOCUS_11670 624725 623988 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031453.1 protein_id gnl|my_center|LOCUS_11670 625449 624817 gene locus_tag LOCUS_11680 625449 624817 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031118.1 protein_id gnl|my_center|LOCUS_11680 626183 625446 gene locus_tag LOCUS_11690 626183 625446 CDS product succinyl-CoA--3-ketoacid CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412786.1 protein_id gnl|my_center|LOCUS_11690 626125 626313 gene locus_tag LOCUS_11700 626125 626313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 626325 627308 gene locus_tag LOCUS_11710 626325 627308 CDS product ArsA-related P-loop ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029095.1 protein_id gnl|my_center|LOCUS_11710 627305 628477 gene locus_tag LOCUS_11720 627305 628477 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230566.1 protein_id gnl|my_center|LOCUS_11720 628848 628558 gene locus_tag LOCUS_11730 gene wblA 628848 628558 CDS product transcriptional regulator WblA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029097.1 protein_id gnl|my_center|LOCUS_11730 629129 631297 gene locus_tag LOCUS_11740 629129 631297 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930028.1 protein_id gnl|my_center|LOCUS_11740 631775 631308 gene locus_tag LOCUS_11750 631775 631308 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975355.1 protein_id gnl|my_center|LOCUS_11750 631775 632725 gene locus_tag LOCUS_11760 631775 632725 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467832.1 protein_id gnl|my_center|LOCUS_11760 632799 632873 gene locus_tag LOCUS_t00190 632799 632873 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 632944 633624 gene locus_tag LOCUS_11770 632944 633624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 634225 633800 gene locus_tag LOCUS_11780 634225 633800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 635259 634222 gene locus_tag LOCUS_11790 635259 634222 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087033.1 protein_id gnl|my_center|LOCUS_11790 636669 635383 gene locus_tag LOCUS_11800 636669 635383 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975324.1 protein_id gnl|my_center|LOCUS_11800 637253 636729 gene locus_tag LOCUS_11810 637253 636729 CDS product DUF5063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975322.1 protein_id gnl|my_center|LOCUS_11810 637948 637352 gene locus_tag LOCUS_11820 gene recR 637948 637352 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 protein_id gnl|my_center|LOCUS_11820 638382 638005 gene locus_tag LOCUS_11830 638382 638005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 640591 638456 gene locus_tag LOCUS_11840 640591 638456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 640781 640868 gene locus_tag LOCUS_t00200 640781 640868 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 642598 640928 gene locus_tag LOCUS_11850 642598 640928 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155594933.1 protein_id gnl|my_center|LOCUS_11850 643525 642647 gene locus_tag LOCUS_11860 643525 642647 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224290.1 protein_id gnl|my_center|LOCUS_11860 644810 643518 gene locus_tag LOCUS_11870 gene mycP 644810 643518 CDS product type VII secretion-associated serine protease mycosin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030414.1 protein_id gnl|my_center|LOCUS_11870 646261 644807 gene locus_tag LOCUS_11880 646261 644807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 647617 646268 gene locus_tag LOCUS_11890 gene eccD 647617 646268 CDS product type VII secretion integral membrane protein EccD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222634.1 protein_id gnl|my_center|LOCUS_11890 648044 647751 gene locus_tag LOCUS_11900 648044 647751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 648391 648074 gene locus_tag LOCUS_11910 648391 648074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 649917 648550 gene locus_tag LOCUS_11920 649917 648550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 650355 650029 gene locus_tag LOCUS_11930 650355 650029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 650246 654133 gene locus_tag LOCUS_11940 650246 654133 CDS product type VII secretion protein EccC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030426.1 protein_id gnl|my_center|LOCUS_11940 654977 654513 gene locus_tag LOCUS_11950 654977 654513 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727083.1 protein_id gnl|my_center|LOCUS_11950 655027 655245 gene locus_tag LOCUS_11960 655027 655245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 656933 655335 gene locus_tag LOCUS_11970 656933 655335 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730039.1 protein_id gnl|my_center|LOCUS_11970 656978 657280 gene locus_tag LOCUS_11980 656978 657280 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003999914.1 protein_id gnl|my_center|LOCUS_11980 657277 657795 gene locus_tag LOCUS_11990 657277 657795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 658442 657897 gene locus_tag LOCUS_12000 658442 657897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 659681 658656 gene locus_tag LOCUS_12010 659681 658656 CDS product arginine deiminase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533364.1 protein_id gnl|my_center|LOCUS_12010 661273 659780 gene locus_tag LOCUS_12020 661273 659780 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975632.1 protein_id gnl|my_center|LOCUS_12020 661788 661306 gene locus_tag LOCUS_12030 661788 661306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 661839 663329 gene locus_tag LOCUS_12040 661839 663329 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409207.1 protein_id gnl|my_center|LOCUS_12040 663426 664598 gene locus_tag LOCUS_12050 663426 664598 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419356.1 protein_id gnl|my_center|LOCUS_12050 665891 664611 gene locus_tag LOCUS_12060 665891 664611 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226163.1 protein_id gnl|my_center|LOCUS_12060 665991 666425 gene locus_tag LOCUS_12070 665991 666425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 666436 667377 gene locus_tag LOCUS_12080 666436 667377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 667374 668678 gene locus_tag LOCUS_12090 667374 668678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 670092 668683 gene locus_tag LOCUS_12100 670092 668683 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224866.1 protein_id gnl|my_center|LOCUS_12100 670973 670089 gene locus_tag LOCUS_12110 670973 670089 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895962.1 protein_id gnl|my_center|LOCUS_12110 671127 671477 gene locus_tag LOCUS_12120 671127 671477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 672759 671590 gene locus_tag LOCUS_12130 672759 671590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 672977 672792 gene locus_tag LOCUS_12140 672977 672792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 673174 673085 gene locus_tag LOCUS_t00210 673174 673085 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 673654 673223 gene locus_tag LOCUS_12150 gene tadA 673654 673223 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974924.1 protein_id gnl|my_center|LOCUS_12150 674177 673692 gene locus_tag LOCUS_12160 674177 673692 CDS product tRNA adenosine deaminase-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199198884.1 protein_id gnl|my_center|LOCUS_12160 674260 674901 gene locus_tag LOCUS_12170 gene upp 674260 674901 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974921.1 protein_id gnl|my_center|LOCUS_12170 676368 674980 gene locus_tag LOCUS_12180 676368 674980 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223979.1 protein_id gnl|my_center|LOCUS_12180 676682 676368 gene locus_tag LOCUS_12190 676682 676368 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816822.1 protein_id gnl|my_center|LOCUS_12190 677806 676679 gene locus_tag LOCUS_12200 677806 676679 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174136.1 protein_id gnl|my_center|LOCUS_12200 678409 677837 gene locus_tag LOCUS_12210 gene thpR 678409 677837 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870382.1 protein_id gnl|my_center|LOCUS_12210 679171 678413 gene locus_tag LOCUS_12220 679171 678413 CDS product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230540.1 protein_id gnl|my_center|LOCUS_12220 679869 679168 gene locus_tag LOCUS_12230 679869 679168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 681082 679937 gene locus_tag LOCUS_12240 681082 679937 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072191.1 protein_id gnl|my_center|LOCUS_12240 681235 683451 gene locus_tag LOCUS_12250 gene glgX 681235 683451 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731328.1 protein_id gnl|my_center|LOCUS_12250 683456 685699 gene locus_tag LOCUS_12260 gene treY 683456 685699 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224464.1 protein_id gnl|my_center|LOCUS_12260 685701 687455 gene locus_tag LOCUS_12270 gene treZ 685701 687455 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224465.1 protein_id gnl|my_center|LOCUS_12270 687543 689063 gene locus_tag LOCUS_12280 687543 689063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 689457 689068 gene locus_tag LOCUS_12290 689457 689068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 691755 689542 gene locus_tag LOCUS_12300 691755 689542 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028362.1 protein_id gnl|my_center|LOCUS_12300 691867 692628 gene locus_tag LOCUS_12310 691867 692628 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231033.1 protein_id gnl|my_center|LOCUS_12310 693328 692630 gene locus_tag LOCUS_12320 gene cobB 693328 692630 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000952755.1 protein_id gnl|my_center|LOCUS_12320 693974 693333 gene locus_tag LOCUS_12330 693974 693333 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777112.1 protein_id gnl|my_center|LOCUS_12330 694555 693971 gene locus_tag LOCUS_12340 694555 693971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 695590 694601 gene locus_tag LOCUS_12350 695590 694601 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222531.1 protein_id gnl|my_center|LOCUS_12350 695737 696612 gene locus_tag LOCUS_12360 695737 696612 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679981.1 protein_id gnl|my_center|LOCUS_12360 696609 697340 gene locus_tag LOCUS_12370 696609 697340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 697353 698048 gene locus_tag LOCUS_12380 697353 698048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 698803 700035 gene locus_tag LOCUS_12390 698803 700035 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416051.1 protein_id gnl|my_center|LOCUS_12390 700563 700048 gene locus_tag LOCUS_12400 700563 700048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 700750 702225 gene locus_tag LOCUS_12410 700750 702225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 702376 702212 gene locus_tag LOCUS_12420 702376 702212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12420 703443 702556 gene locus_tag LOCUS_12430 703443 702556 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230733.1 protein_id gnl|my_center|LOCUS_12430 703481 704275 gene locus_tag LOCUS_12440 703481 704275 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027387.1 protein_id gnl|my_center|LOCUS_12440 704286 704681 gene locus_tag LOCUS_12450 704286 704681 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878487.1 protein_id gnl|my_center|LOCUS_12450 708089 704700 gene locus_tag LOCUS_12460 708089 704700 CDS product glucodextranase DOMON-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227692.1 protein_id gnl|my_center|LOCUS_12460 708276 709478 gene locus_tag LOCUS_12470 708276 709478 CDS product GAF domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928864.1 protein_id gnl|my_center|LOCUS_12470 709480 712107 gene locus_tag LOCUS_12480 709480 712107 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487423.1 protein_id gnl|my_center|LOCUS_12480 712256 712029 gene locus_tag LOCUS_12490 712256 712029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 713263 712328 gene locus_tag LOCUS_12500 713263 712328 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094646.1 protein_id gnl|my_center|LOCUS_12500 713320 713763 gene locus_tag LOCUS_12510 713320 713763 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978086.1 protein_id gnl|my_center|LOCUS_12510 713817 715286 gene locus_tag LOCUS_12520 713817 715286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 715905 715294 gene locus_tag LOCUS_12530 715905 715294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901515.1 protein_id gnl|my_center|LOCUS_12530 717711 715915 gene locus_tag LOCUS_12540 gene recD 717711 715915 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900979.1 protein_id gnl|my_center|LOCUS_12540 721088 717708 gene locus_tag LOCUS_12550 gene recB 721088 717708 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727605.1 protein_id gnl|my_center|LOCUS_12550 724432 721085 gene locus_tag LOCUS_12560 gene recC 724432 721085 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877040.1 protein_id gnl|my_center|LOCUS_12560 724492 725625 gene locus_tag LOCUS_12570 724492 725625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 726036 725713 gene locus_tag LOCUS_12580 726036 725713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 >Feature sequence12 551 886 gene locus_tag LOCUS_12590 551 886 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731611.1 protein_id gnl|my_center|LOCUS_12590 905 1375 gene locus_tag LOCUS_12600 905 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12600 1569 1766 gene locus_tag LOCUS_12610 1569 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12610 1822 1977 gene locus_tag LOCUS_12620 1822 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 2412 2194 gene locus_tag LOCUS_12630 2412 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 2654 2463 gene locus_tag LOCUS_12640 2654 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 4448 2745 gene locus_tag LOCUS_12650 4448 2745 CDS product anti-phage dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102963.1 protein_id gnl|my_center|LOCUS_12650 4496 4801 gene locus_tag LOCUS_12660 4496 4801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 >Feature sequence13 121 12 gene locus_tag LOCUS_r00010 121 12 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3403 257 gene locus_tag LOCUS_r00020 3403 257 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 5313 3782 gene locus_tag LOCUS_r00030 5313 3782 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence14 295 693 gene locus_tag LOCUS_12670 295 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 690 1196 gene locus_tag LOCUS_12680 690 1196 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053954397.1 protein_id gnl|my_center|LOCUS_12680 1250 1429 gene locus_tag LOCUS_12690 1250 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 1667 3043 gene locus_tag LOCUS_12700 1667 3043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 3050 3322 gene locus_tag LOCUS_12710 3050 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 3282 3518 gene locus_tag LOCUS_12720 3282 3518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 3582 3776 gene locus_tag LOCUS_12730 3582 3776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 >Feature sequence15 1046 243 gene locus_tag LOCUS_12740 1046 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12740 1351 1046 gene locus_tag LOCUS_12750 1351 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 1447 1788 gene locus_tag LOCUS_12760 1447 1788 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235677901.1 protein_id gnl|my_center|LOCUS_12760 1946 2734 gene locus_tag LOCUS_12770 1946 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12770 >Feature sequence16 62 1687 gene locus_tag LOCUS_12780 62 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 >Feature sequence17 1137 7 gene locus_tag LOCUS_12790 1137 7 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068319765.1 protein_id gnl|my_center|LOCUS_12790 >Feature sequence18 542 907 gene locus_tag LOCUS_12800 542 907 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490570.1 protein_id gnl|my_center|LOCUS_12800 >Feature sequence19 >Feature sequence20 128 1048 gene locus_tag LOCUS_12810 128 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 4151 1050 gene locus_tag LOCUS_12820 4151 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 4573 4148 gene locus_tag LOCUS_12830 4573 4148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 5007 4570 gene locus_tag LOCUS_12840 5007 4570 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189749557.1 protein_id gnl|my_center|LOCUS_12840 5351 5004 gene locus_tag LOCUS_12850 5351 5004 CDS product TadE/TadG family type IV pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189749558.1 protein_id gnl|my_center|LOCUS_12850 5571 5383 gene locus_tag LOCUS_12860 5571 5383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 5955 5623 gene locus_tag LOCUS_12870 5955 5623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12870 6527 5925 gene locus_tag LOCUS_12880 6527 5925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12880 7381 6524 gene locus_tag LOCUS_12890 7381 6524 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228858.1 protein_id gnl|my_center|LOCUS_12890 8859 7378 gene locus_tag LOCUS_12900 8859 7378 CDS product CpaF/VirB11 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228859.1 protein_id gnl|my_center|LOCUS_12900 9623 8856 gene locus_tag LOCUS_12910 9623 8856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974416.1 protein_id gnl|my_center|LOCUS_12910 10294 9623 gene locus_tag LOCUS_12920 10294 9623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 11278 10319 gene locus_tag LOCUS_12930 11278 10319 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189749566.1 protein_id gnl|my_center|LOCUS_12930 11826 11263 gene locus_tag LOCUS_12940 11826 11263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 12224 15751 gene locus_tag LOCUS_12950 12224 15751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 15865 16245 gene locus_tag LOCUS_12960 15865 16245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 16535 16170 gene locus_tag LOCUS_12970 16535 16170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 18958 16532 gene locus_tag LOCUS_12980 18958 16532 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073950391.1 protein_id gnl|my_center|LOCUS_12980 19205 22525 gene locus_tag LOCUS_12990 19205 22525 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204874017.1 protein_id gnl|my_center|LOCUS_12990 22522 25362 gene locus_tag LOCUS_13000 22522 25362 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613294.1 protein_id gnl|my_center|LOCUS_13000 26096 25518 gene locus_tag LOCUS_13010 26096 25518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 26628 26083 gene locus_tag LOCUS_13020 26628 26083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 27660 26671 gene locus_tag LOCUS_13030 27660 26671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 27751 28338 gene locus_tag LOCUS_13040 27751 28338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 28469 28930 gene locus_tag LOCUS_13050 28469 28930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 28997 30292 gene locus_tag LOCUS_13060 28997 30292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 30486 31319 gene locus_tag LOCUS_13070 30486 31319 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973816.1 protein_id gnl|my_center|LOCUS_13070 31350 34850 gene locus_tag LOCUS_13080 31350 34850 CDS product TM0106 family RecB-like putative nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730276.1 protein_id gnl|my_center|LOCUS_13080 34884 42137 gene locus_tag LOCUS_13090 34884 42137 CDS product DUF3320 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104117.1 protein_id gnl|my_center|LOCUS_13090 42597 42175 gene locus_tag LOCUS_13100 42597 42175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 42770 43258 gene locus_tag LOCUS_13110 42770 43258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 44382 43372 gene locus_tag LOCUS_13120 44382 43372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 44572 45084 gene locus_tag LOCUS_13130 44572 45084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877660.1 protein_id gnl|my_center|LOCUS_13130 45951 45097 gene locus_tag LOCUS_13140 45951 45097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 46151 45993 gene locus_tag LOCUS_13150 46151 45993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 46801 46319 gene locus_tag LOCUS_13160 46801 46319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 47516 48157 gene locus_tag LOCUS_13170 47516 48157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13170 48501 50060 gene locus_tag LOCUS_13180 48501 50060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 50057 51268 gene locus_tag LOCUS_13190 50057 51268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 51265 55329 gene locus_tag LOCUS_13200 51265 55329 CDS product TIGR02680 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052667156.1 protein_id gnl|my_center|LOCUS_13200 55326 56540 gene locus_tag LOCUS_13210 55326 56540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 56734 56507 gene locus_tag LOCUS_13220 56734 56507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 56654 60199 gene locus_tag LOCUS_13230 56654 60199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 61204 60545 gene locus_tag LOCUS_13240 61204 60545 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640623.1 protein_id gnl|my_center|LOCUS_13240 61274 62260 gene locus_tag LOCUS_13250 61274 62260 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030035.1 protein_id gnl|my_center|LOCUS_13250 62767 62474 gene locus_tag LOCUS_13260 62767 62474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 62655 63887 gene locus_tag LOCUS_13270 62655 63887 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005118518.1 protein_id gnl|my_center|LOCUS_13270 64009 64770 gene locus_tag LOCUS_13280 64009 64770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 65350 64922 gene locus_tag LOCUS_13290 65350 64922 CDS product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728346.1 protein_id gnl|my_center|LOCUS_13290 66326 65592 gene locus_tag LOCUS_13300 66326 65592 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900263.1 protein_id gnl|my_center|LOCUS_13300 66535 67854 gene locus_tag LOCUS_13310 66535 67854 CDS product bifunctional alpha/beta hydrolase/OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085686.1 protein_id gnl|my_center|LOCUS_13310 68676 68413 gene locus_tag LOCUS_13320 68676 68413 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013354.1 protein_id gnl|my_center|LOCUS_13320 69086 68676 gene locus_tag LOCUS_13330 69086 68676 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026896.1 protein_id gnl|my_center|LOCUS_13330 69366 71237 gene locus_tag LOCUS_13340 69366 71237 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228610.1 protein_id gnl|my_center|LOCUS_13340 71245 72012 gene locus_tag LOCUS_13350 71245 72012 CDS product endo alpha-1,4 polygalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027189.1 protein_id gnl|my_center|LOCUS_13350 72291 72031 gene locus_tag LOCUS_13360 72291 72031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 73285 72320 gene locus_tag LOCUS_13370 73285 72320 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223022.1 protein_id gnl|my_center|LOCUS_13370 73815 73339 gene locus_tag LOCUS_13380 73815 73339 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226310.1 protein_id gnl|my_center|LOCUS_13380 74395 73859 gene locus_tag LOCUS_13390 74395 73859 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892919.1 protein_id gnl|my_center|LOCUS_13390 74500 75408 gene locus_tag LOCUS_13400 74500 75408 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892918.1 protein_id gnl|my_center|LOCUS_13400 76806 75550 gene locus_tag LOCUS_13410 76806 75550 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225393.1 protein_id gnl|my_center|LOCUS_13410 78119 76803 gene locus_tag LOCUS_13420 78119 76803 CDS product cellulose-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973600.1 protein_id gnl|my_center|LOCUS_13420 79602 78262 gene locus_tag LOCUS_13430 gene ccrA 79602 78262 CDS product crotonyl-CoA carboxylase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283587.1 protein_id gnl|my_center|LOCUS_13430 79958 79728 gene locus_tag LOCUS_13440 79958 79728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 80506 80051 gene locus_tag LOCUS_13450 gene mce 80506 80051 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223476.1 protein_id gnl|my_center|LOCUS_13450 80640 81830 gene locus_tag LOCUS_13460 80640 81830 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084654.1 protein_id gnl|my_center|LOCUS_13460 81814 82794 gene locus_tag LOCUS_13470 gene meaB 81814 82794 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030222.1 protein_id gnl|my_center|LOCUS_13470 84156 82897 gene locus_tag LOCUS_13480 84156 82897 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929866.1 protein_id gnl|my_center|LOCUS_13480 84240 85178 gene locus_tag LOCUS_13490 84240 85178 CDS product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406887.1 protein_id gnl|my_center|LOCUS_13490 85222 86004 gene locus_tag LOCUS_13500 85222 86004 CDS product EI24 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028326.1 protein_id gnl|my_center|LOCUS_13500 86881 85976 gene locus_tag LOCUS_13510 86881 85976 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028565.1 protein_id gnl|my_center|LOCUS_13510 86955 87884 gene locus_tag LOCUS_13520 86955 87884 CDS product O-acetylserine/cysteine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526255.1 protein_id gnl|my_center|LOCUS_13520 88461 87814 gene locus_tag LOCUS_13530 88461 87814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 89993 89046 gene locus_tag LOCUS_13540 89993 89046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 92264 90000 gene locus_tag LOCUS_13550 gene glgB 92264 90000 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224470.1 protein_id gnl|my_center|LOCUS_13550 93676 92261 gene locus_tag LOCUS_13560 93676 92261 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731333.1 protein_id gnl|my_center|LOCUS_13560 95445 93673 gene locus_tag LOCUS_13570 gene treS 95445 93673 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973556.1 protein_id gnl|my_center|LOCUS_13570 97409 95442 gene locus_tag LOCUS_13580 97409 95442 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031595.1 protein_id gnl|my_center|LOCUS_13580 101119 97565 gene locus_tag LOCUS_13590 101119 97565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 101237 103837 gene locus_tag LOCUS_13600 101237 103837 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486976.1 protein_id gnl|my_center|LOCUS_13600 106002 103891 gene locus_tag LOCUS_13610 gene glgX 106002 103891 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123389167.1 protein_id gnl|my_center|LOCUS_13610 106108 106887 gene locus_tag LOCUS_13620 106108 106887 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030262.1 protein_id gnl|my_center|LOCUS_13620 106893 107327 gene locus_tag LOCUS_13630 106893 107327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 107458 108336 gene locus_tag LOCUS_13640 107458 108336 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027565.1 protein_id gnl|my_center|LOCUS_13640 108355 109308 gene locus_tag LOCUS_13650 108355 109308 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027564.1 protein_id gnl|my_center|LOCUS_13650 110262 109402 gene locus_tag LOCUS_13660 110262 109402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 110858 110259 gene locus_tag LOCUS_13670 110858 110259 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974105.1 protein_id gnl|my_center|LOCUS_13670 111635 110910 gene locus_tag LOCUS_13680 111635 110910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 111938 113197 gene locus_tag LOCUS_13690 111938 113197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 113985 113518 gene locus_tag LOCUS_13700 113985 113518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 114029 115288 gene locus_tag LOCUS_13710 114029 115288 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976218.1 protein_id gnl|my_center|LOCUS_13710 115319 115942 gene locus_tag LOCUS_13720 115319 115942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 115949 116413 gene locus_tag LOCUS_13730 115949 116413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 116465 116632 gene locus_tag LOCUS_13740 116465 116632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 116685 117296 gene locus_tag LOCUS_13750 gene nadD 116685 117296 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015061.1 protein_id gnl|my_center|LOCUS_13750 117306 117683 gene locus_tag LOCUS_13760 gene rsfS 117306 117683 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976226.1 protein_id gnl|my_center|LOCUS_13760 117680 118297 gene locus_tag LOCUS_13770 117680 118297 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084950.1 protein_id gnl|my_center|LOCUS_13770 118362 118436 gene locus_tag LOCUS_t00220 118362 118436 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 119082 119903 gene locus_tag LOCUS_13780 119082 119903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 119939 120619 gene locus_tag LOCUS_13790 119939 120619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 120712 121422 gene locus_tag LOCUS_13800 120712 121422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 121897 123237 gene locus_tag LOCUS_13810 121897 123237 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110107303.1 protein_id gnl|my_center|LOCUS_13810 123819 123487 gene locus_tag LOCUS_13820 123819 123487 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015550.1 protein_id gnl|my_center|LOCUS_13820 123856 125520 gene locus_tag LOCUS_13830 123856 125520 CDS product bifunctional 3'-5' exonuclease/DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930206.1 protein_id gnl|my_center|LOCUS_13830 125539 128520 gene locus_tag LOCUS_13840 125539 128520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 130038 128539 gene locus_tag LOCUS_13850 130038 128539 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043782908.1 protein_id gnl|my_center|LOCUS_13850 130094 131056 gene locus_tag LOCUS_13860 130094 131056 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223455.1 protein_id gnl|my_center|LOCUS_13860 131202 132707 gene locus_tag LOCUS_13870 131202 132707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 132704 133237 gene locus_tag LOCUS_13880 132704 133237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 134081 133308 gene locus_tag LOCUS_13890 134081 133308 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337278.1 protein_id gnl|my_center|LOCUS_13890 134096 135004 gene locus_tag LOCUS_13900 134096 135004 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893577.1 protein_id gnl|my_center|LOCUS_13900 135007 135651 gene locus_tag LOCUS_13910 135007 135651 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225351.1 protein_id gnl|my_center|LOCUS_13910 135804 138302 gene locus_tag LOCUS_13920 gene leuS 135804 138302 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938492.1 protein_id gnl|my_center|LOCUS_13920 138295 138624 gene locus_tag LOCUS_13930 138295 138624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 138635 139525 gene locus_tag LOCUS_13940 138635 139525 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976234.1 protein_id gnl|my_center|LOCUS_13940 139595 139966 gene locus_tag LOCUS_13950 139595 139966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 140001 143042 gene locus_tag LOCUS_13960 140001 143042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 143124 144824 gene locus_tag LOCUS_13970 143124 144824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 144952 145989 gene locus_tag LOCUS_13980 144952 145989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 146000 148363 gene locus_tag LOCUS_13990 146000 148363 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028431.1 protein_id gnl|my_center|LOCUS_13990 148415 149401 gene locus_tag LOCUS_14000 gene holA 148415 149401 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485035.1 protein_id gnl|my_center|LOCUS_14000 149733 149473 gene locus_tag LOCUS_14010 gene rpsT 149733 149473 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976241.1 protein_id gnl|my_center|LOCUS_14010 150837 149851 gene locus_tag LOCUS_14020 150837 149851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 151845 150856 gene locus_tag LOCUS_14030 151845 150856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 151950 153830 gene locus_tag LOCUS_14040 gene lepA 151950 153830 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976242.1 protein_id gnl|my_center|LOCUS_14040 153834 154727 gene locus_tag LOCUS_14050 153834 154727 CDS product streptomycin 6-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729101.1 protein_id gnl|my_center|LOCUS_14050 154751 155338 gene locus_tag LOCUS_14060 154751 155338 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189284363.1 protein_id gnl|my_center|LOCUS_14060 155425 157248 gene locus_tag LOCUS_14070 155425 157248 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485037.1 protein_id gnl|my_center|LOCUS_14070 158360 157401 gene locus_tag LOCUS_14080 158360 157401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 158652 159860 gene locus_tag LOCUS_14090 gene hemW 158652 159860 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326185.1 protein_id gnl|my_center|LOCUS_14090 160677 159844 gene locus_tag LOCUS_14100 160677 159844 CDS product DUF3097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728763.1 protein_id gnl|my_center|LOCUS_14100 160916 160713 gene locus_tag LOCUS_14110 160916 160713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 161829 160972 gene locus_tag LOCUS_14120 161829 160972 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228583.1 protein_id gnl|my_center|LOCUS_14120 162149 161835 gene locus_tag LOCUS_14130 162149 161835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 162051 163085 gene locus_tag LOCUS_14140 gene hrcA 162051 163085 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976249.1 protein_id gnl|my_center|LOCUS_14140 163144 164295 gene locus_tag LOCUS_14150 gene dnaJ 163144 164295 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976250.1 protein_id gnl|my_center|LOCUS_14150 164308 165048 gene locus_tag LOCUS_14160 164308 165048 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976252.1 protein_id gnl|my_center|LOCUS_14160 165985 165056 gene locus_tag LOCUS_14170 165985 165056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 166119 166460 gene locus_tag LOCUS_14180 166119 166460 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976256.1 protein_id gnl|my_center|LOCUS_14180 166788 166504 gene locus_tag LOCUS_14190 166788 166504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 166962 167975 gene locus_tag LOCUS_14200 166962 167975 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976271.1 protein_id gnl|my_center|LOCUS_14200 167983 168432 gene locus_tag LOCUS_14210 gene ybeY 167983 168432 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060346.1 protein_id gnl|my_center|LOCUS_14210 168443 169768 gene locus_tag LOCUS_14220 168443 169768 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895866.1 protein_id gnl|my_center|LOCUS_14220 169813 171516 gene locus_tag LOCUS_14230 gene sppA 169813 171516 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727691.1 protein_id gnl|my_center|LOCUS_14230 171521 171889 gene locus_tag LOCUS_14240 171521 171889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 172007 173392 gene locus_tag LOCUS_14250 172007 173392 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005121857.1 protein_id gnl|my_center|LOCUS_14250 173400 174692 gene locus_tag LOCUS_14260 173400 174692 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897704.1 protein_id gnl|my_center|LOCUS_14260 174715 175431 gene locus_tag LOCUS_14270 174715 175431 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977203.1 protein_id gnl|my_center|LOCUS_14270 175428 176384 gene locus_tag LOCUS_14280 gene era 175428 176384 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326176.1 protein_id gnl|my_center|LOCUS_14280 177358 176504 gene locus_tag LOCUS_14290 177358 176504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 178127 177351 gene locus_tag LOCUS_14300 178127 177351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 178712 178230 gene locus_tag LOCUS_14310 178712 178230 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069385.1 protein_id gnl|my_center|LOCUS_14310 178860 179534 gene locus_tag LOCUS_14320 178860 179534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 180113 179616 gene locus_tag LOCUS_14330 180113 179616 CDS product DUF6328 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079520.1 protein_id gnl|my_center|LOCUS_14330 180283 182019 gene locus_tag LOCUS_14340 gene leuA 180283 182019 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930223.1 protein_id gnl|my_center|LOCUS_14340 184837 182030 gene locus_tag LOCUS_14350 184837 182030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 184919 185782 gene locus_tag LOCUS_14360 184919 185782 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467188.1 protein_id gnl|my_center|LOCUS_14360 185799 186527 gene locus_tag LOCUS_14370 gene recO 185799 186527 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863758.1 protein_id gnl|my_center|LOCUS_14370 187140 186616 gene locus_tag LOCUS_14380 187140 186616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 187847 187221 gene locus_tag LOCUS_14390 187847 187221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 188441 187980 gene locus_tag LOCUS_14400 188441 187980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 188644 189336 gene locus_tag LOCUS_14410 188644 189336 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976293.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14410 190571 189561 gene locus_tag LOCUS_14420 190571 189561 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028393.1 protein_id gnl|my_center|LOCUS_14420 191370 190579 gene locus_tag LOCUS_14430 191370 190579 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028392.1 protein_id gnl|my_center|LOCUS_14430 192260 191361 gene locus_tag LOCUS_14440 192260 191361 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976297.1 protein_id gnl|my_center|LOCUS_14440 194438 192453 gene locus_tag LOCUS_14450 194438 192453 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229847.1 protein_id gnl|my_center|LOCUS_14450 195579 194533 gene locus_tag LOCUS_14460 gene sepH 195579 194533 CDS product septation protein SepH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973165.1 protein_id gnl|my_center|LOCUS_14460 195656 196276 gene locus_tag LOCUS_14470 195656 196276 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973517.1 protein_id gnl|my_center|LOCUS_14470 197124 196324 gene locus_tag LOCUS_14480 197124 196324 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283913.1 protein_id gnl|my_center|LOCUS_14480 198305 197184 gene locus_tag LOCUS_14490 198305 197184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 198856 198302 gene locus_tag LOCUS_14500 198856 198302 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225162.1 protein_id gnl|my_center|LOCUS_14500 200075 198867 gene locus_tag LOCUS_14510 200075 198867 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973162.1 protein_id gnl|my_center|LOCUS_14510 200218 202446 gene locus_tag LOCUS_14520 200218 202446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 202451 203545 gene locus_tag LOCUS_14530 202451 203545 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973161.1 protein_id gnl|my_center|LOCUS_14530 203542 204369 gene locus_tag LOCUS_14540 203542 204369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 204497 204799 gene locus_tag LOCUS_14550 204497 204799 CDS product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003993510.1 protein_id gnl|my_center|LOCUS_14550 205510 205199 gene locus_tag LOCUS_14560 205510 205199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 206013 205549 gene locus_tag LOCUS_14570 206013 205549 CDS product DUF3093 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973155.1 protein_id gnl|my_center|LOCUS_14570 206086 206601 gene locus_tag LOCUS_14580 gene dut 206086 206601 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224478.1 protein_id gnl|my_center|LOCUS_14580 206598 207236 gene locus_tag LOCUS_14590 206598 207236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 207243 207608 gene locus_tag LOCUS_14600 207243 207608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 207605 208363 gene locus_tag LOCUS_14610 207605 208363 CDS product DUF3159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230310.1 protein_id gnl|my_center|LOCUS_14610 209115 208444 gene locus_tag LOCUS_14620 209115 208444 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973146.1 protein_id gnl|my_center|LOCUS_14620 209806 209138 gene locus_tag LOCUS_14630 209806 209138 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973145.1 protein_id gnl|my_center|LOCUS_14630 209801 211912 gene locus_tag LOCUS_14640 209801 211912 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742167.1 protein_id gnl|my_center|LOCUS_14640 211909 213045 gene locus_tag LOCUS_14650 211909 213045 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111514.1 protein_id gnl|my_center|LOCUS_14650 213305 213805 gene locus_tag LOCUS_14660 213305 213805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 213805 214824 gene locus_tag LOCUS_14670 213805 214824 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331254.1 protein_id gnl|my_center|LOCUS_14670 215854 214886 gene locus_tag LOCUS_14680 215854 214886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223235.1 protein_id gnl|my_center|LOCUS_14680 215930 216883 gene locus_tag LOCUS_14690 215930 216883 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918355.1 protein_id gnl|my_center|LOCUS_14690 216880 218109 gene locus_tag LOCUS_14700 216880 218109 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728095.1 protein_id gnl|my_center|LOCUS_14700 218111 220438 gene locus_tag LOCUS_14710 218111 220438 CDS product pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235190946.1 protein_id gnl|my_center|LOCUS_14710 220500 221471 gene locus_tag LOCUS_14720 220500 221471 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206714.1 protein_id gnl|my_center|LOCUS_14720 221584 223095 gene locus_tag LOCUS_14730 221584 223095 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243012.1 protein_id gnl|my_center|LOCUS_14730 223448 224572 gene locus_tag LOCUS_14740 223448 224572 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404710.1 protein_id gnl|my_center|LOCUS_14740 224554 225132 gene locus_tag LOCUS_14750 224554 225132 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236074025.1 protein_id gnl|my_center|LOCUS_14750 225129 225407 gene locus_tag LOCUS_14760 225129 225407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 225404 226882 gene locus_tag LOCUS_14770 225404 226882 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211039795.1 protein_id gnl|my_center|LOCUS_14770 227467 226901 gene locus_tag LOCUS_14780 227467 226901 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028998.1 protein_id gnl|my_center|LOCUS_14780 228200 227535 gene locus_tag LOCUS_14790 228200 227535 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028999.1 protein_id gnl|my_center|LOCUS_14790 228302 229543 gene locus_tag LOCUS_14800 228302 229543 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236074023.1 protein_id gnl|my_center|LOCUS_14800 229540 230415 gene locus_tag LOCUS_14810 229540 230415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 230412 231239 gene locus_tag LOCUS_14820 230412 231239 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028995.1 protein_id gnl|my_center|LOCUS_14820 231236 232345 gene locus_tag LOCUS_14830 231236 232345 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028994.1 protein_id gnl|my_center|LOCUS_14830 232476 233207 gene locus_tag LOCUS_14840 232476 233207 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028987.1 protein_id gnl|my_center|LOCUS_14840 233898 233356 gene locus_tag LOCUS_14850 233898 233356 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921658.1 protein_id gnl|my_center|LOCUS_14850 234031 234723 gene locus_tag LOCUS_14860 gene cmr 234031 234723 CDS product HTH-type transcriptional regulator Cmr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898967.1 protein_id gnl|my_center|LOCUS_14860 234964 236307 gene locus_tag LOCUS_14870 234964 236307 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086856069.1 protein_id gnl|my_center|LOCUS_14870 237289 236801 gene locus_tag LOCUS_14880 237289 236801 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859290.1 protein_id gnl|my_center|LOCUS_14880 238049 237312 gene locus_tag LOCUS_14890 238049 237312 CDS product Rv2466c family mycothiol-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412664.1 protein_id gnl|my_center|LOCUS_14890 238124 238849 gene locus_tag LOCUS_14900 238124 238849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14900 238732 239112 gene locus_tag LOCUS_14910 238732 239112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 239431 239613 gene locus_tag LOCUS_14920 239431 239613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 240390 239737 gene locus_tag LOCUS_14930 240390 239737 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966671.1 protein_id gnl|my_center|LOCUS_14930 240498 241610 gene locus_tag LOCUS_14940 240498 241610 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408279.1 protein_id gnl|my_center|LOCUS_14940 241603 242553 gene locus_tag LOCUS_14950 241603 242553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408272.1 protein_id gnl|my_center|LOCUS_14950 242550 243509 gene locus_tag LOCUS_14960 242550 243509 CDS product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125171.1 protein_id gnl|my_center|LOCUS_14960 243506 244249 gene locus_tag LOCUS_14970 243506 244249 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403548.1 protein_id gnl|my_center|LOCUS_14970 244268 246025 gene locus_tag LOCUS_14980 244268 246025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 247519 246167 gene locus_tag LOCUS_14990 247519 246167 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296237.1 protein_id gnl|my_center|LOCUS_14990 247827 247516 gene locus_tag LOCUS_15000 247827 247516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 248224 247820 gene locus_tag LOCUS_15010 248224 247820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 248175 248567 gene locus_tag LOCUS_15020 248175 248567 CDS product hypoxia response transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900026.1 protein_id gnl|my_center|LOCUS_15020 250318 248924 gene locus_tag LOCUS_15030 250318 248924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 250427 251251 gene locus_tag LOCUS_15040 250427 251251 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727421.1 protein_id gnl|my_center|LOCUS_15040 251333 252130 gene locus_tag LOCUS_15050 251333 252130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 252411 255233 gene locus_tag LOCUS_15060 gene acnA 252411 255233 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972923.1 protein_id gnl|my_center|LOCUS_15060 255354 256019 gene locus_tag LOCUS_15070 255354 256019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 256042 256368 gene locus_tag LOCUS_15080 256042 256368 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726762.1 protein_id gnl|my_center|LOCUS_15080 256380 256937 gene locus_tag LOCUS_15090 256380 256937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 256943 257350 gene locus_tag LOCUS_15100 256943 257350 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977690.1 protein_id gnl|my_center|LOCUS_15100 257391 257762 gene locus_tag LOCUS_15110 257391 257762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 257863 260154 gene locus_tag LOCUS_15120 257863 260154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 260183 261049 gene locus_tag LOCUS_15130 260183 261049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 261046 261987 gene locus_tag LOCUS_15140 261046 261987 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228739.1 protein_id gnl|my_center|LOCUS_15140 262058 263962 gene locus_tag LOCUS_15150 gene dxs 262058 263962 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972908.1 protein_id gnl|my_center|LOCUS_15150 263946 265343 gene locus_tag LOCUS_15160 263946 265343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 265420 266370 gene locus_tag LOCUS_15170 265420 266370 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229588.1 protein_id gnl|my_center|LOCUS_15170 266367 267224 gene locus_tag LOCUS_15180 gene tesB 266367 267224 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972544.1 protein_id gnl|my_center|LOCUS_15180 268196 267351 gene locus_tag LOCUS_15190 268196 267351 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230939.1 protein_id gnl|my_center|LOCUS_15190 269558 268200 gene locus_tag LOCUS_15200 269558 268200 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230940.1 protein_id gnl|my_center|LOCUS_15200 269710 270999 gene locus_tag LOCUS_15210 269710 270999 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230941.1 protein_id gnl|my_center|LOCUS_15210 271776 271084 gene locus_tag LOCUS_15220 271776 271084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 273419 271869 gene locus_tag LOCUS_15230 273419 271869 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877353.1 protein_id gnl|my_center|LOCUS_15230 273522 276791 gene locus_tag LOCUS_15240 273522 276791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 277617 277024 gene locus_tag LOCUS_15250 277617 277024 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403451.1 protein_id gnl|my_center|LOCUS_15250 278446 277673 gene locus_tag LOCUS_15260 278446 277673 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729165.1 protein_id gnl|my_center|LOCUS_15260 278493 279440 gene locus_tag LOCUS_15270 278493 279440 CDS product DNA-3-methyladenine glycosylase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139979125.1 protein_id gnl|my_center|LOCUS_15270 280639 279446 gene locus_tag LOCUS_15280 280639 279446 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077087.1 protein_id gnl|my_center|LOCUS_15280 280762 281991 gene locus_tag LOCUS_15290 280762 281991 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168581903.1 protein_id gnl|my_center|LOCUS_15290 282077 283420 gene locus_tag LOCUS_15300 282077 283420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 283816 285942 gene locus_tag LOCUS_15310 gene uvrB 283816 285942 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028069.1 protein_id gnl|my_center|LOCUS_15310 286095 287456 gene locus_tag LOCUS_15320 286095 287456 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975127.1 protein_id gnl|my_center|LOCUS_15320 287453 287752 gene locus_tag LOCUS_15330 287453 287752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268497.1 protein_id gnl|my_center|LOCUS_15330 287929 288675 gene locus_tag LOCUS_15340 287929 288675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 288692 289954 gene locus_tag LOCUS_15350 288692 289954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 290888 289962 gene locus_tag LOCUS_15360 290888 289962 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804229.1 protein_id gnl|my_center|LOCUS_15360 290975 292339 gene locus_tag LOCUS_15370 gene chrA 290975 292339 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969287.1 protein_id gnl|my_center|LOCUS_15370 294689 292359 gene locus_tag LOCUS_15380 294689 292359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 295207 294758 gene locus_tag LOCUS_15390 295207 294758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 295535 295200 gene locus_tag LOCUS_15400 295535 295200 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257824.1 protein_id gnl|my_center|LOCUS_15400 297568 295532 gene locus_tag LOCUS_15410 297568 295532 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257823.1 protein_id gnl|my_center|LOCUS_15410 298764 297565 gene locus_tag LOCUS_15420 298764 297565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 299452 298919 gene locus_tag LOCUS_15430 299452 298919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 299697 300470 gene locus_tag LOCUS_15440 299697 300470 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976385.1 protein_id gnl|my_center|LOCUS_15440 300470 301309 gene locus_tag LOCUS_15450 300470 301309 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223674.1 protein_id gnl|my_center|LOCUS_15450 301323 302669 gene locus_tag LOCUS_15460 301323 302669 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976387.1 protein_id gnl|my_center|LOCUS_15460 302666 303754 gene locus_tag LOCUS_15470 302666 303754 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222535.1 protein_id gnl|my_center|LOCUS_15470 303822 304814 gene locus_tag LOCUS_15480 303822 304814 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284352.1 protein_id gnl|my_center|LOCUS_15480 304811 306037 gene locus_tag LOCUS_15490 304811 306037 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222537.1 protein_id gnl|my_center|LOCUS_15490 306034 307386 gene locus_tag LOCUS_15500 306034 307386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 307383 308672 gene locus_tag LOCUS_15510 307383 308672 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068112509.1 protein_id gnl|my_center|LOCUS_15510 308669 309199 gene locus_tag LOCUS_15520 308669 309199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 309209 309940 gene locus_tag LOCUS_15530 309209 309940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 310011 310982 gene locus_tag LOCUS_15540 310011 310982 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284007.1 protein_id gnl|my_center|LOCUS_15540 310994 311188 gene locus_tag LOCUS_15550 310994 311188 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730111.1 protein_id gnl|my_center|LOCUS_15550 311189 312094 gene locus_tag LOCUS_15560 311189 312094 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730882.1 protein_id gnl|my_center|LOCUS_15560 312096 312854 gene locus_tag LOCUS_15570 312096 312854 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224298.1 protein_id gnl|my_center|LOCUS_15570 312873 313367 gene locus_tag LOCUS_15580 312873 313367 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225733.1 protein_id gnl|my_center|LOCUS_15580 314440 313499 gene locus_tag LOCUS_15590 314440 313499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148043383.1 protein_id gnl|my_center|LOCUS_15590 315333 314692 gene locus_tag LOCUS_15600 gene kstR 315333 314692 CDS product cholesterol catabolism transcriptional regulator KstR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224372.1 protein_id gnl|my_center|LOCUS_15600 315486 316766 gene locus_tag LOCUS_15610 315486 316766 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731311.1 protein_id gnl|my_center|LOCUS_15610 316770 317531 gene locus_tag LOCUS_15620 316770 317531 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731310.1 protein_id gnl|my_center|LOCUS_15620 317524 318627 gene locus_tag LOCUS_15630 317524 318627 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731309.1 protein_id gnl|my_center|LOCUS_15630 319400 318735 gene locus_tag LOCUS_15640 319400 318735 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192781106.1 protein_id gnl|my_center|LOCUS_15640 319487 321556 gene locus_tag LOCUS_15650 319487 321556 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224373.1 protein_id gnl|my_center|LOCUS_15650 322826 321567 gene locus_tag LOCUS_15660 322826 321567 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224376.1 protein_id gnl|my_center|LOCUS_15660 322957 324393 gene locus_tag LOCUS_15670 322957 324393 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224377.1 protein_id gnl|my_center|LOCUS_15670 324404 325780 gene locus_tag LOCUS_15680 324404 325780 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410042.1 protein_id gnl|my_center|LOCUS_15680 326212 327033 gene locus_tag LOCUS_15690 326212 327033 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225290.1 protein_id gnl|my_center|LOCUS_15690 327956 327042 gene locus_tag LOCUS_15700 327956 327042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 328071 330293 gene locus_tag LOCUS_15710 328071 330293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 330290 330799 gene locus_tag LOCUS_15720 330290 330799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15720 330796 331191 gene locus_tag LOCUS_15730 330796 331191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15730 331188 331574 gene locus_tag LOCUS_15740 gene chsH1 331188 331574 CDS product 3-oxo-23,24-bisnorchol-4,17(20)-dien-22-oyl-CoA hydratase subunit beta ChsH1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419290.1 protein_id gnl|my_center|LOCUS_15740 331571 332755 gene locus_tag LOCUS_15750 331571 332755 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224384.1 protein_id gnl|my_center|LOCUS_15750 332799 333437 gene locus_tag LOCUS_15760 332799 333437 CDS product SatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730969.1 protein_id gnl|my_center|LOCUS_15760 333442 334191 gene locus_tag LOCUS_15770 333442 334191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 334202 334669 gene locus_tag LOCUS_15780 334202 334669 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729045.1 protein_id gnl|my_center|LOCUS_15780 336152 334884 gene locus_tag LOCUS_15790 336152 334884 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074038115.1 protein_id gnl|my_center|LOCUS_15790 337138 336350 gene locus_tag LOCUS_15800 337138 336350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 337923 337141 gene locus_tag LOCUS_15810 337923 337141 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111854.1 protein_id gnl|my_center|LOCUS_15810 337922 339421 gene locus_tag LOCUS_15820 337922 339421 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485823.1 protein_id gnl|my_center|LOCUS_15820 340345 339494 gene locus_tag LOCUS_15830 340345 339494 CDS product bacteriorhodopsin-like inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140202.1 protein_id gnl|my_center|LOCUS_15830 341450 340509 gene locus_tag LOCUS_15840 341450 340509 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978674.1 protein_id gnl|my_center|LOCUS_15840 341960 341514 gene locus_tag LOCUS_15850 341960 341514 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895709.1 protein_id gnl|my_center|LOCUS_15850 342029 343312 gene locus_tag LOCUS_15860 342029 343312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 343362 344714 gene locus_tag LOCUS_15870 343362 344714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 344711 345322 gene locus_tag LOCUS_15880 344711 345322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 345363 346595 gene locus_tag LOCUS_15890 345363 346595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 347100 346657 gene locus_tag LOCUS_15900 347100 346657 CDS product OsmC family peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224811.1 protein_id gnl|my_center|LOCUS_15900 347170 347634 gene locus_tag LOCUS_15910 347170 347634 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224812.1 protein_id gnl|my_center|LOCUS_15910 348444 347647 gene locus_tag LOCUS_15920 348444 347647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 348549 349283 gene locus_tag LOCUS_15930 348549 349283 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542425.1 protein_id gnl|my_center|LOCUS_15930 349289 351031 gene locus_tag LOCUS_15940 349289 351031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 351117 351431 gene locus_tag LOCUS_15950 351117 351431 CDS product EthD family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566769.1 protein_id gnl|my_center|LOCUS_15950 351454 352221 gene locus_tag LOCUS_15960 gene cofC 351454 352221 