COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..401658 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 288..1217 product VirK family antimicrobial peptide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178741.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS complement(3129..4142) product HoxN/HupN/NixA family nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212234.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS complement(4275..5690) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872343.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS complement(5677..6351) product transcriptional regulator TctD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237936.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 gene tctD CDS 6506..7483 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098088.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS 7498..7929 product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283754.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS 7940..9454 product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382024.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS 9758..10735 product glutarate dioxygenase GlaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993092.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 gene glaH CDS 10761..12029 product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271916.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 gene lhgO CDS 12051..13499 product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176534.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 gene gabD CDS 13514..14797 product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095643.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 gene gabT CDS 14927..16327 product GABA permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531291.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 gene gabP CDS 16369..17046 product DNA-binding transcriptional regulator CsiR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126152.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 gene csiR CDS complement(17068..17517) product potassium binding protein Kbp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522413.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 gene kbp CDS complement(17617..17775) product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000508175.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS 17958..18257 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137417.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS 18267..18794 product rhodanese family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022010.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS 18873..19052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370085.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS complement(19142..19543) product DNA-binding protein StpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051100.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 gene stpA CDS 20036..20215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS 20241..20690 product L-alanine exporter AlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000492647.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 gene alaE CDS complement(20725..21075) product DUF2002 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281304.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS 21237..21563 product DUF883 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519557.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS complement(21647..22981) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138449.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS 23070..23501 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209805.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS 23773..24018 product glutaredoxin-like protein NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028873.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 gene nrdH CDS 24015..24425 product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275403.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 gene nrdI CDS 24425..26542 product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201426.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 gene nrdE CDS 26553..27512 product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777898.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 gene nrdF CDS 27867..29069 product glycine betaine/L-proline ABC transporter ATP-binding protein ProV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985490.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 gene proV CDS 29062..30126 product glycine betaine/L-proline ABC transporter permease ProW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775015.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 gene proW CDS 30196..31191 product glycine betaine/L-proline ABC transporter substrate-binding protein ProX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216613.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 gene proX CDS 31356..32540 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165770.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS 33037..33567 product transcriptional repressor MprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378431.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 gene mprA CDS 33694..34866 product multidrug efflux MFS transporter periplasmic adaptor subunit EmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275597.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 gene emrA CDS 34883..36421 product multidrug efflux MFS transporter permease subunit EmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187289.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 gene emrB CDS complement(36470..37840) product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645128.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS complement(38186..38701) product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130191.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 gene luxS CDS complement(38851..40407) product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611827.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 gene gshA CDS complement(40484..40909) product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279499.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(40906..41472) product fructose-1-phosphate/6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271296.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 gene yqaB tRNA complement(41709..41785) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 tRNA complement(41979..42055) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 tRNA complement(42118..42194) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 tRNA complement(42256..42332) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 tRNA complement(42336..42428) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS complement(42732..42917) product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906486.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 gene csrA CDS complement(43152..45782) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047238.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 gene alaS CDS complement(46018..46518) product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294863.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 gene recX CDS complement(46635..47696) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963150.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 gene recA CDS complement(47781..48278) product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132240.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 gene pncC CDS 48474..48719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS complement(48757..49836) product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476820.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 gene mltB CDS 50090..50653 product PTS glucitol/sorbitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573335.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 gene srlA CDS 50650..51621 product PTS glucitol/sorbitol transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199043.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS 51633..51995 product PTS glucitol/sorbitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111554.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 gene srlB CDS 52007..52786 product sorbitol-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077371.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 gene srlD CDS 52863..53222 product transcriptional regulator GutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255198.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 gene gutM CDS 53420..54193 product glucitol operon DNA-binding transcriptional repressor SrlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804536.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 gene srlR CDS 54186..55151 product arabinose-5-phosphate isomerase GutQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278206.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 gene gutQ CDS complement(55148..56668) product nitric oxide reductase transcriptional regulator NorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010816.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 gene norR CDS 56854..58293 product anaerobic nitric oxide reductase flavorubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025997.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 gene norV CDS 58290..59423 product NADH:flavorubredoxin reductase NorW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086352.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 gene norW CDS complement(59520..61760) product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963417.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 gene hypF CDS complement(61906..62451) product electron transport protein HydN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078791.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 gene hydN CDS complement(62652..62936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00610 note possible pseudo, frameshifted CDS complement(62980..63462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00620 note possible pseudo, frameshifted CDS complement(63489..63959) product hydrogenase maturation peptidase HycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132980.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 gene hycI CDS complement(63952..64362) product formate hydrogenlyase maturation HycH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003725.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS complement(64359..65126) product formate hydrogenlyase subunit HycG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067418.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 gene hycG CDS complement(65126..65668) product formate hydrogenlyase subunit HycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493767.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 gene hycF CDS complement(65678..67387) product formate hydrogenlyase subunit HycE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000461354.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 gene hycE CDS complement(67405..68328) product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110563.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS complement(68331..70157) product formate hydrogenlyase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097032.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 gene hycC CDS complement(70157..70765) product formate hydrogenlyase subunit HycB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079164.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 gene hycB CDS complement(70911..71372) product formate hydrogenlyase regulator HycA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158074.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 gene hycA CDS 71582..71938 product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544461.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 gene hypA CDS 72007..72879 product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337646.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 gene hypB CDS 72870..73142 product hydrogenase 3 maturation protein HypC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334871.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 gene hypC CDS 73142..74263 product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212958.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 gene hypD CDS 74260..75270 product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014343887.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 gene hypE CDS 75489..77567 product formate hydrogenlyase transcriptional activator FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122695.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 gene flhA CDS complement(77629..77973) product nitrous oxide-stimulated promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117938.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS 78155..79072 product iron/manganese ABC transporter substrate-binding protein SitA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182930.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 gene sitA CDS 79069..79890 product iron/manganese ABC transporter ATP-binding protein SitB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083163.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 gene sitB CDS 79887..80747 product iron/manganese ABC transporter permease subunit SitC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104338.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 gene sitC CDS 80738..81586 product iron/manganese ABC transporter permease subunit SitD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477918.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 gene sitD CDS complement(81685..82551) product type III secretion system YopJ family effector YopP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117648.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 gene yopP CDS complement(82754..83509) product transcriptional regulator SprB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246664.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 gene sprB CDS complement(83894..84781) product invasion transcriptional regulator HilC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000243995.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 gene hilC CDS complement(85126..85578) product type III secretion system effector protein OrgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612184.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS complement(85575..86255) product type III secretion system linker protein OrgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916657.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 gene orgB CDS complement(86212..86790) product oxygen-regulated invasion protein OrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001574876.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 gene orgA CDS complement(86783..87541) product type III secretion system inner membrane ring lipoprotein PrgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621241.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 gene prgK CDS complement(87538..87843) product type III secretion system inner rod protein PrgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020428.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 gene prgJ CDS complement(87862..88104) product type III secretion system needle filament protein PrgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143299.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 gene prgI CDS complement(88129..89193) product type III secretion system inner membrane ring protein PrgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450189.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 gene prgH CDS 89623..90552 product transcriptional regulator HilD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432696.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 gene hilD CDS 91710..93305 product transcriptional regulator HilA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120092.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 gene hilA CDS 93404..93805 product SPI-1 type III secretion system invasion protein IagB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558926.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 gene iagB CDS complement(93859..95466) product SPI-1 type III secretion system effector GTPase-activating protein SptP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000946989.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 gene sptP CDS complement(95477..95869) product chaperone SicP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147852.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 gene sicP CDS complement(95896..96156) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692253.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS complement(96200..96448) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055579.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS complement(96467..98479) product SPI-1 type III secretion system effector SipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258814.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 gene sipA CDS complement(98543..99574) product SPI-1 type III secretion system needle tip complex protein SipD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932243.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 gene sipD CDS complement(99645..100874) product SPI-1 type III secretion system needle tip complex protein SipC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000909023.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 gene sipC CDS complement(100902..102683) product SPI-1 type III secretion system needle tip complex protein SipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000245782.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 gene sipB CDS complement(102686..103183) product SycD/LcrH family type III secretion system chaperone SicA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386309.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 gene sicA CDS complement(103321..104391) product SPI-1 type III secretion system export apparatus protein SpaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097721.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 gene spaS CDS complement(104378..105169) product SPI-1 type III secretion system export apparatus protein SpaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964941.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 gene spaR CDS complement(105173..105433) product SPI-1 type III secretion system export apparatus protein SpaQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342503.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 gene spaQ CDS complement(105459..106133) product SPI-1 type III secretion system export apparatus protein SpaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000526019.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 gene spaP CDS complement(106123..107034) product SPI-1 type III secretion system protein SpaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058738.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 gene spaO CDS complement(107034..108044) product SPI-1 type III secretion system protein SpaN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503113.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 gene spaN CDS complement(108044..108487) product SPI-1 type III secretion system protein SpaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000555884.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 gene spaM CDS complement(108465..109760) product SctN family type III secretion system ATPase InvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856766.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 gene invC CDS complement(109757..110164) product SPI-1 type III secretion system chaperone SpaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001164066.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 gene spaK CDS complement(110188..112245) product type III secretion system export apparatus protein InvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000927219.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 gene invA CDS complement(112270..113388) product type III secretion system gatekeeper InvE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612166.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 gene invE CDS complement(113385..114929) product type III secretion system outer membrane ring protein InvG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848103.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 gene invG CDS complement(115070..115831) product type III secretion system transcriptional activator InvF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001674874.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 gene invF CDS 116176..116619 product SPI-1 type III secretion system invasion lipoprotein InvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715096.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 gene invH CDS 117491..117772 product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855694.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS 117772..118296 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971655.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS complement(118369..118545) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS 118933..119589 product protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000420463.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 gene pphB CDS complement(119834..120328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS complement(120355..121023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS complement(121253..121405) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS complement(121597..122007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS 122165..124732 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005807.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 gene mutS CDS complement(124788..125168) product DUF4440 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703291.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS complement(125165..126373) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222405.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS 126482..127393 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216318.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS complement(127435..128931) product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202725.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS complement(128928..129878) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001165737.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS complement(129918..130694) product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136884.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS complement(130699..131337) product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153636.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS complement(131334..132596) product 3-oxo-tetronate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590392.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS complement(132590..133513) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847985.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS 133710..134474 product DNA-binding transcriptional repressor YgbI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613182.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 gene ygbI CDS complement(134493..134897) product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423338.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS 135068..135661 product non-oxidative hydroxyarylic acid decarboxylases subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001764801.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS 135661..137088 product non-oxidative hydroxyarylic acid decarboxylases subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863165.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS 137099..137335 product non-oxidative hydroxyarylic acid decarboxylases subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562964.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS complement(137380..138372) product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081498.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 gene rpoS CDS complement(138435..139289) product murein hydrolase activator NlpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272624.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 gene nlpD CDS 139408..139605 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS complement(139744..140370) product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253542.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS complement(140364..141125) product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221538.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 gene surE CDS complement(141106..142155) product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134253.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 gene truD CDS complement(142152..142631) product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219244.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 gene ispF CDS complement(142631..143341) product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741649.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 gene ispD CDS complement(143360..143671) product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517480.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 gene ftsB CDS complement(143862..144140) product DUF3561 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118109.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS complement(144236..144841) product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173663.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 gene cysC CDS complement(144828..146267) product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092273.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 gene cysN CDS complement(146277..147185) product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372384.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 gene cysD CDS 147436..148482 product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490486.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 repeat_region 148497..149074 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggtttatccccgctggcgcggggaacac CDS complement(149171..149464) product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063176.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 gene cas2e CDS complement(149464..150384) product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144875.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 gene cas1e CDS complement(150381..151031) product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281434.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 gene cas6e CDS complement(151013..151759) product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000085058.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 gene cas5e CDS complement(151770..152828) product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206445.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 gene cas7e CDS complement(152842..153396) product type I-E CRISPR-associated protein Cse2/CasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029331.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 gene casB CDS complement(153393..154949) product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084093.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 gene casA CDS complement(154961..157513) product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233965.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS 158068..159021 product SPI-1 type III secretion system effector SopD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145541.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 gene sopD CDS complement(159109..159843) product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080392.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 gene cysH CDS complement(159945..161657) product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291998.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 gene cysI CDS complement(161657..163456) product NADPH-dependent assimilatory sulfite reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210901.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 gene cysJ CDS 163880..164242 product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108313.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 gene queD CDS complement(164330..165127) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208015.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 repeat_region 165228..165926 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttatccccgctggcgcggggaacac CDS complement(166223..166894) product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199961.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 gene queE CDS complement(167030..168328) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036734.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 gene eno CDS complement(168411..170048) product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210863.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 gene pyrG CDS complement(170276..171076) product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210450.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 gene mazG CDS 171684..172271 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032646.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS 172405..175050 product outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181237660.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS 175063..175836 product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044464.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS 175862..176362 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178263.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS 176377..176847 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832400.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS 176844..177380 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079652.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS 177435..178466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS complement(178816..181050) product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226841.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 gene relA CDS complement(181102..182397) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046844.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 gene rlmD CDS 182455..185211 product two-component sensor histidine kinase BarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186405.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 gene barA CDS complement(185255..186397) product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706477.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS complement(186475..187815) product glucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107119.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 gene gudD CDS complement(187836..189176) product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211809.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(189173..190531) product galactarate/glucarate/glycerate transporter GudP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097011.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 gene gudP CDS 190611..190862 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS complement(191012..191461) product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807735.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS complement(191480..192262) product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000890022.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 gene truC CDS complement(192262..192591) product YqcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207010.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS complement(193203..193748) product SecY-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343990.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 gene syd CDS 193817..194665 product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100463.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 gene queF CDS 194778..196142 product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627966.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 gene ppnN CDS 196707..197996 product HAAAP family serine/threonine permease SdaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859030.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 gene sdaC CDS 198055..199422 product L-serine ammonia-lyase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626388.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 gene sdaB CDS 199592..200347 product flap endonuclease Xni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001532501.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 gene xni CDS complement(200439..201587) product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013573.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 gene fucO CDS complement(201604..202251) product L-fuculose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440828.