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973437.1 protein_id gnl|my_center|LOCUS_15960 352621 352181 gene locus_tag LOCUS_15970 352621 352181 CDS product TIGR03668 family PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226497.1 protein_id gnl|my_center|LOCUS_15970 352760 354298 gene locus_tag LOCUS_15980 352760 354298 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730671.1 protein_id gnl|my_center|LOCUS_15980 354467 355453 gene locus_tag LOCUS_15990 354467 355453 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225353.1 protein_id gnl|my_center|LOCUS_15990 356460 355477 gene locus_tag LOCUS_16000 356460 355477 CDS product TIGR03619 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222522.1 protein_id gnl|my_center|LOCUS_16000 356583 357242 gene locus_tag LOCUS_16010 356583 357242 CDS product peptidase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026982.1 protein_id gnl|my_center|LOCUS_16010 358137 357259 gene locus_tag LOCUS_16020 358137 357259 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224387.1 protein_id gnl|my_center|LOCUS_16020 359783 358137 gene locus_tag LOCUS_16030 gene kstD 359783 358137 CDS product 3-oxosteroid 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224391.1 protein_id gnl|my_center|LOCUS_16030 359878 360711 gene locus_tag LOCUS_16040 359878 360711 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095297.1 protein_id gnl|my_center|LOCUS_16040 360714 361619 gene locus_tag LOCUS_16050 360714 361619 CDS product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419251.1 protein_id gnl|my_center|LOCUS_16050 361616 362695 gene locus_tag LOCUS_16060 gene dmpG 361616 362695 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419250.1 protein_id gnl|my_center|LOCUS_16060 363532 362705 gene locus_tag LOCUS_16070 363532 362705 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226050.1 protein_id gnl|my_center|LOCUS_16070 364602 363553 gene locus_tag LOCUS_16080 364602 363553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 364696 365586 gene locus_tag LOCUS_16090 364696 365586 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044081650.1 protein_id gnl|my_center|LOCUS_16090 365702 366868 gene locus_tag LOCUS_16100 365702 366868 CDS product flavin-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224393.1 protein_id gnl|my_center|LOCUS_16100 366873 367790 gene locus_tag LOCUS_16110 366873 367790 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224394.1 protein_id gnl|my_center|LOCUS_16110 367787 368686 gene locus_tag LOCUS_16120 367787 368686 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224395.1 protein_id gnl|my_center|LOCUS_16120 368704 369348 gene locus_tag LOCUS_16130 368704 369348 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224396.1 protein_id gnl|my_center|LOCUS_16130 369350 370267 gene locus_tag LOCUS_16140 369350 370267 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111129.1 protein_id gnl|my_center|LOCUS_16140 371771 370287 gene locus_tag LOCUS_16150 371771 370287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 371907 372293 gene locus_tag LOCUS_16160 371907 372293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 372556 372954 gene locus_tag LOCUS_16170 372556 372954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 372961 373290 gene locus_tag LOCUS_16180 372961 373290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 373808 373374 gene locus_tag LOCUS_16190 373808 373374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 374145 373909 gene locus_tag LOCUS_16200 374145 373909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 374311 375648 gene locus_tag LOCUS_16210 374311 375648 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416051.1 protein_id gnl|my_center|LOCUS_16210 375778 375659 gene locus_tag LOCUS_16220 375778 375659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 375910 376182 gene locus_tag LOCUS_16230 375910 376182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 377180 376179 gene locus_tag LOCUS_16240 377180 376179 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742091.1 protein_id gnl|my_center|LOCUS_16240 377908 377180 gene locus_tag LOCUS_16250 377908 377180 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113158.1 protein_id gnl|my_center|LOCUS_16250 379224 378064 gene locus_tag LOCUS_16260 379224 378064 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225245.1 protein_id gnl|my_center|LOCUS_16260 380748 379228 gene locus_tag LOCUS_16270 380748 379228 CDS product FadD3 family acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225243.1 protein_id gnl|my_center|LOCUS_16270 380770 381984 gene locus_tag LOCUS_16280 380770 381984 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113162.1 protein_id gnl|my_center|LOCUS_16280 381985 382788 gene locus_tag LOCUS_16290 381985 382788 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225241.1 protein_id gnl|my_center|LOCUS_16290 382788 383387 gene locus_tag LOCUS_16300 gene kstR2 382788 383387 CDS product TetR family transcriptional regulator KstR2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419329.1 protein_id gnl|my_center|LOCUS_16300 383389 384552 gene locus_tag LOCUS_16310 383389 384552 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225240.1 protein_id gnl|my_center|LOCUS_16310 385765 384638 gene locus_tag LOCUS_16320 385765 384638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 386048 386707 gene locus_tag LOCUS_16330 386048 386707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 388460 386724 gene locus_tag LOCUS_16340 388460 386724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 389807 388626 gene locus_tag LOCUS_16350 389807 388626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 389989 389804 gene locus_tag LOCUS_16360 389989 389804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 390171 391277 gene locus_tag LOCUS_16370 390171 391277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 392377 391274 gene locus_tag LOCUS_16380 392377 391274 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113167.1 protein_id gnl|my_center|LOCUS_16380 393141 392374 gene locus_tag LOCUS_16390 393141 392374 CDS product CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225237.1 protein_id gnl|my_center|LOCUS_16390 394019 393138 gene locus_tag LOCUS_16400 394019 393138 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225236.1 protein_id gnl|my_center|LOCUS_16400 394771 394016 gene locus_tag LOCUS_16410 394771 394016 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897402.1 protein_id gnl|my_center|LOCUS_16410 394821 395570 gene locus_tag LOCUS_16420 394821 395570 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225233.1 protein_id gnl|my_center|LOCUS_16420 395604 396485 gene locus_tag LOCUS_16430 395604 396485 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730964.1 protein_id gnl|my_center|LOCUS_16430 396605 396922 gene locus_tag LOCUS_16440 396605 396922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 398057 396906 gene locus_tag LOCUS_16450 398057 396906 CDS product steroid 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085491.1 protein_id gnl|my_center|LOCUS_16450 398229 399470 gene locus_tag LOCUS_16460 398229 399470 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878473.1 protein_id gnl|my_center|LOCUS_16460 400267 399500 gene locus_tag LOCUS_16470 gene map 400267 399500 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814888.1 protein_id gnl|my_center|LOCUS_16470 400366 400959 gene locus_tag LOCUS_16480 400366 400959 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971862.1 protein_id gnl|my_center|LOCUS_16480 400959 401564 gene locus_tag LOCUS_16490 400959 401564 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971863.1 protein_id gnl|my_center|LOCUS_16490 401574 402353 gene locus_tag LOCUS_16500 401574 402353 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225798.1 protein_id gnl|my_center|LOCUS_16500 402698 402372 gene locus_tag LOCUS_16510 402698 402372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16510 402774 403196 gene locus_tag LOCUS_16520 402774 403196 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229383.1 protein_id gnl|my_center|LOCUS_16520 403204 403650 gene locus_tag LOCUS_16530 403204 403650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 404804 403647 gene locus_tag LOCUS_16540 404804 403647 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224426.1 protein_id gnl|my_center|LOCUS_16540 405850 404804 gene locus_tag LOCUS_16550 405850 404804 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224427.1 protein_id gnl|my_center|LOCUS_16550 406844 405879 gene locus_tag LOCUS_16560 406844 405879 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224428.1 protein_id gnl|my_center|LOCUS_16560 406902 407945 gene locus_tag LOCUS_16570 406902 407945 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078017.1 protein_id gnl|my_center|LOCUS_16570 408742 407942 gene locus_tag LOCUS_16580 408742 407942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 409186 408815 gene locus_tag LOCUS_16590 409186 408815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 409204 410808 gene locus_tag LOCUS_16600 gene fadD8 409204 410808 CDS product fatty-acid--CoA ligase FadD8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191317023.1 protein_id gnl|my_center|LOCUS_16600 410943 413003 gene locus_tag LOCUS_16610 410943 413003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 413464 413063 gene locus_tag LOCUS_16620 413464 413063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 413823 413461 gene locus_tag LOCUS_16630 413823 413461 CDS product lycopene cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225087.1 protein_id gnl|my_center|LOCUS_16630 413896 414582 gene locus_tag LOCUS_16640 413896 414582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16640 414579 415415 gene locus_tag LOCUS_16650 414579 415415 CDS product carotenoid biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225926.1 protein_id gnl|my_center|LOCUS_16650 415412 416530 gene locus_tag LOCUS_16660 415412 416530 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225927.1 protein_id gnl|my_center|LOCUS_16660 416527 418011 gene locus_tag LOCUS_16670 gene crtI 416527 418011 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225928.1 protein_id gnl|my_center|LOCUS_16670 418685 417918 gene locus_tag LOCUS_16680 418685 417918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 420288 418687 gene locus_tag LOCUS_16690 gene crtI 420288 418687 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804092.1 protein_id gnl|my_center|LOCUS_16690 421205 420285 gene locus_tag LOCUS_16700 421205 420285 CDS product squalene/phytoene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930127.1 protein_id gnl|my_center|LOCUS_16700 421333 421746 gene locus_tag LOCUS_16710 gene arr 421333 421746 CDS product NAD(+)--rifampin ADP-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727512.1 protein_id gnl|my_center|LOCUS_16710 421786 422790 gene locus_tag LOCUS_16720 421786 422790 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173775.1 protein_id gnl|my_center|LOCUS_16720 423511 422810 gene locus_tag LOCUS_16730 423511 422810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 424394 423573 gene locus_tag LOCUS_16740 424394 423573 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897311.1 protein_id gnl|my_center|LOCUS_16740 424442 426082 gene locus_tag LOCUS_16750 424442 426082 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742163.1 protein_id gnl|my_center|LOCUS_16750 426082 427185 gene locus_tag LOCUS_16760 426082 427185 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224431.1 protein_id gnl|my_center|LOCUS_16760 427272 428267 gene locus_tag LOCUS_16770 427272 428267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 428555 428220 gene locus_tag LOCUS_16780 428555 428220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 428950 428552 gene locus_tag LOCUS_16790 428950 428552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 430028 428985 gene locus_tag LOCUS_16800 430028 428985 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804096.1 protein_id gnl|my_center|LOCUS_16800 430971 430153 gene locus_tag LOCUS_16810 430971 430153 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721008.1 protein_id gnl|my_center|LOCUS_16810 431006 431671 gene locus_tag LOCUS_16820 431006 431671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 431668 432231 gene locus_tag LOCUS_16830 431668 432231 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775868.1 protein_id gnl|my_center|LOCUS_16830 433460 432387 gene locus_tag LOCUS_16840 433460 432387 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112221.1 protein_id gnl|my_center|LOCUS_16840 434739 433543 gene locus_tag LOCUS_16850 434739 433543 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094904.1 protein_id gnl|my_center|LOCUS_16850 434786 435931 gene locus_tag LOCUS_16860 434786 435931 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224390.1 protein_id gnl|my_center|LOCUS_16860 435934 436233 gene locus_tag LOCUS_16870 435934 436233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 436280 437380 gene locus_tag LOCUS_16880 436280 437380 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224388.1 protein_id gnl|my_center|LOCUS_16880 437674 438243 gene locus_tag LOCUS_16890 437674 438243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 438940 438257 gene locus_tag LOCUS_16900 438940 438257 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976859.1 protein_id gnl|my_center|LOCUS_16900 439644 438934 gene locus_tag LOCUS_16910 439644 438934 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028067.1 protein_id gnl|my_center|LOCUS_16910 439806 442886 gene locus_tag LOCUS_16920 gene uvrA 439806 442886 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028066.1 protein_id gnl|my_center|LOCUS_16920 442973 443446 gene locus_tag LOCUS_16930 442973 443446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 443443 443871 gene locus_tag LOCUS_16940 443443 443871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 443944 445413 gene locus_tag LOCUS_16950 443944 445413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 445423 446445 gene locus_tag LOCUS_16960 445423 446445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 447731 446400 gene locus_tag LOCUS_16970 447731 446400 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084112.1 protein_id gnl|my_center|LOCUS_16970 447845 449866 gene locus_tag LOCUS_16980 gene uvrC 447845 449866 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831611.1 protein_id gnl|my_center|LOCUS_16980 449869 450765 gene locus_tag LOCUS_16990 gene rapZ 449869 450765 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093455885.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16990 450762 451757 gene locus_tag LOCUS_17000 gene yvcK 450762 451757 CDS product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028061.1 protein_id gnl|my_center|LOCUS_17000 451845 452831 gene locus_tag LOCUS_17010 gene whiA 451845 452831 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224649.1 protein_id gnl|my_center|LOCUS_17010 453094 453672 gene locus_tag LOCUS_17020 453094 453672 CDS product putative glycolipid-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551593.1 protein_id gnl|my_center|LOCUS_17020 453796 454791 gene locus_tag LOCUS_17030 gene gap 453796 454791 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224666.1 protein_id gnl|my_center|LOCUS_17030 454794 456002 gene locus_tag LOCUS_17040 454794 456002 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028057.1 protein_id gnl|my_center|LOCUS_17040 456016 456813 gene locus_tag LOCUS_17050 gene tpiA 456016 456813 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976873.1 protein_id gnl|my_center|LOCUS_17050 456864 457100 gene locus_tag LOCUS_17060 gene secG 456864 457100 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325957.1 protein_id gnl|my_center|LOCUS_17060 457204 457512 gene locus_tag LOCUS_17070 457204 457512 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284344.1 protein_id gnl|my_center|LOCUS_17070 457617 457775 gene locus_tag LOCUS_17080 457617 457775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 458512 457793 gene locus_tag LOCUS_17090 gene pgl 458512 457793 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976879.1 protein_id gnl|my_center|LOCUS_17090 459450 458509 gene locus_tag LOCUS_17100 gene opcA 459450 458509 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972335.1 protein_id gnl|my_center|LOCUS_17100 460992 459454 gene locus_tag LOCUS_17110 gene zwf 460992 459454 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976881.1 protein_id gnl|my_center|LOCUS_17110 462665 460989 gene locus_tag LOCUS_17120 gene pgi 462665 460989 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804725.1 protein_id gnl|my_center|LOCUS_17120 463768 462662 gene locus_tag LOCUS_17130 gene tal 463768 462662 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224676.1 protein_id gnl|my_center|LOCUS_17130 465924 463828 gene locus_tag LOCUS_17140 gene tkt 465924 463828 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167022841.1 protein_id gnl|my_center|LOCUS_17140 466115 467062 gene locus_tag LOCUS_17150 466115 467062 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976885.1 protein_id gnl|my_center|LOCUS_17150 467371 467952 gene locus_tag LOCUS_17160 467371 467952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 468813 467971 gene locus_tag LOCUS_17170 468813 467971 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971433.1 protein_id gnl|my_center|LOCUS_17170 469774 468860 gene locus_tag LOCUS_17180 469774 468860 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897656.1 protein_id gnl|my_center|LOCUS_17180 470523 469771 gene locus_tag LOCUS_17190 470523 469771 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976890.1 protein_id gnl|my_center|LOCUS_17190 471476 470520 gene locus_tag LOCUS_17200 471476 470520 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976891.1 protein_id gnl|my_center|LOCUS_17200 471500 471865 gene locus_tag LOCUS_17210 471500 471865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 471858 472313 gene locus_tag LOCUS_17220 471858 472313 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222283.1 protein_id gnl|my_center|LOCUS_17220 473581 472298 gene locus_tag LOCUS_17230 473581 472298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 473655 474350 gene locus_tag LOCUS_17240 473655 474350 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976893.1 protein_id gnl|my_center|LOCUS_17240 474347 475765 gene locus_tag LOCUS_17250 gene sufB 474347 475765 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976894.1 protein_id gnl|my_center|LOCUS_17250 475815 476999 gene locus_tag LOCUS_17260 gene sufD 475815 476999 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976895.1 protein_id gnl|my_center|LOCUS_17260 476999 477346 gene locus_tag LOCUS_17270 476999 477346 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976896.1 protein_id gnl|my_center|LOCUS_17270 477343 478101 gene locus_tag LOCUS_17280 gene sufC 477343 478101 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805067.1 protein_id gnl|my_center|LOCUS_17280 478215 479480 gene locus_tag LOCUS_17290 478215 479480 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976898.1 protein_id gnl|my_center|LOCUS_17290 479485 479931 gene locus_tag LOCUS_17300 479485 479931 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224701.1 protein_id gnl|my_center|LOCUS_17300 479928 480314 gene locus_tag LOCUS_17310 479928 480314 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224702.1 protein_id gnl|my_center|LOCUS_17310 480507 481124 gene locus_tag LOCUS_17320 480507 481124 CDS product acVLRF1 family peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224727.1 protein_id gnl|my_center|LOCUS_17320 481121 481630 gene locus_tag LOCUS_17330 481121 481630 CDS product YfcE family phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228757.1 protein_id gnl|my_center|LOCUS_17330 481641 482549 gene locus_tag LOCUS_17340 481641 482549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 483506 482565 gene locus_tag LOCUS_17350 483506 482565 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222195.1 protein_id gnl|my_center|LOCUS_17350 483590 485188 gene locus_tag LOCUS_17360 483590 485188 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976982.1 protein_id gnl|my_center|LOCUS_17360 485227 486051 gene locus_tag LOCUS_17370 485227 486051 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028003.1 protein_id gnl|my_center|LOCUS_17370 486089 487975 gene locus_tag LOCUS_17380 486089 487975 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031376.1 protein_id gnl|my_center|LOCUS_17380 488307 487927 gene locus_tag LOCUS_17390 488307 487927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 489324 488497 gene locus_tag LOCUS_17400 489324 488497 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411514.1 protein_id gnl|my_center|LOCUS_17400 489477 490439 gene locus_tag LOCUS_17410 gene moaA 489477 490439 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106977887.1 protein_id gnl|my_center|LOCUS_17410 490442 490654 gene locus_tag LOCUS_17420 490442 490654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 490976 490659 gene locus_tag LOCUS_17430 490976 490659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 491290 492018 gene locus_tag LOCUS_17440 gene fabG 491290 492018 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977008.1 protein_id gnl|my_center|LOCUS_17440 492030 492812 gene locus_tag LOCUS_17450 gene fabI 492030 492812 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977009.1 protein_id gnl|my_center|LOCUS_17450 493348 492839 gene locus_tag LOCUS_17460 493348 492839 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_216858026.1 protein_id gnl|my_center|LOCUS_17460 493397 495094 gene locus_tag LOCUS_17470 493397 495094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 495800 495105 gene locus_tag LOCUS_17480 495800 495105 CDS product TIGR02206 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730633.1 protein_id gnl|my_center|LOCUS_17480 496185 495820 gene locus_tag LOCUS_17490 496185 495820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 498961 496187 gene locus_tag LOCUS_17500 gene cphA 498961 496187 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207603497.1 protein_id gnl|my_center|LOCUS_17500 499929 498958 gene locus_tag LOCUS_17510 499929 498958 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942561.1 protein_id gnl|my_center|LOCUS_17510 500045 500575 gene locus_tag LOCUS_17520 500045 500575 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977013.1 protein_id gnl|my_center|LOCUS_17520 500666 501400 gene locus_tag LOCUS_17530 500666 501400 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972454.1 protein_id gnl|my_center|LOCUS_17530 502637 501405 gene locus_tag LOCUS_17540 gene serB 502637 501405 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977014.1 protein_id gnl|my_center|LOCUS_17540 502722 503099 gene locus_tag LOCUS_17550 502722 503099 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119294.1 protein_id gnl|my_center|LOCUS_17550 503885 503154 gene locus_tag LOCUS_17560 503885 503154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 503942 504736 gene locus_tag LOCUS_17570 503942 504736 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284427.1 protein_id gnl|my_center|LOCUS_17570 504767 505228 gene locus_tag LOCUS_17580 504767 505228 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971919.1 protein_id gnl|my_center|LOCUS_17580 505232 506341 gene locus_tag LOCUS_17590 505232 506341 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027982.1 protein_id gnl|my_center|LOCUS_17590 506338 507102 gene locus_tag LOCUS_17600 506338 507102 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222221.1 protein_id gnl|my_center|LOCUS_17600 507478 507110 gene locus_tag LOCUS_17610 507478 507110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 508159 507512 gene locus_tag LOCUS_17620 508159 507512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 508247 508726 gene locus_tag LOCUS_17630 508247 508726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 508732 509571 gene locus_tag LOCUS_17640 508732 509571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 510565 509597 gene locus_tag LOCUS_17650 510565 509597 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081672.1 protein_id gnl|my_center|LOCUS_17650 510634 511704 gene locus_tag LOCUS_17660 510634 511704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 512648 511710 gene locus_tag LOCUS_17670 512648 511710 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865419.1 protein_id gnl|my_center|LOCUS_17670 513471 512653 gene locus_tag LOCUS_17680 513471 512653 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028652.1 protein_id gnl|my_center|LOCUS_17680 514261 513464 gene locus_tag LOCUS_17690 514261 513464 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975914.1 protein_id gnl|my_center|LOCUS_17690 514421 517582 gene locus_tag LOCUS_17700 514421 517582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 517579 521463 gene locus_tag LOCUS_17710 517579 521463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 521559 522836 gene locus_tag LOCUS_17720 gene cobA 521559 522836 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226827.1 protein_id gnl|my_center|LOCUS_17720 522829 523644 gene locus_tag LOCUS_17730 522829 523644 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067135926.1 protein_id gnl|my_center|LOCUS_17730 524359 523754 gene locus_tag LOCUS_17740 gene def 524359 523754 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974385.1 protein_id gnl|my_center|LOCUS_17740 524445 525827 gene locus_tag LOCUS_17750 524445 525827 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229644.1 protein_id gnl|my_center|LOCUS_17750 525827 527041 gene locus_tag LOCUS_17760 525827 527041 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206631.1 protein_id gnl|my_center|LOCUS_17760 527661 527113 gene locus_tag LOCUS_17770 527661 527113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 529139 527658 gene locus_tag LOCUS_17780 529139 527658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 529576 529280 gene locus_tag LOCUS_17790 529576 529280 CDS product YiaA/YiaB family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977125.1 protein_id gnl|my_center|LOCUS_17790 529815 529573 gene locus_tag LOCUS_17800 529815 529573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 529703 531052 gene locus_tag LOCUS_17810 529703 531052 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976750.1 protein_id gnl|my_center|LOCUS_17810 532208 531036 gene locus_tag LOCUS_17820 gene galK 532208 531036 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028786.1 protein_id gnl|my_center|LOCUS_17820 532179 533612 gene locus_tag LOCUS_17830 532179 533612 CDS product GuaB1 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164279790.1 protein_id gnl|my_center|LOCUS_17830 534224 533637 gene locus_tag LOCUS_17840 534224 533637 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228176.1 protein_id gnl|my_center|LOCUS_17840 534266 535243 gene locus_tag LOCUS_17850 534266 535243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 536044 535268 gene locus_tag LOCUS_17860 536044 535268 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974288.1 protein_id gnl|my_center|LOCUS_17860 536137 537537 gene locus_tag LOCUS_17870 536137 537537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 537693 537556 gene locus_tag LOCUS_17880 537693 537556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 538081 538644 gene locus_tag LOCUS_17890 538081 538644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 540948 538723 gene locus_tag LOCUS_17900 gene katG 540948 538723 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027206.1 protein_id gnl|my_center|LOCUS_17900 541397 540975 gene locus_tag LOCUS_17910 541397 540975 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225955.1 protein_id gnl|my_center|LOCUS_17910 542402 541500 gene locus_tag LOCUS_17920 542402 541500 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978710.1 protein_id gnl|my_center|LOCUS_17920 543387 542503 gene locus_tag LOCUS_17930 543387 542503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 544259 543447 gene locus_tag LOCUS_17940 544259 543447 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259682.1 protein_id gnl|my_center|LOCUS_17940 544908 544249 gene locus_tag LOCUS_17950 544908 544249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 546434 544980 gene locus_tag LOCUS_17960 546434 544980 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392987.1 protein_id gnl|my_center|LOCUS_17960 547105 546431 gene locus_tag LOCUS_17970 gene tcrA 547105 546431 CDS product two-component system response regulator TcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403148.1 protein_id gnl|my_center|LOCUS_17970 547322 547236 gene locus_tag LOCUS_t00230 547322 547236 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 547401 548741 gene locus_tag LOCUS_17980 547401 548741 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977149.1 protein_id gnl|my_center|LOCUS_17980 548992 548774 gene locus_tag LOCUS_17990 548992 548774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 549954 548992 gene locus_tag LOCUS_18000 549954 548992 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285031.1 protein_id gnl|my_center|LOCUS_18000 550035 550850 gene locus_tag LOCUS_18010 550035 550850 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226473.1 protein_id gnl|my_center|LOCUS_18010 551841 550861 gene locus_tag LOCUS_18020 gene corA 551841 550861 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027906.1 protein_id gnl|my_center|LOCUS_18020 551874 552605 gene locus_tag LOCUS_18030 551874 552605 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226474.1 protein_id gnl|my_center|LOCUS_18030 552618 553199 gene locus_tag LOCUS_18040 552618 553199 CDS product DUF3090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977160.1 protein_id gnl|my_center|LOCUS_18040 553214 553957 gene locus_tag LOCUS_18050 553214 553957 CDS product SCO1664 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080175.1 protein_id gnl|my_center|LOCUS_18050 554207 555451 gene locus_tag LOCUS_18060 gene mshC 554207 555451 CDS product cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977162.1 protein_id gnl|my_center|LOCUS_18060 556345 555479 gene locus_tag LOCUS_18070 gene parJ 556345 555479 CDS product filament polymerization regulator ParJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977163.1 protein_id gnl|my_center|LOCUS_18070 556626 560372 gene locus_tag LOCUS_18080 gene metH 556626 560372 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021268943.1 protein_id gnl|my_center|LOCUS_18080 560647 560775 gene locus_tag LOCUS_18090 560647 560775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 561082 561729 gene locus_tag LOCUS_18100 561082 561729 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467175.1 protein_id gnl|my_center|LOCUS_18100 562728 561814 gene locus_tag LOCUS_18110 562728 561814 CDS product RecB family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485830.1 protein_id gnl|my_center|LOCUS_18110 562770 563888 gene locus_tag LOCUS_18120 562770 563888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 563970 564950 gene locus_tag LOCUS_18130 563970 564950 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027901.1 protein_id gnl|my_center|LOCUS_18130 564947 565684 gene locus_tag LOCUS_18140 564947 565684 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776999.1 protein_id gnl|my_center|LOCUS_18140 565803 567557 gene locus_tag LOCUS_18150 gene arc 565803 567557 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027900.1 protein_id gnl|my_center|LOCUS_18150 568487 567714 gene locus_tag LOCUS_18160 568487 567714 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118644.1 protein_id gnl|my_center|LOCUS_18160 568374 568961 gene locus_tag LOCUS_18170 568374 568961 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776270.1 protein_id gnl|my_center|LOCUS_18170 569014 570525 gene locus_tag LOCUS_18180 gene dop 569014 570525 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977179.1 protein_id gnl|my_center|LOCUS_18180 570666 570863 gene locus_tag LOCUS_18190 570666 570863 CDS product ubiquitin-like protein Pup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027899.1 protein_id gnl|my_center|LOCUS_18190 570868 571713 gene locus_tag LOCUS_18200 gene prcB 570868 571713 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977182.1 protein_id gnl|my_center|LOCUS_18200 571710 572576 gene locus_tag LOCUS_18210 gene prcA 571710 572576 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027897.1 protein_id gnl|my_center|LOCUS_18210 572573 573115 gene locus_tag LOCUS_18220 572573 573115 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185716.1 protein_id gnl|my_center|LOCUS_18220 573318 574679 gene locus_tag LOCUS_18230 gene pafA 573318 574679 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977186.1 protein_id gnl|my_center|LOCUS_18230 574824 575834 gene locus_tag LOCUS_18240 574824 575834 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389466.1 protein_id gnl|my_center|LOCUS_18240 575866 576831 gene locus_tag LOCUS_18250 575866 576831 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226715.1 protein_id gnl|my_center|LOCUS_18250 576828 577853 gene locus_tag LOCUS_18260 576828 577853 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226714.1 protein_id gnl|my_center|LOCUS_18260 577903 578208 gene locus_tag LOCUS_18270 gene tatA 577903 578208 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977193.1 protein_id gnl|my_center|LOCUS_18270 578231 579067 gene locus_tag LOCUS_18280 gene tatC 578231 579067 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977194.1 protein_id gnl|my_center|LOCUS_18280 579077 579469 gene locus_tag LOCUS_18290 579077 579469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 579616 580512 gene locus_tag LOCUS_18300 579616 580512 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112080.1 protein_id gnl|my_center|LOCUS_18300 580509 583307 gene locus_tag LOCUS_18310 580509 583307 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027893.1 protein_id gnl|my_center|LOCUS_18310 584523 583315 gene locus_tag LOCUS_18320 584523 583315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 585461 584520 gene locus_tag LOCUS_18330 585461 584520 CDS product 5'-3' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027889.1 protein_id gnl|my_center|LOCUS_18330 585541 586002 gene locus_tag LOCUS_18340 585541 586002 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019983923.1 protein_id gnl|my_center|LOCUS_18340 587095 586148 gene locus_tag LOCUS_18350 587095 586148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 588777 587323 gene locus_tag LOCUS_18360 588777 587323 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742083.1 protein_id gnl|my_center|LOCUS_18360 588910 589968 gene locus_tag LOCUS_18370 gene kdd 588910 589968 CDS product L-erythro-3,5-diaminohexanoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015884.1 protein_id gnl|my_center|LOCUS_18370 589961 591520 gene locus_tag LOCUS_18380 589961 591520 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866976.1 protein_id gnl|my_center|LOCUS_18380 591517 593115 gene locus_tag LOCUS_18390 591517 593115 CDS product D-lysine 5,6-aminomutase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015881.1 protein_id gnl|my_center|LOCUS_18390 593115 593891 gene locus_tag LOCUS_18400 593115 593891 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902977.1 protein_id gnl|my_center|LOCUS_18400 593888 594274 gene locus_tag LOCUS_18410 593888 594274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 594841 596412 gene locus_tag LOCUS_18420 gene lnt 594841 596412 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027519.1 protein_id gnl|my_center|LOCUS_18420 596409 597161 gene locus_tag LOCUS_18430 596409 597161 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061374.1 protein_id gnl|my_center|LOCUS_18430 597186 597674 gene locus_tag LOCUS_18440 597186 597674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 598099 597710 gene locus_tag LOCUS_18450 598099 597710 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977404.1 protein_id gnl|my_center|LOCUS_18450 599687 598287 gene locus_tag LOCUS_18460 599687 598287 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258886.1 protein_id gnl|my_center|LOCUS_18460 600490 599705 gene locus_tag LOCUS_18470 600490 599705 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180933263.1 protein_id gnl|my_center|LOCUS_18470 602246 600711 gene locus_tag LOCUS_18480 602246 600711 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929956.1 protein_id gnl|my_center|LOCUS_18480 602350 603366 gene locus_tag LOCUS_18490 602350 603366 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225577.1 protein_id gnl|my_center|LOCUS_18490 603561 603397 gene locus_tag LOCUS_18500 603561 603397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 603761 604012 gene locus_tag LOCUS_18510 603761 604012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 604106 605533 gene locus_tag LOCUS_18520 604106 605533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 605618 606412 gene locus_tag LOCUS_18530 605618 606412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 607097 606429 gene locus_tag LOCUS_18540 607097 606429 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029175.1 protein_id gnl|my_center|LOCUS_18540 607531 607127 gene locus_tag LOCUS_18550 607531 607127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 607692 608963 gene locus_tag LOCUS_18560 607692 608963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 609213 609344 gene locus_tag LOCUS_18570 609213 609344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 610578 609367 gene locus_tag LOCUS_18580 610578 609367 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728661.1 protein_id gnl|my_center|LOCUS_18580 611373 610909 gene locus_tag LOCUS_18590 611373 610909 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727560.1 protein_id gnl|my_center|LOCUS_18590 611539 611333 gene locus_tag LOCUS_18600 611539 611333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 612310 611612 gene locus_tag LOCUS_18610 612310 611612 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224710.1 protein_id gnl|my_center|LOCUS_18610 613377 612382 gene locus_tag LOCUS_18620 613377 612382 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929968.1 protein_id gnl|my_center|LOCUS_18620 614114 613389 gene locus_tag LOCUS_18630 614114 613389 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067360532.1 protein_id gnl|my_center|LOCUS_18630 614190 614930 gene locus_tag LOCUS_18640 614190 614930 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027093.1 protein_id gnl|my_center|LOCUS_18640 615601 614927 gene locus_tag LOCUS_18650 615601 614927 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227864.1 protein_id gnl|my_center|LOCUS_18650 617154 615598 gene locus_tag LOCUS_18660 617154 615598 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227865.1 protein_id gnl|my_center|LOCUS_18660 617342 617914 gene locus_tag LOCUS_18670 617342 617914 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284050.1 protein_id gnl|my_center|LOCUS_18670 617911 619089 gene locus_tag LOCUS_18680 617911 619089 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027238.1 protein_id gnl|my_center|LOCUS_18680 619770 619105 gene locus_tag LOCUS_18690 619770 619105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 619900 620352 gene locus_tag LOCUS_18700 619900 620352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204250160.1 protein_id gnl|my_center|LOCUS_18700 620413 621741 gene locus_tag LOCUS_18710 620413 621741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 622730 621834 gene locus_tag LOCUS_18720 622730 621834 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109967.1 protein_id gnl|my_center|LOCUS_18720 623224 622730 gene locus_tag LOCUS_18730 623224 622730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 623362 624357 gene locus_tag LOCUS_18740 623362 624357 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222377.1 protein_id gnl|my_center|LOCUS_18740 624513 625127 gene locus_tag LOCUS_18750 624513 625127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 625191 627665 gene locus_tag LOCUS_18760 gene pepN 625191 627665 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283751.1 protein_id gnl|my_center|LOCUS_18760 627695 628462 gene locus_tag LOCUS_18770 gene fdhD 627695 628462 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876561.1 protein_id gnl|my_center|LOCUS_18770 628564 629766 gene locus_tag LOCUS_18780 628564 629766 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977530.1 protein_id gnl|my_center|LOCUS_18780 629763 632756 gene locus_tag LOCUS_18790 629763 632756 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027705.1 protein_id gnl|my_center|LOCUS_18790 633302 632769 gene locus_tag LOCUS_18800 633302 632769 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030978.1 protein_id gnl|my_center|LOCUS_18800 634097 633375 gene locus_tag LOCUS_18810 634097 633375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 634136 635698 gene locus_tag LOCUS_18820 634136 635698 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729853.1 protein_id gnl|my_center|LOCUS_18820 635695 637086 gene locus_tag LOCUS_18830 635695 637086 CDS product metallopeptidase TldD-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027992.1 protein_id gnl|my_center|LOCUS_18830 637173 637850 gene locus_tag LOCUS_18840 637173 637850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 637843 638616 gene locus_tag LOCUS_18850 637843 638616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 638693 639337 gene locus_tag LOCUS_18860 638693 639337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 640859 639351 gene locus_tag LOCUS_18870 640859 639351 CDS product CYTH and CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978319.1 protein_id gnl|my_center|LOCUS_18870 642149 640908 gene locus_tag LOCUS_18880 642149 640908 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230185.1 protein_id gnl|my_center|LOCUS_18880 645064 642146 gene locus_tag LOCUS_18890 gene gcvP 645064 642146 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027754.1 protein_id gnl|my_center|LOCUS_18890 645958 645353 gene locus_tag LOCUS_18900 645958 645353 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805153.1 protein_id gnl|my_center|LOCUS_18900 646596 646132 gene locus_tag LOCUS_18910 646596 646132 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977444.1 protein_id gnl|my_center|LOCUS_18910 647505 646678 gene locus_tag LOCUS_18920 647505 646678 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467185.1 protein_id gnl|my_center|LOCUS_18920 648046 647516 gene locus_tag LOCUS_18930 648046 647516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 648045 648290 gene locus_tag LOCUS_18940 648045 648290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 648652 648266 gene locus_tag LOCUS_18950 gene gcvH 648652 648266 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071083.1 protein_id gnl|my_center|LOCUS_18950 649472 648747 gene locus_tag LOCUS_18960 649472 648747 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027758.1 protein_id gnl|my_center|LOCUS_18960 649818 649486 gene locus_tag LOCUS_18970 649818 649486 CDS product small basic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977440.1 protein_id gnl|my_center|LOCUS_18970 650522 649815 gene locus_tag LOCUS_18980 650522 649815 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977439.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18980 651349 650756 gene locus_tag LOCUS_18990 651349 650756 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221514425.1 protein_id gnl|my_center|LOCUS_18990 652522 651470 gene locus_tag LOCUS_19000 652522 651470 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777114.1 protein_id gnl|my_center|LOCUS_19000 653943 652519 gene locus_tag LOCUS_19010 653943 652519 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777115.1 protein_id gnl|my_center|LOCUS_19010 655141 654359 gene locus_tag LOCUS_19020 655141 654359 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028594.1 protein_id gnl|my_center|LOCUS_19020 655189 656214 gene locus_tag LOCUS_19030 655189 656214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 656264 656641 gene locus_tag LOCUS_19040 656264 656641 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084268.1 protein_id gnl|my_center|LOCUS_19040 656664 657656 gene locus_tag LOCUS_19050 656664 657656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 657661 657972 gene locus_tag LOCUS_19060 657661 657972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 657969 658697 gene locus_tag LOCUS_19070 657969 658697 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063562.1 protein_id gnl|my_center|LOCUS_19070 658747 660567 gene locus_tag LOCUS_19080 658747 660567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 661166 660453 gene locus_tag LOCUS_19090 661166 660453 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027753.1 protein_id gnl|my_center|LOCUS_19090 661809 661330 gene locus_tag LOCUS_19100 661809 661330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19100 662016 663197 gene locus_tag LOCUS_19110 662016 663197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 663222 663701 gene locus_tag LOCUS_19120 663222 663701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19120 664513 663725 gene locus_tag LOCUS_19130 664513 663725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 665310 664510 gene locus_tag LOCUS_19140 665310 664510 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972912.1 protein_id gnl|my_center|LOCUS_19140 666164 665310 gene locus_tag LOCUS_19150 666164 665310 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382989.1 protein_id gnl|my_center|LOCUS_19150 667276 666161 gene locus_tag LOCUS_19160 667276 666161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 667471 668715 gene locus_tag LOCUS_19170 667471 668715 CDS product NADH:flavin oxidoreductase/NADH oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079719.1 protein_id gnl|my_center|LOCUS_19170 668909 670225 gene locus_tag LOCUS_19180 668909 670225 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227654.1 protein_id gnl|my_center|LOCUS_19180 670791 670366 gene locus_tag LOCUS_19190 670791 670366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 >Feature sequence21 765 538 gene locus_tag LOCUS_19200 765 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 712 1299 gene locus_tag LOCUS_19210 712 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19210 2770 1310 gene locus_tag LOCUS_19220 2770 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 2967 4010 gene locus_tag LOCUS_19230 2967 4010 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026966.1 protein_id gnl|my_center|LOCUS_19230 4010 4816 gene locus_tag LOCUS_19240 4010 4816 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026967.1 protein_id gnl|my_center|LOCUS_19240 4813 5847 gene locus_tag LOCUS_19250 4813 5847 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728056.1 protein_id gnl|my_center|LOCUS_19250 5899 6600 gene locus_tag LOCUS_19260 5899 6600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 6753 8876 gene locus_tag LOCUS_19270 6753 8876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 7369 7455 gene locus_tag LOCUS_t00240 7369 7455 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 8977 10035 gene locus_tag LOCUS_19280 8977 10035 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224840.1 protein_id gnl|my_center|LOCUS_19280 11690 10056 gene locus_tag LOCUS_19290 11690 10056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879694.1 protein_id gnl|my_center|LOCUS_19290 13123 11687 gene locus_tag LOCUS_19300 13123 11687 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150981032.1 protein_id gnl|my_center|LOCUS_19300 13035 14234 gene locus_tag LOCUS_19310 13035 14234 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223295.1 protein_id gnl|my_center|LOCUS_19310 14231 15094 gene locus_tag LOCUS_19320 14231 15094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19320 15100 15906 gene locus_tag LOCUS_19330 15100 15906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 16435 15851 gene locus_tag LOCUS_19340 16435 15851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 17214 16423 gene locus_tag LOCUS_19350 17214 16423 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228580.1 protein_id gnl|my_center|LOCUS_19350 18049 17207 gene locus_tag LOCUS_19360 18049 17207 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233703.1 protein_id gnl|my_center|LOCUS_19360 19048 18266 gene locus_tag LOCUS_19370 19048 18266 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484409.1 protein_id gnl|my_center|LOCUS_19370 19149 20003 gene locus_tag LOCUS_19380 19149 20003 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204051675.1 protein_id gnl|my_center|LOCUS_19380 20950 19982 gene locus_tag LOCUS_19390 20950 19982 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167379699.1 protein_id gnl|my_center|LOCUS_19390 21116 22357 gene locus_tag LOCUS_19400 21116 22357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730849.1 protein_id gnl|my_center|LOCUS_19400 22261 22338 gene locus_tag LOCUS_t00250 22261 22338 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 22398 24809 gene locus_tag LOCUS_19410 22398 24809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 24910 26148 gene locus_tag LOCUS_19420 24910 26148 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403911.1 protein_id gnl|my_center|LOCUS_19420 26145 27488 gene locus_tag LOCUS_19430 gene cyp51 26145 27488 CDS product lanosterol 14-alpha demethylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898577.1 protein_id gnl|my_center|LOCUS_19430 27865 27518 gene locus_tag LOCUS_19440 27865 27518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 27991 28191 gene locus_tag LOCUS_19450 27991 28191 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059330.1 protein_id gnl|my_center|LOCUS_19450 28188 28811 gene locus_tag LOCUS_19460 28188 28811 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403887.1 protein_id gnl|my_center|LOCUS_19460 28808 30262 gene locus_tag LOCUS_19470 28808 30262 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403919.1 protein_id gnl|my_center|LOCUS_19470 30342 31076 gene locus_tag LOCUS_19480 30342 31076 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084281.1 protein_id gnl|my_center|LOCUS_19480 31162 31992 gene locus_tag LOCUS_19490 31162 31992 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084282.1 protein_id gnl|my_center|LOCUS_19490 31994 32377 gene locus_tag LOCUS_19500 31994 32377 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084283.1 protein_id gnl|my_center|LOCUS_19500 32398 32820 gene locus_tag LOCUS_19510 32398 32820 CDS product BLUF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338827.1 protein_id gnl|my_center|LOCUS_19510 32861 34528 gene locus_tag LOCUS_19520 32861 34528 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219893520.1 protein_id gnl|my_center|LOCUS_19520 35342 34545 gene locus_tag LOCUS_19530 35342 34545 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893773.1 protein_id gnl|my_center|LOCUS_19530 35618 35421 gene locus_tag LOCUS_19540 35618 35421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 36017 36481 gene locus_tag LOCUS_19550 36017 36481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 37365 36664 gene locus_tag LOCUS_19560 37365 36664 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085274.1 protein_id gnl|my_center|LOCUS_19560 39547 37376 gene locus_tag LOCUS_19570 39547 37376 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030282.1 protein_id gnl|my_center|LOCUS_19570 39680 40822 gene locus_tag LOCUS_19580 39680 40822 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227983.1 protein_id gnl|my_center|LOCUS_19580 40819 41475 gene locus_tag LOCUS_19590 40819 41475 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227982.1 protein_id gnl|my_center|LOCUS_19590 41861 41571 gene locus_tag LOCUS_19600 41861 41571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 42821 42060 gene locus_tag LOCUS_19610 42821 42060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 43182 46043 gene locus_tag LOCUS_19620 43182 46043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 47443 46022 gene locus_tag LOCUS_19630 47443 46022 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188658.1 protein_id gnl|my_center|LOCUS_19630 47503 47859 gene locus_tag LOCUS_19640 47503 47859 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229205.1 protein_id gnl|my_center|LOCUS_19640 48916 47885 gene locus_tag LOCUS_19650 48916 47885 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895326.1 protein_id gnl|my_center|LOCUS_19650 50007 48913 gene locus_tag LOCUS_19660 50007 48913 CDS product TIGR03857 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877342.1 protein_id gnl|my_center|LOCUS_19660 51184 49997 gene locus_tag LOCUS_19670 51184 49997 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731407.1 protein_id gnl|my_center|LOCUS_19670 51239 52273 gene locus_tag LOCUS_19680 51239 52273 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728115.1 protein_id gnl|my_center|LOCUS_19680 52297 53454 gene locus_tag LOCUS_19690 gene purT 52297 53454 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938024.1 protein_id gnl|my_center|LOCUS_19690 53923 53528 gene locus_tag LOCUS_19700 53923 53528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 54540 53920 gene locus_tag LOCUS_19710 54540 53920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 55776 54601 gene locus_tag LOCUS_19720 55776 54601 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230156.1 protein_id gnl|my_center|LOCUS_19720 55741 56607 gene locus_tag LOCUS_19730 55741 56607 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228931.1 protein_id gnl|my_center|LOCUS_19730 57502 56702 gene locus_tag LOCUS_19740 57502 56702 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777089.1 protein_id gnl|my_center|LOCUS_19740 57588 58826 gene locus_tag LOCUS_19750 57588 58826 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777090.1 protein_id gnl|my_center|LOCUS_19750 58823 59887 gene locus_tag LOCUS_19760 58823 59887 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222380.1 protein_id gnl|my_center|LOCUS_19760 59884 61275 gene locus_tag LOCUS_19770 gene zwf 59884 61275 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_19770 61272 63080 gene locus_tag LOCUS_19780 61272 63080 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225751.1 protein_id gnl|my_center|LOCUS_19780 63077 63769 gene locus_tag LOCUS_19790 63077 63769 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228658.1 protein_id gnl|my_center|LOCUS_19790 63766 65187 gene locus_tag LOCUS_19800 63766 65187 CDS product mycothione reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223941.1 protein_id gnl|my_center|LOCUS_19800 65252 66745 gene locus_tag LOCUS_19810 65252 66745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 68070 66793 gene locus_tag LOCUS_19820 68070 66793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 68190 68480 gene locus_tag LOCUS_19830 68190 68480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 69813 68623 gene locus_tag LOCUS_19840 69813 68623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 69925 70173 gene locus_tag LOCUS_19850 69925 70173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 70248 70529 gene locus_tag LOCUS_19860 70248 70529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 70976 70596 gene locus_tag LOCUS_19870 70976 70596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 71232 70954 gene locus_tag LOCUS_19880 71232 70954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 71278 71583 gene locus_tag LOCUS_19890 71278 71583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 71776 74097 gene locus_tag LOCUS_19900 71776 74097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 74094 74753 gene locus_tag LOCUS_19910 74094 74753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 74846 77083 gene locus_tag LOCUS_19920 74846 77083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 77194 77574 gene locus_tag LOCUS_19930 77194 77574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 77609 78709 gene locus_tag LOCUS_19940 77609 78709 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853634.1 protein_id gnl|my_center|LOCUS_19940 78975 79454 gene locus_tag LOCUS_19950 78975 79454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 80361 79501 gene locus_tag LOCUS_19960 gene heR 80361 79501 CDS product heliorhodopsin HeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013296133.1 protein_id gnl|my_center|LOCUS_19960 80849 80289 gene locus_tag LOCUS_19970 gene idi 80849 80289 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804097.1 protein_id gnl|my_center|LOCUS_19970 80897 81754 gene locus_tag LOCUS_19980 80897 81754 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031819.1 protein_id gnl|my_center|LOCUS_19980 81751 82893 gene locus_tag LOCUS_19990 81751 82893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 82922 83992 gene locus_tag LOCUS_20000 82922 83992 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase III C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727205.1 protein_id gnl|my_center|LOCUS_20000 83995 84522 gene locus_tag LOCUS_20010 83995 84522 CDS product isoprenylcysteine carboxyl methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727206.1 protein_id gnl|my_center|LOCUS_20010 84659 85696 gene locus_tag LOCUS_20020 84659 85696 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031816.1 protein_id gnl|my_center|LOCUS_20020 85696 86445 gene locus_tag LOCUS_20030 85696 86445 CDS product ZIP family zinc transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225190.1 protein_id gnl|my_center|LOCUS_20030 86676 87326 gene locus_tag LOCUS_20040 86676 87326 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143673.1 protein_id gnl|my_center|LOCUS_20040 87323 88537 gene locus_tag LOCUS_20050 gene aroB 87323 88537 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413008.1 protein_id gnl|my_center|LOCUS_20050 88534 89319 gene locus_tag LOCUS_20060 88534 89319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 89316 90632 gene locus_tag LOCUS_20070 89316 90632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 90635 91663 gene locus_tag LOCUS_20080 90635 91663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 91660 92460 gene locus_tag LOCUS_20090 91660 92460 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551692.1 protein_id gnl|my_center|LOCUS_20090 92457 93494 gene locus_tag LOCUS_20100 92457 93494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 93491 94708 gene locus_tag LOCUS_20110 93491 94708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 94705 95538 gene locus_tag LOCUS_20120 94705 95538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 96323 95586 gene locus_tag LOCUS_20130 96323 95586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 96526 97026 gene locus_tag LOCUS_20140 96526 97026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 98868 97591 gene locus_tag LOCUS_20150 98868 97591 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074038115.1 protein_id gnl|my_center|LOCUS_20150 99098 99304 gene locus_tag LOCUS_20160 99098 99304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079856.1 protein_id gnl|my_center|LOCUS_20160 100308 99403 gene locus_tag LOCUS_20170 100308 99403 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969690.1 protein_id gnl|my_center|LOCUS_20170 100515 100312 gene locus_tag LOCUS_20180 100515 100312 CDS product DUF2945 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339146.1 protein_id gnl|my_center|LOCUS_20180 100572 101414 gene locus_tag LOCUS_20190 100572 101414 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225970.1 protein_id gnl|my_center|LOCUS_20190 101642 102721 gene locus_tag LOCUS_20200 101642 102721 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189282703.1 protein_id gnl|my_center|LOCUS_20200 104056 102722 gene locus_tag LOCUS_20210 104056 102722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 105117 104050 gene locus_tag LOCUS_20220 105117 104050 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268143.1 protein_id gnl|my_center|LOCUS_20220 106064 105114 gene locus_tag LOCUS_20230 106064 105114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 106253 106966 gene locus_tag LOCUS_20240 106253 106966 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275384.1 protein_id gnl|my_center|LOCUS_20240 107153 107983 gene locus_tag LOCUS_20250 107153 107983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 109813 108005 gene locus_tag LOCUS_20260 gene malQ 109813 108005 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408795.1 protein_id gnl|my_center|LOCUS_20260 111434 110166 gene locus_tag LOCUS_20270 111434 110166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 112672 111677 gene locus_tag LOCUS_20280 112672 111677 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031646.1 protein_id gnl|my_center|LOCUS_20280 112779 113417 gene locus_tag LOCUS_20290 112779 113417 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814649.1 protein_id gnl|my_center|LOCUS_20290 113497 113943 gene locus_tag LOCUS_20300 113497 113943 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226133.1 protein_id gnl|my_center|LOCUS_20300 113940 115523 gene locus_tag LOCUS_20310 113940 115523 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031630.1 protein_id gnl|my_center|LOCUS_20310 115580 116242 gene locus_tag LOCUS_20320 115580 116242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 116239 116685 gene locus_tag LOCUS_20330 116239 116685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 116661 117200 gene locus_tag LOCUS_20340 116661 117200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 117304 117954 gene locus_tag LOCUS_20350 117304 117954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 117947 118231 gene locus_tag LOCUS_20360 117947 118231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 118665 118348 gene locus_tag LOCUS_20370 118665 118348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 118915 119187 gene locus_tag LOCUS_20380 118915 119187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 119250 120389 gene locus_tag LOCUS_20390 119250 120389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 120391 121458 gene locus_tag LOCUS_20400 120391 121458 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119846.1 protein_id gnl|my_center|LOCUS_20400 121455 122441 gene locus_tag LOCUS_20410 121455 122441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119847.1 protein_id gnl|my_center|LOCUS_20410 122438 123274 gene locus_tag LOCUS_20420 122438 123274 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119848.1 protein_id gnl|my_center|LOCUS_20420 123339 124526 gene locus_tag LOCUS_20430 123339 124526 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226129.1 protein_id gnl|my_center|LOCUS_20430 125412 124561 gene locus_tag LOCUS_20440 125412 124561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 125650 125420 gene locus_tag LOCUS_20450 125650 125420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 125800 126228 gene locus_tag LOCUS_20460 125800 126228 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228384.1 protein_id gnl|my_center|LOCUS_20460 126256 127509 gene locus_tag LOCUS_20470 126256 127509 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742232.1 protein_id gnl|my_center|LOCUS_20470 127517 127921 gene locus_tag LOCUS_20480 127517 127921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 128031 128966 gene locus_tag LOCUS_20490 128031 128966 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114698.1 protein_id gnl|my_center|LOCUS_20490 129041 131401 gene locus_tag LOCUS_20500 gene lon 129041 131401 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729178.1 protein_id gnl|my_center|LOCUS_20500 131502 131933 gene locus_tag LOCUS_20510 131502 131933 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226310.1 protein_id gnl|my_center|LOCUS_20510 132683 131976 gene locus_tag LOCUS_20520 132683 131976 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727699.1 protein_id gnl|my_center|LOCUS_20520 132814 133809 gene locus_tag LOCUS_20530 132814 133809 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877201.1 protein_id gnl|my_center|LOCUS_20530 133806 134222 gene locus_tag LOCUS_20540 133806 134222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 134215 134892 gene locus_tag LOCUS_20550 134215 134892 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225121.1 protein_id gnl|my_center|LOCUS_20550 135538 134900 gene locus_tag LOCUS_20560 135538 134900 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727699.1 protein_id gnl|my_center|LOCUS_20560 135695 136312 gene locus_tag LOCUS_20570 135695 136312 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131402.1 protein_id gnl|my_center|LOCUS_20570 136360 137028 gene locus_tag LOCUS_20580 136360 137028 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131402.1 protein_id gnl|my_center|LOCUS_20580 138474 137038 gene locus_tag LOCUS_20590 138474 137038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 138592 139221 gene locus_tag LOCUS_20600 138592 139221 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727835.1 protein_id gnl|my_center|LOCUS_20600 139242 140090 gene locus_tag LOCUS_20610 139242 140090 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073792.1 protein_id gnl|my_center|LOCUS_20610 140092 141681 gene locus_tag LOCUS_20620 gene fadD1 140092 141681 CDS product fatty-acid--CoA ligase FadD1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730208.1 protein_id gnl|my_center|LOCUS_20620 142040 141708 gene locus_tag LOCUS_20630 142040 141708 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031865.1 protein_id gnl|my_center|LOCUS_20630 142110 142637 gene locus_tag LOCUS_20640 142110 142637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 142689 143267 gene locus_tag LOCUS_20650 142689 143267 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897891.1 protein_id gnl|my_center|LOCUS_20650 143267 144037 gene locus_tag LOCUS_20660 143267 144037 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898578.1 protein_id gnl|my_center|LOCUS_20660 144034 144909 gene locus_tag LOCUS_20670 144034 144909 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089584.1 protein_id gnl|my_center|LOCUS_20670 145023 145202 gene locus_tag LOCUS_20680 145023 145202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 145252 145959 gene locus_tag LOCUS_20690 145252 145959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 147447 145963 gene locus_tag LOCUS_20700 147447 145963 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555722.1 protein_id gnl|my_center|LOCUS_20700 149309 147501 gene locus_tag LOCUS_20710 149309 147501 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111122.1 protein_id gnl|my_center|LOCUS_20710 150875 149430 gene locus_tag LOCUS_20720 150875 149430 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407382.1 protein_id gnl|my_center|LOCUS_20720 150777 151376 gene locus_tag LOCUS_20730 150777 151376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 151413 151709 gene locus_tag LOCUS_20740 151413 151709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 152600 151725 gene locus_tag LOCUS_20750 152600 151725 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111129.1 protein_id gnl|my_center|LOCUS_20750 153169 152597 gene locus_tag LOCUS_20760 153169 152597 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729386.1 protein_id gnl|my_center|LOCUS_20760 154509 153166 gene locus_tag LOCUS_20770 154509 153166 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728220.1 protein_id gnl|my_center|LOCUS_20770 154598 155749 gene locus_tag LOCUS_20780 gene rlmC 154598 155749 CDS product 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208756.1 protein_id gnl|my_center|LOCUS_20780 156963 155722 gene locus_tag LOCUS_20790 156963 155722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 158467 157013 gene locus_tag LOCUS_20800 158467 157013 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728345.1 protein_id gnl|my_center|LOCUS_20800 159455 158493 gene locus_tag LOCUS_20810 159455 158493 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226301.1 protein_id gnl|my_center|LOCUS_20810 160698 159625 gene locus_tag LOCUS_20820 160698 159625 CDS product NADH-dependent flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398691.1 protein_id gnl|my_center|LOCUS_20820 160892 161755 gene locus_tag LOCUS_20830 160892 161755 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104317.1 protein_id gnl|my_center|LOCUS_20830 161970 162263 gene locus_tag LOCUS_20840 161970 162263 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726761.1 protein_id gnl|my_center|LOCUS_20840 162260 162463 gene locus_tag LOCUS_20850 162260 162463 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225366.1 protein_id gnl|my_center|LOCUS_20850 162471 163331 gene locus_tag LOCUS_20860 162471 163331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225367.1 protein_id gnl|my_center|LOCUS_20860 163328 165541 gene locus_tag LOCUS_20870 163328 165541 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730259.1 protein_id gnl|my_center|LOCUS_20870 165564 166931 gene locus_tag LOCUS_20880 165564 166931 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224741.1 protein_id gnl|my_center|LOCUS_20880 167584 167003 gene locus_tag LOCUS_20890 167584 167003 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027232.1 protein_id gnl|my_center|LOCUS_20890 167720 167866 gene locus_tag LOCUS_20900 167720 167866 CDS product DUF1059 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896554.1 protein_id gnl|my_center|LOCUS_20900 168936 168640 gene locus_tag LOCUS_20910 168936 168640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 169770 169024 gene locus_tag LOCUS_20920 169770 169024 CDS product helical backbone metal receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223098.1 protein_id gnl|my_center|LOCUS_20920 170264 169767 gene locus_tag LOCUS_20930 170264 169767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 170509 172299 gene locus_tag LOCUS_20940 170509 172299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 173022 172558 gene locus_tag LOCUS_20950 173022 172558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 173825 173172 gene locus_tag LOCUS_20960 173825 173172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 174171 173836 gene locus_tag LOCUS_20970 174171 173836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 174941 174168 gene locus_tag LOCUS_20980 174941 174168 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114245.1 protein_id gnl|my_center|LOCUS_20980 174967 175590 gene locus_tag LOCUS_20990 174967 175590 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528472.1 protein_id gnl|my_center|LOCUS_20990 175631 177226 gene locus_tag LOCUS_21000 175631 177226 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104297.1 protein_id gnl|my_center|LOCUS_21000 177817 177248 gene locus_tag LOCUS_21010 gene sigK 177817 177248 CDS product sigma-70 family RNA polymerase sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402246.1 protein_id gnl|my_center|LOCUS_21010 178683 178018 gene locus_tag LOCUS_21020 178683 178018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 181938 178750 gene locus_tag LOCUS_21030 181938 178750 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224369.1 protein_id gnl|my_center|LOCUS_21030 182071 182616 gene locus_tag LOCUS_21040 182071 182616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 182613 182921 gene locus_tag LOCUS_21050 182613 182921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 182918 184699 gene locus_tag LOCUS_21060 182918 184699 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911742.1 protein_id gnl|my_center|LOCUS_21060 184696 185217 gene locus_tag LOCUS_21070 184696 185217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 185407 186636 gene locus_tag LOCUS_21080 185407 186636 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908688.1 protein_id gnl|my_center|LOCUS_21080 189114 186766 gene locus_tag LOCUS_21090 189114 186766 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031731.1 protein_id gnl|my_center|LOCUS_21090 189818 189198 gene locus_tag LOCUS_21100 189818 189198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 190517 189876 gene locus_tag LOCUS_21110 190517 189876 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015034.1 protein_id gnl|my_center|LOCUS_21110 190546 193362 gene locus_tag LOCUS_21120 190546 193362 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138169592.1 protein_id gnl|my_center|LOCUS_21120 193359 194069 gene locus_tag LOCUS_21130 193359 194069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 195513 194098 gene locus_tag LOCUS_21140 195513 194098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 195543 195995 gene locus_tag LOCUS_21150 195543 195995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 196934 196017 gene locus_tag LOCUS_21160 196934 196017 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027621.1 protein_id gnl|my_center|LOCUS_21160 198568 196976 gene locus_tag LOCUS_21170 198568 196976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 199432 198665 gene locus_tag LOCUS_21180 199432 198665 CDS product putative protein N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226080.1 protein_id gnl|my_center|LOCUS_21180 199485 200759 gene locus_tag LOCUS_21190 199485 200759 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727796.1 protein_id gnl|my_center|LOCUS_21190 201180 201503 gene locus_tag LOCUS_21200 201180 201503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 201965 204262 gene locus_tag LOCUS_21210 201965 204262 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022605.1 protein_id gnl|my_center|LOCUS_21210 204266 204871 gene locus_tag LOCUS_21220 204266 204871 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225701.1 protein_id gnl|my_center|LOCUS_21220 204904 206406 gene locus_tag LOCUS_21230 204904 206406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 206438 207565 gene locus_tag LOCUS_21240 206438 207565 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112528.1 protein_id gnl|my_center|LOCUS_21240 207562 208368 gene locus_tag LOCUS_21250 207562 208368 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224179.1 protein_id gnl|my_center|LOCUS_21250 208378 209469 gene locus_tag LOCUS_21260 208378 209469 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223562.1 protein_id gnl|my_center|LOCUS_21260 209884 209456 gene locus_tag LOCUS_21270 209884 209456 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223944.1 protein_id gnl|my_center|LOCUS_21270 210786 209881 gene locus_tag LOCUS_21280 210786 209881 CDS product alpha/beta hydrolase fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921474.1 protein_id gnl|my_center|LOCUS_21280 211361 210870 gene locus_tag LOCUS_21290 211361 210870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 211640 212734 gene locus_tag LOCUS_21300 211640 212734 CDS product thiamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878186.1 protein_id gnl|my_center|LOCUS_21300 212750 214408 gene locus_tag LOCUS_21310 212750 214408 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125313541.1 protein_id gnl|my_center|LOCUS_21310 214405 215415 gene locus_tag LOCUS_21320 214405 215415 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229774.1 protein_id gnl|my_center|LOCUS_21320 215442 216539 gene locus_tag LOCUS_21330 215442 216539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 216594 218570 gene locus_tag LOCUS_21340 216594 218570 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229814.1 protein_id gnl|my_center|LOCUS_21340 218567 218704 gene locus_tag LOCUS_21350 218567 218704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 218695 219363 gene locus_tag LOCUS_21360 218695 219363 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018162528.1 protein_id gnl|my_center|LOCUS_21360 220437 219460 gene locus_tag LOCUS_21370 220437 219460 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066638520.1 protein_id gnl|my_center|LOCUS_21370 221154 220654 gene locus_tag LOCUS_21380 221154 220654 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975424.1 protein_id gnl|my_center|LOCUS_21380 221293 222762 gene locus_tag LOCUS_21390 221293 222762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21390 223046 224113 gene locus_tag LOCUS_21400 223046 224113 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975426.1 protein_id gnl|my_center|LOCUS_21400 224113 225174 gene locus_tag LOCUS_21410 gene tilS 224113 225174 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975427.1 protein_id gnl|my_center|LOCUS_21410 225185 225736 gene locus_tag LOCUS_21420 gene hpt 225185 225736 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007452004.1 protein_id gnl|my_center|LOCUS_21420 225858 226166 gene locus_tag LOCUS_21430 225858 226166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 226422 228500 gene locus_tag LOCUS_21440 gene ftsH 226422 228500 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867756.1 protein_id gnl|my_center|LOCUS_21440 228646 229263 gene locus_tag LOCUS_21450 gene folE 228646 229263 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975430.1 protein_id gnl|my_center|LOCUS_21450 229321 230067 gene locus_tag LOCUS_21460 229321 230067 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532723.1 protein_id gnl|my_center|LOCUS_21460 230514 230092 gene locus_tag LOCUS_21470 230514 230092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 230641 231660 gene locus_tag LOCUS_21480 230641 231660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 231700 232542 gene locus_tag LOCUS_21490 gene folP 231700 232542 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975435.1 protein_id gnl|my_center|LOCUS_21490 232559 232933 gene locus_tag LOCUS_21500 gene folB 232559 232933 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028954.1 protein_id gnl|my_center|LOCUS_21500 232926 233495 gene locus_tag LOCUS_21510 gene folK 232926 233495 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975432.1 protein_id gnl|my_center|LOCUS_21510 233503 233985 gene locus_tag LOCUS_21520 233503 233985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 234104 234634 gene locus_tag LOCUS_21530 234104 234634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 234708 235811 gene locus_tag LOCUS_21540 234708 235811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 236852 235836 gene locus_tag LOCUS_21550 236852 235836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 236856 237581 gene locus_tag LOCUS_21560 236856 237581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 237578 238333 gene locus_tag LOCUS_21570 237578 238333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 238404 239342 gene locus_tag LOCUS_21580 238404 239342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 239625 240146 gene locus_tag LOCUS_21590 239625 240146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 241270 240167 gene locus_tag LOCUS_21600 241270 240167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 241340 242455 gene locus_tag LOCUS_21610 241340 242455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 242452 243414 gene locus_tag LOCUS_21620 242452 243414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 243602 244531 gene locus_tag LOCUS_21630 243602 244531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21630 244528 245391 gene locus_tag LOCUS_21640 gene panC 244528 245391 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731036.1 protein_id gnl|my_center|LOCUS_21640 245403 245807 gene locus_tag LOCUS_21650 245403 245807 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230457.1 protein_id gnl|my_center|LOCUS_21650 245827 247491 gene locus_tag LOCUS_21660 245827 247491 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028946.1 protein_id gnl|my_center|LOCUS_21660 247488 248420 gene locus_tag LOCUS_21670 gene nadC 247488 248420 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224104.1 protein_id gnl|my_center|LOCUS_21670 248423 249196 gene locus_tag LOCUS_21680 248423 249196 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975453.1 protein_id gnl|my_center|LOCUS_21680 249265 249609 gene locus_tag LOCUS_21690 249265 249609 CDS product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065018.1 protein_id gnl|my_center|LOCUS_21690 249671 250921 gene locus_tag LOCUS_21700 249671 250921 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222861.1 protein_id gnl|my_center|LOCUS_21700 250918 251568 gene locus_tag LOCUS_21710 250918 251568 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975186.1 protein_id gnl|my_center|LOCUS_21710 251643 251912 gene locus_tag LOCUS_21720 251643 251912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 251909 252328 gene locus_tag LOCUS_21730 251909 252328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 252494 255097 gene locus_tag LOCUS_21740 252494 255097 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975461.1 protein_id gnl|my_center|LOCUS_21740 256290 255142 gene locus_tag LOCUS_21750 256290 255142 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029664.1 protein_id gnl|my_center|LOCUS_21750 256734 256327 gene locus_tag LOCUS_21760 256734 256327 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974528.1 protein_id gnl|my_center|LOCUS_21760 257824 256844 gene locus_tag LOCUS_21770 257824 256844 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975480.1 protein_id gnl|my_center|LOCUS_21770 257857 258594 gene locus_tag LOCUS_21780 257857 258594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 259815 258733 gene locus_tag LOCUS_21790 gene disA 259815 258733 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975482.1 protein_id gnl|my_center|LOCUS_21790 261157 259826 gene locus_tag LOCUS_21800 gene radA 261157 259826 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028928.1 protein_id gnl|my_center|LOCUS_21800 261072 262430 gene locus_tag LOCUS_21810 261072 262430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 262572 263003 gene locus_tag LOCUS_21820 262572 263003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 264048 263338 gene locus_tag LOCUS_21830 264048 263338 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223868.1 protein_id gnl|my_center|LOCUS_21830 264694 264056 gene locus_tag LOCUS_21840 264694 264056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 265564 264803 gene locus_tag LOCUS_21850 265564 264803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975485.1 protein_id gnl|my_center|LOCUS_21850 265629 266591 gene locus_tag LOCUS_21860 265629 266591 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028926.1 protein_id gnl|my_center|LOCUS_21860 266588 267376 gene locus_tag LOCUS_21870 266588 267376 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975487.1 protein_id gnl|my_center|LOCUS_21870 267529 267876 gene locus_tag LOCUS_21880 267529 267876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 268491 267922 gene locus_tag LOCUS_21890 268491 267922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 269303 268620 gene locus_tag LOCUS_21900 269303 268620 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027558.1 protein_id gnl|my_center|LOCUS_21900 270496 269300 gene locus_tag LOCUS_21910 270496 269300 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976650.1 protein_id gnl|my_center|LOCUS_21910 272643 270538 gene locus_tag LOCUS_21920 272643 270538 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031089.1 protein_id gnl|my_center|LOCUS_21920 272785 273720 gene locus_tag LOCUS_21930 272785 273720 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224531.1 protein_id gnl|my_center|LOCUS_21930 273730 274551 gene locus_tag LOCUS_21940 gene proC 273730 274551 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975496.1 protein_id gnl|my_center|LOCUS_21940 274553 275281 gene locus_tag LOCUS_21950 274553 275281 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326218.1 protein_id gnl|my_center|LOCUS_21950 275278 275796 gene locus_tag LOCUS_21960 275278 275796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 275920 276075 gene locus_tag LOCUS_21970 275920 276075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 276221 277129 gene locus_tag LOCUS_21980 276221 277129 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167379699.1 protein_id gnl|my_center|LOCUS_21980 277796 277116 gene locus_tag LOCUS_21990 277796 277116 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224587.1 protein_id gnl|my_center|LOCUS_21990 278810 277854 gene locus_tag LOCUS_22000 gene trpS 278810 277854 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975499.1 protein_id gnl|my_center|LOCUS_22000 280672 278993 gene locus_tag LOCUS_22010 280672 278993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 282163 280733 gene locus_tag LOCUS_22020 282163 280733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 282293 282475 gene locus_tag LOCUS_22030 282293 282475 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855509.1 protein_id gnl|my_center|LOCUS_22030 282951 284075 gene locus_tag LOCUS_22040 282951 284075 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975510.1 protein_id gnl|my_center|LOCUS_22040 284068 285240 gene locus_tag LOCUS_22050 284068 285240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 286453 285305 gene locus_tag LOCUS_22060 286453 285305 CDS product DUF5667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222409.1 protein_id gnl|my_center|LOCUS_22060 287417 286599 gene locus_tag LOCUS_22070 287417 286599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 288464 287580 gene locus_tag LOCUS_22080 288464 287580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 288550 290205 gene locus_tag LOCUS_22090 288550 290205 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222411.1 protein_id gnl|my_center|LOCUS_22090 290213 290482 gene locus_tag LOCUS_22100 290213 290482 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222412.1 protein_id gnl|my_center|LOCUS_22100 290626 291285 gene locus_tag LOCUS_22110 290626 291285 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975516.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22110 291282 292598 gene locus_tag LOCUS_22120 291282 292598 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061882.1 protein_id gnl|my_center|LOCUS_22120 292595 293572 gene locus_tag LOCUS_22130 gene hemC 292595 293572 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727310.1 protein_id gnl|my_center|LOCUS_22130 293569 295287 gene locus_tag LOCUS_22140 293569 295287 CDS product bifunctional uroporphyrinogen-III C-methyltransferase/uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975519.1 protein_id gnl|my_center|LOCUS_22140 295381 296367 gene locus_tag LOCUS_22150 gene hemB 295381 296367 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831526.1 protein_id gnl|my_center|LOCUS_22150 297712 296489 gene locus_tag LOCUS_22160 297712 296489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 297933 299261 gene locus_tag LOCUS_22170 gene hemL 297933 299261 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029675.1 protein_id gnl|my_center|LOCUS_22170 299258 299938 gene locus_tag LOCUS_22180 299258 299938 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214057055.1 protein_id gnl|my_center|LOCUS_22180 299935 300507 gene locus_tag LOCUS_22190 299935 300507 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029677.1 protein_id gnl|my_center|LOCUS_22190 300500 301261 gene locus_tag LOCUS_22200 300500 301261 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974477.1 protein_id gnl|my_center|LOCUS_22200 301290 302912 gene locus_tag LOCUS_22210 301290 302912 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029679.1 protein_id gnl|my_center|LOCUS_22210 302909 303946 gene locus_tag LOCUS_22220 gene ccsB 302909 303946 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029680.1 protein_id gnl|my_center|LOCUS_22220 304352 304140 gene locus_tag LOCUS_22230 304352 304140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 304406 304717 gene locus_tag LOCUS_22240 304406 304717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 304851 304714 gene locus_tag LOCUS_22250 304851 304714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 305675 304869 gene locus_tag LOCUS_22260 305675 304869 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094666.1 protein_id gnl|my_center|LOCUS_22260 305799 306764 gene locus_tag LOCUS_22270 gene menE 305799 306764 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_216843435.1 protein_id gnl|my_center|LOCUS_22270 306761 307702 gene locus_tag LOCUS_22280 306761 307702 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230276.1 protein_id gnl|my_center|LOCUS_22280 307699 309273 gene locus_tag LOCUS_22290 gene menD 307699 309273 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876969.1 protein_id gnl|my_center|LOCUS_22290 309359 311236 gene locus_tag LOCUS_22300 309359 311236 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093951984.1 protein_id gnl|my_center|LOCUS_22300 312145 311306 gene locus_tag LOCUS_22310 312145 311306 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261950.1 protein_id gnl|my_center|LOCUS_22310 312704 312150 gene locus_tag LOCUS_22320 312704 312150 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219330.1 protein_id gnl|my_center|LOCUS_22320 312703 313344 gene locus_tag LOCUS_22330 312703 313344 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031843.1 protein_id gnl|my_center|LOCUS_22330 313455 314195 gene locus_tag LOCUS_22340 313455 314195 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484721.1 protein_id gnl|my_center|LOCUS_22340 315545 314277 gene locus_tag LOCUS_22350 315545 314277 CDS product chorismate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929999.1 protein_id gnl|my_center|LOCUS_22350 315609 316280 gene locus_tag LOCUS_22360 315609 316280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 317258 316317 gene locus_tag LOCUS_22370 317258 316317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 317346 318068 gene locus_tag LOCUS_22380 317346 318068 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974389.1 protein_id gnl|my_center|LOCUS_22380 318960 318190 gene locus_tag LOCUS_22390 318960 318190 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973591.1 protein_id gnl|my_center|LOCUS_22390 319610 318960 gene locus_tag LOCUS_22400 319610 318960 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109033475.1 protein_id gnl|my_center|LOCUS_22400 320235 319618 gene locus_tag LOCUS_22410 320235 319618 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189739317.1 protein_id gnl|my_center|LOCUS_22410 320541 320903 gene locus_tag LOCUS_22420 320541 320903 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974383.1 protein_id gnl|my_center|LOCUS_22420 320924 321478 gene locus_tag LOCUS_22430 320924 321478 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061196.1 protein_id gnl|my_center|LOCUS_22430 321480 322184 gene locus_tag LOCUS_22440 321480 322184 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029733.1 protein_id gnl|my_center|LOCUS_22440 322184 323536 gene locus_tag LOCUS_22450 322184 323536 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029734.1 protein_id gnl|my_center|LOCUS_22450 323533 324351 gene locus_tag LOCUS_22460 gene nuoE 323533 324351 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974380.1 protein_id gnl|my_center|LOCUS_22460 324485 325690 gene locus_tag LOCUS_22470 gene nuoF 324485 325690 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893427.1 protein_id gnl|my_center|LOCUS_22470 325687 328095 gene locus_tag LOCUS_22480 325687 328095 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728121.1 protein_id gnl|my_center|LOCUS_22480 328095 329429 gene locus_tag LOCUS_22490 gene nuoH 328095 329429 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029736.1 protein_id gnl|my_center|LOCUS_22490 329429 329986 gene locus_tag LOCUS_22500 gene nuoI 329429 329986 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899938.1 protein_id gnl|my_center|LOCUS_22500 329983 330837 gene locus_tag LOCUS_22510 329983 330837 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029738.1 protein_id gnl|my_center|LOCUS_22510 330834 331127 gene locus_tag LOCUS_22520 gene nuoK 330834 331127 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974374.1 protein_id gnl|my_center|LOCUS_22520 331142 333070 gene locus_tag LOCUS_22530 gene nuoL 331142 333070 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893421.1 protein_id gnl|my_center|LOCUS_22530 333071 334660 gene locus_tag LOCUS_22540 333071 334660 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728119.1 protein_id gnl|my_center|LOCUS_22540 334671 336266 gene locus_tag LOCUS_22550 gene nuoN 334671 336266 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974371.1 protein_id gnl|my_center|LOCUS_22550 336263 337252 gene locus_tag LOCUS_22560 336263 337252 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974364.1 protein_id gnl|my_center|LOCUS_22560 338167 337256 gene locus_tag LOCUS_22570 gene rarD 338167 337256 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029749.1 protein_id gnl|my_center|LOCUS_22570 338282 338776 gene locus_tag LOCUS_22580 338282 338776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 339969 338863 gene locus_tag LOCUS_22590 339969 338863 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029750.1 protein_id gnl|my_center|LOCUS_22590 341918 339972 gene locus_tag LOCUS_22600 341918 339972 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108988152.1 protein_id gnl|my_center|LOCUS_22600 342287 343324 gene locus_tag LOCUS_22610 342287 343324 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895899.1 protein_id gnl|my_center|LOCUS_22610 343327 344172 gene locus_tag LOCUS_22620 gene cysT 343327 344172 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412332.1 protein_id gnl|my_center|LOCUS_22620 344165 345019 gene locus_tag LOCUS_22630 gene cysW 344165 345019 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056131.1 protein_id gnl|my_center|LOCUS_22630 345016 346014 gene locus_tag LOCUS_22640 345016 346014 CDS product TOBE-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060315.1 protein_id gnl|my_center|LOCUS_22640 346593 346102 gene locus_tag LOCUS_22650 346593 346102 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727465.1 protein_id gnl|my_center|LOCUS_22650 346701 346784 gene locus_tag LOCUS_t00260 346701 346784 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 346975 347817 gene locus_tag LOCUS_22660 346975 347817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 347918 348964 gene locus_tag LOCUS_22670 347918 348964 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896435.1 protein_id gnl|my_center|LOCUS_22670 349268 349462 gene locus_tag LOCUS_22680 gene infA 349268 349462 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854422.1 protein_id gnl|my_center|LOCUS_22680 349763 350140 gene locus_tag LOCUS_22690 gene rpsM 349763 350140 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004571523.1 protein_id gnl|my_center|LOCUS_22690 350212 350616 gene locus_tag LOCUS_22700 gene rpsK 350212 350616 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948617.1 protein_id gnl|my_center|LOCUS_22700 350643 351251 gene locus_tag LOCUS_22710 gene rpsD 350643 351251 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892911.1 protein_id gnl|my_center|LOCUS_22710 351368 352384 gene locus_tag LOCUS_22720 351368 352384 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003966937.1 protein_id gnl|my_center|LOCUS_22720 352639 353232 gene locus_tag LOCUS_22730 352639 353232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 354760 353780 gene locus_tag LOCUS_22740 354760 353780 CDS product 2-dehydropantoate 2-reductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728687.1 protein_id gnl|my_center|LOCUS_22740 354810 355811 gene locus_tag LOCUS_22750 354810 355811 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973920.1 protein_id gnl|my_center|LOCUS_22750 356182 355820 gene locus_tag LOCUS_22760 356182 355820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 357249 356221 gene locus_tag LOCUS_22770 357249 356221 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229534.1 protein_id gnl|my_center|LOCUS_22770 357373 357993 gene locus_tag LOCUS_22780 357373 357993 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228646.1 protein_id gnl|my_center|LOCUS_22780 358426 357956 gene locus_tag LOCUS_22790 358426 357956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 359547 358423 gene locus_tag LOCUS_22800 359547 358423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 361190 359607 gene locus_tag LOCUS_22810 361190 359607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 362017 361187 gene locus_tag LOCUS_22820 362017 361187 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078040.1 protein_id gnl|my_center|LOCUS_22820 364186 362057 gene locus_tag LOCUS_22830 364186 362057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 364342 365418 gene locus_tag LOCUS_22840 gene ychF 364342 365418 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973917.1 protein_id gnl|my_center|LOCUS_22840 365634 366296 gene locus_tag LOCUS_22850 365634 366296 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223909.1 protein_id gnl|my_center|LOCUS_22850 366305 366931 gene locus_tag LOCUS_22860 366305 366931 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110996.1 protein_id gnl|my_center|LOCUS_22860 366988 367344 gene locus_tag LOCUS_22870 366988 367344 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977977.1 protein_id gnl|my_center|LOCUS_22870 367620 367366 gene locus_tag LOCUS_22880 367620 367366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 368975 367800 gene locus_tag LOCUS_22890 368975 367800 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878214.1 protein_id gnl|my_center|LOCUS_22890 369124 370959 gene locus_tag LOCUS_22900 369124 370959 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896427.1 protein_id gnl|my_center|LOCUS_22900 371415 370963 gene locus_tag LOCUS_22910 371415 370963 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080606.1 protein_id gnl|my_center|LOCUS_22910 373384 371417 gene locus_tag LOCUS_22920 373384 371417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 373874 373503 gene locus_tag LOCUS_22930 373874 373503 CDS product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857248.1 protein_id gnl|my_center|LOCUS_22930 373893 374714 gene locus_tag LOCUS_22940 373893 374714 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327314.1 protein_id gnl|my_center|LOCUS_22940 375925 374879 gene locus_tag LOCUS_22950 375925 374879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 375998 376354 gene locus_tag LOCUS_22960 375998 376354 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973876.1 protein_id gnl|my_center|LOCUS_22960 376351 376638 gene locus_tag LOCUS_22970 376351 376638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 376685 377608 gene locus_tag LOCUS_22980 gene mshB 376685 377608 CDS product N-acetyl-1-D-myo-inositol-2-amino-2-deoxy-alpha-D-glucopyranoside deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089212260.1 protein_id gnl|my_center|LOCUS_22980 377712 377963 gene locus_tag LOCUS_22990 377712 377963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 377973 379703 gene locus_tag LOCUS_23000 377973 379703 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228760.1 protein_id gnl|my_center|LOCUS_23000 380281 381135 gene locus_tag LOCUS_23010 380281 381135 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027946.1 protein_id gnl|my_center|LOCUS_23010 381163 382125 gene locus_tag LOCUS_23020 381163 382125 CDS product DUF389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082376.1 protein_id gnl|my_center|LOCUS_23020 382122 383102 gene locus_tag LOCUS_23030 382122 383102 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775844.1 protein_id gnl|my_center|LOCUS_23030 384035 383115 gene locus_tag LOCUS_23040 384035 383115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 384094 384420 gene locus_tag LOCUS_23050 384094 384420 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973842.1 protein_id gnl|my_center|LOCUS_23050 384425 385546 gene locus_tag LOCUS_23060 384425 385546 CDS product bifunctional succinyldiaminopimelate transaminase/glutamate-prephenate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030077.1 protein_id gnl|my_center|LOCUS_23060 385543 386361 gene locus_tag LOCUS_23070 385543 386361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 386358 387197 gene locus_tag LOCUS_23080 386358 387197 CDS product prephenate dehydratase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783121.1 protein_id gnl|my_center|LOCUS_23080 387194 388108 gene locus_tag LOCUS_23090 387194 388108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 388632 388165 gene locus_tag LOCUS_23100 388632 388165 CDS product SUKH-4 family immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223346.1 protein_id gnl|my_center|LOCUS_23100 389644 388694 gene locus_tag LOCUS_23110 389644 388694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 390797 389838 gene locus_tag LOCUS_23120 gene dapD 390797 389838 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730317.1 protein_id gnl|my_center|LOCUS_23120 390867 391820 gene locus_tag LOCUS_23130 390867 391820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 392412 391852 gene locus_tag LOCUS_23140 392412 391852 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225996.1 protein_id gnl|my_center|LOCUS_23140 392825 392475 gene locus_tag LOCUS_23150 392825 392475 CDS product DNA polymerase ligase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086843187.1 protein_id gnl|my_center|LOCUS_23150 394174 392816 gene locus_tag LOCUS_23160 394174 392816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 395047 394286 gene locus_tag LOCUS_23170 395047 394286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 395239 398460 gene locus_tag LOCUS_23180 gene ileS 395239 398460 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224829.1 protein_id gnl|my_center|LOCUS_23180 398467 399144 gene locus_tag LOCUS_23190 398467 399144 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110169.1 protein_id gnl|my_center|LOCUS_23190 399902 399153 gene locus_tag LOCUS_23200 399902 399153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 400161 399988 gene locus_tag LOCUS_23210 400161 399988 CDS product DUF5999 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977451.1 protein_id gnl|my_center|LOCUS_23210 400327 401412 gene locus_tag LOCUS_23220 gene dapE 400327 401412 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030079.1 protein_id gnl|my_center|LOCUS_23220 401409 402137 gene locus_tag LOCUS_23230 401409 402137 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973837.1 protein_id gnl|my_center|LOCUS_23230 402134 402499 gene locus_tag LOCUS_23240 402134 402499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 402513 402938 gene locus_tag LOCUS_23250 402513 402938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 402938 403717 gene locus_tag LOCUS_23260 402938 403717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 405115 404309 gene locus_tag LOCUS_23270 405115 404309 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030081.1 protein_id gnl|my_center|LOCUS_23270 405342 405509 gene locus_tag LOCUS_23280 405342 405509 CDS product DUF3117 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003966491.1 protein_id gnl|my_center|LOCUS_23280 405506 407116 gene locus_tag LOCUS_23290 405506 407116 CDS product M17 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222970.1 protein_id gnl|my_center|LOCUS_23290 407113 407451 gene locus_tag LOCUS_23300 407113 407451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 408137 407472 gene locus_tag LOCUS_23310 408137 407472 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469700.1 protein_id gnl|my_center|LOCUS_23310 408336 408938 gene locus_tag LOCUS_23320 gene sigE 408336 408938 CDS product RNA polymerase sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973830.1 protein_id gnl|my_center|LOCUS_23320 408935 409423 gene locus_tag LOCUS_23330 408935 409423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 409523 410860 gene locus_tag LOCUS_23340 409523 410860 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230057.1 protein_id gnl|my_center|LOCUS_23340 411110 410865 gene locus_tag LOCUS_23350 411110 410865 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776072.1 protein_id gnl|my_center|LOCUS_23350 411210 411908 gene locus_tag LOCUS_23360 411210 411908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 411905 413137 gene locus_tag LOCUS_23370 411905 413137 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776070.1 protein_id gnl|my_center|LOCUS_23370 415227 413884 gene locus_tag LOCUS_23380 415227 413884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731325.1 protein_id gnl|my_center|LOCUS_23380 415681 415235 gene locus_tag LOCUS_23390 415681 415235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731324.1 protein_id gnl|my_center|LOCUS_23390 415872 417335 gene locus_tag LOCUS_23400 415872 417335 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229720.1 protein_id gnl|my_center|LOCUS_23400 417332 417670 gene locus_tag LOCUS_23410 417332 417670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 417725 419353 gene locus_tag LOCUS_23420 gene pruA 417725 419353 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224530.1 protein_id gnl|my_center|LOCUS_23420 420601 419522 gene locus_tag LOCUS_23430 420601 419522 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104980.1 protein_id gnl|my_center|LOCUS_23430 420701 420898 gene locus_tag LOCUS_23440 420701 420898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 421368 420883 gene locus_tag LOCUS_23450 421368 420883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 421923 421441 gene locus_tag LOCUS_23460 421923 421441 CDS product DUF2505 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876911.1 protein_id gnl|my_center|LOCUS_23460 421976 422791 gene locus_tag LOCUS_23470 421976 422791 CDS product tryptophan 2,3-dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228729.1 protein_id gnl|my_center|LOCUS_23470 422884 427779 gene locus_tag LOCUS_23480 422884 427779 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028707.1 protein_id gnl|my_center|LOCUS_23480 427926 429722 gene locus_tag LOCUS_23490 427926 429722 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730691.1 protein_id gnl|my_center|LOCUS_23490 429719 431560 gene locus_tag LOCUS_23500 429719 431560 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730690.1 protein_id gnl|my_center|LOCUS_23500 431919 431599 gene locus_tag LOCUS_23510 431919 431599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 432161 431916 gene locus_tag LOCUS_23520 432161 431916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 433530 432175 gene locus_tag LOCUS_23530 433530 432175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 433832 433527 gene locus_tag LOCUS_23540 433832 433527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 434152 433832 gene locus_tag LOCUS_23550 434152 433832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23550 434409 435530 gene locus_tag LOCUS_23560 434409 435530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 436355 435531 gene locus_tag LOCUS_23570 436355 435531 CDS product PP2C family serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023173287.1 protein_id gnl|my_center|LOCUS_23570 436488 437246 gene locus_tag LOCUS_23580 436488 437246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 438202 437243 gene locus_tag LOCUS_23590 438202 437243 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227088.1 protein_id gnl|my_center|LOCUS_23590 438279 439232 gene locus_tag LOCUS_23600 438279 439232 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971796.1 protein_id gnl|my_center|LOCUS_23600 439229 440167 gene locus_tag LOCUS_23610 439229 440167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 440358 441065 gene locus_tag LOCUS_23620 440358 441065 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776125.1 protein_id gnl|my_center|LOCUS_23620 441058 442269 gene locus_tag LOCUS_23630 441058 442269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 443678 442587 gene locus_tag LOCUS_23640 443678 442587 CDS product MSMEG_0565 family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876802.1 protein_id gnl|my_center|LOCUS_23640 444496 443675 gene locus_tag LOCUS_23650 444496 443675 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727037.1 protein_id gnl|my_center|LOCUS_23650 445780 444500 gene locus_tag LOCUS_23660 445780 444500 CDS product MSMEG_0569 family flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891990.1 protein_id gnl|my_center|LOCUS_23660 446088 445777 gene locus_tag LOCUS_23670 446088 445777 CDS product MSMEG_0570 family nitrogen starvation response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891991.1 protein_id gnl|my_center|LOCUS_23670 446938 446081 gene locus_tag LOCUS_23680 446938 446081 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104253.1 protein_id gnl|my_center|LOCUS_23680 448368 446935 gene locus_tag LOCUS_23690 448368 446935 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891988.1 protein_id gnl|my_center|LOCUS_23690 449438 448365 gene locus_tag LOCUS_23700 449438 448365 CDS product MSMEG_0568 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876804.1 protein_id gnl|my_center|LOCUS_23700 450102 449440 gene locus_tag LOCUS_23710 450102 449440 CDS product MSMEG_0572 family nitrogen starvation response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891993.1 protein_id gnl|my_center|LOCUS_23710 450937 450089 gene locus_tag LOCUS_23720 450937 450089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 451384 451064 gene locus_tag LOCUS_23730 451384 451064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 451453 455220 gene locus_tag LOCUS_23740 451453 455220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 455277 455804 gene locus_tag LOCUS_23750 455277 455804 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891774.1 protein_id gnl|my_center|LOCUS_23750 455848 456501 gene locus_tag LOCUS_23760 455848 456501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 457221 456523 gene locus_tag LOCUS_23770 457221 456523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 457638 457312 gene locus_tag LOCUS_23780 457638 457312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 457541 458902 gene locus_tag LOCUS_23790 457541 458902 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531553.1 protein_id gnl|my_center|LOCUS_23790 459356 459703 gene locus_tag LOCUS_23800 459356 459703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 459962 461209 gene locus_tag LOCUS_23810 459962 461209 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776058.1 protein_id gnl|my_center|LOCUS_23810 461214 462074 gene locus_tag LOCUS_23820 461214 462074 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776057.1 protein_id gnl|my_center|LOCUS_23820 462071 462955 gene locus_tag LOCUS_23830 462071 462955 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776056.1 protein_id gnl|my_center|LOCUS_23830 463629 464234 gene locus_tag LOCUS_23840 463629 464234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 464381 465121 gene locus_tag LOCUS_23850 464381 465121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 465418 465095 gene locus_tag LOCUS_23860 465418 465095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 465750 465454 gene locus_tag LOCUS_23870 465750 465454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 466285 466719 gene locus_tag LOCUS_23880 466285 466719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 467069 466824 gene locus_tag LOCUS_23890 467069 466824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 472103 467109 gene locus_tag LOCUS_23900 472103 467109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 473365 472103 gene locus_tag LOCUS_23910 473365 472103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 473246 473563 gene locus_tag LOCUS_23920 473246 473563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 475536 473656 gene locus_tag LOCUS_23930 475536 473656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 476693 475533 gene locus_tag LOCUS_23940 476693 475533 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687777.1 protein_id gnl|my_center|LOCUS_23940 478400 476952 gene locus_tag LOCUS_23950 478400 476952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 479139 480002 gene locus_tag LOCUS_23960 479139 480002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 481438 480134 gene locus_tag LOCUS_23970 481438 480134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 482933 482067 gene locus_tag LOCUS_23980 482933 482067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 484694 483195 gene locus_tag LOCUS_23990 484694 483195 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974635.1 protein_id gnl|my_center|LOCUS_23990 484833 485027 gene locus_tag LOCUS_24000 484833 485027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 485027 485428 gene locus_tag LOCUS_24010 485027 485428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 485425 485889 gene locus_tag LOCUS_24020 485425 485889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 485873 486325 gene locus_tag LOCUS_24030 485873 486325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 486431 487069 gene locus_tag LOCUS_24040 486431 487069 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230926.1 protein_id gnl|my_center|LOCUS_24040 487069 488808 gene locus_tag LOCUS_24050 487069 488808 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227095.1 protein_id gnl|my_center|LOCUS_24050 488805 490760 gene locus_tag LOCUS_24060 488805 490760 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227096.1 protein_id gnl|my_center|LOCUS_24060 491573 490791 gene locus_tag LOCUS_24070 491573 490791 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742161.1 protein_id gnl|my_center|LOCUS_24070 492029 493645 gene locus_tag LOCUS_24080 492029 493645 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978239.1 protein_id gnl|my_center|LOCUS_24080 493642 494094 gene locus_tag LOCUS_24090 493642 494094 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973682.1 protein_id gnl|my_center|LOCUS_24090 495697 494069 gene locus_tag LOCUS_24100 495697 494069 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804840.1 protein_id gnl|my_center|LOCUS_24100 496323 495694 gene locus_tag LOCUS_24110 496323 495694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228025.1 protein_id gnl|my_center|LOCUS_24110 497780 496464 gene locus_tag LOCUS_24120 497780 496464 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230152.1 protein_id gnl|my_center|LOCUS_24120 497852 498547 gene locus_tag LOCUS_24130 497852 498547 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974588.1 protein_id gnl|my_center|LOCUS_24130 499508 498639 gene locus_tag LOCUS_24140 499508 498639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729967.1 protein_id gnl|my_center|LOCUS_24140 499774 499505 gene locus_tag LOCUS_24150 499774 499505 CDS product DUF2277 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089416.1 protein_id gnl|my_center|LOCUS_24150 501812 499779 gene locus_tag LOCUS_24160 501812 499779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 502369 501809 gene locus_tag LOCUS_24170 502369 501809 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495205.1 protein_id gnl|my_center|LOCUS_24170 502482 503672 gene locus_tag LOCUS_24180 502482 503672 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228752.1 protein_id gnl|my_center|LOCUS_24180 504014 504430 gene locus_tag LOCUS_24190 504014 504430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 505218 504394 gene locus_tag LOCUS_24200 505218 504394 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192698.1 protein_id gnl|my_center|LOCUS_24200 505677 505288 gene locus_tag LOCUS_24210 505677 505288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 505926 507977 gene locus_tag LOCUS_24220 505926 507977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 508626 507988 gene locus_tag LOCUS_24230 gene eda 508626 507988 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726836.1 protein_id gnl|my_center|LOCUS_24230 510499 508613 gene locus_tag LOCUS_24240 gene edd 510499 508613 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726837.1 protein_id gnl|my_center|LOCUS_24240 512006 510492 gene locus_tag LOCUS_24250 gene zwf 512006 510492 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726838.1 protein_id gnl|my_center|LOCUS_24250 512099 513340 gene locus_tag LOCUS_24260 512099 513340 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876734.1 protein_id gnl|my_center|LOCUS_24260 514856 513327 gene locus_tag LOCUS_24270 514856 513327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 515033 516670 gene locus_tag LOCUS_24280 515033 516670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 518518 516719 gene locus_tag LOCUS_24290 518518 516719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 518727 518652 gene locus_tag LOCUS_t00270 518727 518652 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 518752 520101 gene locus_tag LOCUS_24300 518752 520101 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973639.1 protein_id gnl|my_center|LOCUS_24300 520098 520280 gene locus_tag LOCUS_24310 520098 520280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230044.1 protein_id gnl|my_center|LOCUS_24310 521749 520490 gene locus_tag LOCUS_24320 521749 520490 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074038115.1 protein_id gnl|my_center|LOCUS_24320 522255 521890 gene locus_tag LOCUS_24330 gene mscL 522255 521890 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928676.1 protein_id gnl|my_center|LOCUS_24330 522941 522306 gene locus_tag LOCUS_24340 522941 522306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 523331 522993 gene locus_tag LOCUS_24350 523331 522993 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230041.1 protein_id gnl|my_center|LOCUS_24350 523417 526074 gene locus_tag LOCUS_24360 523417 526074 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259579.1 protein_id gnl|my_center|LOCUS_24360 526778 526194 gene locus_tag LOCUS_24370 526778 526194 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028815.1 protein_id gnl|my_center|LOCUS_24370 526838 528178 gene locus_tag LOCUS_24380 526838 528178 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775783.1 protein_id gnl|my_center|LOCUS_24380 528178 529440 gene locus_tag LOCUS_24390 528178 529440 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486735.1 protein_id gnl|my_center|LOCUS_24390 529447 529929 gene locus_tag LOCUS_24400 gene moaC 529447 529929 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028813.1 protein_id gnl|my_center|LOCUS_24400 529926 530402 gene locus_tag LOCUS_24410 529926 530402 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028812.1 protein_id gnl|my_center|LOCUS_24410 530441 531037 gene locus_tag LOCUS_24420 530441 531037 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804925.1 protein_id gnl|my_center|LOCUS_24420 531216 532085 gene locus_tag LOCUS_24430 531216 532085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 532137 533036 gene locus_tag LOCUS_24440 532137 533036 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942960.1 protein_id gnl|my_center|LOCUS_24440 533033 534169 gene locus_tag LOCUS_24450 533033 534169 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104228.1 protein_id gnl|my_center|LOCUS_24450 534417 534154 gene locus_tag LOCUS_24460 534417 534154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 534605 536170 gene locus_tag LOCUS_24470 534605 536170 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727596.1 protein_id gnl|my_center|LOCUS_24470 536421 536236 gene locus_tag LOCUS_24480 536421 536236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 537557 537060 gene locus_tag LOCUS_24490 