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 gene fucA CDS 202807..204123 product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528619.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 gene fucP CDS 204155..205930 product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724126.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 gene fucI CDS 206031..207449 product L-fuculokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001763972.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 gene fucK CDS 207451..207873 product L-fucose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920848.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 gene fucU CDS 207931..208641 product L-fucose operon activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642330.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 gene fucR CDS complement(208700..209800) product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045494.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 gene rlmM CDS complement(209793..210194) product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203913.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(210207..211124) product glycine cleavage system transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044409.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 gene gcvA CDS complement(211471..211698) product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750393.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS 211891..213096 product cysteine desulfurase CsdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991058.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 gene csdA CDS 213096..213539 product cysteine desulfurase sulfur acceptor subunit CsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184198.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 gene csdE CDS 214055..214726 product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014343890.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 gene rarD CDS complement(214778..215584) product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117742.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 gene tcdA CDS complement(215694..216791) product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678621.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 gene mltA tRNA 216999..217075 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA 217105..217181 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS complement(217291..218487) product N-acetylmuramoyl-L-alanine amidase AmiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011916.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 gene amiC CDS 218777..220108 product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588970.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 gene argA CDS complement(220211..222046) product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155175.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 gene recD CDS complement(222043..225588) product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000533.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 gene recB CDS complement(225581..228469) product pitrilysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138262.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 gene ptrA CDS complement(228647..232018) product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000946820.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 gene recC CDS complement(232034..232354) product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019280.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS complement(232339..232746) product DUF2509 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078536.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS complement(232743..233306) product prepilin peptidase-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029148.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS complement(233297..233767) product prepilin peptidase-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857051.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS complement(233952..234746) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816222.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 gene thyA CDS complement(234753..235628) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204645.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 gene lgt CDS complement(235844..238090) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957883.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 gene ptsP CDS complement(238103..238633) product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000564481.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 gene rppH CDS 239316..240011 product DNA mismatch repair endonuclease MutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274935.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 gene mutH CDS 240193..240906 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895635.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS 241076..241294 product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758664.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS 241485..242525 product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558970.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS complement(242612..243814) product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004684.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 gene lplT CDS complement(243807..245966) product bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896085.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 gene aas CDS 246559..247587 product HTH-type transcriptional regulator GalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201028.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 gene galR CDS 247598..248620 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968342.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS complement(248630..249892) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056585.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 gene lysA CDS 250010..250945 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741798.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS complement(250917..251624) product aspartate/glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848628.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS complement(251737..253155) product arabinose-proton symporter AraE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253635.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 gene araE CDS complement(253509..254270) product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602495.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 gene kduD CDS complement(254327..255235) product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383270.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 gene kduI CDS complement(255594..256772) product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665983.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS complement(256895..257758) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270764.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS 257862..258317 product multidrug/biocide efflux PACE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597495.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS 258459..259688 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036836.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS complement(259719..259991) product Ni(II)/Co(II)-binding transcriptional repressor RcnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019953.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 gene rcnR CDS 260113..260949 product nickel/cobalt efflux protein RcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134629.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 gene rcnA CDS complement(261159..261917) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134788.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS complement(261904..262416) product CaiF/GrlA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000336256.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS complement(262560..263636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141334.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS complement(263633..264376) product fimbrial biogenesis chaperone StdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798497.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 gene stdC CDS complement(264417..266900) product fimbrial outer membrane usher protein StdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705516.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 gene stdB CDS complement(267020..267601) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244646.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS complement(268320..268952) product YfdX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835265.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS complement(268999..269526) product STM3031 family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038500.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS complement(270343..270741) product tRNA(fMet)-specific endonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911334.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 gene vapC CDS complement(270741..270992) product toxin-antitoxin system antitoxin VapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557549.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 gene vapB CDS 271167..271427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS 271713..272513 product DUF1460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989071.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 tRNA complement(272645..272718) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS complement(272798..273556) product amidase activator ActS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518939.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 gene actS CDS 273821..274366 product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133998.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 gene idi CDS complement(274442..275959) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003338.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 gene lysS CDS complement(275969..276850) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989230.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 gene prfB note possible pseudo, frameshifted CDS complement(277172..278905) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813396.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 gene recJ CDS complement(278911..279624) product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745614.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 gene dsbC CDS complement(279648..280544) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434302.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 gene xerD CDS 280657..281178 product flavodoxin FldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055885.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 gene fldB CDS complement(281231..281644) product protein YgfX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244781.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS complement(281625..281891) product FAD assembly factor SdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351186.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 gene sdhE CDS 281890..282126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS 282141..283121 product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000874170.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 gene ygfZ CDS complement(283237..283896) product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250289.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS complement(284060..284371) product N(4)-acetylcytidine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182971.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 gene yqfB CDS 284544..285962 product 6-phospho-beta-glucosidase BglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230148.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 gene bglA CDS complement(286010..286903) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819369.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS complement(287359..290232) product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194962.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 gene gcvP CDS complement(290395..290784) product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295377.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 gene gcvH CDS complement(290810..291904) product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068738.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 gene gcvT CDS complement(292359..293561) product FAD-dependent 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192154.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 gene ubiI CDS complement(293687..294865) product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111142.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 gene ubiH CDS complement(294862..296178) product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193684.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 gene pepP CDS complement(296204..296782) product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027229.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS 296949..297278 product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276011.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 gene zapA CDS 297572..298120 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621084.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS complement(298501..299784) product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151621.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 gene serA CDS complement(300000..300659) product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189741.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 gene rpiA CDS 300813..301706 product DNA-binding transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828344.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 gene argP CDS complement(301972..302718) product oxidative stress defense protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669854.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS complement(302812..303447) product arginine exporter ArgO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626880.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 gene argO CDS complement(303648..304508) product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389833.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS complement(304741..305820) product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034386.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 gene fbaA CDS complement(305922..307085) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111274.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 gene pgk CDS complement(307107..308153) product erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218338.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 gene epd CDS 308527..308952 product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218564.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS 308978..309556 product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124001.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS 309557..310264 product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553271.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS 310252..310929 product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001520421.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS 310923..311579 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956919.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS complement(311623..313614) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098658.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 gene tkt CDS 313890..314648 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701830.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS complement(314749..315669) product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105550.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 gene speB CDS complement(315874..316689) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531321.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS complement(317023..317517) product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209301.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS complement(317556..318563) product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214544.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS complement(318577..319593) product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853929.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS complement(319596..321068) product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640209.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS complement(322291..323040) product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438650.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS complement(323245..323976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758897.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS complement(324121..326019) product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278580.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 gene speA CDS 326887..328041 product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062140.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 gene metK CDS complement(328400..328579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS 328534..329928 product galactose/proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113171.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 gene galP CDS 330049..330504 product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856775.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS 330600..331307 product deoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286121.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 gene endA CDS 331384..332115 product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001800534.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 gene rsmE CDS 332135..333082 product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593242.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 gene gshB CDS 333298..333861 product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053167.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS 333861..334277 product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285491.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 gene ruvX CDS complement(334324..335010) product global regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098333.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS complement(335142..336122) product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055657.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS 336230..336844 product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997790.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS 336863..337429 product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094848.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS 337426..337716 product DUF167 family protein YggU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277205.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 gene yggU CDS 337724..338317 product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174773.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS 338310..339446 product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096530.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 gene hemW CDS complement(339537..340544) product DUF1202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000252198.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS complement(340677..341723) product L-asparaginase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394189.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 gene ansB CDS complement(341912..342631) product DUF2884 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000984827.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS complement(342681..343007) product YggL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107559.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS complement(343007..343726) product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786887.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 gene trmB CDS 343881..344933 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148958.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 gene mutY CDS 344961..345236 product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091706.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS 345349..346434 product membrane-bound lytic murein transglycosylase MltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976289.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 gene mltC CDS 346651..346944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03340 note possible pseudo, frameshifted CDS 346902..347906 product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049802.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 note possible pseudo, frameshifted CDS complement(347968..350094) product ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839779.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 gene speC CDS 350528..351235 product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234466.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 tRNA 351341..351416 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS complement(351575..352009) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208236.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS complement(352020..353345) product itaconate CoA-transferase RipA/Ict inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212070.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 gene ripA CDS complement(353370..353897) product (R)-specific enoyl-CoA hydratase RipB/Ich inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212069.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 gene ripB CDS complement(353921..354763) product itaconate degradation C-C-lyase RipC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212068.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 gene ripC CDS 354855..355733 product itaconate degradation transcriptional regulator RipR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212067.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 gene ripR CDS complement(355781..357520) product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704667.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS complement(357589..358773) product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704668.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS 359285..359968 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275352.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS complement(360072..360629) product DUF3156 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100106.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS complement(360607..362106) product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000475953.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS complement(362315..362689) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704675.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS complement(362704..364005) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092814.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS 364167..365651 product NAD-dependent phenylacetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286412.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS complement(365787..366164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS complement(366167..366652) product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000338756.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS complement(367378..368301) product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540892.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS complement(368340..369218) product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137806.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS complement(369614..370918) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784371.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS 371323..372507 product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815487.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 gene uxuA CDS 372618..374090 product fructuronate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437132.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS 374102..375514 product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190176.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 gene uxaC CDS complement(375814..376869) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000475254.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS complement(377539..379395) product bifunctional glutathionylspermidine amidase/synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033690.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 gene gss CDS 379622..380488 product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774864.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 gene yghU CDS complement(380556..381269) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220944.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS complement(381266..382318) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032012.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS complement(382394..382642) product hydrogenase maturation factor HybG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334887.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 gene hybG CDS complement(382670..383011) product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544945.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 gene hypA CDS complement(383004..383492) product hydrogenase-2 assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004951.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 gene hybE CDS complement(383485..383979) product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221964.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS complement(383979..385682) product hydrogenase 2 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083046.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 gene hybC CDS complement(385679..386857) product Ni/Fe-hydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017676.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 gene hybB CDS complement(386847..387833) product hydrogenase 2 operon protein HybA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081721.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene hybA CDS complement(387836..388954) product hydrogenase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145429.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 gene hybO CDS complement(389144..389431) product DUF2623 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059119.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS complement(389516..391159) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098705.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS complement(391466..391960) product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439337.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS complement(392240..392743) product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433046.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS 392847..393257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936453.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS 393244..393648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098710.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS 393772..394656 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019040.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS complement(394769..395194) product TonB system transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251476.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 gene exbD CDS complement(395201..395935) product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000527859.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 gene exbB CDS 396187..397374 product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130268.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 gene metC CDS 397514..398173 product DedA family general envelope maintenance protein YghB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268441.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 gene yghB CDS complement(398237..399154) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759292.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS 399329..400492 product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787713.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 gene yqhD CDS 400598..401425 product 2,5-didehydrogluconate reductase DkgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013149.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 gene dkgA sequence02 source 1..340423 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 72..1172 product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118148.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 note possible pseudo, frameshifted CDS 1279..1896 product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001164761.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS complement(1897..3057) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245604.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS 3184..4272 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016858.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS complement(4308..4505) product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460619.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS complement(4569..6674) product pyruvate/proton symporter CstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043112.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 gene cstA CDS complement(6856..7269) product proofreading thioesterase EntH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637966.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 gene entH CDS complement(7272..8027) product 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase EntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135726.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 gene entA CDS complement(8027..8884) product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007162.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS complement(8898..10508) product (2,3-dihydroxybenzoyl)adenylate synthase EntE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222445.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 gene entE CDS complement(10518..11693) product isochorismate synthase EntC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367601.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 gene entC CDS 12002..12958 product Fe2+-enterobactin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239614.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 gene fepB CDS complement(13021..14265) product enterobactin transporter EntS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081657.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 gene entS CDS 14376..15383 product Fe(3+)-siderophore ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277880.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 gene fepD CDS 15380..16372 product iron-enterobactin ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480067.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 gene fepG CDS 16369..17163 product iron-enterobactin ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140620.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 gene fepC CDS complement(17216..18352) product LPS O-antigen length regulator Wzz(fepE) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096767.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 gene wzz(fepE) CDS complement(18602..22486) product enterobactin non-ribosomal peptide synthetase EntF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194158.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 gene entF CDS complement(22483..22701) product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000396011.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS complement(22732..23946) product enterochelin esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656592.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 gene fes CDS 24135..26390 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034967.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS 26424..27140 product enterobactin synthase subunit EntD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001681620.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 gene entD CDS 27152..28270 product YbdK family carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196914.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS 28337..28585 product DUF1158 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682500.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS complement(28591..28932) product RamA family antibiotic efflux transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155638.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS 29221..29802 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113603.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS 29802..30170 product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348987.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS 30267..30920 product oxygen-insensitive NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355874.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 gene nfsB CDS complement(31187..33157) product autotransporter domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192421.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS 33468..34715 product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156971.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS complement(34757..36151) product phenylalanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786293.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 gene pheP CDS 36477..37652 product DNA repair ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816311.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS complement(37739..38299) product reactive chlorine resistance membrane protein RclC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362177.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 gene rclC CDS complement(38312..38548) product reactive chlorine resistance periplasmic protein RclB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922170.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 gene rclB CDS complement(38705..40030) product reactive chlorine resistance oxidoreductase RclA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195937.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 gene rclA CDS 40246..41100 product reactive chlorine-specific transcriptional regulator RclR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339629.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 gene rclR CDS complement(41151..41330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS 41439..41768 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS 42007..42213 product copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445906.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS 42636..42998 product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000915523.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS 42995..43921 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703607.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS complement(44132..44257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS complement(44339..44602) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS 44847..45554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS complement(45611..45769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS 45941..46159 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04310 note possible pseudo, internal stop codon, frameshifted CDS 46336..46608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04320 note possible pseudo, internal stop codon, frameshifted tRNA complement(46702..46778) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS 47033..47629 product fimbria biosynthesis transcriptional regulator FimW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948632.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 gene fimW CDS 47791..48102 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226497.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS 48121..48843 product fimbria biosynthesis regulator FimY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258098.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 gene fimY CDS 49447..50079 product fimbria biosynthesis transcriptional regulator FimZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801270.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 gene fimZ CDS complement(50125..50643) product fimbria assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000603408.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 gene sfmF CDS complement(50653..51660) product type 1 fimbria D-mannose specific adhesin FimH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708646.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 gene fimH CDS complement(51675..54308) product fimbrial biogenesis usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754216.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS complement(54318..55031) product type 1 fimbria chaperone FimC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001764009.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 gene fimC CDS complement(55054..55587) product type 1 fimbrial protein subunit FimI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095931.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 gene fimI CDS complement(55661..56218) product type 1 fimbrial protein subunit FimA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681037.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 gene fimA CDS 56765..57631 product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729163.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 gene folD CDS 57633..57845 product ribosome-associated protein YbcJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190278.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 gene ybcJ CDS 57972..58517 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143573.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS 58510..58947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS 58944..59768 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS complement(59812..61197) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912377.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 gene cysS CDS 61370..61864 product peptidylprolyl isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255991.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 gene ppiB CDS 61867..62589 product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212291.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 gene lpxH CDS 62707..63216 product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098739.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 gene purE CDS 63213..64280 product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815594.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 gene purK CDS complement(64321..65214) product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855341.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS complement(65218..66027) product DUF2877 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821188.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS complement(66039..67298) product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495330.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS complement(67308..68972) product acyl-CoA synthetase FdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580919.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS 69288..70337 product ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703940.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 gene allD CDS 70359..71594 product allantoate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589772.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 gene allC CDS 71605..72390 product (S)-ureidoglycine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540981.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 gene allE CDS complement(72470..73618) product glycerate 3-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706333.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 gene glxK CDS complement(73641..74939) product uracil/xanthine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484506.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS complement(74998..76359) product allantoinase AllB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006865.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 gene allB CDS complement(76438..77892) product putative allantoin permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401139.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS complement(77988..79235) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005062.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS complement(79301..80179) product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765818.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 gene glxR CDS complement(80280..81056) product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943597.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 gene hyi CDS complement(81069..82850) product glyoxylate carboligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096863.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 gene gcl CDS complement(82935..83753) product HTH-type transcriptional repressor AllR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141266.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 gene allR CDS complement(83832..84314) product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776388.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 gene allA CDS 84541..85467 product HTH-type transcriptional activator AllS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460171.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 gene allS CDS 85537..86631 product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154074.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 gene mnmH CDS complement(86670..87329) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342247.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS complement(87322..88338) product virulence-associated ABC transporter ATP-binding protein SfbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569655.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 gene sfbB CDS complement(88375..89205) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524312.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS complement(89462..90595) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152873.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS complement(90781..93195) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561782.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS complement(93192..93878) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110598.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS 93816..94463 product multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001010578.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 gene tesA CDS 94618..95388 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001172802.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS 95448..96302 product chaperedoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116065.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 gene cnoX CDS complement(96388..97167) product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002130.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 gene fetB CDS complement(97154..97831) product iron ABC transporter ATP-binding protein FetA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166987.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 gene fetA CDS 97978..98895 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906145.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS 98892..99344 product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561177.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS complement(99345..99761) product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026762.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 gene cueR CDS 99871..102372 product copper-exporting P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083904.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 gene copA CDS 102526..103353 product DUF1311 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488556.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 103439..104233 product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421856.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS 104435..104914 product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186620.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 gene ybaK CDS complement(105031..106683) product bifunctional UDP-sugar hydrolase/5'-nucleotidase UshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095904.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 gene ushA CDS 106856..108076 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251598.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS 108291..109967 product YbaL family putative K(+) efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000546202.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 gene ybaL CDS complement(110016..111320) product inosine/guanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001766867.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 gene gsk CDS 111473..112444 product acetyl esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801788.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 gene aes CDS complement(112441..113403) product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250076.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 gene hemH CDS complement(113632..114276) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220237.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 gene adk CDS complement(114634..116508) product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001682145.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 gene htpG CDS complement(116619..117224) product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195023.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 gene recR CDS complement(117224..117553) product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467098.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS complement(117599..119527) product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121969.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 gene dnaX CDS complement(119641..120192) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127348.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 gene apt CDS complement(120345..120722) product DUF454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189860.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS 120803..121318 product primosomal replication protein N'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844854.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 gene priC CDS 121332..121499 product pleiotropic regulatory protein RsmS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051161.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 gene rsmS CDS 121500..122504 product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440515.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS complement(122546..125902) product mechanosensitive channel MscK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178244.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 gene mscK CDS complement(126027..126680) product multidrug efflux transporter transcriptional repressor AcrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101755.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 gene acrR CDS 126822..128015 product multidrug efflux RND transporter periplasmic adaptor subunit AcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039199.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 gene acrA CDS 128038..131187 product efflux RND transporter permease AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132507.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 gene acrB CDS 131683..132057 product Hha toxicity modulator TomB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344807.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 gene tomB CDS 132085..132303 product HHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280991.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS 132482..133033 product maltose O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278793.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 gene maa CDS 133151..133621 product YlaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136183.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS complement(133823..134083) product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801415.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS 134308..135858 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213129.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 136089..136478 product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961285.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS complement(136511..137080) product YbaY family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779802.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS 137295..138155 product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084179.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 gene tesB CDS complement(138255..139541) product ammonium transporter AmtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684912.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 gene amtB CDS complement(139573..139911) product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780341.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 gene glnK CDS complement(140124..141905) product SmdB family multidrug efflux ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256093.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS complement(141898..143670) product SmdA family multidrug ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235563.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS complement(143711..144169) product DNA-binding transcriptional regulator DecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884593.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 gene decR CDS 144285..145337 product cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987843.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 gene cdsH CDS complement(145387..146205) product HMP-PP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113040.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 gene cof CDS 146291..148006 product SgrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238179.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS 148071..148766 product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817201.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 gene queC CDS complement(148872..149270) product long-chain acyl-CoA thioesterase FadM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194543.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 gene fadM CDS complement(149374..149748) product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680322.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS complement(149898..151769) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969436.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 gene ppiD CDS complement(152060..152332) product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043544.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 gene hupB CDS complement(152541..154895) product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067728.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 gene lon CDS complement(155081..156352) product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130316.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 gene clpX CDS complement(156604..157227) product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122257.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 gene clpP CDS complement(157475..158773) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198406.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 gene tig CDS complement(159120..159437) product transcriptional regulator BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973433.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 gene bolA CDS 159687..160319 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001539323.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS 160357..161838 product muropeptide MFS transporter AmpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098484.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 gene ampG CDS 162291..163247 product cytochrome o ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239449.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 gene cyoA CDS 163258..165249 product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467158.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 gene cyoB CDS 165239..165853 product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179831.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS 165853..166182 product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019878.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS 166194..167084 product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971351.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 gene cyoE CDS complement(167166..168659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS complement(168671..170182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS 170707..172071 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000935.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS complement(172118..172609) product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138911.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS 172735..173646 product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705818.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 gene panE CDS 173609..174199 product protein deglycase YajL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275809.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 gene yajL CDS complement(174296..175105) product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079741.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS complement(175115..176218) product 2-aminoethylphosphonate--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203965.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 gene phnW CDS 176358..177077 product phosphonate utilization transcriptional regulator PhnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836268.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 gene phnR CDS 177275..178288 product 2-aminoethylphosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778002.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 gene phnS CDS 178294..179403 product 2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928794.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 gene phnT CDS 179406..180275 product 2-aminoethylphosphonate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052708.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 gene phnU CDS 180269..181066 product 2-aminoethylphosphonate ABC transport system, membrane component PhnV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000909802.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 gene phnV CDS complement(181110..182558) product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668658.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 gene thiI CDS 182768..183010 product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124944.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 gene xseB CDS 183011..183910 product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348078.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 gene ispA CDS 183934..185796 product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006791.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 gene dxs CDS 185853..186827 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199865.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS complement(186931..187446) product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154063.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 gene pgpA CDS complement(187424..188404) product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742107.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 gene thiL CDS complement(188483..188902) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801120.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 gene nusB CDS complement(188923..189393) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021372.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 gene ribE CDS complement(189482..190585) product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001150215.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 gene ribD CDS complement(190589..191038) product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543535.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 gene nrdR CDS 191190..191729 product DUF3251 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198480.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS 192029..192892 product nucleoside-specific channel-forming protein Tsx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000752021.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS complement(192976..193239) product type I toxin-antitoxin system toxin Ldr family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254108.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS complement(193521..193868) product HNH nuclease YajD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974818.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 gene yajD CDS complement(194038..194730) product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198318.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS complement(194756..195121) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793035.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS complement(195266..196237) product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046629.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 gene secF CDS complement(196248..198062) product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934811.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 gene secD CDS complement(198123..198455) product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007628.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 gene yajC CDS complement(198478..199605) product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667304.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 gene tgt CDS complement(199802..200866) product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266528.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 gene queA CDS 200960..201541 product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009858.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 gene acpH CDS 201751..202353 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244731.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS complement(202425..204242) product maltodextrin glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000930730.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 gene malZ CDS complement(204404..205834) product proline-specific permease ProY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445555.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 gene proY CDS complement(205849..207168) product branched-chain amino acid transporter carrier protein BrnQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149625.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 gene brnQ CDS complement(207577..208872) product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893648.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 gene phoR CDS complement(208942..209631) product phosphate response regulator transcription factor PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113921.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 gene phoB CDS 209846..211048 product exonuclease subunit SbcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221246.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 gene sbcD CDS 211045..214185 product exonuclease subunit SbcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001526312.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 gene sbcC CDS 214358..215530 product MFS transporter AraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326926.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 gene araJ CDS complement(215552..216460) product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219273.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 gene mak CDS 216574..217497 product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964305.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 gene rdgC CDS complement(217535..217819) product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941953.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 gene ppnP CDS complement(217890..218567) product AroM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276434.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS complement(218818..219009) product protein YaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143161.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 gene yaiA CDS complement(219036..219581) product shikimate kinase AroL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983569.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 gene aroL CDS complement(219766..220221) product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158137.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS 220361..221170 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412190.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 gene proC CDS complement(221185..222147) product diguanylate cyclase AdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484099.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 gene adrA CDS complement(222389..222709) product phosphate starvation-inducible protein PsiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705165.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 gene psiF CDS complement(223058..223324) product anti-adapter protein IraP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518423.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 gene iraP CDS complement(223615..224826) product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446769.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS complement(224995..225678) product extensin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480796.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS 225786..226880 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096588.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 gene ddlA CDS complement(226906..227121) product DUF2754 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239240.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS 227389..227697 product YaiY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763139.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS complement(227735..228829) product surface-exposed outer membrane lipoprotein YaiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271423.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 gene yaiW CDS complement(228844..230064) product peptide antibiotic transporter SbmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477016.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 gene sbmA CDS 230411..231568 product D-alanyl-D-alanine-carboxypeptidase/endopeptidase AmpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830774.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 gene ampH CDS complement(231613..232236) product hydrogen peroxide resistance inhibitor IprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950094.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 gene iprA CDS complement(232322..235336) product autotransporter adhesin EhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181238112.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 gene ehaB CDS 235849..236823 product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130724.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 gene hemB CDS complement(236927..238813) product propionate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010226.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 gene prpE CDS complement(238854..240305) product bifunctional 2-methylcitrate dehydratase/aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272709.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS complement(240343..241512) product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132750.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 gene prpC CDS complement(241635..242522) product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052221.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 gene prpB CDS 242788..244413 product propionate catabolism operon regulatory protein PrpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205290.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 gene prpR CDS complement(244549..244824) product DUF1471 family periplasmic protein YahO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848026.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 gene yahO CDS 245056..245688 product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433130.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS complement(245729..247819) product ferrioxamine B receptor FoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127727.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 gene foxA CDS complement(247983..248990) product ferrioxamine uptake transcriptional regulator FoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074609.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 gene foxR CDS complement(249325..250335) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151052.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 gene cydB CDS complement(250332..251735) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393706.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS complement(252230..255202) product type III restriction-modification system endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689015.