537557 537060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 538024 537551 gene locus_tag LOCUS_24500 538024 537551 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003373291.1 protein_id gnl|my_center|LOCUS_24500 538598 538524 gene locus_tag LOCUS_t00280 538598 538524 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 538723 539535 gene locus_tag LOCUS_24510 538723 539535 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977203.1 protein_id gnl|my_center|LOCUS_24510 539804 541951 gene locus_tag LOCUS_24520 539804 541951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 542093 542935 gene locus_tag LOCUS_24530 542093 542935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 543365 542946 gene locus_tag LOCUS_24540 543365 542946 CDS product TIGR03618 family F420-dependent PPOX class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284874.1 protein_id gnl|my_center|LOCUS_24540 545357 543588 gene locus_tag LOCUS_24550 545357 543588 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486701.1 protein_id gnl|my_center|LOCUS_24550 545391 546278 gene locus_tag LOCUS_24560 gene rsmI 545391 546278 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975663.1 protein_id gnl|my_center|LOCUS_24560 546275 547129 gene locus_tag LOCUS_24570 546275 547129 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198448.1 protein_id gnl|my_center|LOCUS_24570 547126 548037 gene locus_tag LOCUS_24580 547126 548037 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028796.1 protein_id gnl|my_center|LOCUS_24580 548408 549586 gene locus_tag LOCUS_24590 548408 549586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 549617 550474 gene locus_tag LOCUS_24600 gene rsmA 549617 550474 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975667.1 protein_id gnl|my_center|LOCUS_24600 550474 551394 gene locus_tag LOCUS_24610 550474 551394 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045756603.1 protein_id gnl|my_center|LOCUS_24610 551387 553150 gene locus_tag LOCUS_24620 551387 553150 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975669.1 protein_id gnl|my_center|LOCUS_24620 553715 553203 gene locus_tag LOCUS_24630 gene tamR 553715 553203 CDS product MarR family transcriptional regulator TamR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975680.1 protein_id gnl|my_center|LOCUS_24630 553765 554553 gene locus_tag LOCUS_24640 553765 554553 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775747.1 protein_id gnl|my_center|LOCUS_24640 554565 554951 gene locus_tag LOCUS_24650 554565 554951 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803775.1 protein_id gnl|my_center|LOCUS_24650 555055 555315 gene locus_tag LOCUS_24660 555055 555315 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899012.1 protein_id gnl|my_center|LOCUS_24660 555616 556095 gene locus_tag LOCUS_24670 555616 556095 CDS product hotdog fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038810.1 protein_id gnl|my_center|LOCUS_24670 556885 556115 gene locus_tag LOCUS_24680 556885 556115 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973246.1 protein_id gnl|my_center|LOCUS_24680 556939 557103 gene locus_tag LOCUS_24690 556939 557103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 557190 558689 gene locus_tag LOCUS_24700 gene miaB 557190 558689 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030453.1 protein_id gnl|my_center|LOCUS_24700 558699 559430 gene locus_tag LOCUS_24710 558699 559430 CDS product peptidase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031666.1 protein_id gnl|my_center|LOCUS_24710 560037 559780 gene locus_tag LOCUS_24720 560037 559780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 560324 560034 gene locus_tag LOCUS_24730 560324 560034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 560843 560346 gene locus_tag LOCUS_24740 560843 560346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 561024 560851 gene locus_tag LOCUS_24750 561024 560851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 561224 561021 gene locus_tag LOCUS_24760 561224 561021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 561247 562209 gene locus_tag LOCUS_24770 gene miaA 561247 562209 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030456.1 protein_id gnl|my_center|LOCUS_24770 562279 563178 gene locus_tag LOCUS_24780 562279 563178 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726832.1 protein_id gnl|my_center|LOCUS_24780 563175 563717 gene locus_tag LOCUS_24790 563175 563717 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179664825.1 protein_id gnl|my_center|LOCUS_24790 563773 565266 gene locus_tag LOCUS_24800 563773 565266 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060486261.1 protein_id gnl|my_center|LOCUS_24800 565283 566122 gene locus_tag LOCUS_24810 gene cmrA 565283 566122 CDS product mycolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084785.1 protein_id gnl|my_center|LOCUS_24810 566136 566795 gene locus_tag LOCUS_24820 566136 566795 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727382.1 protein_id gnl|my_center|LOCUS_24820 566792 567583 gene locus_tag LOCUS_24830 gene dapF 566792 567583 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030458.1 protein_id gnl|my_center|LOCUS_24830 567638 568465 gene locus_tag LOCUS_24840 567638 568465 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891557.1 protein_id gnl|my_center|LOCUS_24840 570899 568563 gene locus_tag LOCUS_24850 570899 568563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 571626 570985 gene locus_tag LOCUS_24860 571626 570985 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016479.1 protein_id gnl|my_center|LOCUS_24860 572056 571628 gene locus_tag LOCUS_24870 572056 571628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 572737 572150 gene locus_tag LOCUS_24880 572737 572150 CDS product nucleoside/nucleotide kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804238.1 protein_id gnl|my_center|LOCUS_24880 572817 574307 gene locus_tag LOCUS_24890 gene hflX 572817 574307 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030461.1 protein_id gnl|my_center|LOCUS_24890 574356 575204 gene locus_tag LOCUS_24900 574356 575204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 575214 577223 gene locus_tag LOCUS_24910 575214 577223 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030465.1 protein_id gnl|my_center|LOCUS_24910 578917 577271 gene locus_tag LOCUS_24920 578917 577271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 580365 579034 gene locus_tag LOCUS_24930 580365 579034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 582059 580365 gene locus_tag LOCUS_24940 582059 580365 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014996.1 protein_id gnl|my_center|LOCUS_24940 582960 582211 gene locus_tag LOCUS_24950 gene lexA 582960 582211 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030466.1 protein_id gnl|my_center|LOCUS_24950 583047 583829 gene locus_tag LOCUS_24960 583047 583829 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090402.1 protein_id gnl|my_center|LOCUS_24960 583966 584277 gene locus_tag LOCUS_24970 583966 584277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 585310 584780 gene locus_tag LOCUS_24980 585310 584780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 585737 585390 gene locus_tag LOCUS_24990 585737 585390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 585818 586366 gene locus_tag LOCUS_25000 585818 586366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 586612 587085 gene locus_tag LOCUS_25010 gene nrdR 586612 587085 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057199.1 protein_id gnl|my_center|LOCUS_25010 587242 590136 gene locus_tag LOCUS_25020 587242 590136 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224267.1 protein_id gnl|my_center|LOCUS_25020 590908 590369 gene locus_tag LOCUS_25030 590908 590369 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889092.1 protein_id gnl|my_center|LOCUS_25030 >Feature sequence22 151 4584 gene locus_tag LOCUS_25040 151 4584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 4586 5074 gene locus_tag LOCUS_25050 4586 5074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 5058 5366 gene locus_tag LOCUS_25060 5058 5366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 5431 5862 gene locus_tag LOCUS_25070 5431 5862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 5877 6449 gene locus_tag LOCUS_25080 5877 6449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 6569 6868 gene locus_tag LOCUS_25090 6569 6868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 6868 8205 gene locus_tag LOCUS_25100 6868 8205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 8243 9211 gene locus_tag LOCUS_25110 8243 9211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 10498 9302 gene locus_tag LOCUS_25120 10498 9302 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112911.1 protein_id gnl|my_center|LOCUS_25120 10792 10514 gene locus_tag LOCUS_25130 10792 10514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 10991 10917 gene locus_tag LOCUS_t00290 10991 10917 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 14190 11056 gene locus_tag LOCUS_25140 14190 11056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 17470 14339 gene locus_tag LOCUS_25150 17470 14339 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973771.1 protein_id gnl|my_center|LOCUS_25150 18225 17467 gene locus_tag LOCUS_25160 18225 17467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 19325 18222 gene locus_tag LOCUS_25170 19325 18222 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804763.1 protein_id gnl|my_center|LOCUS_25170 19734 19429 gene locus_tag LOCUS_25180 19734 19429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 20205 19777 gene locus_tag LOCUS_25190 20205 19777 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973775.1 protein_id gnl|my_center|LOCUS_25190 20241 21617 gene locus_tag LOCUS_25200 20241 21617 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973777.1 protein_id gnl|my_center|LOCUS_25200 21614 22270 gene locus_tag LOCUS_25210 21614 22270 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222931.1 protein_id gnl|my_center|LOCUS_25210 22737 22198 gene locus_tag LOCUS_25220 22737 22198 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223146.1 protein_id gnl|my_center|LOCUS_25220 23820 22747 gene locus_tag LOCUS_25230 23820 22747 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399801.1 protein_id gnl|my_center|LOCUS_25230 24066 23866 gene locus_tag LOCUS_25240 24066 23866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 24943 24152 gene locus_tag LOCUS_25250 24943 24152 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228679.1 protein_id gnl|my_center|LOCUS_25250 25126 25284 gene locus_tag LOCUS_25260 25126 25284 CDS product DUF5679 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010551122.1 protein_id gnl|my_center|LOCUS_25260 25451 26242 gene locus_tag LOCUS_25270 25451 26242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 26416 26246 gene locus_tag LOCUS_25280 26416 26246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 26776 26546 gene locus_tag LOCUS_25290 26776 26546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 27201 26773 gene locus_tag LOCUS_25300 27201 26773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 27582 27304 gene locus_tag LOCUS_25310 27582 27304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 29762 27723 gene locus_tag LOCUS_25320 29762 27723 CDS product ATP-dependent DNA helicase UvrD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668762.1 protein_id gnl|my_center|LOCUS_25320 29839 30084 gene locus_tag LOCUS_25330 29839 30084 CDS product mycoredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973789.1 protein_id gnl|my_center|LOCUS_25330 31050 30130 gene locus_tag LOCUS_25340 gene nudC 31050 30130 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327228.1 protein_id gnl|my_center|LOCUS_25340 31139 32194 gene locus_tag LOCUS_25350 31139 32194 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027605.1 protein_id gnl|my_center|LOCUS_25350 35423 32184 gene locus_tag LOCUS_25360 gene adnB 35423 32184 CDS product ATP-dependent DNA helicase AdnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728029.1 protein_id gnl|my_center|LOCUS_25360 38710 35420 gene locus_tag LOCUS_25370 38710 35420 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223038.1 protein_id gnl|my_center|LOCUS_25370 39208 38777 gene locus_tag LOCUS_25380 39208 38777 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051224.1 protein_id gnl|my_center|LOCUS_25380 39218 39754 gene locus_tag LOCUS_25390 39218 39754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 40431 39751 gene locus_tag LOCUS_25400 40431 39751 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222957.1 protein_id gnl|my_center|LOCUS_25400 41262 40495 gene locus_tag LOCUS_25410 41262 40495 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479811.1 protein_id gnl|my_center|LOCUS_25410 41436 43907 gene locus_tag LOCUS_25420 41436 43907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 44214 43909 gene locus_tag LOCUS_25430 44214 43909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 44756 44214 gene locus_tag LOCUS_25440 44756 44214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 46072 44753 gene locus_tag LOCUS_25450 46072 44753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 47126 46080 gene locus_tag LOCUS_25460 47126 46080 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804471.1 protein_id gnl|my_center|LOCUS_25460 47605 47126 gene locus_tag LOCUS_25470 47605 47126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 48399 47602 gene locus_tag LOCUS_25480 48399 47602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 49365 48484 gene locus_tag LOCUS_25490 49365 48484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 >Feature sequence23 1594 386 gene locus_tag LOCUS_25500 gene moeZ 1594 386 CDS product adenylyltransferase/sulfurtransferase MoeZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973798.1 protein_id gnl|my_center|LOCUS_25500 1733 2365 gene locus_tag LOCUS_25510 1733 2365 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973808.1 protein_id gnl|my_center|LOCUS_25510 2417 2638 gene locus_tag LOCUS_25520 2417 2638 CDS product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221492514.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25520 2900 3121 gene locus_tag LOCUS_25530 2900 3121 CDS product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080983.1 protein_id gnl|my_center|LOCUS_25530 3141 4373 gene locus_tag LOCUS_25540 3141 4373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 5088 4384 gene locus_tag LOCUS_25550 5088 4384 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973811.1 protein_id gnl|my_center|LOCUS_25550 5262 6869 gene locus_tag LOCUS_25560 5262 6869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 7387 6935 gene locus_tag LOCUS_25570 7387 6935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 8134 7394 gene locus_tag LOCUS_25580 8134 7394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 8924 8142 gene locus_tag LOCUS_25590 8924 8142 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728017.1 protein_id gnl|my_center|LOCUS_25590 9766 9458 gene locus_tag LOCUS_25600 9766 9458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 10460 9843 gene locus_tag LOCUS_25610 10460 9843 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973815.1 protein_id gnl|my_center|LOCUS_25610 11320 10457 gene locus_tag LOCUS_25620 11320 10457 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973816.1 protein_id gnl|my_center|LOCUS_25620 12087 11452 gene locus_tag LOCUS_25630 12087 11452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973817.1 protein_id gnl|my_center|LOCUS_25630 12689 12120 gene locus_tag LOCUS_25640 12689 12120 CDS product acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229706.1 protein_id gnl|my_center|LOCUS_25640 14650 12692 gene locus_tag LOCUS_25650 14650 12692 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031492.1 protein_id gnl|my_center|LOCUS_25650 15233 14700 gene locus_tag LOCUS_25660 15233 14700 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223004.1 protein_id gnl|my_center|LOCUS_25660 15513 15325 gene locus_tag LOCUS_25670 15513 15325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 16787 15597 gene locus_tag LOCUS_25680 16787 15597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 17853 16798 gene locus_tag LOCUS_25690 17853 16798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 18941 17850 gene locus_tag LOCUS_25700 18941 17850 CDS product DUF2332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403477.1 protein_id gnl|my_center|LOCUS_25700 20235 19039 gene locus_tag LOCUS_25710 20235 19039 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030944.1 protein_id gnl|my_center|LOCUS_25710 21524 20310 gene locus_tag LOCUS_25720 21524 20310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 24861 22498 gene locus_tag LOCUS_25730 24861 22498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 25925 24858 gene locus_tag LOCUS_25740 25925 24858 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175826.1 protein_id gnl|my_center|LOCUS_25740 26142 25912 gene locus_tag LOCUS_25750 26142 25912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 27461 26157 gene locus_tag LOCUS_25760 27461 26157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 29191 27458 gene locus_tag LOCUS_25770 29191 27458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 32247 29212 gene locus_tag LOCUS_25780 32247 29212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 33968 32439 gene locus_tag LOCUS_25790 33968 32439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 34574 34080 gene locus_tag LOCUS_25800 34574 34080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 35707 34571 gene locus_tag LOCUS_25810 35707 34571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 35953 37230 gene locus_tag LOCUS_25820 35953 37230 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030088.1 protein_id gnl|my_center|LOCUS_25820 37217 37828 gene locus_tag LOCUS_25830 37217 37828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 37841 39013 gene locus_tag LOCUS_25840 37841 39013 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973825.1 protein_id gnl|my_center|LOCUS_25840 39017 39376 gene locus_tag LOCUS_25850 39017 39376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 39971 39432 gene locus_tag LOCUS_25860 39971 39432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 40087 40722 gene locus_tag LOCUS_25870 40087 40722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 40746 41249 gene locus_tag LOCUS_25880 40746 41249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 44439 41512 gene locus_tag LOCUS_25890 gene secA 44439 41512 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975807.1 protein_id gnl|my_center|LOCUS_25890 45723 44500 gene locus_tag LOCUS_25900 45723 44500 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531089.1 protein_id gnl|my_center|LOCUS_25900 46426 45731 gene locus_tag LOCUS_25910 46426 45731 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975804.1 protein_id gnl|my_center|LOCUS_25910 47099 46467 gene locus_tag LOCUS_25920 gene raiA 47099 46467 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975803.1 protein_id gnl|my_center|LOCUS_25920 48245 47451 gene locus_tag LOCUS_25930 48245 47451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 50058 48322 gene locus_tag LOCUS_25940 50058 48322 CDS product LpqB family beta-propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028714.1 protein_id gnl|my_center|LOCUS_25940 51878 50085 gene locus_tag LOCUS_25950 gene mtrB 51878 50085 CDS product two-component system sensor histidine kinase MtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028715.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25950 52604 51882 gene locus_tag LOCUS_25960 gene mtrA 52604 51882 CDS product two-component system response regulator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975799.1 protein_id gnl|my_center|LOCUS_25960 54200 52773 gene locus_tag LOCUS_25970 gene ahcY 54200 52773 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975788.1 protein_id gnl|my_center|LOCUS_25970 55296 54334 gene locus_tag LOCUS_25980 55296 54334 CDS product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891984.1 protein_id gnl|my_center|LOCUS_25980 56363 55302 gene locus_tag LOCUS_25990 56363 55302 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028459.1 protein_id gnl|my_center|LOCUS_25990 57480 56449 gene locus_tag LOCUS_26000 57480 56449 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975785.1 protein_id gnl|my_center|LOCUS_26000 57653 57477 gene locus_tag LOCUS_26010 57653 57477 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545155.1 protein_id gnl|my_center|LOCUS_26010 59020 57653 gene locus_tag LOCUS_26020 59020 57653 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028721.1 protein_id gnl|my_center|LOCUS_26020 59404 59093 gene locus_tag LOCUS_26030 59404 59093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 59500 59952 gene locus_tag LOCUS_26040 59500 59952 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776092.1 protein_id gnl|my_center|LOCUS_26040 60008 60736 gene locus_tag LOCUS_26050 60008 60736 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963056.1 protein_id gnl|my_center|LOCUS_26050 60733 61785 gene locus_tag LOCUS_26060 60733 61785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 63183 61804 gene locus_tag LOCUS_26070 63183 61804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 66068 63180 gene locus_tag LOCUS_26080 66068 63180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 66450 66190 gene locus_tag LOCUS_26090 66450 66190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 66601 67647 gene locus_tag LOCUS_26100 gene cofD 66601 67647 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975775.1 protein_id gnl|my_center|LOCUS_26100 67644 68612 gene locus_tag LOCUS_26110 67644 68612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 68655 69410 gene locus_tag LOCUS_26120 68655 69410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 70535 69432 gene locus_tag LOCUS_26130 70535 69432 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776146.1 protein_id gnl|my_center|LOCUS_26130 70606 71328 gene locus_tag LOCUS_26140 70606 71328 CDS product TIGR03089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975771.1 protein_id gnl|my_center|LOCUS_26140 73535 71355 gene locus_tag LOCUS_26150 73535 71355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 74557 73778 gene locus_tag LOCUS_26160 74557 73778 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776098.1 protein_id gnl|my_center|LOCUS_26160 75473 74565 gene locus_tag LOCUS_26170 75473 74565 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112141.1 protein_id gnl|my_center|LOCUS_26170 77539 75470 gene locus_tag LOCUS_26180 77539 75470 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776100.1 protein_id gnl|my_center|LOCUS_26180 78750 77536 gene locus_tag LOCUS_26190 gene glf 78750 77536 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222174.1 protein_id gnl|my_center|LOCUS_26190 78876 79946 gene locus_tag LOCUS_26200 78876 79946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 80850 79936 gene locus_tag LOCUS_26210 80850 79936 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875987.1 protein_id gnl|my_center|LOCUS_26210 81755 80847 gene locus_tag LOCUS_26220 81755 80847 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091105.1 protein_id gnl|my_center|LOCUS_26220 81778 82560 gene locus_tag LOCUS_26230 81778 82560 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396522.1 protein_id gnl|my_center|LOCUS_26230 83101 82553 gene locus_tag LOCUS_26240 83101 82553 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227463.1 protein_id gnl|my_center|LOCUS_26240 84658 83195 gene locus_tag LOCUS_26250 84658 83195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26250 84810 86099 gene locus_tag LOCUS_26260 84810 86099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 86121 87002 gene locus_tag LOCUS_26270 86121 87002 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918831.1 protein_id gnl|my_center|LOCUS_26270 87788 87015 gene locus_tag LOCUS_26280 87788 87015 CDS product SigB/SigF/SigG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235624325.1 protein_id gnl|my_center|LOCUS_26280 88044 88478 gene locus_tag LOCUS_26290 88044 88478 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027708.1 protein_id gnl|my_center|LOCUS_26290 88482 88904 gene locus_tag LOCUS_26300 gene arfB 88482 88904 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776269.1 protein_id gnl|my_center|LOCUS_26300 88919 89716 gene locus_tag LOCUS_26310 88919 89716 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976477.1 protein_id gnl|my_center|LOCUS_26310 89713 90819 gene locus_tag LOCUS_26320 gene alr 89713 90819 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110568702.1 protein_id gnl|my_center|LOCUS_26320 90816 91775 gene locus_tag LOCUS_26330 90816 91775 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728314.1 protein_id gnl|my_center|LOCUS_26330 91786 93033 gene locus_tag LOCUS_26340 91786 93033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 93030 93725 gene locus_tag LOCUS_26350 93030 93725 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977171.1 protein_id gnl|my_center|LOCUS_26350 94889 93732 gene locus_tag LOCUS_26360 94889 93732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 95394 94867 gene locus_tag LOCUS_26370 gene purE 95394 94867 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975752.1 protein_id gnl|my_center|LOCUS_26370 96561 95395 gene locus_tag LOCUS_26380 96561 95395 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975751.1 protein_id gnl|my_center|LOCUS_26380 96875 96582 gene locus_tag LOCUS_26390 96875 96582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 97859 96987 gene locus_tag LOCUS_26400 97859 96987 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029954.1 protein_id gnl|my_center|LOCUS_26400 98485 97979 gene locus_tag LOCUS_26410 98485 97979 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727928.1 protein_id gnl|my_center|LOCUS_26410 99370 98558 gene locus_tag LOCUS_26420 99370 98558 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029953.1 protein_id gnl|my_center|LOCUS_26420 99470 101068 gene locus_tag LOCUS_26430 99470 101068 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222858.1 protein_id gnl|my_center|LOCUS_26430 101104 101295 gene locus_tag LOCUS_26440 101104 101295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 101292 101897 gene locus_tag LOCUS_26450 101292 101897 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974050.1 protein_id gnl|my_center|LOCUS_26450 102041 104338 gene locus_tag LOCUS_26460 102041 104338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 105788 104385 gene locus_tag LOCUS_26470 105788 104385 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228504.1 protein_id gnl|my_center|LOCUS_26470 106333 105863 gene locus_tag LOCUS_26480 106333 105863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 107563 106391 gene locus_tag LOCUS_26490 107563 106391 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412771.1 protein_id gnl|my_center|LOCUS_26490 108672 107650 gene locus_tag LOCUS_26500 108672 107650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 109640 108981 gene locus_tag LOCUS_26510 109640 108981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 109752 111530 gene locus_tag LOCUS_26520 109752 111530 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029950.1 protein_id gnl|my_center|LOCUS_26520 111631 112725 gene locus_tag LOCUS_26530 111631 112725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 112719 113426 gene locus_tag LOCUS_26540 112719 113426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 113423 114643 gene locus_tag LOCUS_26550 113423 114643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 114640 115827 gene locus_tag LOCUS_26560 114640 115827 CDS product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844744.1 protein_id gnl|my_center|LOCUS_26560 116300 115824 gene locus_tag LOCUS_26570 116300 115824 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480116.1 protein_id gnl|my_center|LOCUS_26570 117716 116352 gene locus_tag LOCUS_26580 117716 116352 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416051.1 protein_id gnl|my_center|LOCUS_26580 117997 117758 gene locus_tag LOCUS_26590 117997 117758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 118240 118812 gene locus_tag LOCUS_26600 118240 118812 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731070.1 protein_id gnl|my_center|LOCUS_26600 118809 120548 gene locus_tag LOCUS_26610 118809 120548 CDS product FAD-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225738.1 protein_id gnl|my_center|LOCUS_26610 121875 120553 gene locus_tag LOCUS_26620 121875 120553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 122423 121929 gene locus_tag LOCUS_26630 122423 121929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 122843 122556 gene locus_tag LOCUS_26640 122843 122556 CDS product DUF1905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084855.1 protein_id gnl|my_center|LOCUS_26640 122868 123353 gene locus_tag LOCUS_26650 122868 123353 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229589.1 protein_id gnl|my_center|LOCUS_26650 123350 124807 gene locus_tag LOCUS_26660 123350 124807 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206015115.1 protein_id gnl|my_center|LOCUS_26660 124854 128261 gene locus_tag LOCUS_26670 124854 128261 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027194.1 protein_id gnl|my_center|LOCUS_26670 129444 128272 gene locus_tag LOCUS_26680 129444 128272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 130935 129535 gene locus_tag LOCUS_26690 130935 129535 CDS product NAD(P)H-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872192.1 protein_id gnl|my_center|LOCUS_26690 132739 131342 gene locus_tag LOCUS_26700 gene lpdA 132739 131342 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283919.1 protein_id gnl|my_center|LOCUS_26700 132803 133249 gene locus_tag LOCUS_26710 132803 133249 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974055.1 protein_id gnl|my_center|LOCUS_26710 133268 134074 gene locus_tag LOCUS_26720 133268 134074 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974056.1 protein_id gnl|my_center|LOCUS_26720 134086 134748 gene locus_tag LOCUS_26730 134086 134748 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229194.1 protein_id gnl|my_center|LOCUS_26730 134780 135169 gene locus_tag LOCUS_26740 134780 135169 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223897.1 protein_id gnl|my_center|LOCUS_26740 135204 136202 gene locus_tag LOCUS_26750 135204 136202 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140840.1 protein_id gnl|my_center|LOCUS_26750 136269 136538 gene locus_tag LOCUS_26760 136269 136538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 137114 136578 gene locus_tag LOCUS_26770 137114 136578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 137133 138815 gene locus_tag LOCUS_26780 137133 138815 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495362.1 protein_id gnl|my_center|LOCUS_26780 139430 138843 gene locus_tag LOCUS_26790 139430 138843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 139454 140416 gene locus_tag LOCUS_26800 gene deoC 139454 140416 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029945.1 protein_id gnl|my_center|LOCUS_26800 140434 141867 gene locus_tag LOCUS_26810 140434 141867 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222793.1 protein_id gnl|my_center|LOCUS_26810 141867 142748 gene locus_tag LOCUS_26820 141867 142748 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222792.1 protein_id gnl|my_center|LOCUS_26820 142745 143362 gene locus_tag LOCUS_26830 142745 143362 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189397579.1 protein_id gnl|my_center|LOCUS_26830 143359 143877 gene locus_tag LOCUS_26840 143359 143877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 144301 143861 gene locus_tag LOCUS_26850 144301 143861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 145402 144320 gene locus_tag LOCUS_26860 145402 144320 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974072.1 protein_id gnl|my_center|LOCUS_26860 145459 145914 gene locus_tag LOCUS_26870 145459 145914 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225005.1 protein_id gnl|my_center|LOCUS_26870 145937 146320 gene locus_tag LOCUS_26880 145937 146320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 147624 146368 gene locus_tag LOCUS_26890 147624 146368 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872150.1 protein_id gnl|my_center|LOCUS_26890 148844 147651 gene locus_tag LOCUS_26900 148844 147651 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222093.1 protein_id gnl|my_center|LOCUS_26900 149211 148816 gene locus_tag LOCUS_26910 149211 148816 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974083.1 protein_id gnl|my_center|LOCUS_26910 150476 149208 gene locus_tag LOCUS_26920 150476 149208 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029928.1 protein_id gnl|my_center|LOCUS_26920 151705 150473 gene locus_tag LOCUS_26930 151705 150473 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222770.1 protein_id gnl|my_center|LOCUS_26930 153282 151702 gene locus_tag LOCUS_26940 153282 151702 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974086.1 protein_id gnl|my_center|LOCUS_26940 154511 153459 gene locus_tag LOCUS_26950 154511 153459 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222768.1 protein_id gnl|my_center|LOCUS_26950 155867 154701 gene locus_tag LOCUS_26960 155867 154701 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776145.1 protein_id gnl|my_center|LOCUS_26960 156445 155975 gene locus_tag LOCUS_26970 156445 155975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 156939 156430 gene locus_tag LOCUS_26980 156939 156430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 157928 156939 gene locus_tag LOCUS_26990 gene meaB 157928 156939 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222827.1 protein_id gnl|my_center|LOCUS_26990 160093 157928 gene locus_tag LOCUS_27000 gene scpA 160093 157928 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222826.1 protein_id gnl|my_center|LOCUS_27000 161814 160090 gene locus_tag LOCUS_27010 161814 160090 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742071.1 protein_id gnl|my_center|LOCUS_27010 162022 163344 gene locus_tag LOCUS_27020 162022 163344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 163423 165093 gene locus_tag LOCUS_27030 163423 165093 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485194.1 protein_id gnl|my_center|LOCUS_27030 165173 166228 gene locus_tag LOCUS_27040 165173 166228 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742121.1 protein_id gnl|my_center|LOCUS_27040 166389 167033 gene locus_tag LOCUS_27050 166389 167033 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225081.1 protein_id gnl|my_center|LOCUS_27050 167051 169075 gene locus_tag LOCUS_27060 167051 169075 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977936.1 protein_id gnl|my_center|LOCUS_27060 169180 169923 gene locus_tag LOCUS_27070 169180 169923 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_27070 171031 169907 gene locus_tag LOCUS_27080 171031 169907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 170975 171547 gene locus_tag LOCUS_27090 170975 171547 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226947.1 protein_id gnl|my_center|LOCUS_27090 172631 171561 gene locus_tag LOCUS_27100 172631 171561 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858295.1 protein_id gnl|my_center|LOCUS_27100 173150 172638 gene locus_tag LOCUS_27110 173150 172638 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029900.1 protein_id gnl|my_center|LOCUS_27110 174221 173160 gene locus_tag LOCUS_27120 gene trpS 174221 173160 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222753.1 protein_id gnl|my_center|LOCUS_27120 174273 175040 gene locus_tag LOCUS_27130 174273 175040 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027556.1 protein_id gnl|my_center|LOCUS_27130 175409 175065 gene locus_tag LOCUS_27140 175409 175065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 175480 176961 gene locus_tag LOCUS_27150 175480 176961 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222156.1 protein_id gnl|my_center|LOCUS_27150 177012 178187 gene locus_tag LOCUS_27160 177012 178187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 179374 178139 gene locus_tag LOCUS_27170 179374 178139 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084599.1 protein_id gnl|my_center|LOCUS_27170 179528 180235 gene locus_tag LOCUS_27180 179528 180235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 180629 180219 gene locus_tag LOCUS_27190 180629 180219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 184229 180666 gene locus_tag LOCUS_27200 184229 180666 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110240682.1 protein_id gnl|my_center|LOCUS_27200 184288 184920 gene locus_tag LOCUS_27210 184288 184920 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030017.1 protein_id gnl|my_center|LOCUS_27210 187209 185020 gene locus_tag LOCUS_27220 187209 185020 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031369.1 protein_id gnl|my_center|LOCUS_27220 187387 188484 gene locus_tag LOCUS_27230 187387 188484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 189237 188539 gene locus_tag LOCUS_27240 189237 188539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 189262 190248 gene locus_tag LOCUS_27250 189262 190248 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406301.1 protein_id gnl|my_center|LOCUS_27250 190784 190320 gene locus_tag LOCUS_27260 190784 190320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 191650 190790 gene locus_tag LOCUS_27270 191650 190790 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056107.1 protein_id gnl|my_center|LOCUS_27270 195879 191713 gene locus_tag LOCUS_27280 195879 191713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 197263 196025 gene locus_tag LOCUS_27290 197263 196025 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226021.1 protein_id gnl|my_center|LOCUS_27290 199059 197503 gene locus_tag LOCUS_27300 gene purH 199059 197503 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029883.1 protein_id gnl|my_center|LOCUS_27300 199774 199166 gene locus_tag LOCUS_27310 gene purN 199774 199166 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974158.1 protein_id gnl|my_center|LOCUS_27310 201056 199785 gene locus_tag LOCUS_27320 201056 199785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 201236 203095 gene locus_tag LOCUS_27330 201236 203095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 203179 204543 gene locus_tag LOCUS_27340 203179 204543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 204678 205928 gene locus_tag LOCUS_27350 204678 205928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 206876 205983 gene locus_tag LOCUS_27360 gene sucD 206876 205983 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063434.1 protein_id gnl|my_center|LOCUS_27360 208041 206878 gene locus_tag LOCUS_27370 gene sucC 208041 206878 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730595.1 protein_id gnl|my_center|LOCUS_27370 208529 209392 gene locus_tag LOCUS_27380 208529 209392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 212220 209776 gene locus_tag LOCUS_27390 gene pcrA 212220 209776 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029870.1 protein_id gnl|my_center|LOCUS_27390 212498 213160 gene locus_tag LOCUS_27400 212498 213160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 214076 213180 gene locus_tag LOCUS_27410 214076 213180 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033261831.1 protein_id gnl|my_center|LOCUS_27410 214750 214073 gene locus_tag LOCUS_27420 214750 214073 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029866.1 protein_id gnl|my_center|LOCUS_27420 216054 214747 gene locus_tag LOCUS_27430 216054 214747 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974180.1 protein_id gnl|my_center|LOCUS_27430 216185 217306 gene locus_tag LOCUS_27440 216185 217306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 217303 217656 gene locus_tag LOCUS_27450 217303 217656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 217653 218195 gene locus_tag LOCUS_27460 217653 218195 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222365.1 protein_id gnl|my_center|LOCUS_27460 218250 219965 gene locus_tag LOCUS_27470 218250 219965 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230756.1 protein_id gnl|my_center|LOCUS_27470 219962 221704 gene locus_tag LOCUS_27480 219962 221704 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027610.1 protein_id gnl|my_center|LOCUS_27480 222000 224261 gene locus_tag LOCUS_27490 222000 224261 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776627.1 protein_id gnl|my_center|LOCUS_27490 224969 224280 gene locus_tag LOCUS_27500 gene npdG 224969 224280 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028232.1 protein_id gnl|my_center|LOCUS_27500 225068 226105 gene locus_tag LOCUS_27510 225068 226105 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031181.1 protein_id gnl|my_center|LOCUS_27510 226886 226122 gene locus_tag LOCUS_27520 226886 226122 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031142.1 protein_id gnl|my_center|LOCUS_27520 226909 228057 gene locus_tag LOCUS_27530 226909 228057 CDS product long-chain specific acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031182.1 protein_id gnl|my_center|LOCUS_27530 228388 230250 gene locus_tag LOCUS_27540 228388 230250 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229431.1 protein_id gnl|my_center|LOCUS_27540 230333 231166 gene locus_tag LOCUS_27550 230333 231166 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891968.1 protein_id gnl|my_center|LOCUS_27550 232712 231168 gene locus_tag LOCUS_27560 232712 231168 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094018.1 protein_id gnl|my_center|LOCUS_27560 232830 234974 gene locus_tag LOCUS_27570 232830 234974 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030047.1 protein_id gnl|my_center|LOCUS_27570 235041 237575 gene locus_tag LOCUS_27580 235041 237575 CDS product bifunctional FO biosynthesis protein CofGH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104130.1 protein_id gnl|my_center|LOCUS_27580 237738 237902 gene locus_tag LOCUS_27590 237738 237902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 238402 238010 gene locus_tag LOCUS_27600 238402 238010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 238480 238977 gene locus_tag LOCUS_27610 238480 238977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 239130 239906 gene locus_tag LOCUS_27620 239130 239906 CDS product TIGR03619 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228576.1 protein_id gnl|my_center|LOCUS_27620 241193 239913 gene locus_tag LOCUS_27630 241193 239913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 242167 241190 gene locus_tag LOCUS_27640 242167 241190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 242265 243602 gene locus_tag LOCUS_27650 242265 243602 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970232.1 protein_id gnl|my_center|LOCUS_27650 243644 244333 gene locus_tag LOCUS_27660 243644 244333 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131402.1 protein_id gnl|my_center|LOCUS_27660 245826 244381 gene locus_tag LOCUS_27670 245826 244381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 247506 245908 gene locus_tag LOCUS_27680 gene guaA 247506 245908 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974187.1 protein_id gnl|my_center|LOCUS_27680 247463 248398 gene locus_tag LOCUS_27690 247463 248398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 250436 248703 gene locus_tag LOCUS_27700 250436 248703 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086844353.1 protein_id gnl|my_center|LOCUS_27700 252085 250499 gene locus_tag LOCUS_27710 252085 250499 CDS product succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029859.1 protein_id gnl|my_center|LOCUS_27710 253762 252308 gene locus_tag LOCUS_27720 253762 252308 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079861.1 protein_id gnl|my_center|LOCUS_27720 254981 253839 gene locus_tag LOCUS_27730 254981 253839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416605.1 protein_id gnl|my_center|LOCUS_27730 256146 254983 gene locus_tag LOCUS_27740 256146 254983 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728110.1 protein_id gnl|my_center|LOCUS_27740 256289 257869 gene locus_tag LOCUS_27750 256289 257869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 258338 257898 gene locus_tag LOCUS_27760 258338 257898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 258392 258991 gene locus_tag LOCUS_27770 258392 258991 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226549.1 protein_id gnl|my_center|LOCUS_27770 258988 260613 gene locus_tag LOCUS_27780 258988 260613 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226548.1 protein_id gnl|my_center|LOCUS_27780 260746 261918 gene locus_tag LOCUS_27790 260746 261918 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222819.1 protein_id gnl|my_center|LOCUS_27790 261966 263561 gene locus_tag LOCUS_27800 261966 263561 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104457.1 protein_id gnl|my_center|LOCUS_27800 263759 265138 gene locus_tag LOCUS_27810 263759 265138 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288614.1 protein_id gnl|my_center|LOCUS_27810 265391 265155 gene locus_tag LOCUS_27820 265391 265155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803898.1 protein_id gnl|my_center|LOCUS_27820 266317 265463 gene locus_tag LOCUS_27830 266317 265463 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803897.1 protein_id gnl|my_center|LOCUS_27830 266973 266404 gene locus_tag LOCUS_27840 266973 266404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 268073 266970 gene locus_tag LOCUS_27850 268073 266970 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490874.1 protein_id gnl|my_center|LOCUS_27850 268807 268070 gene locus_tag LOCUS_27860 268807 268070 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804039.1 protein_id gnl|my_center|LOCUS_27860 268832 269686 gene locus_tag LOCUS_27870 268832 269686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 269706 270614 gene locus_tag LOCUS_27880 269706 270614 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088843.1 protein_id gnl|my_center|LOCUS_27880 271750 270644 gene locus_tag LOCUS_27890 271750 270644 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974202.1 protein_id gnl|my_center|LOCUS_27890 272229 271777 gene locus_tag LOCUS_27900 gene rnhA 272229 271777 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896965.1 protein_id gnl|my_center|LOCUS_27900 272329 274395 gene locus_tag LOCUS_27910 272329 274395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 275905 274403 gene locus_tag LOCUS_27920 gene guaB 275905 274403 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804497.1 protein_id gnl|my_center|LOCUS_27920 276837 275953 gene locus_tag LOCUS_27930 276837 275953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 277815 276910 gene locus_tag LOCUS_27940 277815 276910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 278186 277812 gene locus_tag LOCUS_27950 278186 277812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 278725 278183 gene locus_tag LOCUS_27960 278725 278183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 278830 279882 gene locus_tag LOCUS_27970 278830 279882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 280417 279860 gene locus_tag LOCUS_27980 280417 279860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 280961 280419 gene locus_tag LOCUS_27990 280961 280419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 282752 281127 gene locus_tag LOCUS_28000 gene groL 282752 281127 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974210.1 protein_id gnl|my_center|LOCUS_28000 283141 282845 gene locus_tag LOCUS_28010 gene groES 283141 282845 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892970.1 protein_id gnl|my_center|LOCUS_28010 283346 284524 gene locus_tag LOCUS_28020 283346 284524 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029846.1 protein_id gnl|my_center|LOCUS_28020 285553 284528 gene locus_tag LOCUS_28030 285553 284528 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031881.1 protein_id gnl|my_center|LOCUS_28030 286292 285645 gene locus_tag LOCUS_28040 286292 285645 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229801.1 protein_id gnl|my_center|LOCUS_28040 287392 286292 gene locus_tag LOCUS_28050 287392 286292 CDS product S-(hydroxymethyl)mycothiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027326.1 protein_id gnl|my_center|LOCUS_28050 289278 288031 gene locus_tag LOCUS_28060 289278 288031 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074038115.1 protein_id gnl|my_center|LOCUS_28060 289673 290227 gene locus_tag LOCUS_28070 289673 290227 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495205.1 protein_id gnl|my_center|LOCUS_28070 290227 291477 gene locus_tag LOCUS_28080 290227 291477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 291937 291461 gene locus_tag LOCUS_28090 291937 291461 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776312.1 protein_id gnl|my_center|LOCUS_28090 292575 291934 gene locus_tag LOCUS_28100 gene tsaB 292575 291934 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029839.1 protein_id gnl|my_center|LOCUS_28100 293134 292586 gene locus_tag LOCUS_28110 293134 292586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 294027 293131 gene locus_tag LOCUS_28120 294027 293131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 295109 294039 gene locus_tag LOCUS_28130 295109 294039 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327056.1 protein_id gnl|my_center|LOCUS_28130 296245 295106 gene locus_tag LOCUS_28140 gene alr 296245 295106 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029835.1 protein_id gnl|my_center|LOCUS_28140 297663 296242 gene locus_tag LOCUS_28150 297663 296242 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029833.1 protein_id gnl|my_center|LOCUS_28150 298057 297704 gene locus_tag LOCUS_28160 298057 297704 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974229.1 protein_id gnl|my_center|LOCUS_28160 298409 298092 gene locus_tag LOCUS_28170 298409 298092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 298300 298596 gene locus_tag LOCUS_28180 298300 298596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 298974 298624 gene locus_tag LOCUS_28190 298974 298624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 301021 299219 gene locus_tag LOCUS_28200 gene glmS 301021 299219 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974233.1 protein_id gnl|my_center|LOCUS_28200 301134 302111 gene locus_tag LOCUS_28210 gene coaA 301134 302111 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974235.1 protein_id gnl|my_center|LOCUS_28210 303007 302108 gene locus_tag LOCUS_28220 303007 302108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 303634 303032 gene locus_tag LOCUS_28230 303634 303032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 304647 303631 gene locus_tag LOCUS_28240 304647 303631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 306002 304644 gene locus_tag LOCUS_28250 gene glmM 306002 304644 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974237.1 protein_id gnl|my_center|LOCUS_28250 306617 306117 gene locus_tag LOCUS_28260 gene rpsI 306617 306117 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776323.1 protein_id gnl|my_center|LOCUS_28260 307100 306657 gene locus_tag LOCUS_28270 gene rplM 307100 306657 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056000.1 protein_id gnl|my_center|LOCUS_28270 307361 308659 gene locus_tag LOCUS_28280 307361 308659 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933494.1 protein_id gnl|my_center|LOCUS_28280 310582 309275 gene locus_tag LOCUS_28290 310582 309275 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086878.1 protein_id gnl|my_center|LOCUS_28290 314466 310579 gene locus_tag LOCUS_28300 314466 310579 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061962207.1 protein_id gnl|my_center|LOCUS_28300 315035 314535 gene locus_tag LOCUS_28310 315035 314535 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188679977.1 protein_id gnl|my_center|LOCUS_28310 315111 316328 gene locus_tag LOCUS_28320 315111 316328 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036480.1 protein_id gnl|my_center|LOCUS_28320 317338 316367 gene locus_tag LOCUS_28330 317338 316367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 318938 317358 gene locus_tag LOCUS_28340 318938 317358 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223393.1 protein_id gnl|my_center|LOCUS_28340 319042 320376 gene locus_tag LOCUS_28350 319042 320376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 319916 319822 gene locus_tag LOCUS_t00300 319916 319822 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 321553 320519 gene locus_tag LOCUS_28360 321553 320519 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804257.1 protein_id gnl|my_center|LOCUS_28360 323214 321550 gene locus_tag LOCUS_28370 323214 321550 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030975.1 protein_id gnl|my_center|LOCUS_28370 323095 323412 gene locus_tag LOCUS_28380 323095 323412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 323584 324447 gene locus_tag LOCUS_28390 323584 324447 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026871.1 protein_id gnl|my_center|LOCUS_28390 324485 325336 gene locus_tag LOCUS_28400 324485 325336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 325452 326600 gene locus_tag LOCUS_28410 325452 326600 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731330.1 protein_id gnl|my_center|LOCUS_28410 326612 327760 gene locus_tag LOCUS_28420 326612 327760 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731331.1 protein_id gnl|my_center|LOCUS_28420 327757 328509 gene locus_tag LOCUS_28430 327757 328509 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224989.1 protein_id gnl|my_center|LOCUS_28430 328523 329323 gene locus_tag LOCUS_28440 328523 329323 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224990.1 protein_id gnl|my_center|LOCUS_28440 329320 330345 gene locus_tag LOCUS_28450 329320 330345 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225004.1 protein_id gnl|my_center|LOCUS_28450 330473 331639 gene locus_tag LOCUS_28460 330473 331639 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027926.1 protein_id gnl|my_center|LOCUS_28460 331760 333196 gene locus_tag LOCUS_28470 331760 333196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 333307 336612 gene locus_tag LOCUS_28480 333307 336612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 337086 336631 gene locus_tag LOCUS_28490 337086 336631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 337728 337114 gene locus_tag LOCUS_28500 337728 337114 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389654.1 protein_id gnl|my_center|LOCUS_28500 338551 337721 gene locus_tag LOCUS_28510 gene truA 338551 337721 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974242.1 protein_id gnl|my_center|LOCUS_28510 338622 338753 gene locus_tag LOCUS_28520 338622 338753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 338873 340531 gene locus_tag LOCUS_28530 338873 340531 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971843.1 protein_id gnl|my_center|LOCUS_28530 340721 340545 gene locus_tag LOCUS_28540 340721 340545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 341641 340760 gene locus_tag LOCUS_28550 341641 340760 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776299.1 protein_id gnl|my_center|LOCUS_28550 341673 342038 gene locus_tag LOCUS_28560 341673 342038 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730360.1 protein_id gnl|my_center|LOCUS_28560 342049 343278 gene locus_tag LOCUS_28570 gene xseA 342049 343278 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030027.1 protein_id gnl|my_center|LOCUS_28570 343271 343483 gene locus_tag LOCUS_28580 343271 343483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 344069 343464 gene locus_tag LOCUS_28590 344069 343464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 344153 345394 gene locus_tag LOCUS_28600 344153 345394 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223081.1 protein_id gnl|my_center|LOCUS_28600 345430 346464 gene locus_tag LOCUS_28610 gene glpX 345430 346464 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973930.1 protein_id gnl|my_center|LOCUS_28610 347411 346584 gene locus_tag LOCUS_28620 347411 346584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 347550 348467 gene locus_tag LOCUS_28630 347550 348467 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228713.1 protein_id gnl|my_center|LOCUS_28630 349609 348527 gene locus_tag LOCUS_28640 gene ugpC 349609 348527 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726999.1 protein_id gnl|my_center|LOCUS_28640 351821 349692 gene locus_tag LOCUS_28650 351821 349692 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020639906.1 protein_id gnl|my_center|LOCUS_28650 352022 353293 gene locus_tag LOCUS_28660 352022 353293 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222988.1 protein_id gnl|my_center|LOCUS_28660 353290 354255 gene locus_tag LOCUS_28670 353290 354255 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222989.1 protein_id gnl|my_center|LOCUS_28670 354255 355124 gene locus_tag LOCUS_28680 354255 355124 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222990.1 protein_id gnl|my_center|LOCUS_28680 355132 356355 gene locus_tag LOCUS_28690 gene ugpC 355132 356355 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222991.1 protein_id gnl|my_center|LOCUS_28690 357167 356424 gene locus_tag LOCUS_28700 357167 356424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 357263 358963 gene locus_tag LOCUS_28710 357263 358963 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327174.1 protein_id gnl|my_center|LOCUS_28710 359191 358994 gene locus_tag LOCUS_28720 359191 358994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 359248 359928 gene locus_tag LOCUS_28730 359248 359928 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030151.1 protein_id gnl|my_center|LOCUS_28730 360146 361390 gene locus_tag LOCUS_28740 360146 361390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 362083 361784 gene locus_tag LOCUS_28750 362083 361784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225627.1 protein_id gnl|my_center|LOCUS_28750 362877 362302 gene locus_tag LOCUS_28760 362877 362302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 363029 363445 gene locus_tag LOCUS_28770 363029 363445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 363549 364901 gene locus_tag LOCUS_28780 363549 364901 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030018.1 protein_id gnl|my_center|LOCUS_28780 364904 365602 gene locus_tag LOCUS_28790 364904 365602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 366179 365604 gene locus_tag LOCUS_28800 366179 365604 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973714.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28800 366269 366856 gene locus_tag LOCUS_28810 366269 366856 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222316.1 protein_id gnl|my_center|LOCUS_28810 367579 366875 gene locus_tag LOCUS_28820 367579 366875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 369101 367788 gene locus_tag LOCUS_28830 369101 367788 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973949.1 protein_id gnl|my_center|LOCUS_28830 370189 369437 gene locus_tag LOCUS_28840 370189 369437 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167441465.1 protein_id gnl|my_center|LOCUS_28840 370307 371206 gene locus_tag LOCUS_28850 370307 371206 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112523.1 protein_id gnl|my_center|LOCUS_28850 371278 372021 gene locus_tag LOCUS_28860 371278 372021 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029984.1 protein_id gnl|my_center|LOCUS_28860 372067 372441 gene locus_tag LOCUS_28870 gene trxA 372067 372441 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027416.1 protein_id gnl|my_center|LOCUS_28870 373307 372465 gene locus_tag LOCUS_28880 373307 372465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 374971 373427 gene locus_tag LOCUS_28890 374971 373427 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230761.1 protein_id gnl|my_center|LOCUS_28890 376560 374968 gene locus_tag LOCUS_28900 376560 374968 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230760.1 protein_id gnl|my_center|LOCUS_28900 377870 376620 gene locus_tag LOCUS_28910 377870 376620 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230890.1 protein_id gnl|my_center|LOCUS_28910 378211 377867 gene locus_tag LOCUS_28920 378211 377867 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230891.1 protein_id gnl|my_center|LOCUS_28920 378721 378416 gene locus_tag LOCUS_28930 378721 378416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 379651 378746 gene locus_tag LOCUS_28940 gene mca 379651 378746 CDS product mycothiol conjugate amidase Mca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229824.1 protein_id gnl|my_center|LOCUS_28940 379709 380125 gene locus_tag LOCUS_28950 379709 380125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 380268 380774 gene locus_tag LOCUS_28960 gene greA 380268 380774 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974011.1 protein_id gnl|my_center|LOCUS_28960 382881 380803 gene locus_tag LOCUS_28970 382881 380803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 384034 382889 gene locus_tag LOCUS_28980 384034 382889 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786824.1 protein_id gnl|my_center|LOCUS_28980 386571 384031 gene locus_tag LOCUS_28990 386571 384031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 387680 386571 gene locus_tag LOCUS_29000 387680 386571 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208437.1 protein_id gnl|my_center|LOCUS_29000 391315 387677 gene locus_tag LOCUS_29010 391315 387677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 393862 391409 gene locus_tag LOCUS_29020 393862 391409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 395073 393859 gene locus_tag LOCUS_29030 gene ilvA 395073 393859 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029975.1 protein_id gnl|my_center|LOCUS_29030 396481 395060 gene locus_tag LOCUS_29040 396481 395060 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231015.1 protein_id gnl|my_center|LOCUS_29040 397836 396478 gene locus_tag LOCUS_29050 gene glmL 397836 396478 CDS product methylaspartate mutase accessory protein GlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945203.1 protein_id gnl|my_center|LOCUS_29050 398986 397823 gene locus_tag LOCUS_29060 398986 397823 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870223.1 protein_id gnl|my_center|LOCUS_29060 399120 399770 gene locus_tag LOCUS_29070 gene msrA 399120 399770 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338316.1 protein_id gnl|my_center|LOCUS_29070 399851 401221 gene locus_tag LOCUS_29080 399851 401221 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729414.1 protein_id gnl|my_center|LOCUS_29080 401329 401691 gene locus_tag LOCUS_29090 401329 401691 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226523.1 protein_id gnl|my_center|LOCUS_29090 401727 403085 gene locus_tag LOCUS_29100 401727 403085 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030108.1 protein_id gnl|my_center|LOCUS_29100 403596 403099 gene locus_tag LOCUS_29110 403596 403099 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027466.1 protein_id gnl|my_center|LOCUS_29110 404165 403593 gene locus_tag LOCUS_29120 404165 403593 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228370.1 protein_id gnl|my_center|LOCUS_29120 404823 404191 gene locus_tag LOCUS_29130 404823 404191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 405607 404867 gene locus_tag LOCUS_29140 405607 404867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 405927 405604 gene locus_tag LOCUS_29150 405927 405604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727264.1 protein_id gnl|my_center|LOCUS_29150 406732 405953 gene locus_tag LOCUS_29160 406732 405953 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805161.1 protein_id gnl|my_center|LOCUS_29160 407199 406765 gene locus_tag LOCUS_29170 407199 406765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 407888 407196 gene locus_tag LOCUS_29180 407888 407196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 407977 408600 gene locus_tag LOCUS_29190 407977 408600 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224719.1 protein_id gnl|my_center|LOCUS_29190 408610 409503 gene locus_tag LOCUS_29200 408610 409503 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258980.1 protein_id gnl|my_center|LOCUS_29200 409657 410439 gene locus_tag LOCUS_29210 409657 410439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 410449 411225 gene locus_tag LOCUS_29220 410449 411225 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227392.1 protein_id gnl|my_center|LOCUS_29220 411994 411266 gene locus_tag LOCUS_29230 411994 411266 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131402.1 protein_id gnl|my_center|LOCUS_29230 413849 412074 gene locus_tag LOCUS_29240 413849 412074 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930043.1 protein_id gnl|my_center|LOCUS_29240 416126 414078 gene locus_tag LOCUS_29250 416126 414078 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730584.1 protein_id gnl|my_center|LOCUS_29250 417655 416267 gene locus_tag LOCUS_29260 417655 416267 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878358.1 protein_id gnl|my_center|LOCUS_29260 417777 419207 gene locus_tag LOCUS_29270 417777 419207 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418921.1 protein_id gnl|my_center|LOCUS_29270 419242 420075 gene locus_tag LOCUS_29280 419242 420075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 420195 420455 gene locus_tag LOCUS_29290 420195 420455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 420479 420997 gene locus_tag LOCUS_29300 420479 420997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 421779 420967 gene locus_tag LOCUS_29310 421779 420967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 423589 422393 gene locus_tag LOCUS_29320 423589 422393 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729364.1 protein_id gnl|my_center|LOCUS_29320 424059 423586 gene locus_tag LOCUS_29330 424059 423586 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075834.1 protein_id gnl|my_center|LOCUS_29330 425711 424326 gene locus_tag LOCUS_29340 425711 424326 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229841.1 protein_id gnl|my_center|LOCUS_29340 425757 426770 gene locus_tag LOCUS_29350 425757 426770 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975733.1 protein_id gnl|my_center|LOCUS_29350 426777 426883 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccgtcgcaactacgcgacgggtc 427894 426980 gene locus_tag LOCUS_29360 427894 426980 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975728.1 protein_id gnl|my_center|LOCUS_29360 428646 427972 gene locus_tag LOCUS_29370 428646 427972 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081641.1 protein_id gnl|my_center|LOCUS_29370 428778 428702 gene locus_tag LOCUS_t00310 428778 428702 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 429354 428803 gene locus_tag LOCUS_29380 gene def 429354 428803 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944066.1 protein_id gnl|my_center|LOCUS_29380 429905 429351 gene locus_tag LOCUS_29390 429905 429351 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944067.1 protein_id gnl|my_center|LOCUS_29390 430609 429902 gene locus_tag LOCUS_29400 430609 429902 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976828.1 protein_id gnl|my_center|LOCUS_29400 430693 430974 gene locus_tag LOCUS_29410 430693 430974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 431826 430915 gene locus_tag LOCUS_29420 431826 430915 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975718.1 protein_id gnl|my_center|LOCUS_29420 432319 431819 gene locus_tag LOCUS_29430 432319 431819 CDS product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028762.1 protein_id gnl|my_center|LOCUS_29430 432932 432324 gene locus_tag LOCUS_29440 432932 432324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 434241 432964 gene locus_tag LOCUS_29450 gene eno 434241 432964 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804956.1 protein_id gnl|my_center|LOCUS_29450 434898 434293 gene locus_tag LOCUS_29460 434898 434293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 435639 434920 gene locus_tag LOCUS_29470 435639 434920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 439208 435651 gene locus_tag LOCUS_29480 gene mfd 439208 435651 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028772.1 protein_id gnl|my_center|LOCUS_29480 439735 439415 gene locus_tag LOCUS_29490 439735 439415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 439674 440021 gene locus_tag LOCUS_29500 439674 440021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 441352 440075 gene locus_tag LOCUS_29510 441352 440075 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074038115.1 protein_id gnl|my_center|LOCUS_29510 441544 442353 gene locus_tag LOCUS_29520 441544 442353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 443172 442357 gene locus_tag LOCUS_29530 443172 442357 CDS product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876233.1 protein_id gnl|my_center|LOCUS_29530 444810 443239 gene locus_tag LOCUS_29540 444810 443239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 445758 444901 gene locus_tag LOCUS_29550 445758 444901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 448472 445848 gene locus_tag LOCUS_29560 448472 445848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227471.1 protein_id gnl|my_center|LOCUS_29560 450133 448469 gene locus_tag LOCUS_29570 450133 448469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 451287 450130 gene locus_tag LOCUS_29580 gene pstA 451287 450130 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227473.1 protein_id gnl|my_center|LOCUS_29580 452309 451287 gene locus_tag LOCUS_29590 gene pstC 452309 451287 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227474.1 protein_id gnl|my_center|LOCUS_29590 453351 452530 gene locus_tag LOCUS_29600 453351 452530 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230734.1 protein_id gnl|my_center|LOCUS_29600 454916 453348 gene locus_tag LOCUS_29610 454916 453348 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230735.1 protein_id gnl|my_center|LOCUS_29610 455992 454913 gene locus_tag LOCUS_29620 455992 454913 CDS product CbiQ family ECF transporter T component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161790914.1 protein_id gnl|my_center|LOCUS_29620 456864 455989 gene locus_tag LOCUS_29630 456864 455989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 457936 456872 gene locus_tag LOCUS_29640 457936 456872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 458211 459566 gene locus_tag LOCUS_29650 458211 459566 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110070.1 protein_id gnl|my_center|LOCUS_29650 461213 459702 gene locus_tag LOCUS_29660 gene gatB 461213 459702 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030281.1 protein_id gnl|my_center|LOCUS_29660 462733 461213 gene locus_tag LOCUS_29670 gene gatA 462733 461213 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223570.1 protein_id gnl|my_center|LOCUS_29670 463032 462733 gene locus_tag LOCUS_29680 gene gatC 463032 462733 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223569.1 protein_id gnl|my_center|LOCUS_29680 463087 463707 gene locus_tag LOCUS_29690 463087 463707 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031407.1 protein_id gnl|my_center|LOCUS_29690 463704 464414 gene locus_tag LOCUS_29700 463704 464414 CDS product ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865676.1 protein_id gnl|my_center|LOCUS_29700 465404 464547 gene locus_tag LOCUS_29710 465404 464547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 465478 466071 gene locus_tag LOCUS_29720 gene wrbA 465478 466071 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728300.1 protein_id gnl|my_center|LOCUS_29720 466720 466043 gene locus_tag LOCUS_29730 466720 466043 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027318.1 protein_id gnl|my_center|LOCUS_29730 466786 467952 gene locus_tag LOCUS_29740 466786 467952 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975760.1 protein_id gnl|my_center|LOCUS_29740 468554 468042 gene locus_tag LOCUS_29750 468554 468042 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059290.1 protein_id gnl|my_center|LOCUS_29750 468640 469158 gene locus_tag LOCUS_29760 468640 469158 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230782.1 protein_id gnl|my_center|LOCUS_29760 469151 470251 gene locus_tag LOCUS_29770 469151 470251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 470680 470261 gene locus_tag LOCUS_29780 470680 470261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 472863 470731 gene locus_tag LOCUS_29790 gene ligA 472863 470731 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415263.1 protein_id gnl|my_center|LOCUS_29790 472973 473608 gene locus_tag LOCUS_29800 472973 473608 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224735.1 protein_id gnl|my_center|LOCUS_29800 473719 474360 gene locus_tag LOCUS_29810 473719 474360 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975649.1 protein_id gnl|my_center|LOCUS_29810 474357 476009 gene locus_tag LOCUS_29820 474357 476009 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030470.1 protein_id gnl|my_center|LOCUS_29820 477092 476097 gene locus_tag LOCUS_29830 477092 476097 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030277.1 protein_id gnl|my_center|LOCUS_29830 478168 477092 gene locus_tag LOCUS_29840 gene mnmA 478168 477092 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973510.1 protein_id gnl|my_center|LOCUS_29840 479364 478183 gene locus_tag LOCUS_29850 479364 478183 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223557.1 protein_id gnl|my_center|LOCUS_29850 480105 479476 gene locus_tag LOCUS_29860 480105 479476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973694.1 protein_id gnl|my_center|LOCUS_29860 480259 480828 gene locus_tag LOCUS_29870 480259 480828 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224412.1 protein_id gnl|my_center|LOCUS_29870 480825 481526 gene locus_tag LOCUS_29880 480825 481526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 482285 481683 gene locus_tag LOCUS_29890 482285 481683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 483449 482325 gene locus_tag LOCUS_29900 gene proB 483449 482325 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028438.1 protein_id gnl|my_center|LOCUS_29900 484977 483436 gene locus_tag LOCUS_29910 gene obgE 484977 483436 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976206.1 protein_id gnl|my_center|LOCUS_29910 485334 485080 gene locus_tag LOCUS_29920 gene rpmA 485334 485080 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976205.1 protein_id gnl|my_center|LOCUS_29920 485692 485390 gene locus_tag LOCUS_29930 gene rplU 485692 485390 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412578.1 protein_id gnl|my_center|LOCUS_29930 489067 485885 gene locus_tag LOCUS_29940 489067 485885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29940 490122 489391 gene locus_tag LOCUS_29950 490122 489391 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976201.1 protein_id gnl|my_center|LOCUS_29950 491360 490179 gene locus_tag LOCUS_29960 491360 490179 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729341.1 protein_id gnl|my_center|LOCUS_29960 491458 492192 gene locus_tag LOCUS_29970 491458 492192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 492195 492695 gene locus_tag LOCUS_29980 492195 492695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 494664 492700 gene locus_tag LOCUS_29990 494664 492700 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976193.1 protein_id gnl|my_center|LOCUS_29990 496729 495056 gene locus_tag LOCUS_30000 496729 495056 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230478.1 protein_id gnl|my_center|LOCUS_30000 496788 497933 gene locus_tag LOCUS_30010 496788 497933 CDS product ionic transporter y4hA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226367.1 protein_id gnl|my_center|LOCUS_30010 499459 498278 gene locus_tag LOCUS_30020 gene rodA 499459 498278 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976192.1 protein_id gnl|my_center|LOCUS_30020 501606 499456 gene locus_tag LOCUS_30030 gene mrdA 501606 499456 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028453.1 protein_id gnl|my_center|LOCUS_30030 502194 501658 gene locus_tag LOCUS_30040 gene mreD 502194 501658 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976190.1 protein_id gnl|my_center|LOCUS_30040 503141 502191 gene locus_tag LOCUS_30050 gene mreC 503141 502191 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976189.1 protein_id gnl|my_center|LOCUS_30050 504172 503138 gene locus_tag LOCUS_30060 504172 503138 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107906544.1 protein_id gnl|my_center|LOCUS_30060 505031 504621 gene locus_tag LOCUS_30070 gene ndk 505031 504621 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060204.1 protein_id gnl|my_center|LOCUS_30070 505236 505042 gene locus_tag LOCUS_30080 505236 505042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 505978 505265 gene locus_tag LOCUS_30090 505978 505265 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977465.1 protein_id gnl|my_center|LOCUS_30090 506008 507378 gene locus_tag LOCUS_30100 506008 507378 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223637.1 protein_id gnl|my_center|LOCUS_30100 507771 507406 gene locus_tag LOCUS_30110 507771 507406 CDS product DUF4233 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976186.1 protein_id gnl|my_center|LOCUS_30110 509198 507801 gene locus_tag LOCUS_30120 509198 507801 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485025.1 protein_id gnl|my_center|LOCUS_30120 509283 510383 gene locus_tag LOCUS_30130 509283 510383 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112348.1 protein_id gnl|my_center|LOCUS_30130 512145 510391 gene locus_tag LOCUS_30140 512145 510391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 513050 512139 gene locus_tag LOCUS_30150 513050 512139 CDS product amino acid--[acyl-carrier-protein] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080728814.1 protein_id gnl|my_center|LOCUS_30150 514267 513047 gene locus_tag LOCUS_30160 514267 513047 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972410.1 protein_id gnl|my_center|LOCUS_30160 514527 514264 gene locus_tag LOCUS_30170 514527 514264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 515000 514524 gene locus_tag LOCUS_30180 515000 514524 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393656.1 protein_id gnl|my_center|LOCUS_30180 515123 517735 gene locus_tag LOCUS_30190 gene valS 515123 517735 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054756.1 protein_id gnl|my_center|LOCUS_30190 518753 517794 gene locus_tag LOCUS_30200 518753 517794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 520387 519104 gene locus_tag LOCUS_30210 gene clpX 520387 519104 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896045.1 protein_id gnl|my_center|LOCUS_30210 521141 520536 gene locus_tag LOCUS_30220 521141 520536 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930165.1 protein_id gnl|my_center|LOCUS_30220 521757 521152 gene locus_tag LOCUS_30230 521757 521152 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115412275.1 protein_id gnl|my_center|LOCUS_30230 521955 524723 gene locus_tag LOCUS_30240 521955 524723 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742126.1 protein_id gnl|my_center|LOCUS_30240 525233 524742 gene locus_tag LOCUS_30250 525233 524742 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091468.1 protein_id gnl|my_center|LOCUS_30250 526452 525241 gene locus_tag LOCUS_30260 526452 525241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 526614 527465 gene locus_tag LOCUS_30270 526614 527465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 527532 527801 gene locus_tag LOCUS_30280 527532 527801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 528058 529752 gene locus_tag LOCUS_30290 528058 529752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 529799 530062 gene locus_tag LOCUS_30300 529799 530062 CDS product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776162.1 protein_id gnl|my_center|LOCUS_30300 530162 534496 gene locus_tag LOCUS_30310 530162 534496 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776163.1 protein_id gnl|my_center|LOCUS_30310 534496 537054 gene locus_tag LOCUS_30320 534496 537054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 537071 538060 gene locus_tag LOCUS_30330 537071 538060 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929980.1 protein_id gnl|my_center|LOCUS_30330 538085 539254 gene locus_tag LOCUS_30340 538085 539254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 539251 540396 gene locus_tag LOCUS_30350 539251 540396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 >Feature sequence24 1467 745 gene locus_tag LOCUS_30360 gene ndgR 1467 745 CDS product IclR family transcriptional regulator NdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030305.1 protein_id gnl|my_center|LOCUS_30360 1567 2982 gene locus_tag LOCUS_30370 gene leuC 1567 2982 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973442.1 protein_id gnl|my_center|LOCUS_30370 2984 3589 gene locus_tag LOCUS_30380 gene leuD 2984 3589 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893754.1 protein_id gnl|my_center|LOCUS_30380 3697 4554 gene locus_tag LOCUS_30390 3697 4554 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383500.1 protein_id gnl|my_center|LOCUS_30390 4707 5372 gene locus_tag LOCUS_30400 4707 5372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_30400 6080 5463 gene locus_tag LOCUS_30410 gene cofC 6080 5463 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973437.1 protein_id gnl|my_center|LOCUS_30410 6142 6969 gene locus_tag LOCUS_30420 6142 6969 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973436.1 protein_id gnl|my_center|LOCUS_30420 6966 7970 gene locus_tag LOCUS_30430 6966 7970 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030308.1 protein_id gnl|my_center|LOCUS_30430 9107 8025 gene locus_tag LOCUS_30440 9107 8025 CDS product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222013.1 protein_id gnl|my_center|LOCUS_30440 9132 10274 gene locus_tag LOCUS_30450 9132 10274 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973434.1 protein_id gnl|my_center|LOCUS_30450 10765 10286 gene locus_tag LOCUS_30460 10765 10286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 11049 10813 gene locus_tag LOCUS_30470 11049 10813 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091994.1 protein_id gnl|my_center|LOCUS_30470 11167 12153 gene locus_tag LOCUS_30480 11167 12153 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973432.1 protein_id gnl|my_center|LOCUS_30480 12414 12229 gene locus_tag LOCUS_30490 gene rpmB 12414 12229 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973430.1 protein_id gnl|my_center|LOCUS_30490 12548 14209 gene locus_tag LOCUS_30500 12548 14209 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030309.1 protein_id gnl|my_center|LOCUS_30500 14225 16450 gene locus_tag LOCUS_30510 gene recG 14225 16450 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973428.1 protein_id gnl|my_center|LOCUS_30510 16447 17004 gene locus_tag LOCUS_30520 gene rsmD 16447 17004 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030310.1 protein_id gnl|my_center|LOCUS_30520 17012 17494 gene locus_tag LOCUS_30530 gene coaD 17012 17494 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973426.1 protein_id gnl|my_center|LOCUS_30530 17595 18137 gene locus_tag LOCUS_30540 17595 18137 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973424.1 protein_id gnl|my_center|LOCUS_30540 18147 18332 gene locus_tag LOCUS_30550 gene rpmF 18147 18332 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006139588.1 protein_id gnl|my_center|LOCUS_30550 18274 19065 gene locus_tag LOCUS_30560 gene rnc 18274 19065 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973423.1 protein_id gnl|my_center|LOCUS_30560 19078 19962 gene locus_tag LOCUS_30570 gene mutM 19078 19962 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973422.1 protein_id gnl|my_center|LOCUS_30570 20081 19890 gene locus_tag LOCUS_30580 20081 19890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 20080 20280 gene locus_tag LOCUS_30590 20080 20280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 22591 20360 gene locus_tag LOCUS_30600 22591 20360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 32808 22654 gene locus_tag LOCUS_30610 32808 22654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 33099 36686 gene locus_tag LOCUS_30620 gene smc 33099 36686 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030315.1 protein_id gnl|my_center|LOCUS_30620 36686 37144 gene locus_tag LOCUS_30630 36686 37144 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063533.1 protein_id gnl|my_center|LOCUS_30630 37141 37986 gene locus_tag LOCUS_30640 37141 37986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 38112 38345 gene locus_tag LOCUS_30650 38112 38345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 38355 39494 gene locus_tag LOCUS_30660 gene ftsY 38355 39494 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164278219.1 protein_id gnl|my_center|LOCUS_30660 39722 41098 gene locus_tag LOCUS_30670 39722 41098 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893791.1 protein_id gnl|my_center|LOCUS_30670 41095 41433 gene locus_tag LOCUS_30680 41095 41433 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893792.1 protein_id gnl|my_center|LOCUS_30680 41523 42866 gene locus_tag LOCUS_30690 41523 42866 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063182.1 protein_id gnl|my_center|LOCUS_30690 42863 43201 gene locus_tag LOCUS_30700 42863 43201 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051565.1 protein_id gnl|my_center|LOCUS_30700 43235 45469 gene locus_tag LOCUS_30710 43235 45469 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487177.1 protein_id gnl|my_center|LOCUS_30710 45761 45483 gene locus_tag LOCUS_30720 45761 45483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 45842 47413 gene locus_tag LOCUS_30730 gene ffh 45842 47413 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327355.1 protein_id gnl|my_center|LOCUS_30730 47415 47801 gene locus_tag LOCUS_30740 47415 47801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 47821 48903 gene locus_tag LOCUS_30750 47821 48903 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976959.1 protein_id gnl|my_center|LOCUS_30750 50092 48935 gene locus_tag LOCUS_30760 50092 48935 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972914.1 protein_id gnl|my_center|LOCUS_30760 50237 52288 gene locus_tag LOCUS_30770 50237 52288 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222851.1 protein_id gnl|my_center|LOCUS_30770 52446 53099 gene locus_tag LOCUS_30780 52446 53099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 54034 53123 gene locus_tag LOCUS_30790 54034 53123 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114171.1 protein_id gnl|my_center|LOCUS_30790 54267 54767 gene locus_tag LOCUS_30800 54267 54767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 54767 55018 gene locus_tag LOCUS_30810 54767 55018 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973401.1 protein_id gnl|my_center|LOCUS_30810 55095 55637 gene locus_tag LOCUS_30820 gene rimM 55095 55637 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142459073.1 protein_id gnl|my_center|LOCUS_30820 55657 56844 gene locus_tag LOCUS_30830 55657 56844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 57058 57408 gene locus_tag LOCUS_30840 gene rplS 57058 57408 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014838.1 protein_id gnl|my_center|LOCUS_30840 57444 58286 gene locus_tag LOCUS_30850 57444 58286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 58290 59036 gene locus_tag LOCUS_30860 58290 59036 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728344.1 protein_id gnl|my_center|LOCUS_30860 59723 58965 gene locus_tag LOCUS_30870 59723 58965 CDS product YqjF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409685.1 protein_id gnl|my_center|LOCUS_30870 59781 60089 gene locus_tag LOCUS_30880 59781 60089 CDS product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096226.1 protein_id gnl|my_center|LOCUS_30880 60214 60687 gene locus_tag LOCUS_30890 60214 60687 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930680.1 protein_id gnl|my_center|LOCUS_30890 60690 62375 gene locus_tag LOCUS_30900 60690 62375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 62518 62904 gene locus_tag LOCUS_30910 62518 62904 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872622.1 protein_id gnl|my_center|LOCUS_30910 62904 64511 gene locus_tag LOCUS_30920 62904 64511 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030329.1 protein_id gnl|my_center|LOCUS_30920 64508 65644 gene locus_tag LOCUS_30930 gene dprA 64508 65644 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487183.1 protein_id gnl|my_center|LOCUS_30930 65673 66620 gene locus_tag LOCUS_30940 65673 66620 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223859.1 protein_id gnl|my_center|LOCUS_30940 66800 67033 gene locus_tag LOCUS_30950 66800 67033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 67104 68702 gene locus_tag LOCUS_30960 67104 68702 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065424.1 protein_id gnl|my_center|LOCUS_30960 69341 68706 gene locus_tag LOCUS_30970 69341 68706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 69772 70740 gene locus_tag LOCUS_30980 gene rpsB 69772 70740 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106517497.1 protein_id gnl|my_center|LOCUS_30980 70780 71589 gene locus_tag LOCUS_30990 gene tsf 70780 71589 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899527.1 protein_id gnl|my_center|LOCUS_30990 71788 72501 gene locus_tag LOCUS_31000 gene pyrH 71788 72501 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804636.1 protein_id gnl|my_center|LOCUS_31000 72544 73101 gene locus_tag LOCUS_31010 gene frr 72544 73101 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973383.1 protein_id gnl|my_center|LOCUS_31010 73128 74006 gene locus_tag LOCUS_31020 73128 74006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 74006 74521 gene locus_tag LOCUS_31030 74006 74521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 74553 75023 gene locus_tag LOCUS_31040 74553 75023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 76625 75051 gene locus_tag LOCUS_31050 gene glpK 76625 75051 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226254.1 protein_id gnl|my_center|LOCUS_31050 77380 76622 gene locus_tag LOCUS_31060 77380 76622 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226255.1 protein_id gnl|my_center|LOCUS_31060 77515 78339 gene locus_tag LOCUS_31070 77515 78339 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109004014.1 protein_id gnl|my_center|LOCUS_31070 78393 79910 gene locus_tag LOCUS_31080 gene glpK 78393 79910 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226257.1 protein_id gnl|my_center|LOCUS_31080 79998 81716 gene locus_tag LOCUS_31090 79998 81716 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974200.1 protein_id gnl|my_center|LOCUS_31090 81753 82895 gene locus_tag LOCUS_31100 gene rlmN 81753 82895 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973380.1 protein_id gnl|my_center|LOCUS_31100 82920 83699 gene locus_tag LOCUS_31110 82920 83699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 83953 83726 gene locus_tag LOCUS_31120 83953 83726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 83867 84988 gene locus_tag LOCUS_31130 83867 84988 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742121.1 protein_id gnl|my_center|LOCUS_31130 86108 85026 gene locus_tag LOCUS_31140 86108 85026 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189284839.1 protein_id gnl|my_center|LOCUS_31140 87032 86133 gene locus_tag LOCUS_31150 87032 86133 CDS product RIO kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223947.1 protein_id gnl|my_center|LOCUS_31150 88597 87218 gene locus_tag LOCUS_31160 88597 87218 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027250.1 protein_id gnl|my_center|LOCUS_31160 89190 88717 gene locus_tag LOCUS_31170 89190 88717 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973369.1 protein_id gnl|my_center|LOCUS_31170 89343 90575 gene locus_tag LOCUS_31180 89343 90575 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973358.1 protein_id gnl|my_center|LOCUS_31180 90575 91693 gene locus_tag LOCUS_31190 90575 91693 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973357.1 protein_id gnl|my_center|LOCUS_31190 91690 92604 gene locus_tag LOCUS_31200 91690 92604 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030376.1 protein_id gnl|my_center|LOCUS_31200 92601 93410 gene locus_tag LOCUS_31210 92601 93410 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973355.1 protein_id gnl|my_center|LOCUS_31210 93419 94813 gene locus_tag LOCUS_31220 93419 94813 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030377.1 protein_id gnl|my_center|LOCUS_31220 96235 94865 gene locus_tag LOCUS_31230 96235 94865 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973370.1 protein_id gnl|my_center|LOCUS_31230 96368 97810 gene locus_tag LOCUS_31240 96368 97810 CDS product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223105.1 protein_id gnl|my_center|LOCUS_31240 97937 99166 gene locus_tag LOCUS_31250 97937 99166 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731196.1 protein_id gnl|my_center|LOCUS_31250 99176 100597 gene locus_tag LOCUS_31260 99176 100597 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174854953.1 protein_id gnl|my_center|LOCUS_31260 100658 100921 gene locus_tag LOCUS_31270 100658 100921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 100918 102597 gene locus_tag LOCUS_31280 100918 102597 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973742.1 protein_id gnl|my_center|LOCUS_31280 103038 102625 gene locus_tag LOCUS_31290 103038 102625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 104053 103043 gene locus_tag LOCUS_31300 104053 103043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31300 104636 105328 gene locus_tag LOCUS_31310 104636 105328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 106205 105339 gene locus_tag LOCUS_31320 106205 105339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 106246 107352 gene locus_tag LOCUS_31330 gene dxr 106246 107352 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973332.1 protein_id gnl|my_center|LOCUS_31330 107354 108724 gene locus_tag LOCUS_31340 107354 108724 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030397.1 protein_id gnl|my_center|LOCUS_31340 109123 110280 gene locus_tag LOCUS_31350 gene ispG 109123 110280 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284254.1 protein_id gnl|my_center|LOCUS_31350 110302 111147 gene locus_tag LOCUS_31360 110302 111147 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873433.1 protein_id gnl|my_center|LOCUS_31360 111176 111541 gene locus_tag LOCUS_31370 111176 111541 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223040.1 protein_id gnl|my_center|LOCUS_31370 112583 111591 gene locus_tag LOCUS_31380 112583 111591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 112688 114457 gene locus_tag LOCUS_31390 112688 114457 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223963.1 protein_id gnl|my_center|LOCUS_31390 114459 115169 gene locus_tag LOCUS_31400 114459 115169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 115398 116345 gene locus_tag LOCUS_31410 115398 116345 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229676.1 protein_id gnl|my_center|LOCUS_31410 117116 116697 gene locus_tag LOCUS_31420 117116 116697 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030399.1 protein_id gnl|my_center|LOCUS_31420 117631 117113 gene locus_tag LOCUS_31430 117631 117113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 117733 118272 gene locus_tag LOCUS_31440 gene rimP 117733 118272 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285696.1 protein_id gnl|my_center|LOCUS_31440 118272 119252 gene locus_tag LOCUS_31450 gene nusA 118272 119252 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030401.1 protein_id gnl|my_center|LOCUS_31450 119249 120046 gene locus_tag LOCUS_31460 119249 120046 CDS product acyl-CoA thioester hydrolase/BAAT C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532919.1 protein_id gnl|my_center|LOCUS_31460 120054 120407 gene locus_tag LOCUS_31470 120054 120407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 120520 123315 gene locus_tag LOCUS_31480 120520 123315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 123433 123897 gene locus_tag LOCUS_31490 gene rbfA 123433 123897 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804655.1 protein_id gnl|my_center|LOCUS_31490 123894 124754 gene locus_tag LOCUS_31500 gene truB 123894 124754 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091315604.1 protein_id gnl|my_center|LOCUS_31500 124910 125791 gene locus_tag LOCUS_31510 124910 125791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 125854 126006 gene locus_tag LOCUS_31520 125854 126006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 126049 126990 gene locus_tag LOCUS_31530 126049 126990 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973315.1 protein_id gnl|my_center|LOCUS_31530 126983 127987 gene locus_tag LOCUS_31540 126983 127987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 128720 128016 gene locus_tag LOCUS_31550 128720 128016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31550 129011 128751 gene locus_tag LOCUS_31560 129011 128751 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726655.1 protein_id gnl|my_center|LOCUS_31560 131217 129079 gene locus_tag LOCUS_31570 131217 129079 CDS product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726656.1 protein_id gnl|my_center|LOCUS_31570 132200 131214 gene locus_tag LOCUS_31580 132200 131214 CDS product hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891418.1 protein_id gnl|my_center|LOCUS_31580 132937 132197 gene locus_tag LOCUS_31590 132937 132197 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891419.1 protein_id gnl|my_center|LOCUS_31590 133045 134748 gene locus_tag LOCUS_31600 133045 134748 CDS product phosphoenolpyruvate-utilizing N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104530.1 protein_id gnl|my_center|LOCUS_31600 134801 136027 gene locus_tag LOCUS_31610 134801 136027 CDS product sulfite oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970799.1 protein_id gnl|my_center|LOCUS_31610 138202 136040 gene locus_tag LOCUS_31620 138202 136040 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112888.1 protein_id gnl|my_center|LOCUS_31620 138351 138932 gene locus_tag LOCUS_31630 138351 138932 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974698.1 protein_id gnl|my_center|LOCUS_31630 139004 140092 gene locus_tag LOCUS_31640 139004 140092 CDS product DUF475 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130663.1 protein_id gnl|my_center|LOCUS_31640 140180 141394 gene locus_tag LOCUS_31650 140180 141394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028302.1 protein_id gnl|my_center|LOCUS_31650 142119 141544 gene locus_tag LOCUS_31660 142119 141544 CDS product calcium homeostasis/redox stress adaptation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976436.1 protein_id gnl|my_center|LOCUS_31660 142278 143447 gene locus_tag LOCUS_31670 142278 143447 CDS product HpcH/HpaI aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028308.1 protein_id gnl|my_center|LOCUS_31670 143444 144685 gene locus_tag LOCUS_31680 143444 144685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31680 144685 145839 gene locus_tag LOCUS_31690 144685 145839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31690 145836 146618 gene locus_tag LOCUS_31700 145836 146618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028306.1 protein_id gnl|my_center|LOCUS_31700 146702 147784 gene locus_tag LOCUS_31710 146702 147784 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223900.1 protein_id gnl|my_center|LOCUS_31710 147935 148210 gene locus_tag LOCUS_31720 gene rpsO 147935 148210 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804659.1 protein_id gnl|my_center|LOCUS_31720 148475 150697 gene locus_tag LOCUS_31730 148475 150697 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973290.1 protein_id gnl|my_center|LOCUS_31730 150782 152089 gene locus_tag LOCUS_31740 150782 152089 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973289.1 protein_id gnl|my_center|LOCUS_31740 152671 152156 gene locus_tag LOCUS_31750 152671 152156 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530144.1 protein_id gnl|my_center|LOCUS_31750 152727 153485 gene locus_tag LOCUS_31760 gene dapB 152727 153485 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081787.1 protein_id gnl|my_center|LOCUS_31760 153651 155312 gene locus_tag LOCUS_31770 153651 155312 CDS product M4 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028372.1 protein_id gnl|my_center|LOCUS_31770 >Feature sequence25 688 386 gene locus_tag LOCUS_31780 688 386 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804664.1 protein_id gnl|my_center|LOCUS_31780 1362 685 gene locus_tag LOCUS_31790 1362 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 1920 1375 gene locus_tag LOCUS_31800 1920 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 1966 2976 gene locus_tag LOCUS_31810 1966 2976 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224067.1 protein_id gnl|my_center|LOCUS_31810 3583 3035 gene locus_tag LOCUS_31820 3583 3035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 3667 4434 gene locus_tag LOCUS_31830 3667 4434 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063739112.1 protein_id gnl|my_center|LOCUS_31830 4431 4730 gene locus_tag LOCUS_31840 4431 4730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976649.1 protein_id gnl|my_center|LOCUS_31840 4754 5656 gene locus_tag LOCUS_31850 gene htpX 4754 5656 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976613.1 protein_id gnl|my_center|LOCUS_31850 5656 6249 gene locus_tag LOCUS_31860 5656 6249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028194.1 protein_id gnl|my_center|LOCUS_31860 6304 6828 gene locus_tag LOCUS_31870 6304 6828 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230782.1 protein_id gnl|my_center|LOCUS_31870 6825 7655 gene locus_tag LOCUS_31880 6825 7655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 7694 8845 gene locus_tag LOCUS_31890 7694 8845 CDS product GAF domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029628869.1 protein_id gnl|my_center|LOCUS_31890 9303 8866 gene locus_tag LOCUS_31900 9303 8866 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028365.1 protein_id gnl|my_center|LOCUS_31900 9851 9300 gene locus_tag LOCUS_31910 9851 9300 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727620.1 protein_id gnl|my_center|LOCUS_31910 9914 10888 gene locus_tag LOCUS_31920 9914 10888 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727621.1 protein_id gnl|my_center|LOCUS_31920 12119 10944 gene locus_tag LOCUS_31930 gene nadA 12119 10944 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869444.1 protein_id gnl|my_center|LOCUS_31930 13039 12149 gene locus_tag LOCUS_31940 13039 12149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 13095 14180 gene locus_tag LOCUS_31950 13095 14180 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085331.1 protein_id gnl|my_center|LOCUS_31950 14264 14623 gene locus_tag LOCUS_31960 14264 14623 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060786.1 protein_id gnl|my_center|LOCUS_31960 14917 14702 gene locus_tag LOCUS_31970 14917 14702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 14969 15955 gene locus_tag LOCUS_31980 14969 15955 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326033.1 protein_id gnl|my_center|LOCUS_31980 16211 15987 gene locus_tag LOCUS_31990 16211 15987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31990 17326 16208 gene locus_tag LOCUS_32000 17326 16208 CDS product cysteine desulfurase/sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028169.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32000 17581 17414 gene locus_tag LOCUS_32010 17581 17414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 17549 18313 gene locus_tag LOCUS_32020 gene coxB 17549 18313 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028168.1 protein_id gnl|my_center|LOCUS_32020 18310 20091 gene locus_tag LOCUS_32030 gene ctaD 18310 20091 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976660.1 protein_id gnl|my_center|LOCUS_32030 20088 20504 gene locus_tag LOCUS_32040 20088 20504 CDS product cytochrome c oxidase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060801.1 protein_id gnl|my_center|LOCUS_32040 20627 21844 gene locus_tag LOCUS_32050 20627 21844 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156694785.1 protein_id gnl|my_center|LOCUS_32050 23081 21846 gene locus_tag LOCUS_32060 23081 21846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 24974 23223 gene locus_tag LOCUS_32070 24974 23223 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028167.1 protein_id gnl|my_center|LOCUS_32070 26038 24971 gene locus_tag LOCUS_32080 26038 24971 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976666.1 protein_id gnl|my_center|LOCUS_32080 26973 26035 gene locus_tag LOCUS_32090 26973 26035 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976665.1 protein_id gnl|my_center|LOCUS_32090 27597 27019 gene locus_tag LOCUS_32100 27597 27019 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976664.1 protein_id gnl|my_center|LOCUS_32100 27750 28685 gene locus_tag LOCUS_32110 27750 28685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 28687 29124 gene locus_tag LOCUS_32120 28687 29124 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893433.1 protein_id gnl|my_center|LOCUS_32120 29177 30202 gene locus_tag LOCUS_32130 gene trpD 29177 30202 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028166.1 protein_id gnl|my_center|LOCUS_32130 30835 30224 gene locus_tag LOCUS_32140 30835 30224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 31239 30886 gene locus_tag LOCUS_32150 31239 30886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 31951 31247 gene locus_tag LOCUS_32160 31951 31247 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776105.1 protein_id gnl|my_center|LOCUS_32160 32137 33582 gene locus_tag LOCUS_32170 32137 33582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 33579 34403 gene locus_tag LOCUS_32180 33579 34403 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776102.1 protein_id gnl|my_center|LOCUS_32180 34400 35146 gene locus_tag LOCUS_32190 34400 35146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 35440 35162 gene locus_tag LOCUS_32200 35440 35162 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976675.1 protein_id gnl|my_center|LOCUS_32200 37204 35450 gene locus_tag LOCUS_32210 37204 35450 CDS product DEDD exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224085.1 protein_id gnl|my_center|LOCUS_32210 37330 37545 gene locus_tag LOCUS_32220 37330 37545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 37872 38864 gene locus_tag LOCUS_32230 37872 38864 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029867.1 protein_id gnl|my_center|LOCUS_32230 38921 40153 gene locus_tag LOCUS_32240 38921 40153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 40150 41385 gene locus_tag LOCUS_32250 40150 41385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 41671 41468 gene locus_tag LOCUS_32260 41671 41468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 42165 41863 gene locus_tag LOCUS_32270 42165 41863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 42964 42311 gene locus_tag LOCUS_32280 42964 42311 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977456.1 protein_id gnl|my_center|LOCUS_32280 44533 43019 gene locus_tag LOCUS_32290 44533 43019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 45467 44538 gene locus_tag LOCUS_32300 45467 44538 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256414.1 protein_id gnl|my_center|LOCUS_32300 47413 45470 gene locus_tag LOCUS_32310 47413 45470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 49059 47410 gene locus_tag LOCUS_32320 49059 47410 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_32320 50267 49056 gene locus_tag LOCUS_32330 50267 49056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 51116 50274 gene locus_tag LOCUS_32340 51116 50274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 53262 51358 gene locus_tag LOCUS_32350 53262 51358 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028155.1 protein_id gnl|my_center|LOCUS_32350 53313 53762 gene locus_tag LOCUS_32360 53313 53762 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976686.1 protein_id gnl|my_center|LOCUS_32360 53792 55003 gene locus_tag LOCUS_32370 53792 55003 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224322.1 protein_id gnl|my_center|LOCUS_32370 54996 55475 gene locus_tag LOCUS_32380 54996 55475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 55483 56472 gene locus_tag LOCUS_32390 55483 56472 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030775.1 protein_id gnl|my_center|LOCUS_32390 56488 57573 gene locus_tag LOCUS_32400 56488 57573 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030775.1 protein_id gnl|my_center|LOCUS_32400 57976 57521 gene locus_tag LOCUS_32410 57976 57521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 58759 57986 gene locus_tag LOCUS_32420 58759 57986 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224329.1 protein_id gnl|my_center|LOCUS_32420 58826 59569 gene locus_tag LOCUS_32430 58826 59569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 59661 60446 gene locus_tag LOCUS_32440 59661 60446 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080236.1 protein_id gnl|my_center|LOCUS_32440 60515 61594 gene locus_tag LOCUS_32450 60515 61594 CDS product DUF5931 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976694.1 protein_id gnl|my_center|LOCUS_32450 61602 62126 gene locus_tag LOCUS_32460 61602 62126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 62206 62892 gene locus_tag LOCUS_32470 62206 62892 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976695.1 protein_id gnl|my_center|LOCUS_32470 62935 63783 gene locus_tag LOCUS_32480 62935 63783 CDS product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229456.1 protein_id gnl|my_center|LOCUS_32480 63780 64250 gene locus_tag LOCUS_32490 63780 64250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 64247 65143 gene locus_tag LOCUS_32500 64247 65143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027240.1 protein_id gnl|my_center|LOCUS_32500 66099 65140 gene locus_tag LOCUS_32510 66099 65140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 66945 66127 gene locus_tag LOCUS_32520 66945 66127 CDS product DUF1028 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228982.1 protein_id gnl|my_center|LOCUS_32520 66944 67732 gene locus_tag LOCUS_32530 66944 67732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 67802 68830 gene locus_tag LOCUS_32540 67802 68830 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976696.1 protein_id gnl|my_center|LOCUS_32540 70438 68957 gene locus_tag LOCUS_32550 gene qac 70438 68957 CDS product quaternary ammonium compound efflux MFS transporter QacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622776.1 protein_id gnl|my_center|LOCUS_32550 70995 70435 gene locus_tag LOCUS_32560 70995 70435 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325826.1 protein_id gnl|my_center|LOCUS_32560 71147 72628 gene locus_tag LOCUS_32570 71147 72628 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897250.1 protein_id gnl|my_center|LOCUS_32570 74218 72782 gene locus_tag LOCUS_32580 74218 72782 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224455.1 protein_id gnl|my_center|LOCUS_32580 74997 74218 gene locus_tag LOCUS_32590 74997 74218 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897420.1 protein_id gnl|my_center|LOCUS_32590 76390 75176 gene locus_tag LOCUS_32600 76390 75176 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224453.1 protein_id gnl|my_center|LOCUS_32600 76560 77759 gene locus_tag LOCUS_32610 76560 77759 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972914.1 protein_id gnl|my_center|LOCUS_32610 77824 79176 gene locus_tag LOCUS_32620 77824 79176 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976701.1 protein_id gnl|my_center|LOCUS_32620 79239 80246 gene locus_tag LOCUS_32630 79239 80246 CDS product GntG family PLP-dependent aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404173.1 protein_id gnl|my_center|LOCUS_32630 80308 81462 gene locus_tag LOCUS_32640 80308 81462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 82073 81495 gene locus_tag LOCUS_32650 82073 81495 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284042.1 protein_id gnl|my_center|LOCUS_32650 82143 83246 gene locus_tag LOCUS_32660 82143 83246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 83323 84402 gene locus_tag LOCUS_32670 83323 84402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223257.1 protein_id gnl|my_center|LOCUS_32670 84399 85367 gene locus_tag LOCUS_32680 84399 85367 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223258.1 protein_id gnl|my_center|LOCUS_32680 85454 86182 gene locus_tag LOCUS_32690 85454 86182 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223259.1 protein_id gnl|my_center|LOCUS_32690 87033 86242 gene locus_tag LOCUS_32700 87033 86242 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086852896.1 protein_id gnl|my_center|LOCUS_32700 88173 87094 gene locus_tag LOCUS_32710 88173 87094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 89347 88295 gene locus_tag LOCUS_32720 gene aroF 89347 88295 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393889.1 protein_id gnl|my_center|LOCUS_32720 90495 89590 gene locus_tag LOCUS_32730 90495 89590 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181584.1 protein_id gnl|my_center|LOCUS_32730 92630 90546 gene locus_tag LOCUS_32740 92630 90546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 92769 93125 gene locus_tag LOCUS_32750 92769 93125 CDS product Rv2175c family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003910516.1 protein_id gnl|my_center|LOCUS_32750 93132 93689 gene locus_tag LOCUS_32760 93132 93689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 93697 94101 gene locus_tag LOCUS_32770 93697 94101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 95203 94109 gene locus_tag LOCUS_32780 95203 94109 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224198.1 protein_id gnl|my_center|LOCUS_32780 95259 96122 gene locus_tag LOCUS_32790 gene metF 95259 96122 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080230.1 protein_id gnl|my_center|LOCUS_32790 96162 96770 gene locus_tag LOCUS_32800 96162 96770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 98163 96820 gene locus_tag LOCUS_32810 98163 96820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 98261 98710 gene locus_tag LOCUS_32820 98261 98710 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889092.1 protein_id gnl|my_center|LOCUS_32820 99848 98922 gene locus_tag LOCUS_32830 99848 98922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 101293 99845 gene locus_tag LOCUS_32840 101293 99845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 101916 101284 gene locus_tag LOCUS_32850 101916 101284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 102377 101922 gene locus_tag LOCUS_32860 102377 101922 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224204.1 protein_id gnl|my_center|LOCUS_32860 102452 102901 gene locus_tag LOCUS_32870 102452 102901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 103178 103570 gene locus_tag LOCUS_32880 103178 103570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 103584 104006 gene locus_tag LOCUS_32890 103584 104006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 104086 105243 gene locus_tag LOCUS_32900 104086 105243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 105451 109293 gene locus_tag LOCUS_32910 gene dnaE 105451 109293 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027948.1 protein_id gnl|my_center|LOCUS_32910 109325 110038 gene locus_tag LOCUS_32920 109325 110038 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028138.1 protein_id gnl|my_center|LOCUS_32920 110057 111274 gene locus_tag LOCUS_32930 gene dinB 110057 111274 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228056.1 protein_id gnl|my_center|LOCUS_32930 111385 111819 gene locus_tag LOCUS_32940 111385 111819 CDS product spore wall synthesis complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028137.1 protein_id gnl|my_center|LOCUS_32940 114639 112237 gene locus_tag LOCUS_32950 114639 112237 CDS product DUF3488 and transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486200.1 protein_id gnl|my_center|LOCUS_32950 115958 114636 gene locus_tag LOCUS_32960 115958 114636 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486197.1 protein_id gnl|my_center|LOCUS_32960 116982 115951 gene locus_tag LOCUS_32970 116982 115951 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976721.1 protein_id gnl|my_center|LOCUS_32970 117284 117703 gene locus_tag LOCUS_32980 gene mraZ 117284 117703 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804693.1 protein_id gnl|my_center|LOCUS_32980 118145 117960 gene locus_tag LOCUS_32990 118145 117960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 118199 119221 gene locus_tag LOCUS_33000 gene rsmH 118199 119221 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228045.1 protein_id gnl|my_center|LOCUS_33000 119218 119685 gene locus_tag LOCUS_33010 119218 119685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 119685 121532 gene locus_tag LOCUS_33020 gene ftsI 119685 121532 CDS product cell division protein FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028132.1 protein_id gnl|my_center|LOCUS_33020 121553 123085 gene locus_tag LOCUS_33030 121553 123085 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028131.1 protein_id gnl|my_center|LOCUS_33030 123082 124434 gene locus_tag LOCUS_33040 123082 124434 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976727.1 protein_id gnl|my_center|LOCUS_33040 124431 125540 gene locus_tag LOCUS_33050 gene mraY 124431 125540 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976728.1 protein_id gnl|my_center|LOCUS_33050 125537 127078 gene locus_tag LOCUS_33060 gene murD 125537 127078 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976729.1 protein_id gnl|my_center|LOCUS_33060 127104 128387 gene locus_tag LOCUS_33070 gene ftsW 127104 128387 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976730.1 protein_id gnl|my_center|LOCUS_33070 128424 129506 gene locus_tag LOCUS_33080 gene murG 128424 129506 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976731.1 protein_id gnl|my_center|LOCUS_33080 129503 130873 gene locus_tag LOCUS_33090 gene murC 129503 130873 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228036.1 protein_id gnl|my_center|LOCUS_33090 130857 131624 gene locus_tag LOCUS_33100 130857 131624 CDS product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228035.1 protein_id gnl|my_center|LOCUS_33100 132193 133326 gene locus_tag LOCUS_33110 gene ftsZ 132193 133326 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976733.1 protein_id gnl|my_center|LOCUS_33110 133342 134058 gene locus_tag LOCUS_33120 gene pgeF 133342 134058 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028130.1 protein_id gnl|my_center|LOCUS_33120 134055 134759 gene locus_tag LOCUS_33130 134055 134759 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028129.1 protein_id gnl|my_center|LOCUS_33130 134833 135372 gene locus_tag LOCUS_33140 gene sepF 134833 135372 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976736.1 protein_id gnl|my_center|LOCUS_33140 135661 135948 gene locus_tag LOCUS_33150 135661 135948 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976737.1 protein_id gnl|my_center|LOCUS_33150 136111 136875 gene locus_tag LOCUS_33160 136111 136875 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080209.1 protein_id gnl|my_center|LOCUS_33160 137048 138169 gene locus_tag LOCUS_33170 137048 138169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 138142 138750 gene locus_tag LOCUS_33180 138142 138750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 138747 139682 gene locus_tag LOCUS_33190 138747 139682 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976742.1 protein_id gnl|my_center|LOCUS_33190 139669 140118 gene locus_tag LOCUS_33200 139669 140118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 140635 144180 gene locus_tag LOCUS_33210 gene dnaE 140635 144180 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804720.1 protein_id gnl|my_center|LOCUS_33210 144177 144797 gene locus_tag LOCUS_33220 144177 144797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 145165 146808 gene locus_tag LOCUS_33230 145165 146808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 147364 146876 gene locus_tag LOCUS_33240 gene ybaK 147364 146876 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976757.1 protein_id gnl|my_center|LOCUS_33240 148054 147389 gene locus_tag LOCUS_33250 148054 147389 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028120.1 protein_id gnl|my_center|LOCUS_33250 148221 149525 gene locus_tag LOCUS_33260 gene hisD 148221 149525 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028117.1 protein_id gnl|my_center|LOCUS_33260 149522 150619 gene locus_tag LOCUS_33270 149522 150619 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929983.1 protein_id gnl|my_center|LOCUS_33270 150616 151224 gene locus_tag LOCUS_33280 gene hisB 150616 151224 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908229.1 protein_id gnl|my_center|LOCUS_33280 151275 151856 gene locus_tag LOCUS_33290 gene hisH 151275 151856 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776205.1 protein_id gnl|my_center|LOCUS_33290 151858 152187 gene locus_tag LOCUS_33300 151858 152187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 152195 152938 gene locus_tag LOCUS_33310 gene priA 152195 152938 CDS product bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976766.1 protein_id gnl|my_center|LOCUS_33310 152935 153699 gene locus_tag LOCUS_33320 gene hisF 152935 153699 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976768.1 protein_id gnl|my_center|LOCUS_33320 154340 153708 gene locus_tag LOCUS_33330 154340 153708 CDS product TIGR03085 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230583.1 protein_id gnl|my_center|LOCUS_33330 154501 156321 gene locus_tag LOCUS_33340 154501 156321 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776700.