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS complement(255212..257170) product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910350.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS complement(257359..258612) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288510.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS complement(258904..259098) product gold resistance metallochaperone GolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159469.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 gene golB CDS complement(259176..259640) product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811033.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 gene cueR CDS complement(259637..261940) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931165.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS 262217..263443 product multidrug efflux RND transporter periplasmic adaptor subunit MexP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119548.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 gene mexP CDS 263440..266607 product multidrug efflux RND transporter permease subunit MexQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112892.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 gene mexQ CDS 266624..268081 product AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811956.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 gene adeC CDS complement(268151..268534) product DUF4156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722977.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS complement(268568..268777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS complement(268803..269330) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610820.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS complement(269588..270112) product Ail/Lom family outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830239.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS complement(270513..270971) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545416.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS complement(270974..271717) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081360.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS complement(271817..273391) product cyclic diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868284.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS complement(273693..274193) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545416.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS complement(274166..274900) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005856.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS 275563..276099 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062036.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS 276161..276922 product fimbrial biogenesis chaperone StbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781490.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 gene stbB CDS 276906..279467 product fimbrial outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075318.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS 279472..280797 product fimbrial usher protein StbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899085.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 gene stbD CDS 280763..281521 product fimbrial biogenesis chaperone StbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247037.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 gene stbE CDS complement(281568..281966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS 282658..282930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS complement(282875..283840) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367267.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS complement(283874..284788) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256667.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS complement(284788..285666) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098684.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS complement(285681..286307) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972565.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 gene leuD CDS complement(286309..287730) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446523.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 gene leuC CDS complement(287862..288785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS complement(289442..289741) product DUF1889 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369626.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(289947..290315) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS 290382..290681 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169527.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS complement(290606..291007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS complement(291020..291289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06570 tRNA complement(291453..291528) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS complement(291644..292891) product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893213.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 gene proA CDS complement(292903..294006) product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285275.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 gene proB CDS 294288..295340 product phosphoporin PhoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043666.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 gene phoE CDS complement(295391..295792) product sigma factor-binding protein Crl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174696.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 gene crl CDS complement(295850..297094) product esterase FrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189584.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 gene frsA CDS complement(297183..297641) product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292018.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 gene gpt CDS 297890..299338 product cytosol nonspecific dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292984.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 gene pepD CDS complement(299493..300107) product peptide chain release factor H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602086.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 gene prfH CDS complement(300104..301243) product RNA ligase RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528894.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS complement(301462..302517) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226198.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 gene dinB CDS 302767..303507 product peptidoglycan meso-diaminopimelic acid protein amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225658.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 gene dpaA CDS complement(303478..304245) product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333360.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS complement(304458..305036) product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284051.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 gene lpcA CDS 305276..307720 product acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973055.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 gene fadE CDS 307829..308596 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000015775.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS 308906..309313 product Spy/CpxP family protein refolding chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000788200.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS 309644..310363 product adhesin/invasin protein PagN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787614.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 gene pagN CDS complement(310702..311649) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970302.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS complement(312464..313285) product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119384.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS complement(313693..314163) product AfaD family invasin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000266939.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 gene afaD CDS complement(314185..316695) product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669630.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS complement(316719..317456) product pili assembly chaperone SafB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691915.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 gene safB CDS complement(317540..318037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS complement(318800..319078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06810 note possible pseudo, internal stop codon, frameshifted CDS complement(319291..319500) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06820 note possible pseudo, frameshifted CDS 319625..319867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS complement(319934..320287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS complement(320529..320948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS complement(320993..321310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS complement(321667..321807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS complement(321868..322101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS 322436..322693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS complement(322759..323205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS complement(323202..326519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS complement(326441..327082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS complement(327479..327997) product DUF2778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808301.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS complement(328024..328296) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS 328353..329096 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS 329107..330162 product type VI secretion system ImpA family N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402248.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 tRNA complement(330485..330561) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS complement(330695..331435) product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001670675.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 gene dnaQ CDS 331490..331957 product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917872.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 gene rnhA CDS complement(331954..332676) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801233.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS 332711..333466 product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052766.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 gene gloB CDS 333685..334905 product murein transglycosylase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644706.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 gene mltD CDS complement(334961..335731) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207227.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS complement(335809..336609) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230964.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS complement(336741..337916) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127546.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS 338021..338935 product DNA-binding transcriptional regulator YafC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648539.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 gene yafC CDS complement(338956..339759) product 2,5-didehydrogluconate reductase DkgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154870.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 gene dkgB tRNA complement(339924..340000) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 rRNA complement(340195..340305) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 sequence03 source 1..309179 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(542..2656) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124693.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 gene fusA CDS complement(2753..3223) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138043.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 gene rpsG CDS complement(3319..3693) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246815.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 gene rpsL CDS complement(3819..4106) product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903398.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 gene tusB CDS complement(4114..4470) product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000820707.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 gene tusC CDS complement(4470..4856) product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268013.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 gene tusD CDS complement(4856..5578) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091471.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS complement(5854..6672) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838232.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 gene fkpA CDS 6892..7110 product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001152702.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS complement(7299..7889) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861345.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 gene slyD CDS complement(7984..8184) product YheV family putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007735.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS complement(8194..9999) product glutathione-regulated potassium-efflux system protein KefB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000398137.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 gene kefB CDS complement(9999..10550) product glutathione-regulated potassium-efflux system ancillary protein KefG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081820.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 gene kefG CDS 10816..12723 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634756.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS 12886..13107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS complement(13109..13420) product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047690.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS 13663..14685 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057395.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS 14682..14900 product YheU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586568.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS 14951..15820 product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274690.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS complement(15916..16320) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148917.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS 16628..17260 product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242758.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 gene crp CDS 17366..19396 product YccS/YhfK family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012135464.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS complement(19439..20656) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190017.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS complement(20742..21305) product aminodeoxychorismate synthase component 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601879.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 gene pabA CDS complement(21337..21939) product putative adenosine monophosphate-protein transferase Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280679.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS complement(21929..22201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS complement(22205..22777) product peptidylprolyl isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920482.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 gene ppiA CDS 23054..24235 product MFS transporter TsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185273.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 gene tsgA CDS complement(24369..24641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS 24534..27041 product NADPH-nitrite reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049259.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 gene nirB CDS 27038..27364 product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084814.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 gene nirD CDS 27560..28369 product nitrite transporter NirC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493575.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 gene nirC CDS 28381..29754 product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349908.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 gene cysG CDS 30092..35863 product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189075.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS 36056..36226 product YhfL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472323.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS complement(36371..37375) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165562.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 gene trpS CDS complement(37368..38126) product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038040.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 gene gph CDS complement(38119..38796) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816285.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 gene rpe CDS complement(38814..39650) product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742132.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 gene dam CDS complement(39831..41108) product cell division protein DamX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343137.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 gene damX CDS complement(41206..42183) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439825.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 gene aroB CDS complement(42351..42872) product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818621.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 gene aroK CDS complement(43337..44539) product DNA uptake porin HofQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832818.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 gene hofQ CDS complement(44490..44891) product HofP DNA utilization family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868832.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS complement(44881..45354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992480.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS complement(45338..45877) product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951390.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS complement(45877..46656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000874746.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS 46798..49329 product peptidoglycan glycosyltransferase/peptidoglycan DD-transpeptidase MrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013215.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 gene mrcA CDS complement(49425..49988) product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519362.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 gene nudE CDS 50311..52443 product intracellular growth attenuator protein IgaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104086.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 gene igaA CDS 52508..53176 product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001520508.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 gene yrfG CDS 53187..53588 product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660720.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 gene hslR CDS 53613..54491 product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001775502.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 gene hslO CDS complement(54600..56309) product DUF4153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446446.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS 56689..58296 product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001265689.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 gene pckA CDS complement(58371..59714) product two-component system sensor histidine kinase EnvZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253815.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 gene envZ CDS complement(59720..60439) product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157751.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 gene ompR CDS 60665..61138 product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856695.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 gene greB CDS 61237..63567 product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980674.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS 64004..64231 product ferrous iron transporter A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160955.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 gene feoA CDS 64250..66568 product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000736984.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 gene feoB CDS 66581..66817 product [Fe-S]-dependent transcriptional repressor FeoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157589.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 gene feoC CDS 67052..67978 product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235943.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS complement(68014..68784) product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998145.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 gene bioH CDS 68842..69027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS 69014..69505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS 69564..70139 product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619394.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 gene nfuA CDS 70516..71832 product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131741.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 gene gntT CDS complement(71951..74029) product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428711.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 gene malQ CDS complement(74039..76432) product maltodextrin phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082255.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 gene malP CDS 77026..79731 product HTH-type transcriptional regulator MalT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907046.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 gene malT CDS complement(79819..80094) product type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170383.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS complement(80097..80357) product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816235.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS complement(80466..81485) product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827117.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 gene rtcA CDS complement(81489..82706) product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105467.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 gene rtcB CDS complement(83051..84604) product TROVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123257.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS 84794..86377 product DNA-binding transcriptional regulator RtcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232919.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 gene rtcR CDS complement(86374..86961) product DeoR/GlpR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815087.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 note possible pseudo, frameshifted CDS complement(86943..87131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07850 note possible pseudo, frameshifted CDS complement(87225..88055) product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928705.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 gene glpG CDS complement(88131..88457) product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434523.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 gene glpE CDS 88656..90173 product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448178.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 gene glpD CDS complement(90220..90765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS complement(90775..92271) product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982774.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS complement(92429..93538) product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083283.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS 93876..95210 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094951.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS 95207..96922 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966867.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS 96966..97871 product 2-keto-3-deoxygluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136613.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 gene yagE CDS complement(97915..98670) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894191.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS complement(98848..101295) product glycogen phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993423.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 gene glgP CDS complement(101315..102748) product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197660.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 gene glgA CDS complement(102748..104043) product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253993.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 gene glgC CDS complement(104058..106034) product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192475.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 gene glgX CDS complement(106031..108217) product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098552.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 gene glgB CDS complement(108564..109670) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799940.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 gene asd CDS 109700..109864 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS complement(110094..111434) product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105950.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 gene gntU CDS complement(111431..111925) product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108342.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 gene gntK CDS complement(112103..113056) product gluconate operon transcriptional repressor GntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730239.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 gene gntR CDS complement(113469..114164) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639789.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS complement(114288..115325) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172399.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS 115794..116282 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290280.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 gene yhhY CDS 116547..117761 product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667442.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS 117777..118538 product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066512.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS 118592..119563 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038946.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS 119560..120594 product phosphotriesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675710.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS complement(120639..122381) product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805086.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 gene ggt CDS 122507..122923 product DUF2756 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826039.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS complement(122936..123676) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073552.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 gene ugpQ CDS complement(123673..124743) product sn-glycerol-3-phosphate import ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907851.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS complement(124745..125590) product sn-glycerol-3-phosphate ABC transporter permease UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572199.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 gene ugpE CDS complement(125587..126474) product sn-glycerol-3-phosphate ABC transporter permease UgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099302.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 gene ugpA CDS complement(126579..127895) product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624747.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 gene ugpB CDS complement(128154..128522) product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816307.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS complement(128519..128740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS complement(128871..129584) product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416114.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 gene livF CDS complement(129586..130353) product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082083.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 gene livG CDS complement(130350..131627) product branched chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803764.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 gene livM CDS complement(131624..132550) product high-affinity branched-chain amino acid ABC transporter permease LivH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003007.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 gene livH CDS complement(132610..133719) product high-affinity branched-chain amino acid ABC transporter substrate-binding protein LivK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822976.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 gene livK CDS 134140..134523 product aspartate 1-decarboxylase autocleavage activator PanM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778873.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 gene panM CDS complement(134719..135816) product branched chain amino acid ABC transporter substrate-binding protein LivJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021996.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 gene livJ CDS complement(136144..136998) product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159621.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 gene rpoH CDS complement(137244..138299) product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081708.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 gene ftsX CDS complement(138292..138960) product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617729.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 gene ftsE CDS complement(138963..140438) product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118701.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 gene ftsY CDS 140564..141160 product 16S rRNA (guanine(966)-N(2))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743275.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 gene rsmD CDS 141150..141419 product DUF1145 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001575094.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS complement(141441..141812) product DUF2500 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042855.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS 141954..142580 product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964735.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS 142661..144859 product Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106671.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 gene zntA CDS 145059..146702 product methyl-accepting chemotaxis citrate transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789682.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS complement(146726..146971) product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001541054.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 gene tusA CDS 147141..147806 product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187489.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS 147879..148436 product DcrB family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245277.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS complement(148440..149657) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001576500.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS 149789..150838 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179588.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS 150890..151468 product 4'-phosphopantetheinyl transferase AcpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284366.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 gene acpT CDS 151560..151961 product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190057.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 gene nikR CDS complement(152050..153174) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001314210.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS complement(153174..155915) product ribosome-associated ATPase/putative transporter RbbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202935.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 gene rbbA CDS complement(155912..156979) product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359835.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS complement(157285..158481) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439232.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS 158712..160208 product inorganic phosphate transporter PitA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902764.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 gene pitA CDS complement(160349..160684) product universal stress protein UspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626193.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 gene uspB CDS 161072..161506 product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323571.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 gene uspA CDS 161831..163303 product dipeptide/tripeptide permease DtpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098284.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 gene dtpB CDS complement(163395..164153) product 16S rRNA (guanine(1516)-N(2))-methyltransferase RsmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001165126.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 gene rsmJ CDS complement(164160..166202) product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184173.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 gene prlC CDS complement(166384..167655) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS 167866..168708 product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954235.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS 168813..170165 product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160779.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 gene gorA CDS complement(170212..171237) product asparaginase AnsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246337.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 gene ansZ CDS complement(171314..172633) product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498698.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS complement(172687..173532) product fructoselysine 6-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966764.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS complement(173596..174570) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966767.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS complement(174749..175468) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572570.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS 175794..177443 product alpha,alpha-trehalase TreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934251.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 gene treF CDS complement(177456..179045) product STY4199 family HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099200.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS 179326..179682 product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120250.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS complement(179688..180290) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196086.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS 180921..181820 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358042.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS 181893..182921 product inner membrane protein YhjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191231.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 gene yhjD CDS 183272..184594 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148985.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS complement(184634..186694) product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158664.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS complement(186804..187571) product cyclic-guanylate-specific phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595629.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 gene pdeH CDS 187800..188729 product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037582.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS complement(188783..190270) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163190.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS complement(190490..191776) product C4-dicarboxylate transporter DctC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858232.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 gene dctA CDS complement(191934..193940) product biofilm formation regulator HmsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014344205.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 gene hmsP CDS complement(194114..197566) product cellulose synthase complex outer membrane protein BcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225124.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 gene bcsC CDS complement(197638..198747) product cellulose synthase complex periplasmic endoglucanase BcsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988805.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 gene bcsZ CDS complement(198751..200901) product cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823808.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 gene bcsB CDS complement(201062..203686) product UDP-forming cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275344.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 gene bcsA CDS complement(203683..204435) product cellulose biosynthesis protein BcsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996130.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 gene bcsQ CDS complement(204436..204639) product cellulose biosynthesis protein BcsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282616.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 gene bcsR CDS 204896..206455 product cellulose biosynthesis c-di-GMP-binding protein BcsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205773.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 gene bcsE CDS 206452..206643 product cellulose biosynthesis protein BcsF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988321.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 gene bcsF CDS 206640..208319 product cellulose biosynthesis protein BcsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192026.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 gene bcsG CDS complement(208401..208532) product type I toxin-antitoxin system toxin Ldr family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001541083.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS 209151..210449 product aromatic amino acid transport family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001150177.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS complement(210550..211563) product dipeptide ABC transporter ATP-binding subunit DppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103568.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 gene dppF CDS complement(211560..212543) product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196507.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 gene dppD CDS complement(212554..213456) product dipeptide ABC transporter permease DppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084689.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 gene dppC CDS complement(213466..214485) product dipeptide ABC transporter permease DppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938843.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 gene dppB CDS complement(214642..216222) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028045.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS complement(216805..218130) product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975177.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS complement(218188..219312) product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940824.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 219462..220469 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290717.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 tRNA complement(220784..220860) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS complement(220951..222624) product kdo(2)-lipid A phosphoethanolamine 7''-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269253.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 gene eptB CDS complement(222860..223387) product long polar fimbrial protein LpfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831422.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 gene lpfE CDS complement(223393..224472) product long polar fimbrial protein LpfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000694929.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 gene lpfD CDS complement(224490..227018) product outer membrane usher protein LpfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558664.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 gene lpfC CDS complement(227041..227739) product long polar fimbrial biogenesis chaperone LpfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836900.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 gene lpfB CDS complement(227824..228348) product long polar fimbria major subunit LpfA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758167.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 gene lpfA1 CDS 228676..228864 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS complement(228866..229516) product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637074.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS 229727..230308 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188408.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 gene tag CDS 230286..230726 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619903.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS complement(230695..233028) product molybdopterin guanine dinucleotide-containing S/N-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148449.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS 233181..233843 product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747548.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS 234062..235036 product glyoxylate/hydroxypyruvate reductase GhrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804690.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 gene ghrB CDS complement(235086..235796) product DUF3053 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190524.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS 236193..236525 product HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455790.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS 236813..237025 product RNA chaperone/antiterminator CspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014594.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 gene cspA CDS 237199..237738 product copper-binding periplasmic metallochaperone CueP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047148.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 gene cueP CDS complement(238109..238594) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533908.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS complement(238582..238848) product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965889.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS complement(239047..239514) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702452.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS complement(239686..239877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09160 note possible pseudo, internal stop codon CDS complement(239920..240159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09170 note possible pseudo, internal stop codon CDS complement(240474..242543) product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291805.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 gene glyS CDS complement(242553..243464) product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168544.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 gene glyQ CDS complement(243603..243905) product YsaB family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605592.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS 244071..245066 product O-acetyltransferase WecH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182662.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 gene wecH CDS complement(245089..245442) product YiaA/YiaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340932.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS complement(245617..247071) product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000275331.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 gene xylB CDS complement(247171..248493) product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001149568.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 gene xylA CDS 248856..250034 product XylR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459824.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS complement(250095..250667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS 251235..253262 product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761327.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS 253436..254686 product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144384.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 gene avtA CDS complement(254723..255196) product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078818.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS complement(255313..256113) product IclR family transcriptional regulator YiaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081338.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 gene yiaJ CDS 256343..257341 product 3-dehydro-L-gulonate 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869006.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 gene yiaK CDS 257353..257817 product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576062.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS 257841..258773 product DUF4862 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000794971.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS 258912..259385 product 2,3-diketo-L-gulonate TRAP transporter small permease YiaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832313.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 gene yiaM CDS 259388..260665 product 2,3-diketo-L-gulonate transporter large permease YiaN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301825.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 gene yiaN CDS 260677..261663 product 2,3-diketo-L-gulonate transporter substrate-binding protein YiaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776928.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 gene yiaO CDS 261667..263163 product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074072.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS 263160..263822 product 3-keto-L-gulonate-6-phosphate decarboxylase UlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089538.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 gene ulaD CDS 263815..264675 product L-ribulose-5-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244034.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS 264669..265364 product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893174.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 gene araD CDS complement(265525..266340) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891802.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS 266604..268559 product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101526.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS complement(268677..270215) product aldehyde dehydrogenase AldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183998.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 gene aldB CDS 270384..271265 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188270.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS complement(271513..273363) product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582376.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 gene selB CDS complement(273360..274751) product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200188.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 gene selA CDS complement(274850..275458) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766681.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS 275934..277850 product PTS mannitol transporter subunit IICBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093287.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 gene mtlA CDS 278071..279219 product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645390.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 gene mtlD CDS 279282..279806 product mannitol operon repressor MtlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193201.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 gene mtlR CDS complement(279816..280025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062561.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS 280316..280678 product YibL family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665687.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS 281166..281849 product DUF3251 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277586.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS 281893..286278 product trimeric autotransporter adhesin SadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079584.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 gene sadA CDS 286577..288232 product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055299.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 gene lldP CDS 288229..289005 product transcriptional regulator LldR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636695.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 gene lldR CDS 289002..290192 product FMN-dependent L-lactate dehydrogenase LldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587027.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 gene lldD CDS 290258..290731 product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932331.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 gene trmL CDS complement(290799..291803) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981551.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS 292121..293317 product L-talarate/galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218254.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS 293505..294701 product glucarate transporter GudP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234818.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 gene gudP CDS complement(294784..295605) product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112114.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 gene cysE CDS complement(295683..296702) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076596.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 gene gpsA CDS complement(296702..297169) product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003370.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 gene secB CDS complement(297213..297464) product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273795.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 gene grxC CDS complement(297551..297982) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156179.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS 298230..299774 product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116577.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 gene gpmM CDS 299784..301067 product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001214137.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 gene envC CDS 301071..302033 product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135520.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS complement(302020..303054) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798185.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS complement(303348..304373) product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645995.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 gene tdh CDS complement(304383..305579) product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213794.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 gene kbl CDS 305782..306714 product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587771.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 gene rfaD CDS 306717..307763 product ADP-heptose--LPS heptosyltransferase RfaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699210.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 gene rfaF CDS 307763..308716 product lipopolysaccharide heptosyltransferase RfaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264610.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 gene rfaC sequence04 source 1..247921 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 169..279 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 CDS 491..946 product DUF4385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985648.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS 1050..2351 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807800.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS complement(2348..2671) product YfiM family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264473.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS complement(2716..4074) product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949286.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 gene pssA CDS complement(4186..6846) product protein lysine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082656.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 gene pat CDS complement(6900..7580) product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183640.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 gene tapT CDS complement(7653..8072) product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098738.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 gene trxC CDS 8276..9313 product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997368.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS complement(9429..10118) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179978.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 gene ung CDS 10437..10820 product autonomous glycyl radical cofactor GrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627811.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 gene grcA CDS complement(10882..11469) product cysteine/O-acetylserine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188410.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 gene eamB CDS 11572..12471 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309673.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS complement(12489..13823) product ATP-dependent RNA helicase SrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219176.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 gene srmB CDS 13953..14690 product tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083348.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 gene trmN CDS complement(14675..16297) product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000989173.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 gene nadB CDS 16723..17298 product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003307.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 gene rpoE CDS 17330..17980 product anti-sigma-E factor RseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168379.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 gene rseA CDS 17980..18936 product sigma-E factor regulatory protein RseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812023.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 gene rseB CDS 18933..19412 product SoxR-reducing system protein RseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589049.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 gene rseC CDS 19663..21462 product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790154.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 gene lepA CDS 21479..22453 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002559.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 gene lepB CDS 22793..23407 product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989216.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 gene rnc CDS 23404..24309 product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102231.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 gene era CDS 24321..25049 product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399380.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 gene recO CDS 25061..25792 product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818969.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 gene pdxJ CDS 25792..26172 product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986043.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 gene acpS CDS complement(26284..26544) product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196291.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS complement(26582..27508) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001581956.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS 27624..28820 product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276374.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS 28842..29759 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684023.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS complement(29798..30646) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000995694.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS 30762..31655 product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048539.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 gene murQ CDS 31666..33027 product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361665.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS 33031..33666 product phosphatidylglycerophosphatase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253562.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 gene yfhb CDS 33724..34242 product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001134566.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 gene tadA CDS complement(34293..35837) product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734212.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 gene mltF CDS 36093..39980 product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970035.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 gene purL CDS complement(40418..40597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS 40675..42060 product two component system sensor histidine kinase QseE/GlrK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001538042.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 gene qseE CDS 42140..42826 product two-component system QseEF-associated lipoprotein QseG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054242.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 gene qseG CDS 42823..44160 product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625590.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 gene glrR CDS 44237..44575 product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914032.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 gene glnB CDS complement(44624..46084) product dipeptide permease DtpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856790.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 gene dtpD CDS complement(46140..48284) product lysine decarboxylase CadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100652.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 gene cadA CDS complement(48367..49698) product cadaverine/lysine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100004.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 gene cadB CDS complement(50059..51603) product lysine decarboxylation/transport transcriptional activator CadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187128.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 gene cadC CDS complement(51785..52975) product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883143.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 gene hmpA CDS 53300..54553 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919178.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS 54749..55888 product 3-phenylpropionate MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173729.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS complement(55883..57160) product stationary phase inducible protein CsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982954.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 gene csiE CDS 57256..57924 product DUF1007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805721.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS 57915..58901 product nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098297.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS complement(58902..59915) product sulfite reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020685.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 gene asrC CDS complement(59926..60744) product anaerobic sulfite reductase subunit AsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017585.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 gene asrB CDS complement(60748..60984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10300 note possible pseudo, frameshifted CDS complement(60968..61792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10310 note possible pseudo, frameshifted CDS complement(61974..62852) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174949.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS complement(62997..63800) product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553464.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 gene suhB CDS 63919..64650 product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940032.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 gene trmJ CDS 64810..65304 product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241346.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 gene iscR CDS 65485..66699 product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775265.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 gene iscS CDS 66727..67113 product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331704.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 gene iscU CDS 67142..67465 product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028952.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 gene iscA CDS 67661..68176 product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384391.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 gene hscB CDS 68189..70039 product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196658.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 gene hscA CDS 70041..70376 product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124466.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 gene fdx CDS 70388..70588 product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523621.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 gene iscX CDS 70766..72049 product aminopeptidase PepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133543.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 gene pepB CDS 72150..72935 product enhanced serine sensitivity protein SseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612718.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 gene sseB CDS complement(73504..74172) product DUF5066 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355346.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS complement(74418..75260) product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205251.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 gene sseA CDS 75469..80403 product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681887.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS 80404..82719 product peptidoglycan glycosyltransferase PbpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014751.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 gene pbpC CDS 83154..85253 product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098283.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS 85250..85879 product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077439.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 gene dmsB CDS 85872..86681 product dimethyl sulfoxide reductase anchor subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544883.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS 86681..87544 product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247794.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS 87665..88096 product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963846.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 gene ndk CDS 88303..89469 product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003206.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS 89761..90765 product cytoskeleton protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090905.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 gene rodZ CDS 90792..91910 product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551816.