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33340 156318 158183 gene locus_tag LOCUS_33350 156318 158183 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776699.1 protein_id gnl|my_center|LOCUS_33350 158233 158598 gene locus_tag LOCUS_33360 gene hisI 158233 158598 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976772.1 protein_id gnl|my_center|LOCUS_33360 158591 159205 gene locus_tag LOCUS_33370 158591 159205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 159256 159456 gene locus_tag LOCUS_33380 159256 159456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 159485 159913 gene locus_tag LOCUS_33390 159485 159913 CDS product DUF2752 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908242.1 protein_id gnl|my_center|LOCUS_33390 160033 160815 gene locus_tag LOCUS_33400 gene trpC 160033 160815 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224167.1 protein_id gnl|my_center|LOCUS_33400 160812 162047 gene locus_tag LOCUS_33410 gene trpB 160812 162047 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284348.1 protein_id gnl|my_center|LOCUS_33410 162050 162862 gene locus_tag LOCUS_33420 gene trpA 162050 162862 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224169.1 protein_id gnl|my_center|LOCUS_33420 162852 163430 gene locus_tag LOCUS_33430 162852 163430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 163432 164460 gene locus_tag LOCUS_33440 gene lgt 163432 164460 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466801.1 protein_id gnl|my_center|LOCUS_33440 164626 169185 gene locus_tag LOCUS_33450 gene gltB 164626 169185 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028104.1 protein_id gnl|my_center|LOCUS_33450 169178 170665 gene locus_tag LOCUS_33460 169178 170665 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976791.1 protein_id gnl|my_center|LOCUS_33460 170819 172264 gene locus_tag LOCUS_33470 gene pyk 170819 172264 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028096.1 protein_id gnl|my_center|LOCUS_33470 172879 172280 gene locus_tag LOCUS_33480 172879 172280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 173024 172941 gene locus_tag LOCUS_t00320 173024 172941 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 173178 173792 gene locus_tag LOCUS_33490 173178 173792 CDS product ANTAR domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057960.1 protein_id gnl|my_center|LOCUS_33490 173926 175281 gene locus_tag LOCUS_33500 173926 175281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 176307 175459 gene locus_tag LOCUS_33510 176307 175459 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055908.1 protein_id gnl|my_center|LOCUS_33510 177239 176304 gene locus_tag LOCUS_33520 177239 176304 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073601368.1 protein_id gnl|my_center|LOCUS_33520 178206 177229 gene locus_tag LOCUS_33530 178206 177229 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173609.1 protein_id gnl|my_center|LOCUS_33530 179605 178223 gene locus_tag LOCUS_33540 179605 178223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 180546 179800 gene locus_tag LOCUS_33550 180546 179800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 180649 181242 gene locus_tag LOCUS_33560 180649 181242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 181707 181276 gene locus_tag LOCUS_33570 181707 181276 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976812.1 protein_id gnl|my_center|LOCUS_33570 181762 184440 gene locus_tag LOCUS_33580 gene polA 181762 184440 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467407.1 protein_id gnl|my_center|LOCUS_33580 185687 184659 gene locus_tag LOCUS_33590 185687 184659 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528461.1 protein_id gnl|my_center|LOCUS_33590 187011 185734 gene locus_tag LOCUS_33600 187011 185734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 187141 191256 gene locus_tag LOCUS_33610 187141 191256 CDS product alpha-(1->3)-arabinofuranosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229292.1 protein_id gnl|my_center|LOCUS_33610 191262 193025 gene locus_tag LOCUS_33620 191262 193025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191313987.1 protein_id gnl|my_center|LOCUS_33620 193022 194815 gene locus_tag LOCUS_33630 193022 194815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229290.1 protein_id gnl|my_center|LOCUS_33630 194818 194949 gene locus_tag LOCUS_33640 194818 194949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 195091 195885 gene locus_tag LOCUS_33650 195091 195885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 195887 197137 gene locus_tag LOCUS_33660 195887 197137 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086841211.1 protein_id gnl|my_center|LOCUS_33660 197139 198155 gene locus_tag LOCUS_33670 197139 198155 CDS product DUF3068 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891671.1 protein_id gnl|my_center|LOCUS_33670 199237 198272 gene locus_tag LOCUS_33680 199237 198272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229288.1 protein_id gnl|my_center|LOCUS_33680 199932 199234 gene locus_tag LOCUS_33690 199932 199234 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523383.1 protein_id gnl|my_center|LOCUS_33690 200799 199942 gene locus_tag LOCUS_33700 200799 199942 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227917.1 protein_id gnl|my_center|LOCUS_33700 201542 200796 gene locus_tag LOCUS_33710 201542 200796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 201602 202003 gene locus_tag LOCUS_33720 201602 202003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 202012 202914 gene locus_tag LOCUS_33730 202012 202914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 203105 204577 gene locus_tag LOCUS_33740 gene rpsA 203105 204577 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227916.1 protein_id gnl|my_center|LOCUS_33740 204845 204696 gene locus_tag LOCUS_33750 204845 204696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 204939 205883 gene locus_tag LOCUS_33760 204939 205883 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055585491.1 protein_id gnl|my_center|LOCUS_33760 205933 207285 gene locus_tag LOCUS_33770 205933 207285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 208569 207301 gene locus_tag LOCUS_33780 208569 207301 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228959.1 protein_id gnl|my_center|LOCUS_33780 209261 208566 gene locus_tag LOCUS_33790 209261 208566 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230648.1 protein_id gnl|my_center|LOCUS_33790 209387 210349 gene locus_tag LOCUS_33800 209387 210349 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225136.1 protein_id gnl|my_center|LOCUS_33800 210420 210701 gene locus_tag LOCUS_33810 210420 210701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 210723 211307 gene locus_tag LOCUS_33820 gene coaE 210723 211307 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976822.1 protein_id gnl|my_center|LOCUS_33820 211304 212527 gene locus_tag LOCUS_33830 211304 212527 CDS product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486041.1 protein_id gnl|my_center|LOCUS_33830 212963 212508 gene locus_tag LOCUS_33840 212963 212508 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462739.1 protein_id gnl|my_center|LOCUS_33840 214007 213060 gene locus_tag LOCUS_33850 214007 213060 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975615.1 protein_id gnl|my_center|LOCUS_33850 216363 214210 gene locus_tag LOCUS_33860 216363 214210 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898586.1 protein_id gnl|my_center|LOCUS_33860 216437 217324 gene locus_tag LOCUS_33870 216437 217324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 217321 218019 gene locus_tag LOCUS_33880 217321 218019 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027118.1 protein_id gnl|my_center|LOCUS_33880 218039 218632 gene locus_tag LOCUS_33890 218039 218632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 218629 219486 gene locus_tag LOCUS_33900 218629 219486 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027120.1 protein_id gnl|my_center|LOCUS_33900 220477 219473 gene locus_tag LOCUS_33910 220477 219473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 221841 220489 gene locus_tag LOCUS_33920 221841 220489 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027755.1 protein_id gnl|my_center|LOCUS_33920 221972 223012 gene locus_tag LOCUS_33930 221972 223012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 223113 224588 gene locus_tag LOCUS_33940 223113 224588 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031712.1 protein_id gnl|my_center|LOCUS_33940 225213 224704 gene locus_tag LOCUS_33950 225213 224704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 225291 225677 gene locus_tag LOCUS_33960 225291 225677 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729640.1 protein_id gnl|my_center|LOCUS_33960 226613 225726 gene locus_tag LOCUS_33970 226613 225726 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200823401.1 protein_id gnl|my_center|LOCUS_33970 226689 227258 gene locus_tag LOCUS_33980 226689 227258 CDS product HhH-GPD-type base excision DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974916.1 protein_id gnl|my_center|LOCUS_33980 227436 228962 gene locus_tag LOCUS_33990 227436 228962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 229518 229054 gene locus_tag LOCUS_34000 229518 229054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 230375 229830 gene locus_tag LOCUS_34010 230375 229830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34010 230265 230636 gene locus_tag LOCUS_34020 230265 230636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 230988 230764 gene locus_tag LOCUS_34030 230988 230764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805039.1 protein_id gnl|my_center|LOCUS_34030 231408 233531 gene locus_tag LOCUS_34040 231408 233531 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973199.1 protein_id gnl|my_center|LOCUS_34040 233531 234034 gene locus_tag LOCUS_34050 233531 234034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 234082 234807 gene locus_tag LOCUS_34060 234082 234807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 235317 234823 gene locus_tag LOCUS_34070 235317 234823 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921867.1 protein_id gnl|my_center|LOCUS_34070 237086 235335 gene locus_tag LOCUS_34080 237086 235335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 237817 237083 gene locus_tag LOCUS_34090 237817 237083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 240338 237822 gene locus_tag LOCUS_34100 240338 237822 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030487.1 protein_id gnl|my_center|LOCUS_34100 240473 242035 gene locus_tag LOCUS_34110 240473 242035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 242032 242655 gene locus_tag LOCUS_34120 242032 242655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 242705 245413 gene locus_tag LOCUS_34130 242705 245413 CDS product bifunctional GNAT family N-acetyltransferase/acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224292.1 protein_id gnl|my_center|LOCUS_34130 245456 246094 gene locus_tag LOCUS_34140 245456 246094 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224664.1 protein_id gnl|my_center|LOCUS_34140 246132 246713 gene locus_tag LOCUS_34150 246132 246713 CDS product DUF5998 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030492.1 protein_id gnl|my_center|LOCUS_34150 246721 247839 gene locus_tag LOCUS_34160 246721 247839 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030493.1 protein_id gnl|my_center|LOCUS_34160 249928 248660 gene locus_tag LOCUS_34170 249928 248660 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074038115.1 protein_id gnl|my_center|LOCUS_34170 250754 250101 gene locus_tag LOCUS_34180 250754 250101 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973175.1 protein_id gnl|my_center|LOCUS_34180 251395 250784 gene locus_tag LOCUS_34190 251395 250784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908302.1 protein_id gnl|my_center|LOCUS_34190 251638 251462 gene locus_tag LOCUS_34200 251638 251462 CDS product DUF6104 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030139.1 protein_id gnl|my_center|LOCUS_34200 255396 251656 gene locus_tag LOCUS_34210 255396 251656 CDS product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030150.1 protein_id gnl|my_center|LOCUS_34210 255557 256195 gene locus_tag LOCUS_34220 255557 256195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 256192 257103 gene locus_tag LOCUS_34230 256192 257103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 257209 257282 gene locus_tag LOCUS_t00330 257209 257282 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 257386 259041 gene locus_tag LOCUS_34240 gene argS 257386 259041 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730214.1 protein_id gnl|my_center|LOCUS_34240 259052 260452 gene locus_tag LOCUS_34250 gene lysA 259052 260452 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775960.1 protein_id gnl|my_center|LOCUS_34250 260449 261771 gene locus_tag LOCUS_34260 260449 261771 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283905.1 protein_id gnl|my_center|LOCUS_34260 261768 262847 gene locus_tag LOCUS_34270 gene thrC 261768 262847 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973642.1 protein_id gnl|my_center|LOCUS_34270 262858 263763 gene locus_tag LOCUS_34280 gene thrB 262858 263763 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030204.1 protein_id gnl|my_center|LOCUS_34280 263914 265965 gene locus_tag LOCUS_34290 263914 265965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 265967 266365 gene locus_tag LOCUS_34300 265967 266365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 266489 268141 gene locus_tag LOCUS_34310 266489 268141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 268165 268494 gene locus_tag LOCUS_34320 268165 268494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 268580 269653 gene locus_tag LOCUS_34330 gene prfA 268580 269653 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973637.1 protein_id gnl|my_center|LOCUS_34330 269650 270525 gene locus_tag LOCUS_34340 gene prmC 269650 270525 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973636.1 protein_id gnl|my_center|LOCUS_34340 270531 271202 gene locus_tag LOCUS_34350 270531 271202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 271195 272334 gene locus_tag LOCUS_34360 271195 272334 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030207.1 protein_id gnl|my_center|LOCUS_34360 272426 272926 gene locus_tag LOCUS_34370 272426 272926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 272957 273178 gene locus_tag LOCUS_34380 272957 273178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 273189 274019 gene locus_tag LOCUS_34390 gene atpB 273189 274019 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229528.1 protein_id gnl|my_center|LOCUS_34390 274090 274329 gene locus_tag LOCUS_34400 274090 274329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 274364 274927 gene locus_tag LOCUS_34410 274364 274927 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229526.1 protein_id gnl|my_center|LOCUS_34410 274940 275749 gene locus_tag LOCUS_34420 274940 275749 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327277.1 protein_id gnl|my_center|LOCUS_34420 275822 277453 gene locus_tag LOCUS_34430 gene atpA 275822 277453 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973626.1 protein_id gnl|my_center|LOCUS_34430 277460 278374 gene locus_tag LOCUS_34440 277460 278374 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973625.1 protein_id gnl|my_center|LOCUS_34440 278378 279832 gene locus_tag LOCUS_34450 gene atpD 278378 279832 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814333.1 protein_id gnl|my_center|LOCUS_34450 279834 280235 gene locus_tag LOCUS_34460 279834 280235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 280307 280747 gene locus_tag LOCUS_34470 280307 280747 CDS product DUF2550 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973622.1 protein_id gnl|my_center|LOCUS_34470 283928 280767 gene locus_tag LOCUS_34480 283928 280767 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111768112.1 protein_id gnl|my_center|LOCUS_34480 284672 284001 gene locus_tag LOCUS_34490 284672 284001 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973616.1 protein_id gnl|my_center|LOCUS_34490 284592 285215 gene locus_tag LOCUS_34500 284592 285215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 285267 285584 gene locus_tag LOCUS_34510 285267 285584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 285682 287694 gene locus_tag LOCUS_34520 285682 287694 CDS product protein meaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086840716.1 protein_id gnl|my_center|LOCUS_34520 287768 287977 gene locus_tag LOCUS_34530 287768 287977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 288010 288531 gene locus_tag LOCUS_34540 288010 288531 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062850.1 protein_id gnl|my_center|LOCUS_34540 288560 289384 gene locus_tag LOCUS_34550 288560 289384 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224549.1 protein_id gnl|my_center|LOCUS_34550 289806 289381 gene locus_tag LOCUS_34560 289806 289381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 290240 289896 gene locus_tag LOCUS_34570 290240 289896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 290884 290285 gene locus_tag LOCUS_34580 290884 290285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 291582 290884 gene locus_tag LOCUS_34590 gene nucS 291582 290884 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007387684.1 protein_id gnl|my_center|LOCUS_34590 291660 292205 gene locus_tag LOCUS_34600 291660 292205 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921094.1 protein_id gnl|my_center|LOCUS_34600 292249 294072 gene locus_tag LOCUS_34610 292249 294072 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229492.1 protein_id gnl|my_center|LOCUS_34610 296004 294097 gene locus_tag LOCUS_34620 296004 294097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 297307 296114 gene locus_tag LOCUS_34630 297307 296114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 298097 297669 gene locus_tag LOCUS_34640 298097 297669 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859527.1 protein_id gnl|my_center|LOCUS_34640 298247 299515 gene locus_tag LOCUS_34650 298247 299515 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222356.1 protein_id gnl|my_center|LOCUS_34650 299533 299766 gene locus_tag LOCUS_34660 299533 299766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 300194 299826 gene locus_tag LOCUS_34670 300194 299826 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222011.1 protein_id gnl|my_center|LOCUS_34670 301763 300252 gene locus_tag LOCUS_34680 301763 300252 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029141.1 protein_id gnl|my_center|LOCUS_34680 302258 301821 gene locus_tag LOCUS_34690 302258 301821 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412347.1 protein_id gnl|my_center|LOCUS_34690 303191 302298 gene locus_tag LOCUS_34700 303191 302298 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775973.1 protein_id gnl|my_center|LOCUS_34700 304293 303289 gene locus_tag LOCUS_34710 gene rsgA 304293 303289 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973761.1 protein_id gnl|my_center|LOCUS_34710 305558 304293 gene locus_tag LOCUS_34720 gene aroA 305558 304293 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973760.1 protein_id gnl|my_center|LOCUS_34720 306202 305678 gene locus_tag LOCUS_34730 306202 305678 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230942.1 protein_id gnl|my_center|LOCUS_34730 306258 307055 gene locus_tag LOCUS_34740 306258 307055 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030116.1 protein_id gnl|my_center|LOCUS_34740 307052 307702 gene locus_tag LOCUS_34750 307052 307702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973757.1 protein_id gnl|my_center|LOCUS_34750 307718 308413 gene locus_tag LOCUS_34760 gene sigR 307718 308413 CDS product RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973756.1 protein_id gnl|my_center|LOCUS_34760 308410 308703 gene locus_tag LOCUS_34770 308410 308703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 309324 308929 gene locus_tag LOCUS_34780 309324 308929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 309809 309324 gene locus_tag LOCUS_34790 309809 309324 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223567.1 protein_id gnl|my_center|LOCUS_34790 311515 309812 gene locus_tag LOCUS_34800 311515 309812 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409218.1 protein_id gnl|my_center|LOCUS_34800 312383 311541 gene locus_tag LOCUS_34810 312383 311541 CDS product DUF2785 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006668.1 protein_id gnl|my_center|LOCUS_34810 312448 313929 gene locus_tag LOCUS_34820 312448 313929 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973732.1 protein_id gnl|my_center|LOCUS_34820 314250 313999 gene locus_tag LOCUS_34830 314250 313999 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973730.1 protein_id gnl|my_center|LOCUS_34830 314429 314845 gene locus_tag LOCUS_34840 314429 314845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 315760 314909 gene locus_tag LOCUS_34850 315760 314909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 316194 315763 gene locus_tag LOCUS_34860 316194 315763 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973726.1 protein_id gnl|my_center|LOCUS_34860 316807 316256 gene locus_tag LOCUS_34870 316807 316256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 317986 316853 gene locus_tag LOCUS_34880 317986 316853 CDS product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728588.1 protein_id gnl|my_center|LOCUS_34880 318082 319002 gene locus_tag LOCUS_34890 318082 319002 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728589.1 protein_id gnl|my_center|LOCUS_34890 319490 319089 gene locus_tag LOCUS_34900 gene sodN 319490 319089 CDS product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973716.1 protein_id gnl|my_center|LOCUS_34900 319569 319871 gene locus_tag LOCUS_34910 319569 319871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 319930 321123 gene locus_tag LOCUS_34920 319930 321123 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973709.1 protein_id gnl|my_center|LOCUS_34920 322599 321148 gene locus_tag LOCUS_34930 gene zwf 322599 321148 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275501.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34930 322656 323624 gene locus_tag LOCUS_34940 322656 323624 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228445.1 protein_id gnl|my_center|LOCUS_34940 323624 324319 gene locus_tag LOCUS_34950 323624 324319 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189933225.1 protein_id gnl|my_center|LOCUS_34950 325875 324394 gene locus_tag LOCUS_34960 325875 324394 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226072.1 protein_id gnl|my_center|LOCUS_34960 326549 325920 gene locus_tag LOCUS_34970 326549 325920 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727865.1 protein_id gnl|my_center|LOCUS_34970 326689 327825 gene locus_tag LOCUS_34980 326689 327825 CDS product ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727866.1 protein_id gnl|my_center|LOCUS_34980 327837 328940 gene locus_tag LOCUS_34990 327837 328940 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223974.1 protein_id gnl|my_center|LOCUS_34990 328937 329140 gene locus_tag LOCUS_35000 328937 329140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 330758 329160 gene locus_tag LOCUS_35010 330758 329160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 330863 331084 gene locus_tag LOCUS_35020 330863 331084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 332464 331214 gene locus_tag LOCUS_35030 332464 331214 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222244.1 protein_id gnl|my_center|LOCUS_35030 332503 332979 gene locus_tag LOCUS_35040 332503 332979 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088894.1 protein_id gnl|my_center|LOCUS_35040 333643 332984 gene locus_tag LOCUS_35050 333643 332984 CDS product acetoacetate decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224746.1 protein_id gnl|my_center|LOCUS_35050 333666 333986 gene locus_tag LOCUS_35060 333666 333986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 334039 335451 gene locus_tag LOCUS_35070 334039 335451 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729870.1 protein_id gnl|my_center|LOCUS_35070 335458 336186 gene locus_tag LOCUS_35080 335458 336186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 336267 337400 gene locus_tag LOCUS_35090 gene dusB 336267 337400 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230697.1 protein_id gnl|my_center|LOCUS_35090 337591 338535 gene locus_tag LOCUS_35100 337591 338535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 338845 340092 gene locus_tag LOCUS_35110 338845 340092 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028369.1 protein_id gnl|my_center|LOCUS_35110 340138 341061 gene locus_tag LOCUS_35120 340138 341061 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030286.1 protein_id gnl|my_center|LOCUS_35120 341092 342963 gene locus_tag LOCUS_35130 gene dnaG 341092 342963 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228362.1 protein_id gnl|my_center|LOCUS_35130 342995 343477 gene locus_tag LOCUS_35140 342995 343477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 343587 343660 gene locus_tag LOCUS_t00340 343587 343660 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 343749 343973 gene locus_tag LOCUS_35150 343749 343973 CDS product DUF3099 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326801.1 protein_id gnl|my_center|LOCUS_35150 344723 343977 gene locus_tag LOCUS_35160 344723 343977 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978056.1 protein_id gnl|my_center|LOCUS_35160 344874 346448 gene locus_tag LOCUS_35170 344874 346448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_35170 347728 347078 gene locus_tag LOCUS_35180 347728 347078 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225371.1 protein_id gnl|my_center|LOCUS_35180 348350 347811 gene locus_tag LOCUS_35190 348350 347811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 348465 349181 gene locus_tag LOCUS_35200 348465 349181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 350664 349972 gene locus_tag LOCUS_35210 350664 349972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 351371 350721 gene locus_tag LOCUS_35220 351371 350721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 351859 351368 gene locus_tag LOCUS_35230 351859 351368 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225958345.1 protein_id gnl|my_center|LOCUS_35230 352652 351993 gene locus_tag LOCUS_35240 352652 351993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 353225 352728 gene locus_tag LOCUS_35250 353225 352728 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177767.1 protein_id gnl|my_center|LOCUS_35250 354469 353546 gene locus_tag LOCUS_35260 354469 353546 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728589.1 protein_id gnl|my_center|LOCUS_35260 354563 355705 gene locus_tag LOCUS_35270 354563 355705 CDS product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728588.1 protein_id gnl|my_center|LOCUS_35270 355888 356466 gene locus_tag LOCUS_35280 355888 356466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 356463 356753 gene locus_tag LOCUS_35290 356463 356753 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972099.1 protein_id gnl|my_center|LOCUS_35290 356821 357192 gene locus_tag LOCUS_35300 356821 357192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 357821 357462 gene locus_tag LOCUS_35310 357821 357462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 358308 358039 gene locus_tag LOCUS_35320 358308 358039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 358202 359128 gene locus_tag LOCUS_35330 358202 359128 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183337994.1 protein_id gnl|my_center|LOCUS_35330 359159 359332 gene locus_tag LOCUS_35340 359159 359332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 359820 359401 gene locus_tag LOCUS_35350 359820 359401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35350 360141 359875 gene locus_tag LOCUS_35360 360141 359875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 360826 363660 gene locus_tag LOCUS_35370 360826 363660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 363810 364094 gene locus_tag LOCUS_35380 363810 364094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 364254 365417 gene locus_tag LOCUS_35390 364254 365417 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_35390 365449 365523 gene locus_tag LOCUS_t00350 365449 365523 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 365579 366271 gene locus_tag LOCUS_35400 365579 366271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35400 366680 366282 gene locus_tag LOCUS_35410 366680 366282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 368142 366682 gene locus_tag LOCUS_35420 368142 366682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 368242 369513 gene locus_tag LOCUS_35430 gene tyrS 368242 369513 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027993.1 protein_id gnl|my_center|LOCUS_35430 369515 370570 gene locus_tag LOCUS_35440 369515 370570 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887674.1 protein_id gnl|my_center|LOCUS_35440 >Feature sequence26 925 332 gene locus_tag LOCUS_35450 925 332 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227827.1 protein_id gnl|my_center|LOCUS_35450 2324 909 gene locus_tag LOCUS_35460 gene argH 2324 909 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729312.1 protein_id gnl|my_center|LOCUS_35460 3241 2321 gene locus_tag LOCUS_35470 3241 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 4683 3241 gene locus_tag LOCUS_35480 gene argG 4683 3241 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972108.1 protein_id gnl|my_center|LOCUS_35480 5282 4683 gene locus_tag LOCUS_35490 5282 4683 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776177.1 protein_id gnl|my_center|LOCUS_35490 6208 5279 gene locus_tag LOCUS_35500 gene argF 6208 5279 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062134354.1 protein_id gnl|my_center|LOCUS_35500 7383 6205 gene locus_tag LOCUS_35510 7383 6205 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977247.1 protein_id gnl|my_center|LOCUS_35510 8308 7376 gene locus_tag LOCUS_35520 gene argB 8308 7376 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227836.1 protein_id gnl|my_center|LOCUS_35520 9425 8358 gene locus_tag LOCUS_35530 gene argJ 9425 8358 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027859.1 protein_id gnl|my_center|LOCUS_35530 9925 9536 gene locus_tag LOCUS_35540 9925 9536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 11013 9922 gene locus_tag LOCUS_35550 gene argC 11013 9922 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977244.1 protein_id gnl|my_center|LOCUS_35550 11103 11930 gene locus_tag LOCUS_35560 11103 11930 CDS product maleylpyruvate isomerase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929965.1 protein_id gnl|my_center|LOCUS_35560 14443 11954 gene locus_tag LOCUS_35570 gene pheT 14443 11954 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027870.1 protein_id gnl|my_center|LOCUS_35570 15549 14443 gene locus_tag LOCUS_35580 gene pheS 15549 14443 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977229.1 protein_id gnl|my_center|LOCUS_35580 16506 15616 gene locus_tag LOCUS_35590 16506 15616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 16592 17422 gene locus_tag LOCUS_35600 16592 17422 CDS product DUF817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399435.1 protein_id gnl|my_center|LOCUS_35600 18502 17435 gene locus_tag LOCUS_35610 18502 17435 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027872.1 protein_id gnl|my_center|LOCUS_35610 19264 18512 gene locus_tag LOCUS_35620 19264 18512 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408112.1 protein_id gnl|my_center|LOCUS_35620 19707 19312 gene locus_tag LOCUS_35630 gene rplT 19707 19312 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977226.1 protein_id gnl|my_center|LOCUS_35630 19963 19751 gene locus_tag LOCUS_35640 gene rpmI 19963 19751 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977225.1 protein_id gnl|my_center|LOCUS_35640 20560 20054 gene locus_tag LOCUS_35650 20560 20054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 20447 20968 gene locus_tag LOCUS_35660 20447 20968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 21597 21094 gene locus_tag LOCUS_35670 21597 21094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 21700 22578 gene locus_tag LOCUS_35680 21700 22578 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226851.1 protein_id gnl|my_center|LOCUS_35680 22566 23420 gene locus_tag LOCUS_35690 22566 23420 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729372.1 protein_id gnl|my_center|LOCUS_35690 23417 24442 gene locus_tag LOCUS_35700 23417 24442 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026153082.1 protein_id gnl|my_center|LOCUS_35700 24449 25609 gene locus_tag LOCUS_35710 24449 25609 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226848.1 protein_id gnl|my_center|LOCUS_35710 25965 26420 gene locus_tag LOCUS_35720 25965 26420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 26432 27001 gene locus_tag LOCUS_35730 26432 27001 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898102.1 protein_id gnl|my_center|LOCUS_35730 27025 27963 gene locus_tag LOCUS_35740 27025 27963 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230161.1 protein_id gnl|my_center|LOCUS_35740 28410 27922 gene locus_tag LOCUS_35750 28410 27922 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977388.1 protein_id gnl|my_center|LOCUS_35750 29245 28394 gene locus_tag LOCUS_35760 gene hisG 29245 28394 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977387.1 protein_id gnl|my_center|LOCUS_35760 29522 29259 gene locus_tag LOCUS_35770 29522 29259 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929945.1 protein_id gnl|my_center|LOCUS_35770 30103 29615 gene locus_tag LOCUS_35780 gene ribH 30103 29615 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977385.1 protein_id gnl|my_center|LOCUS_35780 31386 30103 gene locus_tag LOCUS_35790 31386 30103 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057753.1 protein_id gnl|my_center|LOCUS_35790 32039 31383 gene locus_tag LOCUS_35800 32039 31383 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977382.1 protein_id gnl|my_center|LOCUS_35800 33088 32039 gene locus_tag LOCUS_35810 gene ribD 33088 32039 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803669.1 protein_id gnl|my_center|LOCUS_35810 33880 33431 gene locus_tag LOCUS_35820 33880 33431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 34584 33877 gene locus_tag LOCUS_35830 gene rpe 34584 33877 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977361.1 protein_id gnl|my_center|LOCUS_35830 35593 34595 gene locus_tag LOCUS_35840 35593 34595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 36015 35590 gene locus_tag LOCUS_35850 36015 35590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 36989 36012 gene locus_tag LOCUS_35860 gene ligD 36989 36012 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226451.1 protein_id gnl|my_center|LOCUS_35860 37014 37736 gene locus_tag LOCUS_35870 37014 37736 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091945.1 protein_id gnl|my_center|LOCUS_35870 39195 37813 gene locus_tag LOCUS_35880 39195 37813 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977354.1 protein_id gnl|my_center|LOCUS_35880 40129 39188 gene locus_tag LOCUS_35890 gene fmt 40129 39188 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027805.1 protein_id gnl|my_center|LOCUS_35890 40688 40143 gene locus_tag LOCUS_35900 gene def 40688 40143 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224209.1 protein_id gnl|my_center|LOCUS_35900 40769 42382 gene locus_tag LOCUS_35910 40769 42382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 44449 42410 gene locus_tag LOCUS_35920 44449 42410 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027807.1 protein_id gnl|my_center|LOCUS_35920 46002 44800 gene locus_tag LOCUS_35930 gene metK 46002 44800 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977350.1 protein_id gnl|my_center|LOCUS_35930 47295 46078 gene locus_tag LOCUS_35940 gene coaBC 47295 46078 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485775.1 protein_id gnl|my_center|LOCUS_35940 47716 47390 gene locus_tag LOCUS_35950 gene rpoZ 47716 47390 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977348.1 protein_id gnl|my_center|LOCUS_35950 48462 47797 gene locus_tag LOCUS_35960 gene gmk 48462 47797 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805082.1 protein_id gnl|my_center|LOCUS_35960 48782 48459 gene locus_tag LOCUS_35970 48782 48459 CDS product integration host factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977346.1 protein_id gnl|my_center|LOCUS_35970 49379 48924 gene locus_tag LOCUS_35980 49379 48924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 50197 49376 gene locus_tag LOCUS_35990 gene pyrF 50197 49376 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485777.1 protein_id gnl|my_center|LOCUS_35990 51458 50292 gene locus_tag LOCUS_36000 51458 50292 CDS product lactate 2-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728393.1 protein_id gnl|my_center|LOCUS_36000 52541 51501 gene locus_tag LOCUS_36010 52541 51501 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977344.1 protein_id gnl|my_center|LOCUS_36010 55864 52538 gene locus_tag LOCUS_36020 gene carB 55864 52538 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977343.1 protein_id gnl|my_center|LOCUS_36020 57008 55866 gene locus_tag LOCUS_36030 gene carA 57008 55866 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027810.1 protein_id gnl|my_center|LOCUS_36030 58053 57133 gene locus_tag LOCUS_36040 58053 57133 CDS product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674266.1 protein_id gnl|my_center|LOCUS_36040 60505 58067 gene locus_tag LOCUS_36050 gene hrpB 60505 58067 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223186.1 protein_id gnl|my_center|LOCUS_36050 62030 60738 gene locus_tag LOCUS_36060 62030 60738 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977340.1 protein_id gnl|my_center|LOCUS_36060 62968 62027 gene locus_tag LOCUS_36070 62968 62027 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057676.1 protein_id gnl|my_center|LOCUS_36070 63543 62965 gene locus_tag LOCUS_36080 gene pyrR 63543 62965 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805074.1 protein_id gnl|my_center|LOCUS_36080 63625 64506 gene locus_tag LOCUS_36090 63625 64506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 64516 64920 gene locus_tag LOCUS_36100 64516 64920 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977952.1 protein_id gnl|my_center|LOCUS_36100 65950 64940 gene locus_tag LOCUS_36110 65950 64940 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226304.1 protein_id gnl|my_center|LOCUS_36110 66666 66079 gene locus_tag LOCUS_36120 66666 66079 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031480854.1 protein_id gnl|my_center|LOCUS_36120 67472 66663 gene locus_tag LOCUS_36130 67472 66663 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878395.1 protein_id gnl|my_center|LOCUS_36130 68560 67469 gene locus_tag LOCUS_36140 68560 67469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405629.1 protein_id gnl|my_center|LOCUS_36140 70139 68739 gene locus_tag LOCUS_36150 70139 68739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 71057 70245 gene locus_tag LOCUS_36160 71057 70245 CDS product DUF1206 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776922.1 protein_id gnl|my_center|LOCUS_36160 72508 71054 gene locus_tag LOCUS_36170 72508 71054 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028984.1 protein_id gnl|my_center|LOCUS_36170 72937 72530 gene locus_tag LOCUS_36180 gene nusB 72937 72530 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224611.1 protein_id gnl|my_center|LOCUS_36180 73500 72937 gene locus_tag LOCUS_36190 gene efp 73500 72937 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224610.1 protein_id gnl|my_center|LOCUS_36190 74239 73790 gene locus_tag LOCUS_36200 gene aroQ 74239 73790 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224605.1 protein_id gnl|my_center|LOCUS_36200 75387 74236 gene locus_tag LOCUS_36210 gene aroB 75387 74236 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027813.1 protein_id gnl|my_center|LOCUS_36210 75896 75384 gene locus_tag LOCUS_36220 75896 75384 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027814.1 protein_id gnl|my_center|LOCUS_36220 77071 75893 gene locus_tag LOCUS_36230 gene aroC 77071 75893 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977330.1 protein_id gnl|my_center|LOCUS_36230 77861 77112 gene locus_tag LOCUS_36240 77861 77112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 78691 77861 gene locus_tag LOCUS_36250 78691 77861 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027816.1 protein_id gnl|my_center|LOCUS_36250 79905 78703 gene locus_tag LOCUS_36260 gene mltG 79905 78703 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053383.1 protein_id gnl|my_center|LOCUS_36260 78716 78808 gene locus_tag LOCUS_t00360 78716 78808 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 80407 79898 gene locus_tag LOCUS_36270 gene ruvX 80407 79898 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042825781.1 protein_id gnl|my_center|LOCUS_36270 83079 80404 gene locus_tag LOCUS_36280 gene alaS 83079 80404 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093585.1 protein_id gnl|my_center|LOCUS_36280 83399 83079 gene locus_tag LOCUS_36290 83399 83079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 83920 83396 gene locus_tag LOCUS_36300 83920 83396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 85302 83932 gene locus_tag LOCUS_36310 85302 83932 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977320.1 protein_id gnl|my_center|LOCUS_36310 86575 85289 gene locus_tag LOCUS_36320 86575 85289 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973861.1 protein_id gnl|my_center|LOCUS_36320 87663 86572 gene locus_tag LOCUS_36330 87663 86572 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973862.1 protein_id gnl|my_center|LOCUS_36330 88655 87660 gene locus_tag LOCUS_36340 88655 87660 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973863.1 protein_id gnl|my_center|LOCUS_36340 90625 88844 gene locus_tag LOCUS_36350 90625 88844 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973864.1 protein_id gnl|my_center|LOCUS_36350 91701 90673 gene locus_tag LOCUS_36360 91701 90673 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973522.1 protein_id gnl|my_center|LOCUS_36360 93635 91863 gene locus_tag LOCUS_36370 gene aspS 93635 91863 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224570.1 protein_id gnl|my_center|LOCUS_36370 94981 93632 gene locus_tag LOCUS_36380 gene hisS 94981 93632 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805006.1 protein_id gnl|my_center|LOCUS_36380 95712 94987 gene locus_tag LOCUS_36390 95712 94987 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977317.1 protein_id gnl|my_center|LOCUS_36390 95861 97090 gene locus_tag LOCUS_36400 95861 97090 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325802.1 protein_id gnl|my_center|LOCUS_36400 99533 97290 gene locus_tag LOCUS_36410 gene relA 99533 97290 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977314.1 protein_id gnl|my_center|LOCUS_36410 100235 99696 gene locus_tag LOCUS_36420 100235 99696 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325803.1 protein_id gnl|my_center|LOCUS_36420 101488 100241 gene locus_tag LOCUS_36430 gene secF 101488 100241 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977312.1 protein_id gnl|my_center|LOCUS_36430 103383 101488 gene locus_tag LOCUS_36440 gene secD 103383 101488 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027823.1 protein_id gnl|my_center|LOCUS_36440 103724 103389 gene locus_tag LOCUS_36450 103724 103389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 104916 103840 gene locus_tag LOCUS_36460 gene ruvB 104916 103840 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977309.1 protein_id gnl|my_center|LOCUS_36460 105550 104930 gene locus_tag LOCUS_36470 gene ruvA 105550 104930 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027825.1 protein_id gnl|my_center|LOCUS_36470 106074 105547 gene locus_tag LOCUS_36480 gene ruvC 106074 105547 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977307.1 protein_id gnl|my_center|LOCUS_36480 106940 106167 gene locus_tag LOCUS_36490 106940 106167 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977306.1 protein_id gnl|my_center|LOCUS_36490 107633 107010 gene locus_tag LOCUS_36500 gene pdxT 107633 107010 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977305.1 protein_id gnl|my_center|LOCUS_36500 109083 107689 gene locus_tag LOCUS_36510 109083 107689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 109723 109076 gene locus_tag LOCUS_36520 109723 109076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 110584 109826 gene locus_tag LOCUS_36530 110584 109826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 111168 110584 gene locus_tag LOCUS_36540 111168 110584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 111769 111191 gene locus_tag LOCUS_36550 111769 111191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 113520 112015 gene locus_tag LOCUS_36560 113520 112015 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096659.1 protein_id gnl|my_center|LOCUS_36560 114453 113536 gene locus_tag LOCUS_36570 gene pdxS 114453 113536 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051767629.1 protein_id gnl|my_center|LOCUS_36570 115150 114473 gene locus_tag LOCUS_36580 115150 114473 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027830.1 protein_id gnl|my_center|LOCUS_36580 115263 115397 gene locus_tag LOCUS_36590 115263 115397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 116044 115499 gene locus_tag LOCUS_36600 116044 115499 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227148.1 protein_id gnl|my_center|LOCUS_36600 116751 116041 gene locus_tag LOCUS_36610 116751 116041 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223018.1 protein_id gnl|my_center|LOCUS_36610 118431 116758 gene locus_tag LOCUS_36620 118431 116758 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730708.1 protein_id gnl|my_center|LOCUS_36620 119454 118450 gene locus_tag LOCUS_36630 119454 118450 CDS product diiron oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897094.1 protein_id gnl|my_center|LOCUS_36630 120280 119783 gene locus_tag LOCUS_36640 120280 119783 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467800.1 protein_id gnl|my_center|LOCUS_36640 121111 120344 gene locus_tag LOCUS_36650 121111 120344 CDS product pirin-like bicupin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089568.1 protein_id gnl|my_center|LOCUS_36650 121161 121616 gene locus_tag LOCUS_36660 121161 121616 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878772.1 protein_id gnl|my_center|LOCUS_36660 122108 121626 gene locus_tag LOCUS_36670 122108 121626 CDS product TIGR03618 family F420-dependent PPOX class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974936.1 protein_id gnl|my_center|LOCUS_36670 122381 122863 gene locus_tag LOCUS_36680 122381 122863 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530760.1 protein_id gnl|my_center|LOCUS_36680 123327 122836 gene locus_tag LOCUS_36690 123327 122836 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229329.1 protein_id gnl|my_center|LOCUS_36690 125315 123324 gene locus_tag LOCUS_36700 gene thrS 125315 123324 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977296.1 protein_id gnl|my_center|LOCUS_36700 126101 125391 gene locus_tag LOCUS_36710 126101 125391 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027476.1 protein_id gnl|my_center|LOCUS_36710 127442 126204 gene locus_tag LOCUS_36720 127442 126204 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978156.1 protein_id gnl|my_center|LOCUS_36720 128659 127439 gene locus_tag LOCUS_36730 128659 127439 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027307.1 protein_id gnl|my_center|LOCUS_36730 129542 128652 gene locus_tag LOCUS_36740 129542 128652 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027308.1 protein_id gnl|my_center|LOCUS_36740 130450 129539 gene locus_tag LOCUS_36750 130450 129539 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228791.1 protein_id gnl|my_center|LOCUS_36750 131265 130447 gene locus_tag LOCUS_36760 131265 130447 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978152.1 protein_id gnl|my_center|LOCUS_36760 132752 131262 gene locus_tag LOCUS_36770 132752 131262 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031160740.1 protein_id gnl|my_center|LOCUS_36770 132888 134093 gene locus_tag LOCUS_36780 132888 134093 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224859.1 protein_id gnl|my_center|LOCUS_36780 134458 134385 gene locus_tag LOCUS_t00370 134458 134385 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 134658 134476 gene locus_tag LOCUS_36790 134658 134476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 134657 135070 gene locus_tag LOCUS_36800 134657 135070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 135916 135098 gene locus_tag LOCUS_36810 135916 135098 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977279.1 protein_id gnl|my_center|LOCUS_36810 136065 136138 gene locus_tag LOCUS_t00380 136065 136138 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 136179 136252 gene locus_tag LOCUS_t00390 136179 136252 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 136279 136353 gene locus_tag LOCUS_t00400 136279 136353 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 138005 136413 gene locus_tag LOCUS_36820 gene atzF 138005 136413 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140963.1 protein_id gnl|my_center|LOCUS_36820 139984 138002 gene locus_tag LOCUS_36830 139984 138002 CDS product 5-oxoprolinase/urea amidolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728209.1 protein_id gnl|my_center|LOCUS_36830 140616 139984 gene locus_tag LOCUS_36840 140616 139984 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096803.1 protein_id gnl|my_center|LOCUS_36840 141317 140613 gene locus_tag LOCUS_36850 141317 140613 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420904.1 protein_id gnl|my_center|LOCUS_36850 142879 141314 gene locus_tag LOCUS_36860 142879 141314 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077940.1 protein_id gnl|my_center|LOCUS_36860 143808 143131 gene locus_tag LOCUS_36870 143808 143131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 144633 143971 gene locus_tag LOCUS_36880 144633 143971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 144833 146797 gene locus_tag LOCUS_36890 144833 146797 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038140.1 protein_id gnl|my_center|LOCUS_36890 147667 147383 gene locus_tag LOCUS_36900 147667 147383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 148813 147710 gene locus_tag LOCUS_36910 148813 147710 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975108.1 protein_id gnl|my_center|LOCUS_36910 149777 148806 gene locus_tag LOCUS_36920 149777 148806 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972813.1 protein_id gnl|my_center|LOCUS_36920 151270 149858 gene locus_tag LOCUS_36930 151270 149858 CDS product C4-dicarboxylate transporter DctA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973562.1 protein_id gnl|my_center|LOCUS_36930 153127 151676 gene locus_tag LOCUS_36940 153127 151676 CDS product glycine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730415.1 protein_id gnl|my_center|LOCUS_36940 153879 153166 gene locus_tag LOCUS_36950 153879 153166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 154276 155994 gene locus_tag LOCUS_36960 154276 155994 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729896.1 protein_id gnl|my_center|LOCUS_36960 155991 156149 gene locus_tag LOCUS_36970 155991 156149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972819.1 protein_id gnl|my_center|LOCUS_36970 156146 156892 gene locus_tag LOCUS_36980 156146 156892 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972820.1 protein_id gnl|my_center|LOCUS_36980 156939 157712 gene locus_tag LOCUS_36990 156939 157712 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030650.1 protein_id gnl|my_center|LOCUS_36990 158196 157798 gene locus_tag LOCUS_37000 158196 157798 CDS product DUF3037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027736.1 protein_id gnl|my_center|LOCUS_37000 158954 158193 gene locus_tag LOCUS_37010 158954 158193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977478.1 protein_id gnl|my_center|LOCUS_37010 159799 158951 gene locus_tag LOCUS_37020 159799 158951 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112196.1 protein_id gnl|my_center|LOCUS_37020 160360 159854 gene locus_tag LOCUS_37030 160360 159854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 161121 160636 gene locus_tag LOCUS_37040 161121 160636 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230535.1 protein_id gnl|my_center|LOCUS_37040 161923 161159 gene locus_tag LOCUS_37050 161923 161159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 162986 161925 gene locus_tag LOCUS_37060 gene recA 162986 161925 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030442.1 protein_id gnl|my_center|LOCUS_37060 164318 163191 gene locus_tag LOCUS_37070 164318 163191 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029200.1 protein_id gnl|my_center|LOCUS_37070 165064 164315 gene locus_tag LOCUS_37080 165064 164315 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230050.1 protein_id gnl|my_center|LOCUS_37080 165498 165064 gene locus_tag LOCUS_37090 165498 165064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 166679 165495 gene locus_tag LOCUS_37100 166679 165495 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876933.1 protein_id gnl|my_center|LOCUS_37100 167323 166676 gene locus_tag LOCUS_37110 167323 166676 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230054.1 protein_id gnl|my_center|LOCUS_37110 168027 167320 gene locus_tag LOCUS_37120 168027 167320 CDS product DUF2064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727343.1 protein_id gnl|my_center|LOCUS_37120 168683 168024 gene locus_tag LOCUS_37130 168683 168024 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230052.1 protein_id gnl|my_center|LOCUS_37130 168965 168696 gene locus_tag LOCUS_37140 168965 168696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 168913 170208 gene locus_tag LOCUS_37150 168913 170208 CDS product integral membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402890.1 protein_id gnl|my_center|LOCUS_37150 171301 170246 gene locus_tag LOCUS_37160 171301 170246 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402868.1 protein_id gnl|my_center|LOCUS_37160 171857 171345 gene locus_tag LOCUS_37170 171857 171345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 172724 171906 gene locus_tag LOCUS_37180 172724 171906 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080321.1 protein_id gnl|my_center|LOCUS_37180 173290 172787 gene locus_tag LOCUS_37190 173290 172787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 173558 173367 gene locus_tag LOCUS_37200 173558 173367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37200 174698 173565 gene locus_tag LOCUS_37210 174698 173565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 174770 175279 gene locus_tag LOCUS_37220 174770 175279 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528179.1 protein_id gnl|my_center|LOCUS_37220 176084 175272 gene locus_tag LOCUS_37230 176084 175272 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228482.1 protein_id gnl|my_center|LOCUS_37230 176929 176081 gene locus_tag LOCUS_37240 176929 176081 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228483.1 protein_id gnl|my_center|LOCUS_37240 177876 176929 gene locus_tag LOCUS_37250 177876 176929 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228484.1 protein_id gnl|my_center|LOCUS_37250 177806 178483 gene locus_tag LOCUS_37260 177806 178483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 178917 178462 gene locus_tag LOCUS_37270 178917 178462 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226091.1 protein_id gnl|my_center|LOCUS_37270 180639 179035 gene locus_tag LOCUS_37280 180639 179035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 180710 182122 gene locus_tag LOCUS_37290 180710 182122 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028662.1 protein_id gnl|my_center|LOCUS_37290 182119 182691 gene locus_tag LOCUS_37300 182119 182691 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975893.1 protein_id gnl|my_center|LOCUS_37300 182688 183431 gene locus_tag LOCUS_37310 182688 183431 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027962.1 protein_id gnl|my_center|LOCUS_37310 183945 188480 gene locus_tag LOCUS_37320 183945 188480 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109508967.1 protein_id gnl|my_center|LOCUS_37320 188467 189294 gene locus_tag LOCUS_37330 188467 189294 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030437.1 protein_id gnl|my_center|LOCUS_37330 192502 189278 gene locus_tag LOCUS_37340 192502 189278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 192990 192631 gene locus_tag LOCUS_37350 192990 192631 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973269.