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 gene ispG CDS 92021..93295 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107147.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 gene hisS CDS 93309..93929 product YfgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409190.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS 93940..95118 product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177072.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 gene bamB CDS 95237..96709 product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249413.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 gene der CDS 96798..97019 product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402503.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS 97529..99409 product intimin-like inverse autotransporter SinH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002432009.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 gene sinH CDS 99467..100426 product SinI family autotransporter-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001149068.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS 100564..106143 product DUF823 domain-containing adhesin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375801.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS 106309..113616 product DUF823/DUF824 repeat adhesin RatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837143.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 gene ratB CDS 114319..120375 product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704642.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS complement(120537..121886) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953156.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 gene xseA CDS 122047..123513 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944174.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 gene guaB CDS 123583..125160 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138293.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 gene guaA CDS 125383..125670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS complement(125690..126004) product DUF1493 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365765.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS complement(125991..126257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS 126328..126561 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10730 note possible pseudo, frameshifted CDS complement(126713..126904) product YfgG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076001.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS 127473..129530 product sensor domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000773655.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS complement(129566..131107) product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123330.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 gene ppx CDS complement(131112..133178) product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529558.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 gene ppk1 CDS complement(133367..134005) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028592.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 gene purN CDS complement(134005..135057) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001767330.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 gene purM CDS 135455..136081 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706208.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 gene upp CDS 136169..137458 product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198341.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 gene uraA CDS 137529..138254 product DnaA inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100388.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS complement(138281..138640) product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132650.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 gene arsC CDS complement(138680..140143) product beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489630.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 gene bepA CDS 140351..141418 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892056.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS 141695..142882 product sugar diacid recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209535.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS 142950..144218 product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200863.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS 144224..145363 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706383.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS complement(145410..145880) product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068686.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 gene bcp CDS complement(145880..146452) product glycine cleavage system transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001576288.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS 146598..147476 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494019.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 gene dapA CDS 147493..148527 product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331881.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 gene bamC CDS 148702..149415 product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171630.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS 149540..150409 product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267527.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS 150425..152443 product tRNA cytosine(34) acetyltransferase TmcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279850.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 gene tmcA CDS complement(152470..152670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS complement(152698..153825) product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277830.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 gene dapE CDS complement(153829..154185) product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631925.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS complement(154759..157872) product multidrug efflux RND transporter permease AcrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001263083.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 gene acrD CDS complement(158057..159757) product nitrate/nitrite two-component system sensor histidine kinase NarQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216820.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 gene narQ CDS 159943..161904 product formate-dependent uric acid utilization protein AegA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078843.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 gene aegA CDS complement(162353..163651) product penicillin binding protein PBP4B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673295.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 gene pbp4b CDS 163855..164430 product GDP-mannose pyrophosphatase NudK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084037.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 gene nudK CDS 164555..165598 product DUF1176 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270663.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS 165726..165956 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS complement(166019..168019) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087345.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 gene tkt CDS complement(168039..168989) product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001072436.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 gene tal CDS 169261..171540 product NADP-dependent oxaloacetate-decarboxylating malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344299.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 gene maeB CDS 171957..172292 product ethanolamine utilization microcompartment protein EutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031444.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 gene eutS CDS 172305..172784 product ethanolamine utilization acetate kinase EutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000820751.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 gene eutP CDS 172762..173451 product ethanolamine utilization acetate kinase EutQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733871.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 gene eutQ CDS 173448..174251 product ethanolamine utilization cob(I)yrinic acid a,c-diamide adenosyltransferase EutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997668.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 gene eutT CDS 174248..175264 product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582913.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 gene pta CDS 175305..175595 product ethanolamine utilization microcompartment protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387713.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 gene eutM CDS 175708..175995 product ethanolamine utilization microcompartment protein EutN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001522340.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 gene eutN CDS 176007..177410 product aldehyde dehydrogenase EutE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075647.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS 177421..178260 product ethanolamine utilization protein EutJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929675.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 gene eutJ CDS 178250..179437 product ethanolamine utilization ethanol dehydrogenase EutG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147519.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 gene eutG CDS 179557..180783 product ethanolamine utilization protein EutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512341.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 gene eutH CDS 180780..182183 product ethanolamine ammonia-lyase reactivating factor EutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097523.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 gene eutA CDS 182195..183556 product ethanolamine ammonia-lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769994.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 gene eutB CDS 183575..184471 product ethanolamine ammonia-lyase subunit EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372351.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 gene eutC CDS 184481..185140 product ethanolamine utilization microcompartment protein EutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001111056.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 gene eutL CDS 185153..185647 product ethanolamine utilization microcompartment protein EutK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606260.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 gene eutK CDS 185695..186747 product HTH-type transcriptional regulator EutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753659.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 gene eutR CDS 187068..187214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS complement(187196..187525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS complement(187546..188445) product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801336.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 gene hemF CDS complement(188448..189317) product N-acetylmuramoyl-L-alanine amidase AmiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102880.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 gene amiA CDS 189530..189955 product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406008.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS 189942..190391 product DUF2919 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842927.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS 190453..191028 product RpoE-regulated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838971.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS 191123..192022 product porphyrinogen peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084583.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 gene yfeX CDS 192260..193051 product SDR family oxidoreductase UcpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517460.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 gene ucpA CDS 193209..194225 product thiosulfate/sulfate ABC transporter substrate-binding protein CysP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290267.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 gene cysP CDS 194225..195058 product sulfate/thiosulfate ABC transporter permease CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881746.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 gene cysT CDS 195058..195933 product sulfate/thiosulfate ABC transporter permease CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852703.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 gene cysW CDS 195923..197020 product sulfate/thiosulfate ABC transporter ATP-binding protein CysA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021072.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 gene cysA CDS 197088..197999 product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093881.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 gene cysM CDS 198251..198859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS complement(198959..199324) product YfeK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710735.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS complement(199401..200120) product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001263738.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS complement(200135..201427) product transcriptional regulator PtsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565130.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 gene ptsJ CDS 201510..202376 product pyridoxine/pyridoxal/pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529606.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 gene pdxK CDS 202373..202612 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844540.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS complement(202776..203285) product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522253.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 gene crr CDS complement(203326..205053) product phosphoenolpyruvate-protein phosphotransferase PtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098199.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 gene ptsI CDS complement(205102..205359) product phosphocarrier protein Hpr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487600.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 gene ptsH CDS complement(205743..206714) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036904.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 gene cysK CDS complement(206878..207639) product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255008.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 gene cysZ CDS 207871..208857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS 208929..210944 product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433258.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 gene ligA CDS 210937..211164 product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114688.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS complement(211161..212159) product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765569.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS 212249..213175 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109834.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS complement(213237..213998) product outer membrane protein OmpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722932.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS 214254..215087 product xanthosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119752.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 gene xapA CDS 215142..216398 product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513243.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS 216457..216615 product DUF1427 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658727.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS 216664..217551 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438886.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 tRNA complement(217715..217790) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 tRNA complement(217795..217870) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 tRNA complement(217912..217987) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 tRNA complement(218033..218108) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS 218367..219782 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695623.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 gene gltX CDS complement(219836..220228) product putative DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826515.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS complement(220230..220592) product putative DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472034.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 tRNA 220814..220889 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 tRNA 220932..221007 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS 221198..223387 product sensor domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112949.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS complement(223440..224642) product nucleoside permease NupC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000376341.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 gene nupC CDS 224985..226226 product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131734.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS complement(226287..226613) product DUF2502 domain-containing protein YpeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490091.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 gene ypeC CDS complement(226727..227725) product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640297.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 gene mgrA CDS 227905..229557 product alpha-keto acid decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001180878.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS complement(229577..230812) product ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468932.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS 231016..231981 product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170371.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 gene glk CDS 232704..233942 product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785618.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 gene alaC CDS complement(234466..235386) product kdo(2)-lipid IV(A) palmitoleoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484431.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 gene lpxP CDS 235908..236150 product YfdY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639889.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS complement(236425..237642) product phosphoglycerate transporter PgtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955756.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 gene pgtP CDS 237948..238208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS 238222..239445 product phosphoglycerate transport regulator PgtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467983.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 gene pgtC CDS 239457..241448 product two-component system sensor histidine kinase PgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678500.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 gene pgtB CDS 241438..242685 product two-component system response regulator PgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000930841.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 gene pgtA CDS 242953..243891 product omptin family outer membrane protease PgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716015.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 gene pgtE CDS 244783..245283 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS complement(245400..246710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS complement(247340..247714) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11830 sequence05 source 1..234337 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 65..175 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 tRNA 193..268 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 rRNA 310..420 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00040 CDS complement(1207..1428) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825645.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS complement(1666..4779) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703631.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS complement(4791..5948) product multidrug efflux RND transporter periplasmic adaptor subunit AcrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160334.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 gene acrE CDS 6362..7024 product multidrug efflux transporter transcriptional repressor AcrS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129529.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 gene acrS CDS complement(7027..9126) product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098998.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS complement(9277..9441) product DUF2556 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620015.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS complement(9524..10408) product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642611.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 gene yhdJ CDS complement(10494..10790) product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462905.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 gene fis CDS complement(10816..11661) product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219664.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 gene dusB CDS complement(12442..13323) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145849.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 gene prmA CDS complement(13335..14786) product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001175744.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 gene panF CDS complement(14776..15018) product YhdT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340020.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS complement(15127..16476) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884627.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 gene accC CDS complement(16487..16957) product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354626.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 gene accB CDS complement(17350..17949) product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241496.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 gene msrQ CDS complement(17950..18954) product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723876.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 gene msrP CDS complement(19067..20041) product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148246.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS 20245..22185 product RNase E specificity factor CsrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241379.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 gene csrD CDS 22493..23536 product rod shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913396.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 gene mreB CDS 23601..24653 product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802540.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 gene mreC CDS 24653..25144 product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226619.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 gene mreD CDS 25153..25746 product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210300.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS 25736..27205 product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123188.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 gene rng CDS 27316..31116 product AsmA2 domain-containing protein YhdP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253498.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 gene yhdP CDS 31261..32706 product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055936.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 gene tldD CDS complement(32829..33758) product HTH-type transcriptional activator AaeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440300.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 gene aaeR CDS 33940..34143 product p-hydroxybenzoic acid efflux pump operon protein AaeX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051840.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 gene aaeX CDS 34151..35083 product p-hydroxybenzoic acid efflux pump subunit AaeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855134.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 gene aaeA CDS 35089..37056 product p-hydroxybenzoic acid efflux pump subunit AaeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510909.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 gene aaeB CDS 37228..37500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103887.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS complement(37560..37826) product DUF1471 family stress response protein YhcN-B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853277.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 gene yhcN-B CDS complement(37930..38193) product peroxide/acid stress response protein YhcN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695692.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 gene yhcN CDS complement(38558..39028) product transcriptional regulator ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257852.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 gene argR CDS 39443..40381 product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861588.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 gene mdh CDS 40501..41130 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723780.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS 41117..41782 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171579.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS 41993..43261 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433394.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS 43294..44193 product L(+)-tartrate dehydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045349.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 gene ttdA CDS 44193..44810 product L(+)-tartrate dehydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162405.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 gene ttdB CDS 44967..45209 product oxaloacetate decarboxylase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180130.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS 45225..46997 product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150450.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 gene oadA CDS 47010..48311 product oxalacetate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444843.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS 48364..49062 product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600161.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS complement(49096..50166) product outer membrane-stress sensor serine endopeptidase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497705.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 gene degS CDS complement(50259..51626) product serine endoprotease DegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716695.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 gene degQ CDS complement(51783..52181) product Z-ring associated protein ZapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481183.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 gene zapG CDS 52374..53498 product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191224.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 gene zapE CDS 53800..54228 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847559.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 gene rplM CDS 54244..54636 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829815.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 gene rpsI CDS 54794..55588 product DUF695 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505558.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS 55851..56489 product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257300.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 gene sspA CDS 56495..56995 product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366112.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 gene sspB CDS 57113..57895 product transcriptional regulator NanR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382926.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 gene nanR CDS 58030..58923 product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029662.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 gene nanA CDS 59039..60529 product sialic acid transporter NanT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108071.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 gene nanT CDS 60576..61265 product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054239.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS 61262..62137 product N-acetylmannosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208982.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 gene nanK CDS 62134..62601 product N-acetylneuraminate anomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979902.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 gene nanQ CDS complement(62683..63963) product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001180693.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS complement(63950..65203) product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076275.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 gene codB CDS complement(65319..66422) product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184299.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS complement(66629..68047) product glutamate synthase subunit GltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081705.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 gene gltD CDS complement(68057..72514) product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965014.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 gene gltB CDS 72395..72655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS 73189..74118 product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176887.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS 74212..76548 product aerobic respiration two-component sensor histidine kinase ArcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809818.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 gene arcB CDS 76775..77428 product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719819.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 gene elbB CDS 77425..78153 product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044653.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 gene mtgA CDS complement(78228..78860) product PhoP regulatory network protein YrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602196.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 gene yrbL CDS complement(79110..79382) product PTS phosphocarrier protein NPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216797.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 gene npr CDS complement(79379..80233) product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000243746.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 gene rapZ CDS complement(80279..80770) product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609332.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 gene ptsN CDS complement(80888..81175) product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176588.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 gene hpf CDS complement(81198..82631) product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809012.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 gene rpoN CDS complement(82679..83404) product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224104.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 gene lptB CDS complement(83411..83965) product lipopolysaccharide ABC transporter substrate-binding protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669770.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 gene lptA CDS complement(83934..84509) product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047845.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 gene lptC CDS complement(84506..85072) product 3-deoxy-manno-octulosonate-8-phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030029.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 gene kdsC CDS complement(85093..86079) product arabinose-5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018616.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 gene kdsD CDS complement(86093..87070) product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922739.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS 87283..88095 product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531560.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 gene mlaF CDS 88103..88885 product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925786.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 gene mlaE CDS 88890..89441 product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193591.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 gene mlaD CDS 89460..90095 product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476475.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 gene mlaC CDS 90095..90391 product lipid asymmetry maintenance protein MlaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188843.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 gene mlaB CDS 90579..90833 product BolA family iron metabolism protein IbaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000900133.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 gene ibaG CDS 90887..92146 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357288.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 gene murA CDS complement(92205..92492) product DNA-binding transcriptional regulator SfsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444167.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 gene sfsB CDS complement(92724..93695) product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047354.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 gene ispB CDS 93953..94264 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271396.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 gene rplU CDS 94284..94541 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940593.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 gene rpmA CDS 94671..95636 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813052.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS 95652..96824 product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673554.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 gene cgtA CDS complement(96955..98388) product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212675.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 gene dacB CDS 98636..99112 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148008.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 gene greA CDS complement(99268..99600) product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196654.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 gene yhbY CDS 99688..100314 product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145975.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 gene rlmE CDS 100409..102352 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107481.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 gene ftsH CDS 102457..103305 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764715.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 gene folP CDS 103298..104635 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071169.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 gene glmM CDS 104858..105190 product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272680.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 gene secG tRNA 105204..105290 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS complement(105375..106334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS complement(106492..107835) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207645.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 gene argG tRNA 108179..108255 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS 108463..108915 product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024135124.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 gene rimP CDS 108943..110445 product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031036.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 gene nusA CDS 110470..113148 product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131175.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 gene infB CDS 113369..113770 product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040205.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 gene rbfA CDS 113770..114714 product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089682.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 gene truB CDS 114865..115134 product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059465.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 gene rpsO CDS 115346..117511 product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989243.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 gene pnp CDS 117621..118505 product lipoprotein NlpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802069.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 gene nlpI CDS 118684..120573 product ATP-dependent RNA helicase DeaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301504.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 gene deaD CDS 120727..121971 product tryptophan permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224390.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 gene mtr CDS complement(122032..122562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294022.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS 122721..123440 product murein L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000532752.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS complement(123418..124425) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130426.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS complement(124603..125481) product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877709.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS complement(125490..126485) product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421309.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS 126702..127226 product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884720.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS 127220..127723 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908562.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS complement(127710..128027) product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928379.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS 128065..128508 product YhbP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380404.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS complement(128488..129006) product protein/nucleic acid deglycase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037599.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 gene yhbO CDS 129137..129772 product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001638995.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS complement(129839..130414) product division/outer membrane stress-associated lipid-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643280.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 gene dolP CDS complement(130424..131014) product DnaA initiator-associating protein DiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893483.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 gene diaA CDS complement(131036..131431) product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057282.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS complement(131389..133431) product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249248.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS 133495..134358 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812294.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 gene rsmI CDS complement(134516..135289) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083899.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS complement(135400..136443) product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844177.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 gene gatD CDS complement(136487..137860) product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490608.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS complement(137864..138148) product PTS galactitol transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824293.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 gene gatB CDS complement(138179..138643) product PTS galactitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080443.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 gene gatA CDS complement(138658..139929) product tagatose-bisphosphate aldolase subunit GatZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853833.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 gene gatZ CDS complement(140049..140903) product tagatose bisphosphate family class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469985.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS complement(141161..142732) product galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273719.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 gene garD CDS 143262..144032 product 2-dehydro-3-deoxyglucarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057715.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 gene garL CDS 144058..144948 product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178106.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 gene garR CDS 145046..146191 product glycerate 2-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706461.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 gene garK CDS 147418..148356 product transcriptional regulator TdcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094904.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 gene tdcA CDS 148454..149443 product bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548373.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 gene tdcB CDS 149464..150795 product threonine/serine transporter TdcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020078491.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 gene tdcC CDS 150862..152070 product propionate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001859.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 gene tdcD CDS 152104..154398 product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867312.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 gene pflB CDS 154468..155832 product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622070.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 gene tdcG CDS 156147..157478 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401598.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS 157504..158814 product serine dehydratase subunit alpha family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000463069.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS complement(158927..159091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS complement(159115..159816) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633552.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS 159921..160817 product DNA-binding transcriptional regulator YhaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041028.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 gene yhaJ CDS complement(160856..161221) product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384139.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS complement(161345..162331) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531164.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS complement(162399..162791) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000603920.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS complement(163039..163338) product YqjK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095496.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS complement(163335..163733) product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785626.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS complement(163736..164041) product YqjD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031219.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS complement(164083..164451) product DUF1090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877297.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS complement(164596..164979) product EnvZ/OmpR regulon moderator MzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917516.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 gene mzrA CDS complement(164983..165645) product DedA family general envelope maintenance protein YqjA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422141.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 gene yqjA CDS complement(166095..167339) product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235369.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 gene sstT CDS complement(167594..168562) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098834.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS complement(168833..169831) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617687.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS complement(169920..170552) product vancomycin high temperature exclusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951045.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS complement(170764..171261) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202966.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS 171347..172483 product 23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019992.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 gene rlmG CDS complement(172564..174582) product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121488.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 gene fadH CDS complement(174753..176042) product putrescine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001536702.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 gene ygjG CDS 176562..178082 product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094656.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS 178449..180038 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478457.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS complement(180035..180679) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983441.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS 180914..181681 product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213683.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 tRNA complement(181761..181836) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS 181962..182468 product G/U mismatch-specific DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237776.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 gene mug CDS complement(182592..184574) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519776.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 gene rpoD CDS complement(184589..186334) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918867.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 gene dnaG CDS complement(186569..186784) product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144069.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 gene rpsU CDS 187012..188025 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264383.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 gene tsaD CDS 188049..188228 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS complement(188275..188886) product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272784.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 gene plsY CDS 188990..189352 product bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001540933.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 gene folB CDS 189450..190271 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281933.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 gene bacA CDS complement(190375..191616) product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708457.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS complement(191679..192293) product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125344.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS 192535..193836 product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046233.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS 193954..196797 product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188297.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 gene glnE CDS 196845..198278 product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867682.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 gene hldE CDS complement(198737..200416) product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342894.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS complement(200435..201055) product DUF1449 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171735.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS 201313..201522 product cell surface composition regulator GlgS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928927.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 gene glgS CDS complement(201597..201893) product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001537605.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS 202330..202983 product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076978.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 gene ribB CDS complement(203262..203831) product protein-disulfide oxidoreductase DsbI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345576.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 gene dsbI note possible pseudo, internal stop codon CDS complement(203846..204517) product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096232.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS complement(204537..206333) product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460261.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS complement(206976..207749) product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115874.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 gene zupT CDS 207890..208678 product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000245226.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 gene ygiD CDS complement(208740..209903) product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442833.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS complement(209909..210484) product DUF1190 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831528.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS complement(210793..212262) product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001663008.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 gene tolC CDS 212601..213101 product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001231952.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 gene nudF CDS 213098..213520 product DUF1249 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833403.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS 213545..214372 product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444734.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 gene cpdA CDS 214372..214953 product esterase YqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105725.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 gene yqiA CDS 214981..216873 product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195318.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 gene parE CDS complement(216998..217312) product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958587.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS complement(217344..217925) product NADPH:quinone oxidoreductase MdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065430.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 gene mdaB CDS complement(218032..219381) product quorum sensing histidine kinase QseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779337.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 gene qseC CDS complement(219378..220037) product quorum sensing response regulator transcription factor QseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221574.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 gene qseB CDS 220189..220581 product YgiW/YdeI family stress tolerance OB fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000731552.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS 220653..221519 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998802.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS 221630..223888 product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281905.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 gene parC CDS 224145..224882 product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965730.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 gene plsC CDS 224956..226368 product cell division protein FtsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010658.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 gene ftsP CDS complement(226413..227720) product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345269.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS complement(227731..228213) product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259757.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS complement(228255..229238) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645961.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS 229726..231897 product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274469.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS 232100..232294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS complement(232452..232907) product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128238.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 misc_feature complement(232952..>234337) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000818491.1:DASS family sodium-coupled anion symporter locus_tag LOCUS_14030 sequence06 source 1..212051 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(705..1202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS 1650..2183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14050 note possible pseudo, frameshifted CDS 2476..2691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14060 note possible pseudo, frameshifted CDS complement(2705..2863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS complement(3269..3577) product CcdB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817079.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS complement(3580..3819) product type II toxin-antitoxin system CcdA family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817080.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS complement(3928..4176) product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141823.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS complement(4253..4753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14110 note possible pseudo, internal stop codon tRNA complement(5248..5332) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS 5555..6574 product NADPH-dependent aldehyde reductase Ahr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301967.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 gene ahr CDS complement(6602..7132) product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896738.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 gene idnK CDS 7349..8380 product L-idonate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197416.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 gene idnD CDS 8405..9169 product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998695.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 gene idnO CDS 9231..10550 product gnt-II system L-idonate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128336.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 gene idnT CDS 10614..11612 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244064.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS complement(11818..12900) product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182241.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 gene lptG CDS complement(12900..13979) product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000584132.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 gene lptF CDS 14395..15906 product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397157.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 gene pepA CDS 16043..16486 product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190722.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 gene holC CDS 16486..19341 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416348.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS complement(19483..20670) product YjgN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066967.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS 20865..21368 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519079.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS 21475..21669 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14250 note possible pseudo, frameshifted CDS 21623..21964 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14260 note possible pseudo, frameshifted CDS complement(22198..22962) product tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218459.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 gene miaE CDS complement(23022..23438) product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002940.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 gene rraB CDS 23604..24608 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103040.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 gene argF CDS complement(24682..25134) product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635207.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS 25807..27030 product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410840.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 gene arcA CDS 27041..27973 product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428744.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 gene arcC CDS 28085..29089 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237033.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 gene argF CDS 29145..30548 product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000514432.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS 30735..31223 product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666047.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS 31451..32386 product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013055.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 gene pyrB CDS 32399..32860 product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148566.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 gene pyrI CDS 32937..33323 product 2-iminobutanoate/2-iminopropanoate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047544.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 gene ridA CDS 33398..33844 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251083.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS complement(33960..36668) product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001775586.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 gene mgtA CDS 37052..37999 product trehalose operon repressor TreR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181306.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 gene treR CDS 38137..39555 product PTS trehalose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048822.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 gene treB CDS 39605..41257 product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155051.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 gene treC CDS 41666..43804 product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187820.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 gene nrdD CDS 43926..44390 product anaerobic ribonucleoside-triphosphate reductase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268860.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 gene nrdG CDS complement(44394..44678) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220578.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS complement(44668..44910) product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212724.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS complement(44988..46901) product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989308.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS complement(46918..47658) product KDGP aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779260.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS complement(47655..48773) product DgaE family pyridoxal phosphate-dependent ammonia lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139189.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS complement(48757..49890) product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459938.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS complement(49949..50593) product DUF4310 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392129.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS complement(50605..51381) product DUF4311 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478578.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS complement(51404..51706) product DUF4312 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000975186.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS complement(51706..52068) product SFCGS family glycine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435389.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS complement(52079..52408) product glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255103.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS complement(52695..53081) product cytochrome b562 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232231.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 gene cybC CDS complement(53180..54520) product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852994.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 gene pmbA CDS 54628..55179 product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166287.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 gene yjgA CDS complement(55286..56659) product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219848.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 gene mpl CDS 56834..57832 product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853761.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 gene fbp CDS 58059..58589 product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055079.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 gene ppa CDS 59002..60162 product metallo-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977198.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS 60159..61367 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203124.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS complement(61421..61765) product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219167.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS complement(61768..65547) product autotransporter assembly complex protein TamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060812.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 gene tamB CDS complement(65544..67277) product autotransporter assembly complex protein TamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120231.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 gene tamA CDS 67490..68128 product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051467.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 gene msrA CDS 68311..69654 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934974.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS complement(69739..69945) product DUF1107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689229.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS 70272..70829 product YtfJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175301.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS complement(70819..71559) product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893400.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 gene cysQ CDS 71827..73770 product bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589381.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS complement(73828..74214) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201297.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS 74302..75150 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560623.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS 75231..76196 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623287.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS 76299..76961 product iron-sulfur cluster repair protein YtfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331469.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 gene ytfE CDS complement(77028..78416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944334.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS complement(78431..79570) product DKNYY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155542.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS complement(79908..81311) product D-serine/D-alanine/glycine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228328.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 gene cycA CDS complement(81607..82227) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001663320.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 gene fklB CDS 82447..83082 product OapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119449.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS complement(83132..84058) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381071.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS complement(84206..84655) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196065.