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_37350 193541 193026 gene locus_tag LOCUS_37360 193541 193026 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030436.1 protein_id gnl|my_center|LOCUS_37360 198429 193657 gene locus_tag LOCUS_37370 198429 193657 CDS product ExeM/NucH family extracellular endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390206.1 protein_id gnl|my_center|LOCUS_37370 199244 198624 gene locus_tag LOCUS_37380 gene pgsA 199244 198624 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857464.1 protein_id gnl|my_center|LOCUS_37380 200641 199241 gene locus_tag LOCUS_37390 gene rimO 200641 199241 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973272.1 protein_id gnl|my_center|LOCUS_37390 202206 200722 gene locus_tag LOCUS_37400 202206 200722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 204668 202203 gene locus_tag LOCUS_37410 204668 202203 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113701643.1 protein_id gnl|my_center|LOCUS_37410 204661 204945 gene locus_tag LOCUS_37420 204661 204945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37420 205186 208578 gene locus_tag LOCUS_37430 205186 208578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 210351 208666 gene locus_tag LOCUS_37440 210351 208666 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973282.1 protein_id gnl|my_center|LOCUS_37440 211274 210372 gene locus_tag LOCUS_37450 gene dapA 211274 210372 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030431.1 protein_id gnl|my_center|LOCUS_37450 212212 211271 gene locus_tag LOCUS_37460 212212 211271 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973051.1 protein_id gnl|my_center|LOCUS_37460 212441 213028 gene locus_tag LOCUS_37470 212441 213028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 213510 213025 gene locus_tag LOCUS_37480 213510 213025 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816386.1 protein_id gnl|my_center|LOCUS_37480 214657 213518 gene locus_tag LOCUS_37490 214657 213518 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776617.1 protein_id gnl|my_center|LOCUS_37490 214960 216249 gene locus_tag LOCUS_37500 214960 216249 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074038115.1 protein_id gnl|my_center|LOCUS_37500 217256 216462 gene locus_tag LOCUS_37510 217256 216462 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036023.1 protein_id gnl|my_center|LOCUS_37510 218096 217266 gene locus_tag LOCUS_37520 218096 217266 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762776.1 protein_id gnl|my_center|LOCUS_37520 219530 218166 gene locus_tag LOCUS_37530 219530 218166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 221103 219547 gene locus_tag LOCUS_37540 221103 219547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 221520 221245 gene locus_tag LOCUS_37550 221520 221245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976644.1 protein_id gnl|my_center|LOCUS_37550 222635 221517 gene locus_tag LOCUS_37560 gene gcvT 222635 221517 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899219.1 protein_id gnl|my_center|LOCUS_37560 222704 224197 gene locus_tag LOCUS_37570 222704 224197 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028182.1 protein_id gnl|my_center|LOCUS_37570 224599 224225 gene locus_tag LOCUS_37580 224599 224225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466777.1 protein_id gnl|my_center|LOCUS_37580 226134 224659 gene locus_tag LOCUS_37590 226134 224659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 226300 227682 gene locus_tag LOCUS_37600 gene lpdA 226300 227682 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224051.1 protein_id gnl|my_center|LOCUS_37600 227700 229556 gene locus_tag LOCUS_37610 227700 229556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37610 230349 229894 gene locus_tag LOCUS_37620 230349 229894 CDS product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975175.1 protein_id gnl|my_center|LOCUS_37620 230481 231395 gene locus_tag LOCUS_37630 230481 231395 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870932.1 protein_id gnl|my_center|LOCUS_37630 231915 231367 gene locus_tag LOCUS_37640 231915 231367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 232006 232752 gene locus_tag LOCUS_37650 gene lipB 232006 232752 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895681.1 protein_id gnl|my_center|LOCUS_37650 232957 234132 gene locus_tag LOCUS_37660 232957 234132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 234263 235210 gene locus_tag LOCUS_37670 234263 235210 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974362.1 protein_id gnl|my_center|LOCUS_37670 235207 236214 gene locus_tag LOCUS_37680 235207 236214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 236255 237124 gene locus_tag LOCUS_37690 236255 237124 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140485.1 protein_id gnl|my_center|LOCUS_37690 237154 238104 gene locus_tag LOCUS_37700 gene lipA 237154 238104 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976621.1 protein_id gnl|my_center|LOCUS_37700 238163 238903 gene locus_tag LOCUS_37710 238163 238903 CDS product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976619.1 protein_id gnl|my_center|LOCUS_37710 239717 238923 gene locus_tag LOCUS_37720 239717 238923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 240240 239809 gene locus_tag LOCUS_37730 240240 239809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 240444 241862 gene locus_tag LOCUS_37740 gene glnA 240444 241862 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976617.1 protein_id gnl|my_center|LOCUS_37740 242195 241881 gene locus_tag LOCUS_37750 242195 241881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 242243 242518 gene locus_tag LOCUS_37760 242243 242518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 242624 243811 gene locus_tag LOCUS_37770 242624 243811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37770 244744 243941 gene locus_tag LOCUS_37780 244744 243941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 244841 245305 gene locus_tag LOCUS_37790 244841 245305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 245337 245516 gene locus_tag LOCUS_37800 245337 245516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 245513 246067 gene locus_tag LOCUS_37810 245513 246067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37810 248255 246093 gene locus_tag LOCUS_37820 gene brxL 248255 246093 CDS product BREX system Lon protease-like protein BrxL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038874.1 protein_id gnl|my_center|LOCUS_37820 250765 248267 gene locus_tag LOCUS_37830 gene pglZ 250765 248267 CDS product BREX-1 system phosphatase PglZ type A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038873.1 protein_id gnl|my_center|LOCUS_37830 254232 250762 gene locus_tag LOCUS_37840 gene pglX 254232 250762 CDS product BREX-1 system adenine-specific DNA-methyltransferase PglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939304.1 protein_id gnl|my_center|LOCUS_37840 257696 254232 gene locus_tag LOCUS_37850 gene brxC 257696 254232 CDS product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205228200.1 protein_id gnl|my_center|LOCUS_37850 258303 257701 gene locus_tag LOCUS_37860 258303 257701 CDS product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038867.1 protein_id gnl|my_center|LOCUS_37860 258911 258303 gene locus_tag LOCUS_37870 258911 258303 CDS product DUF1819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205228220.1 protein_id gnl|my_center|LOCUS_37870 259198 258998 gene locus_tag LOCUS_37880 259198 258998 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932357.1 protein_id gnl|my_center|LOCUS_37880 259468 259782 gene locus_tag LOCUS_37890 259468 259782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 259881 261230 gene locus_tag LOCUS_37900 259881 261230 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112893.1 protein_id gnl|my_center|LOCUS_37900 261736 262143 gene locus_tag LOCUS_37910 261736 262143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 262255 262419 gene locus_tag LOCUS_37920 262255 262419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37920 262416 263132 gene locus_tag LOCUS_37930 262416 263132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 263164 263613 gene locus_tag LOCUS_37940 263164 263613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 263733 263960 gene locus_tag LOCUS_37950 263733 263960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37950 263970 264146 gene locus_tag LOCUS_37960 263970 264146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37960 265048 264179 gene locus_tag LOCUS_37970 265048 264179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37970 265266 265631 gene locus_tag LOCUS_37980 265266 265631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 265621 267144 gene locus_tag LOCUS_37990 265621 267144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 267317 268066 gene locus_tag LOCUS_38000 267317 268066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 268172 268765 gene locus_tag LOCUS_38010 268172 268765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 268937 269569 gene locus_tag LOCUS_38020 268937 269569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 269569 270390 gene locus_tag LOCUS_38030 269569 270390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 270470 270724 gene locus_tag LOCUS_38040 270470 270724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 270724 271131 gene locus_tag LOCUS_38050 270724 271131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 271037 271831 gene locus_tag LOCUS_38060 271037 271831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060 271837 272520 gene locus_tag LOCUS_38070 271837 272520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 273749 272493 gene locus_tag LOCUS_38080 273749 272493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 274581 273772 gene locus_tag LOCUS_38090 274581 273772 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014322.1 protein_id gnl|my_center|LOCUS_38090 275285 274578 gene locus_tag LOCUS_38100 275285 274578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179964304.1 protein_id gnl|my_center|LOCUS_38100 276067 275282 gene locus_tag LOCUS_38110 276067 275282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38110 276394 276140 gene locus_tag LOCUS_38120 276394 276140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 277566 276631 gene locus_tag LOCUS_38130 277566 276631 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224538.1 protein_id gnl|my_center|LOCUS_38130 277650 277952 gene locus_tag LOCUS_38140 277650 277952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 277949 278218 gene locus_tag LOCUS_38150 277949 278218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 278341 278222 gene locus_tag LOCUS_38160 278341 278222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 279507 278461 gene locus_tag LOCUS_38170 gene dprA 279507 278461 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487183.1 protein_id gnl|my_center|LOCUS_38170 279667 279476 gene locus_tag LOCUS_38180 279667 279476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 280711 279683 gene locus_tag LOCUS_38190 280711 279683 CDS product DUF4192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179809238.1 protein_id gnl|my_center|LOCUS_38190 281117 280728 gene locus_tag LOCUS_38200 281117 280728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 281660 281163 gene locus_tag LOCUS_38210 281660 281163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 282300 281845 gene locus_tag LOCUS_38220 282300 281845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 282611 284161 gene locus_tag LOCUS_38230 282611 284161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 284235 285281 gene locus_tag LOCUS_38240 284235 285281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 285358 285651 gene locus_tag LOCUS_38250 285358 285651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 285648 285863 gene locus_tag LOCUS_38260 285648 285863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 285893 286108 gene locus_tag LOCUS_38270 285893 286108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 286155 286397 gene locus_tag LOCUS_38280 286155 286397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38280 286394 286744 gene locus_tag LOCUS_38290 286394 286744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38290 287349 286810 gene locus_tag LOCUS_38300 287349 286810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 287737 287315 gene locus_tag LOCUS_38310 287737 287315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38310 288010 293919 gene locus_tag LOCUS_38320 288010 293919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 295191 294388 gene locus_tag LOCUS_38330 295191 294388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38330 295688 295332 gene locus_tag LOCUS_38340 295688 295332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 296386 295685 gene locus_tag LOCUS_38350 296386 295685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 297861 296383 gene locus_tag LOCUS_38360 297861 296383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 298139 297858 gene locus_tag LOCUS_38370 298139 297858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38370 298738 298136 gene locus_tag LOCUS_38380 298738 298136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38380 301959 298816 gene locus_tag LOCUS_38390 301959 298816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 303523 301988 gene locus_tag LOCUS_38400 303523 301988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 305028 303523 gene locus_tag LOCUS_38410 305028 303523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38410 307061 305103 gene locus_tag LOCUS_38420 307061 305103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 307834 307058 gene locus_tag LOCUS_38430 307834 307058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 308700 307834 gene locus_tag LOCUS_38440 308700 307834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 308993 308700 gene locus_tag LOCUS_38450 308993 308700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 309887 309033 gene locus_tag LOCUS_38460 309887 309033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 310177 309884 gene locus_tag LOCUS_38470 310177 309884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 311120 310167 gene locus_tag LOCUS_38480 311120 310167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 312247 311438 gene locus_tag LOCUS_38490 312247 311438 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469478.1 protein_id gnl|my_center|LOCUS_38490 312726 312244 gene locus_tag LOCUS_38500 312726 312244 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014064.1 protein_id gnl|my_center|LOCUS_38500 312799 314034 gene locus_tag LOCUS_38510 312799 314034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38510 314285 314473 gene locus_tag LOCUS_38520 314285 314473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 314795 314514 gene locus_tag LOCUS_38530 314795 314514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38530 316043 314826 gene locus_tag LOCUS_38540 316043 314826 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223381.1 protein_id gnl|my_center|LOCUS_38540 316822 317832 gene locus_tag LOCUS_38550 316822 317832 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289537.1 protein_id gnl|my_center|LOCUS_38550 318124 318459 gene locus_tag LOCUS_38560 318124 318459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38560 318393 319367 gene locus_tag LOCUS_38570 318393 319367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38570 319374 319919 gene locus_tag LOCUS_38580 319374 319919 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084746.1 protein_id gnl|my_center|LOCUS_38580 320785 320048 gene locus_tag LOCUS_38590 320785 320048 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978344.1 protein_id gnl|my_center|LOCUS_38590 320784 321401 gene locus_tag LOCUS_38600 320784 321401 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224939.1 protein_id gnl|my_center|LOCUS_38600 321825 324656 gene locus_tag LOCUS_38610 321825 324656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 325922 325026 gene locus_tag LOCUS_38620 325922 325026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 326482 325916 gene locus_tag LOCUS_38630 326482 325916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38630 326754 326479 gene locus_tag LOCUS_38640 326754 326479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 330037 326777 gene locus_tag LOCUS_38650 330037 326777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 330483 330034 gene locus_tag LOCUS_38660 330483 330034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228853.1 protein_id gnl|my_center|LOCUS_38660 330881 330483 gene locus_tag LOCUS_38670 330881 330483 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189749557.1 protein_id gnl|my_center|LOCUS_38670 331333 330938 gene locus_tag LOCUS_38680 331333 330938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38680 331543 331340 gene locus_tag LOCUS_38690 331543 331340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 332530 331619 gene locus_tag LOCUS_38700 332530 331619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 333459 332527 gene locus_tag LOCUS_38710 333459 332527 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029709.1 protein_id gnl|my_center|LOCUS_38710 335135 333456 gene locus_tag LOCUS_38720 335135 333456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 335971 335132 gene locus_tag LOCUS_38730 335971 335132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974416.1 protein_id gnl|my_center|LOCUS_38730 336655 335975 gene locus_tag LOCUS_38740 336655 335975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 337421 336981 gene locus_tag LOCUS_38750 337421 336981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 337800 339047 gene locus_tag LOCUS_38760 337800 339047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 339044 340474 gene locus_tag LOCUS_38770 339044 340474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021016.1 protein_id gnl|my_center|LOCUS_38770 341102 342337 gene locus_tag LOCUS_38780 341102 342337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 >Feature sequence27 330 124 gene locus_tag LOCUS_38790 330 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38790 626 327 gene locus_tag LOCUS_38800 626 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38800 1725 811 gene locus_tag LOCUS_38810 1725 811 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972246.1 protein_id gnl|my_center|LOCUS_38810 4223 1842 gene locus_tag LOCUS_38820 4223 1842 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228501.1 protein_id gnl|my_center|LOCUS_38820 5271 4309 gene locus_tag LOCUS_38830 5271 4309 CDS product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079769.1 protein_id gnl|my_center|LOCUS_38830 5989 5291 gene locus_tag LOCUS_38840 5989 5291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 7019 6015 gene locus_tag LOCUS_38850 7019 6015 CDS product putative zinc-binding metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894400.1 protein_id gnl|my_center|LOCUS_38850 7996 7103 gene locus_tag LOCUS_38860 7996 7103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 8585 8031 gene locus_tag LOCUS_38870 8585 8031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 9109 8582 gene locus_tag LOCUS_38880 9109 8582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 10023 9106 gene locus_tag LOCUS_38890 10023 9106 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091036.1 protein_id gnl|my_center|LOCUS_38890 12512 10020 gene locus_tag LOCUS_38900 12512 10020 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111384.1 protein_id gnl|my_center|LOCUS_38900 15872 12585 gene locus_tag LOCUS_38910 15872 12585 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728760.1 protein_id gnl|my_center|LOCUS_38910 16065 16646 gene locus_tag LOCUS_38920 16065 16646 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230395.1 protein_id gnl|my_center|LOCUS_38920 16643 17893 gene locus_tag LOCUS_38930 16643 17893 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222244.1 protein_id gnl|my_center|LOCUS_38930 18977 17898 gene locus_tag LOCUS_38940 gene hisC 18977 17898 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029330.1 protein_id gnl|my_center|LOCUS_38940 19599 19066 gene locus_tag LOCUS_38950 19599 19066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 20273 19653 gene locus_tag LOCUS_38960 20273 19653 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228507.1 protein_id gnl|my_center|LOCUS_38960 20337 21728 gene locus_tag LOCUS_38970 20337 21728 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228506.1 protein_id gnl|my_center|LOCUS_38970 22634 21741 gene locus_tag LOCUS_38980 22634 21741 CDS product arginine deiminase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089035.1 protein_id gnl|my_center|LOCUS_38980 22722 23459 gene locus_tag LOCUS_38990 22722 23459 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537996.1 protein_id gnl|my_center|LOCUS_38990 23625 24020 gene locus_tag LOCUS_39000 23625 24020 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975010.1 protein_id gnl|my_center|LOCUS_39000 24020 24502 gene locus_tag LOCUS_39010 24020 24502 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975011.1 protein_id gnl|my_center|LOCUS_39010 24499 25365 gene locus_tag LOCUS_39020 24499 25365 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226372.1 protein_id gnl|my_center|LOCUS_39020 25423 26121 gene locus_tag LOCUS_39030 25423 26121 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230061.1 protein_id gnl|my_center|LOCUS_39030 26118 27650 gene locus_tag LOCUS_39040 26118 27650 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230060.1 protein_id gnl|my_center|LOCUS_39040 27643 28215 gene locus_tag LOCUS_39050 27643 28215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39050 29473 28205 gene locus_tag LOCUS_39060 29473 28205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 30068 29493 gene locus_tag LOCUS_39070 30068 29493 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975605.1 protein_id gnl|my_center|LOCUS_39070 30635 30111 gene locus_tag LOCUS_39080 30635 30111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 32550 30628 gene locus_tag LOCUS_39090 gene phzE 32550 30628 CDS product phenazine biosynthesis protein PhzE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118954.1 protein_id gnl|my_center|LOCUS_39090 35120 32583 gene locus_tag LOCUS_39100 35120 32583 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223261.1 protein_id gnl|my_center|LOCUS_39100 35223 36599 gene locus_tag LOCUS_39110 35223 36599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39110 37063 36605 gene locus_tag LOCUS_39120 37063 36605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 37686 37105 gene locus_tag LOCUS_39130 37686 37105 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223264.1 protein_id gnl|my_center|LOCUS_39130 37880 38221 gene locus_tag LOCUS_39140 37880 38221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39140 40373 38184 gene locus_tag LOCUS_39150 40373 38184 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223681.1 protein_id gnl|my_center|LOCUS_39150 41150 40449 gene locus_tag LOCUS_39160 41150 40449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 42149 41349 gene locus_tag LOCUS_39170 42149 41349 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730572.1 protein_id gnl|my_center|LOCUS_39170 42204 43928 gene locus_tag LOCUS_39180 42204 43928 CDS product sulfite oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027201.1 protein_id gnl|my_center|LOCUS_39180 44047 44730 gene locus_tag LOCUS_39190 44047 44730 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978224.1 protein_id gnl|my_center|LOCUS_39190 44770 45372 gene locus_tag LOCUS_39200 gene sigK 44770 45372 CDS product ECF RNA polymerase sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191314022.1 protein_id gnl|my_center|LOCUS_39200 45369 46103 gene locus_tag LOCUS_39210 45369 46103 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027262.1 protein_id gnl|my_center|LOCUS_39210 46100 48124 gene locus_tag LOCUS_39220 46100 48124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39220 48121 49362 gene locus_tag LOCUS_39230 48121 49362 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402250.1 protein_id gnl|my_center|LOCUS_39230 49376 50695 gene locus_tag LOCUS_39240 49376 50695 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224815.1 protein_id gnl|my_center|LOCUS_39240 52009 50717 gene locus_tag LOCUS_39250 52009 50717 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230367.1 protein_id gnl|my_center|LOCUS_39250 52406 52032 gene locus_tag LOCUS_39260 52406 52032 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082918.1 protein_id gnl|my_center|LOCUS_39260 52562 53377 gene locus_tag LOCUS_39270 52562 53377 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402248.1 protein_id gnl|my_center|LOCUS_39270 53641 54426 gene locus_tag LOCUS_39280 53641 54426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39280 55562 54423 gene locus_tag LOCUS_39290 55562 54423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 56512 55619 gene locus_tag LOCUS_39300 56512 55619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 57715 56552 gene locus_tag LOCUS_39310 57715 56552 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224755.1 protein_id gnl|my_center|LOCUS_39310 59622 57712 gene locus_tag LOCUS_39320 59622 57712 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224754.1 protein_id gnl|my_center|LOCUS_39320 61423 59867 gene locus_tag LOCUS_39330 61423 59867 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466887.1 protein_id gnl|my_center|LOCUS_39330 61920 61450 gene locus_tag LOCUS_39340 61920 61450 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080323.1 protein_id gnl|my_center|LOCUS_39340 63334 62123 gene locus_tag LOCUS_39350 63334 62123 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224752.1 protein_id gnl|my_center|LOCUS_39350 65064 63334 gene locus_tag LOCUS_39360 65064 63334 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029617.1 protein_id gnl|my_center|LOCUS_39360 65866 65066 gene locus_tag LOCUS_39370 65866 65066 CDS product TIGR03084 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095900.1 protein_id gnl|my_center|LOCUS_39370 66480 65863 gene locus_tag LOCUS_39380 66480 65863 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224757.1 protein_id gnl|my_center|LOCUS_39380 67645 66665 gene locus_tag LOCUS_39390 67645 66665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 68285 67869 gene locus_tag LOCUS_39400 68285 67869 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888560.1 protein_id gnl|my_center|LOCUS_39400 68982 68305 gene locus_tag LOCUS_39410 68982 68305 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228740.1 protein_id gnl|my_center|LOCUS_39410 70034 68982 gene locus_tag LOCUS_39420 70034 68982 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228741.1 protein_id gnl|my_center|LOCUS_39420 71284 70031 gene locus_tag LOCUS_39430 71284 70031 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090631.1 protein_id gnl|my_center|LOCUS_39430 71313 71858 gene locus_tag LOCUS_39440 71313 71858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 72052 72306 gene locus_tag LOCUS_39450 72052 72306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39450 72434 73894 gene locus_tag LOCUS_39460 72434 73894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 73904 74203 gene locus_tag LOCUS_39470 73904 74203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39470 75788 74250 gene locus_tag LOCUS_39480 75788 74250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 76485 75763 gene locus_tag LOCUS_39490 76485 75763 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029631.1 protein_id gnl|my_center|LOCUS_39490 78043 76517 gene locus_tag LOCUS_39500 78043 76517 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013433.1 protein_id gnl|my_center|LOCUS_39500 79380 78040 gene locus_tag LOCUS_39510 79380 78040 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112315.1 protein_id gnl|my_center|LOCUS_39510 80591 79554 gene locus_tag LOCUS_39520 80591 79554 CDS product TIGR03842 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111352.1 protein_id gnl|my_center|LOCUS_39520 82102 80657 gene locus_tag LOCUS_39530 gene hydA 82102 80657 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111354.1 protein_id gnl|my_center|LOCUS_39530 82952 82104 gene locus_tag LOCUS_39540 82952 82104 CDS product apolipoprotein acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296600.1 protein_id gnl|my_center|LOCUS_39540 83071 84393 gene locus_tag LOCUS_39550 83071 84393 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728155.1 protein_id gnl|my_center|LOCUS_39550 85136 84390 gene locus_tag LOCUS_39560 85136 84390 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028918.1 protein_id gnl|my_center|LOCUS_39560 85852 85133 gene locus_tag LOCUS_39570 85852 85133 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028919.1 protein_id gnl|my_center|LOCUS_39570 86582 85917 gene locus_tag LOCUS_39580 86582 85917 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222994.1 protein_id gnl|my_center|LOCUS_39580 86673 88181 gene locus_tag LOCUS_39590 86673 88181 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222995.1 protein_id gnl|my_center|LOCUS_39590 90470 88260 gene locus_tag LOCUS_39600 gene fadB 90470 88260 CDS product fatty oxidation protein FadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404426.1 protein_id gnl|my_center|LOCUS_39600 91892 90621 gene locus_tag LOCUS_39610 91892 90621 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031140.1 protein_id gnl|my_center|LOCUS_39610 91968 92669 gene locus_tag LOCUS_39620 91968 92669 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031142.1 protein_id gnl|my_center|LOCUS_39620 93496 92696 gene locus_tag LOCUS_39630 93496 92696 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112261.1 protein_id gnl|my_center|LOCUS_39630 94160 93525 gene locus_tag LOCUS_39640 94160 93525 CDS product protein disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408271.1 protein_id gnl|my_center|LOCUS_39640 95834 94350 gene locus_tag LOCUS_39650 95834 94350 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727728.1 protein_id gnl|my_center|LOCUS_39650 96059 96952 gene locus_tag LOCUS_39660 96059 96952 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227663.1 protein_id gnl|my_center|LOCUS_39660 97857 97165 gene locus_tag LOCUS_39670 97857 97165 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405938.1 protein_id gnl|my_center|LOCUS_39670 98110 97916 gene locus_tag LOCUS_39680 98110 97916 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088593.1 protein_id gnl|my_center|LOCUS_39680 99660 98209 gene locus_tag LOCUS_39690 99660 98209 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226334.1 protein_id gnl|my_center|LOCUS_39690 100469 99702 gene locus_tag LOCUS_39700 100469 99702 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292113.1 protein_id gnl|my_center|LOCUS_39700 101338 100466 gene locus_tag LOCUS_39710 101338 100466 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053659.1 protein_id gnl|my_center|LOCUS_39710 102222 101341 gene locus_tag LOCUS_39720 102222 101341 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116998.1 protein_id gnl|my_center|LOCUS_39720 103438 102266 gene locus_tag LOCUS_39730 103438 102266 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031139.1 protein_id gnl|my_center|LOCUS_39730 103554 104063 gene locus_tag LOCUS_39740 103554 104063 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222261.1 protein_id gnl|my_center|LOCUS_39740 104060 106048 gene locus_tag LOCUS_39750 104060 106048 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222260.1 protein_id gnl|my_center|LOCUS_39750 106071 107210 gene locus_tag LOCUS_39760 106071 107210 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027320.1 protein_id gnl|my_center|LOCUS_39760 107242 108555 gene locus_tag LOCUS_39770 107242 108555 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975759.1 protein_id gnl|my_center|LOCUS_39770 109326 108562 gene locus_tag LOCUS_39780 109326 108562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39780 109702 110481 gene locus_tag LOCUS_39790 109702 110481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39790 112503 110953 gene locus_tag LOCUS_39800 112503 110953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 113425 112496 gene locus_tag LOCUS_39810 113425 112496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39810 114489 113425 gene locus_tag LOCUS_39820 114489 113425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39820 115849 114491 gene locus_tag LOCUS_39830 115849 114491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39830 117657 115975 gene locus_tag LOCUS_39840 117657 115975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39840 117676 119445 gene locus_tag LOCUS_39850 117676 119445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39850 119442 120161 gene locus_tag LOCUS_39860 119442 120161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39860 120341 120186 gene locus_tag LOCUS_39870 120341 120186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39870 120286 120459 gene locus_tag LOCUS_39880 120286 120459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39880 121108 120530 gene locus_tag LOCUS_39890 121108 120530 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729092.1 protein_id gnl|my_center|LOCUS_39890 121208 122128 gene locus_tag LOCUS_39900 121208 122128 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031765.1 protein_id gnl|my_center|LOCUS_39900 122155 123111 gene locus_tag LOCUS_39910 122155 123111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39910 124510 123128 gene locus_tag LOCUS_39920 124510 123128 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222037.1 protein_id gnl|my_center|LOCUS_39920 124503 125162 gene locus_tag LOCUS_39930 124503 125162 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028320.1 protein_id gnl|my_center|LOCUS_39930 126207 125287 gene locus_tag LOCUS_39940 126207 125287 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027281.1 protein_id gnl|my_center|LOCUS_39940 127805 126204 gene locus_tag LOCUS_39950 127805 126204 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484466.1 protein_id gnl|my_center|LOCUS_39950 127823 128428 gene locus_tag LOCUS_39960 127823 128428 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978194.1 protein_id gnl|my_center|LOCUS_39960 128425 130020 gene locus_tag LOCUS_39970 128425 130020 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027283.1 protein_id gnl|my_center|LOCUS_39970 130042 131046 gene locus_tag LOCUS_39980 130042 131046 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079794.1 protein_id gnl|my_center|LOCUS_39980 131079 131672 gene locus_tag LOCUS_39990 131079 131672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39990 131741 132688 gene locus_tag LOCUS_40000 131741 132688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40000 132971 132645 gene locus_tag LOCUS_40010 132971 132645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40010 134468 133014 gene locus_tag LOCUS_40020 134468 133014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 134587 134955 gene locus_tag LOCUS_40030 134587 134955 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052767.1 protein_id gnl|my_center|LOCUS_40030 135918 134980 gene locus_tag LOCUS_40040 135918 134980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 137397 135928 gene locus_tag LOCUS_40050 137397 135928 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229619.1 protein_id gnl|my_center|LOCUS_40050 139749 137860 gene locus_tag LOCUS_40060 139749 137860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40060 142635 139903 gene locus_tag LOCUS_40070 142635 139903 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030729.1 protein_id gnl|my_center|LOCUS_40070 144606 142708 gene locus_tag LOCUS_40080 144606 142708 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804249.1 protein_id gnl|my_center|LOCUS_40080 145474 144668 gene locus_tag LOCUS_40090 145474 144668 CDS product SGNH family lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977101.1 protein_id gnl|my_center|LOCUS_40090 145972 145520 gene locus_tag LOCUS_40100 145972 145520 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189554466.1 protein_id gnl|my_center|LOCUS_40100 146030 146974 gene locus_tag LOCUS_40110 146030 146974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 148994 147177 gene locus_tag LOCUS_40120 148994 147177 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090032.1 protein_id gnl|my_center|LOCUS_40120 149074 149448 gene locus_tag LOCUS_40130 149074 149448 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230234.1 protein_id gnl|my_center|LOCUS_40130 149448 150065 gene locus_tag LOCUS_40140 149448 150065 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296703.1 protein_id gnl|my_center|LOCUS_40140 150095 150874 gene locus_tag LOCUS_40150 150095 150874 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085663.1 protein_id gnl|my_center|LOCUS_40150 151364 150852 gene locus_tag LOCUS_40160 151364 150852 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728757.1 protein_id gnl|my_center|LOCUS_40160 151422 152849 gene locus_tag LOCUS_40170 151422 152849 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226023.1 protein_id gnl|my_center|LOCUS_40170 154659 152836 gene locus_tag LOCUS_40180 gene glmS 154659 152836 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229190.1 protein_id gnl|my_center|LOCUS_40180 154944 154681 gene locus_tag LOCUS_40190 154944 154681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229189.1 protein_id gnl|my_center|LOCUS_40190 155269 157197 gene locus_tag LOCUS_40200 155269 157197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40200 158134 157220 gene locus_tag LOCUS_40210 158134 157220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40210 159234 158170 gene locus_tag LOCUS_40220 159234 158170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40220 160577 159231 gene locus_tag LOCUS_40230 gene hasA 160577 159231 CDS product hyaluronan synthase HasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038431685.1 protein_id gnl|my_center|LOCUS_40230 161595 160567 gene locus_tag LOCUS_40240 161595 160567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 162854 161592 gene locus_tag LOCUS_40250 162854 161592 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461043.1 protein_id gnl|my_center|LOCUS_40250 163600 162863 gene locus_tag LOCUS_40260 163600 162863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 164205 163597 gene locus_tag LOCUS_40270 164205 163597 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403380.1 protein_id gnl|my_center|LOCUS_40270 165184 164462 gene locus_tag LOCUS_40280 165184 164462 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326434.1 protein_id gnl|my_center|LOCUS_40280 165810 165175 gene locus_tag LOCUS_40290 165810 165175 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039130.1 protein_id gnl|my_center|LOCUS_40290 166508 165807 gene locus_tag LOCUS_40300 166508 165807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40300 166845 166973 gene locus_tag LOCUS_40310 166845 166973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 167105 167671 gene locus_tag LOCUS_40320 167105 167671 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226185.1 protein_id gnl|my_center|LOCUS_40320 167753 168685 gene locus_tag LOCUS_40330 167753 168685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40330 169080 168682 gene locus_tag LOCUS_40340 169080 168682 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870063.1 protein_id gnl|my_center|LOCUS_40340 169673 169077 gene locus_tag LOCUS_40350 169673 169077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40350 170040 169675 gene locus_tag LOCUS_40360 170040 169675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40360 170777 170118 gene locus_tag LOCUS_40370 170777 170118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40370 170879 172297 gene locus_tag LOCUS_40380 170879 172297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 174356 172305 gene locus_tag LOCUS_40390 174356 172305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40390 174355 175995 gene locus_tag LOCUS_40400 174355 175995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40400 177448 176030 gene locus_tag LOCUS_40410 177448 176030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_40410 178263 177445 gene locus_tag LOCUS_40420 178263 177445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40420 178411 179004 gene locus_tag LOCUS_40430 178411 179004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40430 179487 179263 gene locus_tag LOCUS_40440 179487 179263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40440 180955 179732 gene locus_tag LOCUS_40450 180955 179732 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977622.1 protein_id gnl|my_center|LOCUS_40450 181034 182014 gene locus_tag LOCUS_40460 181034 182014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40460 182351 181956 gene locus_tag LOCUS_40470 182351 181956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 183082 182348 gene locus_tag LOCUS_40480 183082 182348 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027749.1 protein_id gnl|my_center|LOCUS_40480 183852 183514 gene locus_tag LOCUS_40490 183852 183514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40490 184957 183899 gene locus_tag LOCUS_40500 184957 183899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211410235.1 protein_id gnl|my_center|LOCUS_40500 185196 184954 gene locus_tag LOCUS_40510 185196 184954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40510 186569 185544 gene locus_tag LOCUS_40520 186569 185544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 188716 186773 gene locus_tag LOCUS_40530 188716 186773 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206614.1 protein_id gnl|my_center|LOCUS_40530 188740 189069 gene locus_tag LOCUS_40540 188740 189069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40540 190258 189059 gene locus_tag LOCUS_40550 190258 189059 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214468507.1 protein_id gnl|my_center|LOCUS_40550 190629 190273 gene locus_tag LOCUS_40560 190629 190273 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079890.1 protein_id gnl|my_center|LOCUS_40560 191409 190777 gene locus_tag LOCUS_40570 191409 190777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 191976 191464 gene locus_tag LOCUS_40580 191976 191464 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257245.1 protein_id gnl|my_center|LOCUS_40580 195627 192013 gene locus_tag LOCUS_40590 195627 192013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 196155 195640 gene locus_tag LOCUS_40600 196155 195640 CDS product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528764.1 protein_id gnl|my_center|LOCUS_40600 196680 196168 gene locus_tag LOCUS_40610 196680 196168 CDS product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528766.1 protein_id gnl|my_center|LOCUS_40610 197211 196693 gene locus_tag LOCUS_40620 197211 196693 CDS product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039264.1 protein_id gnl|my_center|LOCUS_40620 197684 197208 gene locus_tag LOCUS_40630 197684 197208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 197992 197681 gene locus_tag LOCUS_40640 197992 197681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40640 198161 198703 gene locus_tag LOCUS_40650 198161 198703 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419208.1 protein_id gnl|my_center|LOCUS_40650 198700 199995 gene locus_tag LOCUS_40660 198700 199995 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730701.1 protein_id gnl|my_center|LOCUS_40660 200018 201508 gene locus_tag LOCUS_40670 200018 201508 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977903.1 protein_id gnl|my_center|LOCUS_40670 201595 202434 gene locus_tag LOCUS_40680 201595 202434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40680 203199 202642 gene locus_tag LOCUS_40690 203199 202642 CDS product DUF664 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224874.1 protein_id gnl|my_center|LOCUS_40690 203201 203659 gene locus_tag LOCUS_40700 203201 203659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 205361 203679 gene locus_tag LOCUS_40710 gene relZ 205361 203679 CDS product bifunctional ribonuclease/(p)ppGpp synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730844.1 protein_id gnl|my_center|LOCUS_40710 206404 205433 gene locus_tag LOCUS_40720 206404 205433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40720 207411 206494 gene locus_tag LOCUS_40730 207411 206494 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888939.1 protein_id gnl|my_center|LOCUS_40730 208259 207408 gene locus_tag LOCUS_40740 208259 207408 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480088.1 protein_id gnl|my_center|LOCUS_40740 208362 209333 gene locus_tag LOCUS_40750 208362 209333 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029976.1 protein_id gnl|my_center|LOCUS_40750 209330 210133 gene locus_tag LOCUS_40760 209330 210133 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466752.1 protein_id gnl|my_center|LOCUS_40760 211351 210221 gene locus_tag LOCUS_40770 211351 210221 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486947.1 protein_id gnl|my_center|LOCUS_40770 212569 211379 gene locus_tag LOCUS_40780 212569 211379 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083253.1 protein_id gnl|my_center|LOCUS_40780 212516 213289 gene locus_tag LOCUS_40790 212516 213289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40790 213300 214424 gene locus_tag LOCUS_40800 gene fahA 213300 214424 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113316.1 protein_id gnl|my_center|LOCUS_40800 215795 214518 gene locus_tag LOCUS_40810 215795 214518 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466963.1 protein_id gnl|my_center|LOCUS_40810 216960 215932 gene locus_tag LOCUS_40820 gene tsaD 216960 215932 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775962.1 protein_id gnl|my_center|LOCUS_40820 217568 216957 gene locus_tag LOCUS_40830 217568 216957 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235191117.1 protein_id gnl|my_center|LOCUS_40830 217637 218539 gene locus_tag LOCUS_40840 217637 218539 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895122.1 protein_id gnl|my_center|LOCUS_40840 218979 218548 gene locus_tag LOCUS_40850 218979 218548 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410811.1 protein_id gnl|my_center|LOCUS_40850 219230 218976 gene locus_tag LOCUS_40860 219230 218976 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410814.1 protein_id gnl|my_center|LOCUS_40860 219350 220651 gene locus_tag LOCUS_40870 219350 220651 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928952.1 protein_id gnl|my_center|LOCUS_40870 220689 221006 gene locus_tag LOCUS_40880 220689 221006 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776253.1 protein_id gnl|my_center|LOCUS_40880 221058 221339 gene locus_tag LOCUS_40890 221058 221339 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887568.1 protein_id gnl|my_center|LOCUS_40890 222446 221358 gene locus_tag LOCUS_40900 222446 221358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40900 223092 222457 gene locus_tag LOCUS_40910 223092 222457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40910 223565 223131 gene locus_tag LOCUS_40920 223565 223131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40920 223612 224718 gene locus_tag LOCUS_40930 223612 224718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40930 225959 224700 gene locus_tag LOCUS_40940 gene thrS 225959 224700 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485230.1 protein_id gnl|my_center|LOCUS_40940 226941 226156 gene locus_tag LOCUS_40950 226941 226156 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072477587.1 protein_id gnl|my_center|LOCUS_40950 227089 228564 gene locus_tag LOCUS_40960 227089 228564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40960 231253 228713 gene locus_tag LOCUS_40970 231253 228713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40970 231957 231250 gene locus_tag LOCUS_40980 gene lolD 231957 231250 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210923.1 protein_id gnl|my_center|LOCUS_40980 232401 232009 gene locus_tag LOCUS_40990 232401 232009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40990 232846 232619 gene locus_tag LOCUS_41000 232846 232619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41000 233025 234392 gene locus_tag LOCUS_41010 233025 234392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41010 236266 234833 gene locus_tag LOCUS_41020 gene dnaB 236266 234833 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975021.1 protein_id gnl|my_center|LOCUS_41020 236765 238102 gene locus_tag LOCUS_41030 236765 238102 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485269.1 protein_id gnl|my_center|LOCUS_41030 238099 238677 gene locus_tag LOCUS_41040 238099 238677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41040 239129 238683 gene locus_tag LOCUS_41050 gene rplI 239129 238683 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975023.1 protein_id gnl|my_center|LOCUS_41050 239383 239147 gene locus_tag LOCUS_41060 gene rpsR 239383 239147 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003949403.1 protein_id gnl|my_center|LOCUS_41060 240024 239446 gene locus_tag LOCUS_41070 240024 239446 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231003.1 protein_id gnl|my_center|LOCUS_41070 240471 240166 gene locus_tag LOCUS_41080 gene rpsF 240471 240166 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898321.1 protein_id gnl|my_center|LOCUS_41080 240684 241598 gene locus_tag LOCUS_41090 240684 241598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_41090 243727 241607 gene locus_tag LOCUS_41100 243727 241607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41100 243858 244655 gene locus_tag LOCUS_41110 243858 244655 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467888.1 protein_id gnl|my_center|LOCUS_41110 244666 245814 gene locus_tag LOCUS_41120 244666 245814 CDS product peptidoglycan bridge formation peptidyltransferase VanK-Sc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029108.1 protein_id gnl|my_center|LOCUS_41120 245822 246877 gene locus_tag LOCUS_41130 245822 246877 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975028.1 protein_id gnl|my_center|LOCUS_41130 248312 246906 gene locus_tag LOCUS_41140 248312 246906 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029301.1 protein_id gnl|my_center|LOCUS_41140 250729 248309 gene locus_tag LOCUS_41150 250729 248309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41150 250803 251537 gene locus_tag LOCUS_41160 250803 251537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41160 251634 252719 gene locus_tag LOCUS_41170 251634 252719 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112786.1 protein_id gnl|my_center|LOCUS_41170 253532 252798 gene locus_tag LOCUS_41180 253532 252798 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043775763.1 protein_id gnl|my_center|LOCUS_41180 254587 253529 gene locus_tag LOCUS_41190 254587 253529 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804256.1 protein_id gnl|my_center|LOCUS_41190 255088 254678 gene locus_tag LOCUS_41200 255088 254678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41200 254979 259991 gene locus_tag LOCUS_41210 254979 259991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41210 260607 260008 gene locus_tag LOCUS_41220 260607 260008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41220 261100 260627 gene locus_tag LOCUS_41230 261100 260627 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897102.1 protein_id gnl|my_center|LOCUS_41230 262587 261133 gene locus_tag LOCUS_41240 262587 261133 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975035.1 protein_id gnl|my_center|LOCUS_41240 262665 264929 gene locus_tag LOCUS_41250 262665 264929 CDS product DUF6049 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029298.1 protein_id gnl|my_center|LOCUS_41250 264926 266629 gene locus_tag LOCUS_41260 264926 266629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41260 266699 268597 gene locus_tag LOCUS_41270 266699 268597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41270 268590 269288 gene locus_tag LOCUS_41280 gene sigM 268590 269288 CDS product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029295.1 protein_id gnl|my_center|LOCUS_41280 269336 270085 gene locus_tag LOCUS_41290 269336 270085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41290 270204 271223 gene locus_tag LOCUS_41300 gene trxB 270204 271223 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975041.1 protein_id gnl|my_center|LOCUS_41300 271289 271615 gene locus_tag LOCUS_41310 gene trxA 271289 271615 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975042.1 protein_id gnl|my_center|LOCUS_41310 272330 271662 gene locus_tag LOCUS_41320 272330 271662 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975043.1 protein_id gnl|my_center|LOCUS_41320 272376 273590 gene locus_tag LOCUS_41330 272376 273590 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090913.1 protein_id gnl|my_center|LOCUS_41330 273663 274442 gene locus_tag LOCUS_41340 273663 274442 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222170.1 protein_id gnl|my_center|LOCUS_41340 275533 274493 gene locus_tag LOCUS_41350 275533 274493 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231063.1 protein_id gnl|my_center|LOCUS_41350 276519 275533 gene locus_tag LOCUS_41360 276519 275533 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029292.1 protein_id gnl|my_center|LOCUS_41360 277425 276685 gene locus_tag LOCUS_41370 gene rsmG 277425 276685 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029291.1 protein_id gnl|my_center|LOCUS_41370 278012 277431 gene locus_tag LOCUS_41380 278012 277431 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029290.1 protein_id gnl|my_center|LOCUS_41380 279043 278009 gene locus_tag LOCUS_41390 gene yidC 279043 278009 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777156.1 protein_id gnl|my_center|LOCUS_41390 279336 279049 gene locus_tag LOCUS_41400 279336 279049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41400 279707 279333 gene locus_tag LOCUS_41410 279707 279333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41410 279902 279765 gene locus_tag LOCUS_41420 gene rpmH 279902 279765 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909051.1 protein_id gnl|my_center|LOCUS_41420 280390 281919 gene locus_tag LOCUS_41430 280390 281919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41430 282319 283455 gene locus_tag LOCUS_41440 gene dnaN 282319 283455 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975054.1 protein_id gnl|my_center|LOCUS_41440 283505 284419 gene locus_tag LOCUS_41450 gene gnd 283505 284419 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029286.1 protein_id gnl|my_center|LOCUS_41450 284844 284428 gene locus_tag LOCUS_41460 284844 284428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41460 285460 284819 gene locus_tag LOCUS_41470 285460 284819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41470 285434 286663 gene locus_tag LOCUS_41480 gene recF 285434 286663 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975056.1 protein_id gnl|my_center|LOCUS_41480 286653 287228 gene locus_tag LOCUS_41490 286653 287228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41490 287514 289643 gene locus_tag LOCUS_41500 gene gyrB 287514 289643 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221960.1 protein_id gnl|my_center|LOCUS_41500 289791 292508 gene locus_tag LOCUS_41510 gene gyrA 289791 292508 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326690.1 protein_id gnl|my_center|LOCUS_41510 292508 293167 gene locus_tag LOCUS_41520 292508 293167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41520 293454 293528 gene locus_tag LOCUS_t00410 293454 293528 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 293558 293686 gene locus_tag LOCUS_41530 293558 293686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41530 293707 293781 gene locus_tag LOCUS_t00420 293707 293781 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 295606 293828 gene locus_tag LOCUS_41540 295606 293828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41540 296333 295614 gene locus_tag LOCUS_41550 296333 295614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41550 296467 297423 gene locus_tag LOCUS_41560 296467 297423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41560 298223 297447 gene locus_tag LOCUS_41570 298223 297447 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113889933.1 protein_id gnl|my_center|LOCUS_41570 298331 299038 gene locus_tag LOCUS_41580 298331 299038 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943910.1 protein_id gnl|my_center|LOCUS_41580 299035 299370 gene locus_tag LOCUS_41590 299035 299370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41590 300052 299414 gene locus_tag LOCUS_41600 300052 299414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41600 300200 300718 gene locus_tag LOCUS_41610 300200 300718 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891350.1 protein_id gnl|my_center|LOCUS_41610 300732 301658 gene locus_tag LOCUS_41620 300732 301658 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975079.1 protein_id gnl|my_center|LOCUS_41620 302411 301938 gene locus_tag LOCUS_41630 302411 301938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41630 302564 303268 gene locus_tag LOCUS_41640 302564 303268 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485254.1 protein_id gnl|my_center|LOCUS_41640 305108 303291 gene locus_tag LOCUS_41650 gene pknB 305108 303291 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029269.1 protein_id gnl|my_center|LOCUS_41650 306670 305105 gene locus_tag LOCUS_41660 306670 305105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41660 308180 306720 gene locus_tag LOCUS_41670 308180 306720 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029268.1 protein_id gnl|my_center|LOCUS_41670 309607 308177 gene locus_tag LOCUS_41680 309607 308177 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726618.1 protein_id gnl|my_center|LOCUS_41680 311007 309610 gene locus_tag LOCUS_41690 311007 309610 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029266.1 protein_id gnl|my_center|LOCUS_41690 311480 311004 gene locus_tag LOCUS_41700 gene fhaB 311480 311004 CDS product antibiotic biosynthesis regulator FhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975090.1 protein_id gnl|my_center|LOCUS_41700 312210 311473 gene locus_tag LOCUS_41710 312210 311473 CDS product DUF3662 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068566.1 protein_id gnl|my_center|LOCUS_41710 312403 312176 gene locus_tag LOCUS_41720 312403 312176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41720 312413 312496 gene locus_tag LOCUS_t00430 312413 312496 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 312562 312879 gene locus_tag LOCUS_41730 312562 312879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41730 313317 313481 gene locus_tag LOCUS_41740 313317 313481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41740 313524 313826 gene locus_tag LOCUS_41750 313524 313826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41750 313862 314356 gene locus_tag LOCUS_41760 313862 314356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 314879 314343 gene locus_tag LOCUS_41770 314879 314343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41770 317293 314885 gene locus_tag LOCUS_41780 317293 314885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41780 318114 317308 gene locus_tag LOCUS_41790 318114 317308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41790 318210 318776 gene locus_tag LOCUS_41800 318210 318776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41800 319429 318740 gene locus_tag LOCUS_41810 319429 318740 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389300.1 protein_id gnl|my_center|LOCUS_41810 320048 319731 gene locus_tag LOCUS_41820 320048 319731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41820 320468 321079 gene locus_tag LOCUS_41830 320468 321079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41830 321859 322101 gene locus_tag LOCUS_41840 321859 322101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41840 322165 323034 gene locus_tag LOCUS_41850 322165 323034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41850 324170 323061 gene locus_tag LOCUS_41860 324170 323061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41860 326064 324298 gene locus_tag LOCUS_41870 326064 324298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41870 326447 326061 gene locus_tag LOCUS_41880 326447 326061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41880 326728 326459 gene locus_tag LOCUS_41890 326728 326459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41890 327200 328330 gene locus_tag LOCUS_41900 327200 328330 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236073048.1 protein_id gnl|my_center|LOCUS_41900 328718 328518 gene locus_tag LOCUS_41910 328718 328518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41910 329020 328751 gene locus_tag LOCUS_41920 329020 328751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41920 329850 329185 gene locus_tag LOCUS_41930 329850 329185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41930 331595 330786 gene locus_tag LOCUS_41940 331595 330786 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389439.1 protein_id gnl|my_center|LOCUS_41940 331940 332848 gene locus_tag LOCUS_41950 331940 332848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41950 333464 333799 gene locus_tag LOCUS_41960 333464 333799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41960 >Feature sequence28 147 914 gene locus_tag LOCUS_41970 147 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41970 954 1769 gene locus_tag LOCUS_41980 954 1769 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467799.1 protein_id gnl|my_center|LOCUS_41980 2323 3141 gene locus_tag LOCUS_41990 2323 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41990 3153 3758 gene locus_tag LOCUS_42000 3153 3758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42000 3850 4380 gene locus_tag LOCUS_42010 3850 4380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42010 5508 4609 gene locus_tag LOCUS_42020 5508 4609 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296303.1 protein_id gnl|my_center|LOCUS_42020 6015 7247 gene locus_tag LOCUS_42030 6015 7247 CDS product DUF2786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223807.1 protein_id gnl|my_center|LOCUS_42030 7244 8347 gene locus_tag LOCUS_42040 7244 8347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42040 8347 9564 gene locus_tag LOCUS_42050 8347 9564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42050 9561 10982 gene locus_tag LOCUS_42060 9561 10982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42060 11210 11809 gene locus_tag LOCUS_42070 11210 11809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42070 12647 11835 gene locus_tag LOCUS_42080 12647 11835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42080 13225 12644 gene locus_tag LOCUS_42090 13225 12644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42090 13935 13222 gene locus_tag LOCUS_42100 13935 13222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42100 14549 14004 gene locus_tag LOCUS_42110 14549 14004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42110 14741 15337 gene locus_tag LOCUS_42120 14741 15337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 15995 15351 gene locus_tag LOCUS_42130 15995 15351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42130 17568 16066 gene locus_tag LOCUS_42140 17568 16066 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142355.1 protein_id gnl|my_center|LOCUS_42140 17752 20073 gene locus_tag LOCUS_42150 17752 20073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42150 20136 20720 gene locus_tag LOCUS_42160 20136 20720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42160 21404 21063 gene locus_tag LOCUS_42170 21404 21063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42170 22702 21401 gene locus_tag LOCUS_42180 22702 21401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42180 22989 22699 gene locus_tag LOCUS_42190 22989 22699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42190 23318 22986 gene locus_tag LOCUS_42200 23318 22986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42200 23486 24463 gene locus_tag LOCUS_42210 23486 24463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42210 24560 25039 gene locus_tag LOCUS_42220 24560 25039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42220 25193 25783 gene locus_tag LOCUS_42230 25193 25783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42230 25807 26139 gene locus_tag LOCUS_42240 25807 26139 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776272.1 protein_id gnl|my_center|LOCUS_42240 26868 26221 gene locus_tag LOCUS_42250 26868 26221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296444.1 protein_id gnl|my_center|LOCUS_42250 26887 27075 gene locus_tag LOCUS_42260 26887 27075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42260 27072 27677 gene locus_tag LOCUS_42270 27072 27677 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224735.1 protein_id gnl|my_center|LOCUS_42270 27707 28405 gene locus_tag LOCUS_42280 27707 28405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42280 28433 29221 gene locus_tag LOCUS_42290 28433 29221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42290 29929 29240 gene locus_tag LOCUS_42300 29929 29240 CDS product EthD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729166.1 protein_id gnl|my_center|LOCUS_42300 30023 30421 gene locus_tag LOCUS_42310 30023 30421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42310 31590 30406 gene locus_tag LOCUS_42320 gene glgA 31590 30406 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805185.1 protein_id gnl|my_center|LOCUS_42320 31620 32882 gene locus_tag LOCUS_42330 gene glgC 31620 32882 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805186.1 protein_id gnl|my_center|LOCUS_42330 33517 32936 gene locus_tag LOCUS_42340 33517 32936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42340 33566 34123 gene locus_tag LOCUS_42350 33566 34123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42350 35440 34142 gene locus_tag LOCUS_42360 35440 34142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42360 37056 35500 gene locus_tag LOCUS_42370 37056 35500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42370 37125 38285 gene locus_tag LOCUS_42380 37125 38285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42380 38651 38316 gene locus_tag LOCUS_42390 38651 38316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42390 39828 39280 gene locus_tag LOCUS_42400 39828 39280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42400 41318 39921 gene locus_tag LOCUS_42410 41318 39921 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229605.1 protein_id gnl|my_center|LOCUS_42410 41513 42160 gene locus_tag LOCUS_42420 41513 42160 CDS product HNH endonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109036339.1 protein_id gnl|my_center|LOCUS_42420 42321 42650 gene locus_tag LOCUS_42430 42321 42650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42430 42750 43817 gene locus_tag LOCUS_42440 42750 43817 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227082.1 protein_id gnl|my_center|LOCUS_42440 44970 43825 gene locus_tag LOCUS_42450 44970 43825 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900145.1 protein_id gnl|my_center|LOCUS_42450 45072 46544 gene locus_tag LOCUS_42460 45072 46544 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230391.1 protein_id gnl|my_center|LOCUS_42460 48096 47254 gene locus_tag LOCUS_42470 48096 47254 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416074.1 protein_id gnl|my_center|LOCUS_42470 49646 48093 gene locus_tag LOCUS_42480 49646 48093 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028809.1 protein_id gnl|my_center|LOCUS_42480 49687 50337 gene locus_tag LOCUS_42490 49687 50337 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164275233.1 protein_id gnl|my_center|LOCUS_42490 50348 50788 gene locus_tag LOCUS_42500 50348 50788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42500 51852 50860 gene locus_tag LOCUS_42510 51852 50860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42510 53874 51982 gene locus_tag LOCUS_42520 53874 51982 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228518.1 protein_id gnl|my_center|LOCUS_42520 55769 53922 gene locus_tag LOCUS_42530 55769 53922 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730236.1 protein_id gnl|my_center|LOCUS_42530 57107 55875 gene locus_tag LOCUS_42540 gene rocD 57107 55875 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977608.1 protein_id gnl|my_center|LOCUS_42540 58235 57270 gene locus_tag LOCUS_42550 58235 57270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42550 58288 59139 gene locus_tag LOCUS_42560 58288 59139 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804145.1 protein_id gnl|my_center|LOCUS_42560 59917 59129 gene locus_tag LOCUS_42570 59917 59129 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977803.1 protein_id gnl|my_center|LOCUS_42570 60149 61525 gene locus_tag LOCUS_42580 60149 61525 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225936.1 protein_id gnl|my_center|LOCUS_42580 61621 62598 gene locus_tag LOCUS_42590 61621 62598 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225935.1 protein_id gnl|my_center|LOCUS_42590 62595 63509 gene locus_tag LOCUS_42600 62595 63509 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225934.1 protein_id gnl|my_center|LOCUS_42600 63506 65551 gene locus_tag LOCUS_42610 63506 65551 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031640.1 protein_id gnl|my_center|LOCUS_42610 66971 65562 gene locus_tag LOCUS_42620 66971 65562 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029388.1 protein_id gnl|my_center|LOCUS_42620 67725 66991 gene locus_tag LOCUS_42630 67725 66991 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863629.1 protein_id gnl|my_center|LOCUS_42630 68612 67773 gene locus_tag LOCUS_42640 68612 67773 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204082927.1 protein_id gnl|my_center|LOCUS_42640 68640 69017 gene locus_tag LOCUS_42650 68640 69017 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060666.1 protein_id gnl|my_center|LOCUS_42650 69074 69589 gene locus_tag LOCUS_42660 69074 69589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42660 71194 69644 gene locus_tag LOCUS_42670 71194 69644 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728639.1 protein_id gnl|my_center|LOCUS_42670 72366 71260 gene locus_tag LOCUS_42680 72366 71260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123815508.1 protein_id gnl|my_center|LOCUS_42680 73573 72377 gene locus_tag LOCUS_42690 73573 72377 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337358.1 protein_id gnl|my_center|LOCUS_42690 73682 77542 gene locus_tag LOCUS_42700 gene hrpA 73682 77542 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029425.1 protein_id gnl|my_center|LOCUS_42700 77563 78177 gene locus_tag LOCUS_42710 77563 78177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804371.1 protein_id gnl|my_center|LOCUS_42710 78852 78295 gene locus_tag LOCUS_42720 78852 78295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42720 79793 79005 gene locus_tag LOCUS_42730 79793 79005 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803735.1 protein_id gnl|my_center|LOCUS_42730 80526 79912 gene locus_tag LOCUS_42740 80526 79912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42740 80988 82364 gene locus_tag LOCUS_42750 80988 82364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42750 83752 82313 gene locus_tag LOCUS_42760 83752 82313 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224510.1 protein_id gnl|my_center|LOCUS_42760 84357 83749 gene locus_tag LOCUS_42770 84357 83749 CDS product DUF3000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030605.1 protein_id gnl|my_center|LOCUS_42770 84428 85480 gene locus_tag LOCUS_42780 gene hemE 84428 85480 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972892.1 protein_id gnl|my_center|LOCUS_42780 85477 86787 gene locus_tag LOCUS_42790 85477 86787 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878613.1 protein_id gnl|my_center|LOCUS_42790 87917 86955 gene locus_tag LOCUS_42800 87917 86955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42800 88722 87973 gene locus_tag LOCUS_42810 88722 87973 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937402.1 protein_id gnl|my_center|LOCUS_42810 88940 88761 gene locus_tag LOCUS_42820 88940 88761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42820 89094 90239 gene locus_tag LOCUS_42830 89094 90239 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226848.1 protein_id gnl|my_center|LOCUS_42830 90236 90766 gene locus_tag LOCUS_42840 90236 90766 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728592.1 protein_id gnl|my_center|LOCUS_42840 90763 91305 gene locus_tag LOCUS_42850 90763 91305 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079914.1 protein_id gnl|my_center|LOCUS_42850 91939 91310 gene locus_tag LOCUS_42860 91939 91310 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974767.1 protein_id gnl|my_center|LOCUS_42860 92578 92012 gene locus_tag LOCUS_42870 92578 92012 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977736.1 protein_id gnl|my_center|LOCUS_42870 94315 92639 gene locus_tag LOCUS_42880 94315 92639 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014996.1 protein_id gnl|my_center|LOCUS_42880 94809 94420 gene locus_tag LOCUS_42890 94809 94420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42890 94860 96929 gene locus_tag LOCUS_42900 94860 96929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42900 96959 98317 gene locus_tag LOCUS_42910 gene hemG 96959 98317 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224513.1 protein_id gnl|my_center|LOCUS_42910 98439 99161 gene locus_tag LOCUS_42920 98439 99161 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972879.1 protein_id gnl|my_center|LOCUS_42920 99197 99862 gene locus_tag LOCUS_42930 99197 99862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42930 100433 100029 gene locus_tag LOCUS_42940 gene msrB 100433 100029 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972860.1 protein_id gnl|my_center|LOCUS_42940 101732 100506 gene locus_tag LOCUS_42950 101732 100506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_42950 101911 102948 gene locus_tag LOCUS_42960 gene ligD 101911 102948 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972287.1 protein_id gnl|my_center|LOCUS_42960 103153 104262 gene locus_tag LOCUS_42970 103153 104262 CDS product NADPH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416922.1 protein_id gnl|my_center|LOCUS_42970 104310 105536 gene locus_tag LOCUS_42980 104310 105536 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893267.1 protein_id gnl|my_center|LOCUS_42980 105533 105865 gene locus_tag LOCUS_42990 105533 105865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42990 105876 106898 gene locus_tag LOCUS_43000 105876 106898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43000 106895 107944 gene locus_tag LOCUS_43010 106895 107944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43010 109309 108071 gene locus_tag LOCUS_43020 109309 108071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43020 110373 109390 gene locus_tag LOCUS_43030 110373 109390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43030 110530 111531 gene locus_tag LOCUS_43040 110530 111531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43040 114218 111528 gene locus_tag LOCUS_43050 114218 111528 CDS product stealth conserved region 3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028443.1 protein_id gnl|my_center|LOCUS_43050 114922 114215 gene locus_tag LOCUS_43060 114922 114215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43060 117676 114923 gene locus_tag LOCUS_43070 117676 114923 CDS product stealth conserved region 3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028443.1 protein_id gnl|my_center|LOCUS_43070 118371 117673 gene locus_tag LOCUS_43080 118371 117673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43080 118929 118390 gene locus_tag LOCUS_43090 118929 118390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43090 120068 118929 gene locus_tag LOCUS_43100 120068 118929 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005121850.1 protein_id gnl|my_center|LOCUS_43100 119977 120192 gene locus_tag LOCUS_43110 119977 120192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43110 120342 121382 gene locus_tag LOCUS_43120 gene pstC 120342 121382 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227474.1 protein_id gnl|my_center|LOCUS_43120 121379 122497 gene locus_tag LOCUS_43130 gene pstA 121379 122497 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227473.1 protein_id gnl|my_center|LOCUS_43130 122494 124254 gene locus_tag LOCUS_43140 122494 124254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43140 124251 127088 gene locus_tag LOCUS_43150 124251 127088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227471.1 protein_id gnl|my_center|LOCUS_43150 127094 127996 gene locus_tag LOCUS_43160 127094 127996 CDS product sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227465.1 protein_id gnl|my_center|LOCUS_43160 128076 129371 gene locus_tag LOCUS_43170 128076 129371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43170 129397 130077 gene locus_tag LOCUS_43180 129397 130077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43180 130126 131367 gene locus_tag LOCUS_43190 130126 131367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43190 131489 132346 gene locus_tag LOCUS_43200 131489 132346 CDS product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876233.1 protein_id gnl|my_center|LOCUS_43200 132505 133266 gene locus_tag LOCUS_43210 132505 133266 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879184.1 protein_id gnl|my_center|LOCUS_43210 133818 133279 gene locus_tag LOCUS_43220 133818 133279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43220 133799 134230 gene locus_tag LOCUS_43230 133799 134230 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930108.1 protein_id gnl|my_center|LOCUS_43230 134263 135855 gene locus_tag LOCUS_43240 134263 135855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43240 135852 136103 gene locus_tag LOCUS_43250 135852 136103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43250 136135 136214 gene locus_tag LOCUS_t00440 136135 136214 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 136365 138047 gene locus_tag LOCUS_43260 136365 138047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43260 138624 138190 gene locus_tag LOCUS_43270 138624 138190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43270 140803 138716 gene locus_tag LOCUS_43280 140803 138716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43280 141027 142496 gene locus_tag LOCUS_43290 gene glmU 141027 142496 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929929.1 protein_id gnl|my_center|LOCUS_43290 142493 143473 gene locus_tag LOCUS_43300 142493 143473 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975691.1 protein_id gnl|my_center|LOCUS_43300 146062 143627 gene locus_tag LOCUS_43310 gene pepN 146062 143627 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283751.1 protein_id gnl|my_center|LOCUS_43310 146254 146925 gene locus_tag LOCUS_43320 146254 146925 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405254.1 protein_id gnl|my_center|LOCUS_43320 146922 147590 gene locus_tag LOCUS_43330 gene pth 146922 147590 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975689.1 protein_id gnl|my_center|LOCUS_43330 148677 147580 gene locus_tag LOCUS_43340 148677 147580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43340 150068 148725 gene locus_tag LOCUS_43350 150068 148725 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227654.1 protein_id gnl|my_center|LOCUS_43350 150351 150707 gene locus_tag LOCUS_43360 150351 150707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43360 151376 150867 gene locus_tag LOCUS_43370 151376 150867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43370 152821 151715 gene locus_tag LOCUS_43380 152821 151715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43380 152878 153672 gene locus_tag LOCUS_43390 152878 153672 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730227.1 protein_id gnl|my_center|LOCUS_43390 153690 154307 gene locus_tag LOCUS_43400 153690 154307 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031285.1 protein_id gnl|my_center|LOCUS_43400 154304 154699 gene locus_tag LOCUS_43410 154304 154699 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223630.1 protein_id gnl|my_center|LOCUS_43410 155625 154711 gene locus_tag LOCUS_43420 155625 154711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43420 155920 155666 gene locus_tag LOCUS_43430 155920 155666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43430 156926 156072 gene locus_tag LOCUS_43440 156926 156072 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974609.1 protein_id gnl|my_center|LOCUS_43440 157005 157460 gene locus_tag LOCUS_43450 157005 157460 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045629.1 protein_id gnl|my_center|LOCUS_43450 157564 159384 gene locus_tag LOCUS_43460 gene ilvD 157564 159384 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726760.1 protein_id gnl|my_center|LOCUS_43460 159587 160387 gene locus_tag LOCUS_43470 159587 160387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43470 161636 160446 gene locus_tag LOCUS_43480 161636 160446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43480 163512 161980 gene locus_tag LOCUS_43490 163512 161980 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731375.1 protein_id gnl|my_center|LOCUS_43490 163635 164984 gene locus_tag LOCUS_43500 163635 164984 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228178.1 protein_id gnl|my_center|LOCUS_43500 164977 166206 gene locus_tag LOCUS_43510 164977 166206 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014146.1 protein_id gnl|my_center|LOCUS_43510 166219 167238 gene locus_tag LOCUS_43520 166219 167238 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289537.1 protein_id gnl|my_center|LOCUS_43520 167235 168470 gene locus_tag LOCUS_43530 167235 168470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43530 170643 168439 gene locus_tag LOCUS_43540 170643 168439 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039318110.1 protein_id gnl|my_center|LOCUS_43540 170989 170636 gene locus_tag LOCUS_43550 170989 170636 CDS product UBP-type zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971845.1 protein_id gnl|my_center|LOCUS_43550 171633 170986 gene locus_tag LOCUS_43560 171633 170986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43560 171876 172607 gene locus_tag LOCUS_43570 171876 172607 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728478.1 protein_id gnl|my_center|LOCUS_43570 172591 173277 gene locus_tag LOCUS_43580 172591 173277 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728478.1 protein_id gnl|my_center|LOCUS_43580 173971 173240 gene locus_tag LOCUS_43590 173971 173240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43590 174252 175991 gene locus_tag LOCUS_43600 174252 175991 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973484.1 protein_id gnl|my_center|LOCUS_43600 176008 176550 gene locus_tag LOCUS_43610 gene ilvN 176008 176550 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973483.1 protein_id gnl|my_center|LOCUS_43610 176605 177630 gene locus_tag LOCUS_43620 gene ilvC 176605 177630 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775904.1 protein_id gnl|my_center|LOCUS_43620 178598 177783 gene locus_tag LOCUS_43630 178598 177783 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086413.1 protein_id gnl|my_center|LOCUS_43630 179491 178595 gene locus_tag LOCUS_43640 179491 178595 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776493.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_43640 179834 181951 gene locus_tag LOCUS_43650 179834 181951 CDS product SGNH hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235624217.1 protein_id gnl|my_center|LOCUS_43650 181979 182890 gene locus_tag LOCUS_43660 181979 182890 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976536.1 protein_id gnl|my_center|LOCUS_43660 182942 184108 gene locus_tag LOCUS_43670 182942 184108 CDS product peptidase M75 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229934.1 protein_id gnl|my_center|LOCUS_43670 184114 185349 gene locus_tag LOCUS_43680 gene efeB 184114 185349 CDS product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229935.1 protein_id gnl|my_center|LOCUS_43680 185460 185912 gene locus_tag LOCUS_43690 185460 185912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43690 186246 185962 gene locus_tag LOCUS_43700 186246 185962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43700 187947 186349 gene locus_tag LOCUS_43710 187947 186349 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085191.1 protein_id gnl|my_center|LOCUS_43710 188172 189770 gene locus_tag LOCUS_43720 gene serA 188172 189770 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973481.1 protein_id gnl|my_center|LOCUS_43720 191354 189903 gene locus_tag LOCUS_43730 191354 189903 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878083.1 protein_id gnl|my_center|LOCUS_43730 191408 192079 gene locus_tag LOCUS_43740 191408 192079 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893694.1 protein_id gnl|my_center|LOCUS_43740 192174 192440 gene locus_tag LOCUS_43750 192174 192440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43750 192536 193789 gene locus_tag LOCUS_43760 192536 193789 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479620.1 protein_id gnl|my_center|LOCUS_43760 193899 194327 gene locus_tag LOCUS_43770 193899 194327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43770 194395 195909 gene locus_tag LOCUS_43780 194395 195909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43780 195906 197195 gene locus_tag LOCUS_43790 195906 197195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43790 197192 198124 gene locus_tag LOCUS_43800 197192 198124 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222295.1 protein_id gnl|my_center|LOCUS_43800 198132 199256 gene locus_tag LOCUS_43810 198132 199256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43810 199253 201637 gene locus_tag LOCUS_43820 199253 201637 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014868643.1 protein_id gnl|my_center|LOCUS_43820 201720 202853 gene locus_tag LOCUS_43830 201720 202853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_43830 202846 204126 gene locus_tag LOCUS_43840 202846 204126 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484988.1 protein_id gnl|my_center|LOCUS_43840 204123 204863 gene locus_tag LOCUS_43850 204123 204863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43850 205603 205010 gene locus_tag LOCUS_43860 205603 205010 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974472.1 protein_id gnl|my_center|LOCUS_43860 205850 206110 gene locus_tag LOCUS_43870 205850 206110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43870 206177 207226 gene locus_tag LOCUS_43880 206177 207226 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030290.1 protein_id gnl|my_center|LOCUS_43880 207391 208473 gene locus_tag LOCUS_43890 207391 208473 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036086.1 protein_id gnl|my_center|LOCUS_43890 208544 209464 gene locus_tag LOCUS_43900 208544 209464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43900 209500 211218 gene locus_tag LOCUS_43910 209500 211218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43910 211864 211232 gene locus_tag LOCUS_43920 211864 211232 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227830.1 protein_id gnl|my_center|LOCUS_43920 212122 213717 gene locus_tag LOCUS_43930 gene cimA 212122 213717 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030295.1 protein_id gnl|my_center|LOCUS_43930 214438 213845 gene locus_tag LOCUS_43940 214438 213845 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415984.1 protein_id gnl|my_center|LOCUS_43940 214546 215097 gene locus_tag LOCUS_43950 214546 215097 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893663.1 protein_id gnl|my_center|LOCUS_43950 215133 216569 gene locus_tag LOCUS_43960 215133 216569 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804864.1 protein_id gnl|my_center|LOCUS_43960 216563 217075 gene locus_tag LOCUS_43970 gene aac(2')-Ic 216563 217075 CDS product aminoglycoside N-acetyltransferase AAC(2')-Ic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899880.1 protein_id gnl|my_center|LOCUS_43970 217394 217089 gene locus_tag LOCUS_43980 217394 217089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43980 217418 217804 gene locus_tag LOCUS_43990 217418 217804 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968054.1 protein_id gnl|my_center|LOCUS_43990 217840 218451 gene locus_tag LOCUS_44000 217840 218451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44000 219145 218471 gene locus_tag LOCUS_44010 gene bioD 219145 218471 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027666.1 protein_id gnl|my_center|LOCUS_44010 220278 219142 gene locus_tag LOCUS_44020 220278 219142 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223945.1 protein_id gnl|my_center|LOCUS_44020 221555 220278 gene locus_tag LOCUS_44030 221555 220278 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027665.1 protein_id gnl|my_center|LOCUS_44030 222642 221563 gene locus_tag LOCUS_44040 gene bioB 222642 221563 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027664.1 protein_id gnl|my_center|LOCUS_44040 223309 222707 gene locus_tag LOCUS_44050 223309 222707 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223382.1 protein_id gnl|my_center|LOCUS_44050 223577 223299 gene locus_tag LOCUS_44060 223577 223299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44060 224133 223615 gene locus_tag LOCUS_44070 224133 223615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44070 225005 224133 gene locus_tag LOCUS_44080 225005 224133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226805.1 protein_id gnl|my_center|LOCUS_44080 225067 225876 gene locus_tag LOCUS_44090 225067 225876 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775888.1 protein_id gnl|my_center|LOCUS_44090 225873 227348 gene locus_tag LOCUS_44100 gene gltX 225873 227348 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775887.1 protein_id gnl|my_center|LOCUS_44100 227345 228310 gene locus_tag LOCUS_44110 227345 228310 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803896.1 protein_id gnl|my_center|LOCUS_44110 228377 228449 gene locus_tag LOCUS_t00450 228377 228449 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 228527 228600 gene locus_tag LOCUS_t00460 228527 228600 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 230011 228788 gene locus_tag LOCUS_44120 230011 228788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44120 230113 231630 gene locus_tag LOCUS_44130 230113 231630 CDS product AlkA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972517.1 protein_id gnl|my_center|LOCUS_44130 231633 232118 gene locus_tag LOCUS_44140 231633 232118 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030939.1 protein_id gnl|my_center|LOCUS_44140 232205 233131 gene locus_tag LOCUS_44150 232205 233131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44150 >Feature sequence29 447 1148 gene locus_tag LOCUS_44160 gene pdxH 447 1148 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029623.1 protein_id gnl|my_center|LOCUS_44160 1205 2620 gene locus_tag LOCUS_44170 1205 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44170 2675 3790 gene locus_tag LOCUS_44180 gene prfB 2675 3790 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975840.1 protein_id gnl|my_center|LOCUS_44180 4310 6223 gene locus_tag LOCUS_44190 4310 6223 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887578.1 protein_id gnl|my_center|LOCUS_44190 6873 6232 gene locus_tag LOCUS_44200 6873 6232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44200 6976 7641 gene locus_tag LOCUS_44210 gene ftsE 6976 7641 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975843.1 protein_id gnl|my_center|LOCUS_44210 7706 8626 gene locus_tag LOCUS_44220 gene ftsX 7706 8626 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975844.1 protein_id gnl|my_center|LOCUS_44220 8694 9956 gene locus_tag LOCUS_44230 8694 9956 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776047.1 protein_id gnl|my_center|LOCUS_44230 10000 10479 gene locus_tag LOCUS_44240 gene smpB 10000 10479 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975846.1 protein_id gnl|my_center|LOCUS_44240 10472 11380 gene locus_tag LOCUS_44250 10472 11380 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029384.1 protein_id gnl|my_center|LOCUS_44250 11417 12547 gene locus_tag LOCUS_44260 11417 12547 CDS product EstA family serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895366.1 protein_id gnl|my_center|LOCUS_44260 13341 12508 gene locus_tag LOCUS_44270 13341 12508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44270 14161 13409 gene locus_tag LOCUS_44280 14161 13409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44280 14261 14631 gene locus_tag LOCUS_tm00010 14261 14631 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 14773 16311 gene locus_tag LOCUS_44290 14773 16311 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067284407.1 protein_id gnl|my_center|LOCUS_44290 17801 16308 gene locus_tag LOCUS_44300 17801 16308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44300 19308 17944 gene locus_tag LOCUS_44310 19308 17944 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396358.1 protein_id gnl|my_center|LOCUS_44310 19374 20810 gene locus_tag LOCUS_44320 19374 20810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44320 21616 20837 gene locus_tag LOCUS_44330 21616 20837 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227890.1 protein_id gnl|my_center|LOCUS_44330 21876 22673 gene locus_tag LOCUS_44340 21876 22673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44340 22710 23111 gene locus_tag LOCUS_44350 22710 23111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44350 23200 24336 gene locus_tag LOCUS_44360 23200 24336 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102904.1 protein_id gnl|my_center|LOCUS_44360 24366 24779 gene locus_tag LOCUS_44370 24366 24779 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730267.1 protein_id gnl|my_center|LOCUS_44370 24957 25724 gene locus_tag LOCUS_44380 gene fabG 24957 25724 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225006.1 protein_id gnl|my_center|LOCUS_44380 26001 27023 gene locus_tag LOCUS_44390 26001 27023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44390 27761 27048 gene locus_tag LOCUS_44400 27761 27048 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095816.1 protein_id gnl|my_center|LOCUS_44400 27969 28526 gene locus_tag LOCUS_44410 27969 28526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44410 28591 29145 gene locus_tag LOCUS_44420 28591 29145 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865482.1 protein_id gnl|my_center|LOCUS_44420 29251 29376 gene locus_tag LOCUS_44430 29251 29376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44430 29373 30176 gene locus_tag LOCUS_44440 29373 30176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44440 30187 30456 gene locus_tag LOCUS_44450 30187 30456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44450 30453 32234 gene locus_tag LOCUS_44460 30453 32234 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929967.1 protein_id gnl|my_center|LOCUS_44460 32289 33776 gene locus_tag LOCUS_44470 32289 33776 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975618.1 protein_id gnl|my_center|LOCUS_44470 34321 33824 gene locus_tag LOCUS_44480 34321 33824 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083753.1 protein_id gnl|my_center|LOCUS_44480 34370 34825 gene locus_tag LOCUS_44490 34370 34825 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084025.1 protein_id gnl|my_center|LOCUS_44490 35345 34851 gene locus_tag LOCUS_44500 35345 34851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44500 37935 35362 gene locus_tag LOCUS_44510 37935 35362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44510 38221 39666 gene locus_tag LOCUS_44520 38221 39666 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225993.1 protein_id gnl|my_center|LOCUS_44520 39778 41235 gene locus_tag LOCUS_44530 39778 41235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44530 42940 41345 gene locus_tag LOCUS_44540 42940 41345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44540 43068 43382 gene locus_tag LOCUS_44550 43068 43382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44550 44104 46011 gene locus_tag LOCUS_44560 44104 46011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44560 46740 46021 gene locus_tag LOCUS_44570 46740 46021 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973759.1 protein_id gnl|my_center|LOCUS_44570 47224 46766 gene locus_tag LOCUS_44580 47224 46766 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028667.1 protein_id gnl|my_center|LOCUS_44580 47271 48500 gene locus_tag LOCUS_44590 gene hppD 47271 48500 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229829.1 protein_id gnl|my_center|LOCUS_44590 49373 48669 gene locus_tag LOCUS_44600 49373 48669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44600 50889 49627 gene locus_tag LOCUS_44610 50889 49627 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729861.1 protein_id gnl|my_center|LOCUS_44610 51329 50886 gene locus_tag LOCUS_44620 51329 50886 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878047.1 protein_id gnl|my_center|LOCUS_44620 51393 53402 gene locus_tag LOCUS_44630 51393 53402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44630 55280 53403 gene locus_tag LOCUS_44640 55280 53403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44640 55371 55910 gene locus_tag LOCUS_44650 55371 55910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44650 56698 55919 gene locus_tag LOCUS_44660 56698 55919 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896587.1 protein_id gnl|my_center|LOCUS_44660 56725 57033 gene locus_tag LOCUS_44670 gene clpS 56725 57033 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030180153.1 protein_id gnl|my_center|LOCUS_44670 57045 57626 gene locus_tag LOCUS_44680 57045 57626 CDS product DUF2017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975896.1 protein_id gnl|my_center|LOCUS_44680 57709 58143 gene locus_tag LOCUS_44690 57709 58143 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028660.1 protein_id gnl|my_center|LOCUS_44690 58155 58445 gene locus_tag LOCUS_44700 58155 58445 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975899.1 protein_id gnl|my_center|LOCUS_44700 59157 58480 gene locus_tag LOCUS_44710 59157 58480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44710 59362 59931 gene locus_tag LOCUS_44720 59362 59931 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777132.1 protein_id gnl|my_center|LOCUS_44720 59940 60689 gene locus_tag LOCUS_44730 59940 60689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44730 60743 61690 gene locus_tag LOCUS_44740 60743 61690 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975900.1 protein_id gnl|my_center|LOCUS_44740 61731 61970 gene locus_tag LOCUS_44750 61731 61970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44750 61975 63090 gene locus_tag LOCUS_44760 61975 63090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44760 64230 63097 gene locus_tag LOCUS_44770 64230 63097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44770 64271 65134 gene locus_tag LOCUS_44780 gene murI 64271 65134 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066567685.1 protein_id gnl|my_center|LOCUS_44780 65131 65898 gene locus_tag LOCUS_44790 65131 65898 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975902.1 protein_id gnl|my_center|LOCUS_44790 66014 66253 gene locus_tag LOCUS_44800 66014 66253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44800 66315 67325 gene locus_tag LOCUS_44810 66315 67325 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776493.1 protein_id gnl|my_center|LOCUS_44810 67322 68173 gene locus_tag LOCUS_44820 67322 68173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44820 68837 68178 gene locus_tag LOCUS_44830 68837 68178 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030771.1 protein_id gnl|my_center|LOCUS_44830 70000 68825 gene locus_tag LOCUS_44840 70000 68825 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030770.1 protein_id gnl|my_center|LOCUS_44840 70096 71043 gene locus_tag LOCUS_44850 70096 71043 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776493.1 protein_id gnl|my_center|LOCUS_44850 71040 71873 gene locus_tag LOCUS_44860 71040 71873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44860 71893 72381 gene locus_tag LOCUS_44870 71893 72381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44870 72548 73276 gene locus_tag LOCUS_44880 gene rph 72548 73276 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776022.1 protein_id gnl|my_center|LOCUS_44880 73280 73885 gene locus_tag LOCUS_44890 gene rdgB 73280 73885 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229451.1 protein_id gnl|my_center|LOCUS_44890 73986 73903 gene locus_tag LOCUS_t00470 73986 73903 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 74590 74015 gene locus_tag LOCUS_44900 gene bcp 74590 74015 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730061.1 protein_id gnl|my_center|LOCUS_44900 74652 75344 gene locus_tag LOCUS_44910 74652 75344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44910 75341 75670 gene locus_tag LOCUS_44920 75341 75670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44920 75681 76349 gene locus_tag LOCUS_44930 gene cbiQ 75681 76349 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975656.1 protein_id gnl|my_center|LOCUS_44930 76346 77140 gene locus_tag LOCUS_44940 76346 77140 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028802.1 protein_id gnl|my_center|LOCUS_44940 77137 77385 gene locus_tag LOCUS_44950 77137 77385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44950 77407 77730 gene locus_tag LOCUS_44960 77407 77730 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975911.1 protein_id gnl|my_center|LOCUS_44960 77747 78355 gene locus_tag LOCUS_44970 77747 78355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44970 79931 78666 gene locus_tag LOCUS_44980 79931 78666 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074038115.1 protein_id gnl|my_center|LOCUS_44980 80545 80114 gene locus_tag LOCUS_44990 80545 80114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44990 81095 80844 gene locus_tag LOCUS_45000 81095 80844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45000 81313 81092 gene locus_tag LOCUS_45010 81313 81092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45010 81935 81366 gene locus_tag LOCUS_45020 81935 81366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45020 84929 82119 gene locus_tag LOCUS_45030 84929 82119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45030 85897 85370 gene locus_tag LOCUS_45040 85897 85370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45040 87111 85933 gene locus_tag LOCUS_45050 87111 85933 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403911.1 protein_id gnl|my_center|LOCUS_45050 87304 87936 gene locus_tag LOCUS_45060 87304 87936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45060 88503 87949 gene locus_tag LOCUS_45070 88503 87949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45070 89619 88552 gene locus_tag LOCUS_45080 89619 88552 CDS product BtrH N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110591.1 protein_id gnl|my_center|LOCUS_45080 90358 89675 gene locus_tag LOCUS_45090 90358 89675 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110587.1 protein_id gnl|my_center|LOCUS_45090 91706 90504 gene locus_tag LOCUS_45100 91706 90504 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086617.1 protein_id gnl|my_center|LOCUS_45100 93102 91711 gene locus_tag LOCUS_45110 93102 91711 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086616.1 protein_id gnl|my_center|LOCUS_45110 93438 93118 gene locus_tag LOCUS_45120 93438 93118 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086615.1 protein_id gnl|my_center|LOCUS_45120 93552 94571 gene locus_tag LOCUS_45130 93552 94571 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086614.1 protein_id gnl|my_center|LOCUS_45130 94957 94769 gene locus_tag LOCUS_45140 94957 94769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_45140 95584 96540 gene locus_tag LOCUS_45150 95584 96540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45150 97750 97082 gene locus_tag LOCUS_45160 97750 97082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45160 98718 99947 gene locus_tag LOCUS_45170 98718 99947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45170 100085 100010 gene locus_tag LOCUS_t00480 100085 100010 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 103837 100166 gene locus_tag LOCUS_45180 103837 100166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45180 105531 103936 gene locus_tag LOCUS_45190 105531 103936 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162483874.1 protein_id gnl|my_center|LOCUS_45190 105582 107753 gene locus_tag LOCUS_45200 105582 107753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45200 107789 108736 gene locus_tag LOCUS_45210 107789 108736 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975143.1 protein_id gnl|my_center|LOCUS_45210 108799 110637 gene locus_tag LOCUS_45220 108799 110637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45220 111000 110650 gene locus_tag LOCUS_45230 111000 110650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45230 113146 111203 gene locus_tag LOCUS_45240 113146 111203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45240 113637 113143 gene locus_tag LOCUS_45250 113637 113143 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084983.1 protein_id gnl|my_center|LOCUS_45250 115940 113634 gene locus_tag LOCUS_45260 115940 113634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45260 116268 116029 gene locus_tag LOCUS_45270 116268 116029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45270 116811 116323 gene locus_tag LOCUS_45280 116811 116323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45280 117698 116808 gene locus_tag LOCUS_45290 gene flgL 117698 116808 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460796.1 protein_id gnl|my_center|LOCUS_45290 119098 117698 gene locus_tag LOCUS_45300 gene flgK 119098 117698 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392267.1 protein_id gnl|my_center|LOCUS_45300 119580 119101 gene locus_tag LOCUS_45310 119580 119101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45310 119930 120799 gene locus_tag LOCUS_45320 119930 120799 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037072.1 protein_id gnl|my_center|LOCUS_45320 121014 122141 gene locus_tag LOCUS_45330 121014 122141 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392281.1 protein_id gnl|my_center|LOCUS_45330 122248 123579 gene locus_tag LOCUS_45340 gene fliD 122248 123579 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943664.1 protein_id gnl|my_center|LOCUS_45340 123785 124126 gene locus_tag LOCUS_45350 123785 124126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45350 124123 124476 gene locus_tag LOCUS_45360 124123 124476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45360 125688 124633 gene locus_tag LOCUS_45370 125688 124633 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037036.1 protein_id gnl|my_center|LOCUS_45370 125790 126692 gene locus_tag LOCUS_45380 125790 126692 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083222.1 protein_id gnl|my_center|LOCUS_45380 126694 127077 gene locus_tag LOCUS_45390 126694 127077 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007600538.1 protein_id gnl|my_center|LOCUS_45390 127074 127553 gene locus_tag LOCUS_45400 127074 127553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45400 127550 127915 gene locus_tag LOCUS_45410 127550 127915 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941071.1 protein_id gnl|my_center|LOCUS_45410 127915 128403 gene locus_tag LOCUS_45420 127915 128403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45420 128565 128939 gene locus_tag LOCUS_45430 gene flgB 128565 128939 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665200.1 protein_id gnl|my_center|LOCUS_45430 128939 129328 gene locus_tag LOCUS_45440 gene flgC 128939 129328 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073132.1 protein_id gnl|my_center|LOCUS_45440 129328 129651 gene locus_tag LOCUS_45450 129328 129651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45450 129651 131252 gene locus_tag LOCUS_45460 gene fliF 129651 131252 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870079.1 protein_id gnl|my_center|LOCUS_45460 131254 132279 gene locus_tag LOCUS_45470 gene fliG 131254 132279 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556889.1 protein_id gnl|my_center|LOCUS_45470 132263 132994 gene locus_tag LOCUS_45480 132263 132994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45480 132991 134340 gene locus_tag LOCUS_45490 gene fliI 132991 134340 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392295.1 protein_id gnl|my_center|LOCUS_45490 134337 134861 gene locus_tag LOCUS_45500 134337 134861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45500 134858 135856 gene locus_tag LOCUS_45510 134858 135856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45510 135853 137133 gene locus_tag LOCUS_45520 135853 137133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45520 137144 137644 gene locus_tag LOCUS_45530 137144 137644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45530 137729 138583 gene locus_tag LOCUS_45540 137729 138583 CDS product flagellar hook-basal body complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392300.1 protein_id gnl|my_center|LOCUS_45540 138720 139040 gene locus_tag LOCUS_45550 138720 139040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45550 139037 139810 gene locus_tag LOCUS_45560 139037 139810 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460801.1 protein_id gnl|my_center|LOCUS_45560 139820 140815 gene locus_tag LOCUS_45570 139820 140815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45570 140812 141252 gene locus_tag LOCUS_45580 140812 141252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45580 141366 142325 gene locus_tag LOCUS_45590 gene fliM 141366 142325 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666990.1 protein_id gnl|my_center|LOCUS_45590 142322 143200 gene locus_tag LOCUS_45600 142322 143200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45600 143202 143747 gene locus_tag LOCUS_45610 143202 143747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45610 143744 144673 gene locus_tag LOCUS_45620 143744 144673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45620 144689 144958 gene locus_tag LOCUS_45630 gene fliQ 144689 144958 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359192.1 protein_id gnl|my_center|LOCUS_45630 144972 145742 gene locus_tag LOCUS_45640 gene fliR 144972 145742 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039843.1 protein_id gnl|my_center|LOCUS_45640 145739 146872 gene locus_tag LOCUS_45650 gene flhB 145739 146872 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063731.1 protein_id gnl|my_center|LOCUS_45650 146988 149063 gene locus_tag LOCUS_45660 gene flhA 146988 149063 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392311.1 protein_id gnl|my_center|LOCUS_45660 149060 149341 gene locus_tag LOCUS_45670 149060 149341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45670 151565 149394 gene locus_tag LOCUS_45680 151565 149394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45680 151953 153605 gene locus_tag LOCUS_45690 151953 153605 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804144.1 protein_id gnl|my_center|LOCUS_45690 153723 153648 gene locus_tag LOCUS_t00490 153723 153648 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 154457 153774 gene locus_tag LOCUS_45700 gene orn 154457 153774 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976007.1 protein_id gnl|my_center|LOCUS_45700 154534 155076 gene locus_tag LOCUS_45710 154534 155076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45710 155076 155792 gene locus_tag LOCUS_45720 155076 155792 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715374.1 protein_id gnl|my_center|LOCUS_45720 155823 156854 gene locus_tag LOCUS_45730 155823 156854 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030372.1 protein_id gnl|my_center|LOCUS_45730 157117 157680 gene locus_tag LOCUS_45740 157117 157680 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814509.1 protein_id gnl|my_center|LOCUS_45740 157840 158250 gene locus_tag LOCUS_45750 157840 158250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45750 158803 158345 gene locus_tag LOCUS_45760 158803 158345 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726821.1 protein_id gnl|my_center|LOCUS_45760 158899 159291 gene locus_tag LOCUS_45770 158899 159291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45770 159293 160036 gene locus_tag LOCUS_45780 159293 160036 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030439798.1 protein_id gnl|my_center|LOCUS_45780 160322 160396 gene locus_tag LOCUS_t00500 160322 160396 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 161244 160432 gene locus_tag LOCUS_45790 161244 160432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45790 162788 161274 gene locus_tag LOCUS_45800 162788 161274 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930178.1 protein_id gnl|my_center|LOCUS_45800 162787 163908 gene locus_tag LOCUS_45810 162787 163908 CDS product PrsW family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230460.1 protein_id gnl|my_center|LOCUS_45810 163905 165686 gene locus_tag LOCUS_45820 163905 165686 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073255020.1 protein_id gnl|my_center|LOCUS_45820 165683 167353 gene locus_tag LOCUS_45830 165683 167353 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776426.1 protein_id gnl|my_center|LOCUS_45830 167359 167838 gene locus_tag LOCUS_45840 167359 167838 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223540.1 protein_id gnl|my_center|LOCUS_45840 167985 168389 gene locus_tag LOCUS_45850 167985 168389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45850 168469 170151 gene locus_tag LOCUS_45860 gene ettA 168469 170151 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084843.1 protein_id gnl|my_center|LOCUS_45860 170827 170162 gene locus_tag LOCUS_45870 170827 170162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45870 171320 170919 gene locus_tag LOCUS_45880 171320 170919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45880 171208 171747 gene locus_tag LOCUS_45890 171208 171747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45890 172091 171744 gene locus_tag LOCUS_45900 172091 171744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45900 171978 172361 gene locus_tag LOCUS_45910 171978 172361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45910 172918 172421 gene locus_tag LOCUS_45920 172918 172421 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742106.1 protein_id gnl|my_center|LOCUS_45920 174179 172965 gene locus_tag LOCUS_45930 174179 172965 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229842.1 protein_id gnl|my_center|LOCUS_45930 174287 175159 gene locus_tag LOCUS_45940 174287 175159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45940 175559 175143 gene locus_tag LOCUS_45950 175559 175143 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028501.1 protein_id gnl|my_center|LOCUS_45950 176566 175559 gene locus_tag LOCUS_45960 176566 175559 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978023.1 protein_id gnl|my_center|LOCUS_45960 176627 177019 gene locus_tag LOCUS_45970 176627 177019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45970 177006 177389 gene locus_tag LOCUS_45980 177006 177389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45980 180106 177551 gene locus_tag LOCUS_45990 gene pepN 180106 177551 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028475.1 protein_id gnl|my_center|LOCUS_45990 180278 181936 gene locus_tag LOCUS_46000 180278 181936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46000 181996 182628 gene locus_tag LOCUS_46010 181996 182628 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730011.1 protein_id gnl|my_center|LOCUS_46010 182678 183817 gene locus_tag LOCUS_46020 182678 183817 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028730.1 protein_id gnl|my_center|LOCUS_46020 183827 184723 gene locus_tag LOCUS_46030 183827 184723 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027526.1 protein_id gnl|my_center|LOCUS_46030 184733 186529 gene locus_tag LOCUS_46040 gene metG 184733 186529 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775786.1 protein_id gnl|my_center|LOCUS_46040 186526 187290 gene locus_tag LOCUS_46050 186526 187290 CDS product DUF3626 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226733.1 protein_id gnl|my_center|LOCUS_46050 187287 187898 gene locus_tag LOCUS_46060 187287 187898 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532395.1 protein_id gnl|my_center|LOCUS_46060 187931 188497 gene locus_tag LOCUS_46070 187931 188497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46070 188509 189432 gene locus_tag LOCUS_46080 188509 189432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46080 190502 189429 gene locus_tag LOCUS_46090 190502 189429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46090 190746 190516 gene locus_tag LOCUS_46100 190746 190516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46100 190805 191317 gene locus_tag LOCUS_46110 190805 191317 CDS product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666673.1 protein_id gnl|my_center|LOCUS_46110 191310 192158 gene locus_tag LOCUS_46120 191310 192158 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228580.1 protein_id gnl|my_center|LOCUS_46120 192205 193311 gene locus_tag LOCUS_46130 192205 193311 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976175.1 protein_id gnl|my_center|LOCUS_46130 193420 193493 gene locus_tag LOCUS_t00510 193420 193493 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 193518 193591 gene locus_tag LOCUS_t00520 193518 193591 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 193649 195067 gene locus_tag LOCUS_46140 gene tig 193649 195067 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976179.1 protein_id gnl|my_center|LOCUS_46140 195176 196837 gene locus_tag LOCUS_46150 195176 196837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46150 197971 196856 gene locus_tag LOCUS_46160 197971 196856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46160