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 gene rplI CDS complement(84697..84924) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135199.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 gene rpsR CDS complement(84929..85243) product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001768658.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 gene priB CDS complement(85250..85645) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216673.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 gene rpsF CDS 86115..86390 product DUF1471 family protein YjfY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001756165.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 gene yjfY CDS complement(86519..87205) product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170772.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS complement(87205..88059) product L-ribulose-5-phosphate 3-epimerase UlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949528.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 gene ulaE CDS complement(88069..88719) product 3-keto-L-gulonate-6-phosphate decarboxylase UlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056755.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 gene ulaD CDS complement(88733..89197) product PTS ascorbate transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776536.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 gene ulaC CDS complement(89207..89512) product PTS ascorbate transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218362.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 gene ulaB CDS complement(89528..90925) product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000404875.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 gene ulaA CDS 91288..92352 product L-ascorbate 6-phosphate lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049161.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 gene ulaG CDS 92457..93212 product HTH-type transcriptional regulator UlaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133618.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 gene ulaR CDS complement(93209..93958) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560304.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 gene yjfP CDS 94169..94471 product biofilm peroxide resistance protein BsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586831.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 gene bsmA CDS 94602..94877 product DUF1471 family protease activator YjfN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000441025.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 gene yjfN CDS complement(94922..96544) product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118984.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS complement(96629..97792) product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943948.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS complement(97795..98433) product DUF1190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085609.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS complement(98443..98841) product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547734.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS complement(98859..99518) product YjfK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090298.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS complement(99515..100585) product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037962.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS complement(100585..101283) product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511955.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS complement(101298..101702) product DUF2170 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000312608.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS complement(101835..102566) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293265.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 gene rlmB CDS complement(102657..105095) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076357.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 gene rnr CDS complement(105133..105558) product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177630.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 gene nsrR CDS complement(105766..107064) product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000527972.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 gene purA CDS complement(107167..107364) product DUF2065 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089290.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS complement(107443..108447) product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232417.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 gene hflC CDS complement(108450..109709) product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000312504.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 gene hflK CDS complement(109924..111204) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460344.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 gene hflX CDS complement(111276..111584) product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051875.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 gene hfq CDS complement(111667..112572) product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000739.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 gene miaA CDS complement(112610..114466) product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122547.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 gene mutL CDS complement(114476..115795) product N-acetylmuramoyl-L-alanine amidase AmiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640365.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 gene amiB CDS complement(115812..116273) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981984.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 gene tsaE CDS complement(116245..117792) product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968671.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 gene nnr CDS 117791..118930 product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964745.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 gene queG tRNA complement(119200..119275) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 tRNA complement(119432..119507) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 tRNA complement(119664..119739) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS 120035..120754 product arginine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922806.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS complement(120816..121361) product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271546.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 gene orn CDS 121468..122520 product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041948.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 gene rsgA CDS 122612..123580 product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934955.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 gene asd CDS 123599..126925 product miniconductance mechanosensitive channel MscM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236760.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 gene mscM CDS complement(126992..127306) product YjeO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276180.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS complement(127358..128860) product glutamate/gamma-aminobutyrate family transporter YjeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149876.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 gene yjeM CDS complement(129086..130063) product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004789.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 gene epmA CDS 130386..132176 product fumarate reductase (quinol) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192954.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 gene frdA CDS 132169..132903 product fumarate reductase iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829507.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 gene frdB CDS 132914..133309 product fumarate reductase subunit FrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208749.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 gene frdC CDS 133320..133679 product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609650.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 gene frdD CDS 133791..134324 product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238395.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS complement(134341..134658) product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118469.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 gene sugE CDS 134963..135502 product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001763937.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS complement(135533..135679) product lipoprotein toxin entericidin B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239598.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 gene ecnB CDS complement(135787..135963) product entericidin A/B family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977686.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS complement(135982..136548) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257282.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 gene efp CDS 136589..137617 product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940490.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 gene epmB CDS 137899..138756 product YjeJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229237.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS complement(138804..139157) product DUF4156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605289.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS complement(139401..141047) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729126.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 gene groL CDS complement(141091..141384) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027827.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS 141639..142901 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989305.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS complement(142960..143436) product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267291.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 gene fxsA CDS 143777..145213 product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069440.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 gene aspA CDS 145328..146629 product anaerobic C4-dicarboxylate transporter DcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637594.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 gene dcuA CDS 146750..147097 product divalent cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887832.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 gene cutA CDS 147073..148776 product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068881.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS 148813..149388 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188506.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 tRNA 149504..149579 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS 150290..151042 product non-specific acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001785756.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS complement(151290..151781) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626103.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS complement(151778..152071) product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110456.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS 153067..153750 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921674.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS 153762..154034 product transcriptional regulator RtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269916.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 gene rtsB CDS complement(154027..154401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS 154334..154606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS complement(155119..155979) product YjiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268195.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS 156328..157728 product DUF1996 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000773796.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS complement(157812..158405) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112218.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS complement(158480..159253) product dimethyl sulfoxide reductase anchor subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544919.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS complement(159246..159872) product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211603.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 gene dmsB CDS complement(159886..162090) product DmsA/YnfE/YnfF family dimethyl sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211602.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS 162022..162231 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS 162732..164321 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682899.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS 164318..165037 product two-component system response regulator DcuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611308.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 gene dcuR CDS 165354..165620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS 165767..167107 product anaerobic C4-dicarboxylate transporter DcuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899146.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 gene dcuB CDS 167203..168849 product class I fumarate hydratase FumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037190.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 gene fumA CDS complement(168947..170377) product melibiose:sodium transporter MelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028072.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 gene melB CDS complement(170461..171813) product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001520868.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 gene melA CDS 172085..173017 product transcriptional regulator MelR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106992.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 gene melR CDS 173247..175517 product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978690.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 gene adiA CDS 175815..176576 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217076.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS 176716..178053 product arginine/agmatine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093130.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 gene adiC CDS 178187..179830 product phosphoethanolamine transferase EptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919286.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 gene eptA CDS 179827..180495 product two-component system response regulator PmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697895.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 gene pmrA CDS 180496..181575 product two-component system sensor histidine kinase PmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212189.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 gene pmrB CDS complement(181742..183244) product glycine betaine/L-proline transporter ProP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919708.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 gene proP CDS 183712..184047 product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056482.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS 184167..184610 product VOC family metalloprotein YjdN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131301.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 gene yjdN CDS 184762..185196 product aminoalkylphosphonate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602318.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 gene phnO CDS 185454..186362 product lipid A hydroxylase LpxO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457029.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 gene lpxO CDS 186717..188864 product formate dehydrogenase N subunit alpha, selenocysteine-containing inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989279.1 transl_table 11 codon_start 1 transl_except (pos:187134..187136,aa:Sec) note codon on position 140 is selenocysteine opal codon. locus_tag LOCUS_15860 CDS 189041..189730 product Sel1 family TPR-like repeat protein YjcO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803225.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 gene yjcO CDS complement(189888..191198) product glutamate/aspartate:proton symporter GltP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793283.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 gene gltP CDS complement(191543..192163) product heme lyase NrfEFG subunit NrfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083247.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 gene nrfG CDS complement(192160..192669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15900 note possible pseudo, internal stop codon, frameshifted CDS complement(192662..194398) product heme lyase NrfEFG subunit NrfEF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551709.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 gene nrfEF note possible pseudo, internal stop codon, frameshifted CDS complement(194391..195347) product cytochrome c nitrite reductase subunit NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199631.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 gene nrfD CDS complement(195344..196015) product cytochrome c nitrite reductase Fe-S protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278023.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 gene nrfC CDS complement(196012..196578) product cytochrome c nitrite reductase pentaheme subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115063.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 gene nrfB CDS complement(196690..198126) product ammonia-forming nitrite reductase cytochrome c552 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101783.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 gene nrfA CDS 198558..200516 product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083869.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 gene acs CDS 200762..201076 product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999620.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS 201073..202722 product cation/acetate symporter ActP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832531.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 gene actP CDS complement(202761..203450) product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067098.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS complement(203443..203853) product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257347.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS 203957..204844 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354962.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS complement(204939..206585) product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001536604.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS complement(206735..208084) product guanine/hypoxanthine transporter GhxP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106903.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 gene ghxP CDS complement(208432..209100) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958574.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS complement(209393..209851) product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412686.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 gene soxR CDS 209938..210261 product superoxide response transcriptional regulator SoxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019484.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 gene soxS CDS complement(210249..211850) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083646.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 sequence07 source 1..186542 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(140..652) product 4-hydroxyphenylacetate 3-monooxygenase reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195559.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS complement(670..2232) product 4-hydroxyphenylacetate 3-monooxygenase, oxygenase component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801496.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 gene hpaB CDS complement(2450..2890) product homoprotocatechuate degradation operon regulator HpaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543921.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 gene hpaR CDS 3165..4454 product 4-hydroxyphenylacetate degradation bifunctional isomerase/decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000679210.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 gene hpaG CDS 4451..5917 product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723530.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 gene hpaE CDS 5919..6770 product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516973.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 gene hpaD CDS 6780..7160 product 5-carboxymethyl-2-hydroxymuconate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119858.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS 7303..8106 product 2-oxo-hepta-3-ene-1,7-dioic acid hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884795.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 gene hpaH CDS 8117..8908 product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785061.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 gene hpaI CDS 8981..10357 product 4-hydroxyphenylacetate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285789.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 gene hpaX CDS 10367..11263 product 4-hydroxyphenylacetate catabolism regulatory protein HpaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000336599.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 gene hpaA CDS 11277..12215 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976557.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS complement(12623..12985) product anti-adapter protein IraM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307134.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 gene iraM CDS complement(13639..13944) product chaperone modulator CbpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284251.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 gene cbpM CDS complement(13944..14864) product curved DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000420603.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 gene cbpA CDS 15100..15462 product copper resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118904.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS 15511..17397 product protein-disulfide reductase DsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000972986.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS 17394..18017 product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876697.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS 18007..18513 product protein disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907521.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS 18646..19062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16270 note possible pseudo, internal stop codon CDS 19069..19887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16280 note possible pseudo, internal stop codon CDS complement(19921..20148) product YccJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143126.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS complement(20169..20765) product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062894.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 gene wrbA CDS 21150..21317 product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273665.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS 21454..22092 product HTH-type transcriptional regulator RutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083125.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 gene rutR CDS complement(22089..22484) product lysozyme inhibitor LprI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821059.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS complement(22543..26523) product trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000537509.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 gene putA CDS 26945..28453 product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018468.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 gene putP CDS 29071..29367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS 29346..30134 product phosphate starvation-inducible protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001617488.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 gene phoH CDS complement(30240..31121) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433673.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS complement(31407..32903) product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261398.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS complement(33240..33920) product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054243.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS 34438..35580 product N-acetylneuraminate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525766.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS 35626..36318 product oligogalacturonate-specific porin KdgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700857.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS 36601..37881 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560763.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS 37892..38998 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988585.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS complement(39165..39458) product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096224.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS 39489..39707 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS complement(40309..40767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS complement(40891..41262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS complement(41271..41711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS complement(41731..42603) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS complement(42636..43115) product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284958.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS complement(43103..44494) product type VI secretion system ImpA and VasL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087741.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS complement(44505..47051) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16530 tRNA 45250..45336 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS 47174..47572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS 47782..48042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS 48367..48663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS 48731..49183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16570 note possible pseudo, frameshifted CDS 49246..49695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16580 note possible pseudo, frameshifted CDS 49889..50188 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169527.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS 50185..50676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16600 note possible pseudo, frameshifted CDS 50673..51038 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16610 note possible pseudo, frameshifted CDS complement(51177..51956) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086142.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS 52224..52502 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16630 note possible pseudo, frameshifted CDS 52559..52876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16640 note possible pseudo, internal stop codon, frameshifted CDS 53416..53628 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208507.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS complement(53653..53832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS complement(54086..55282) product porin OmpS1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080666.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 gene ompS1 CDS 55932..56243 product cell division protein DrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107435.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 gene drpB CDS 56323..57018 product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377043.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS 57092..58522 product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157299.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS 58503..58973 product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785981.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS complement(58962..59882) product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212262.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 gene yedA CDS 60058..60969 product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922683.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS 61046..61231 product YodC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001178602.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS 61396..63108 product cellulose biosynthesis regulator diguanylate cyclase DgcQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119838.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 gene dgcQ CDS complement(63087..63584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS complement(63692..64429) product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253411.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 gene fliP CDS complement(64429..64806) product flagellar biosynthetic protein FliO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978276.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 gene fliO CDS complement(64806..65219) product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282109.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 gene fliN CDS complement(65216..66220) product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502815.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 gene fliM CDS complement(66225..66692) product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132172.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 gene fliL CDS complement(66797..68014) product flagellar hook length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631663.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 gene fliK CDS complement(68011..68454) product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046981.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 gene fliJ CDS complement(68476..69846) product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213259.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 gene fliI CDS complement(69846..70553) product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064158.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 gene fliH CDS complement(70546..71541) product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067735.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 gene fliG CDS complement(71534..73216) product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276841.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 gene fliF CDS 73433..73747 product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719033.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 gene fliE CDS complement(73867..74253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639596.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS complement(74518..74751) product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790504.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 gene yedF CDS complement(74748..75953) product selenium metabolism membrane protein YedE/FdhT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580669.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 gene yedE CDS 76139..76552 product lipoprotein YedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754694.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 gene yedD CDS complement(76592..78076) product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795470.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 gene amyA CDS complement(78148..78516) product flagella biosynthesis regulatory protein FliT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204899.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 gene fliT CDS complement(78516..78923) product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287765.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 gene fliS CDS complement(78938..80344) product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146805.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 gene fliD CDS 80244..80582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS 80600..82117 product FliC/FljB family flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079784.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS 82196..83401 product flagellin lysine-N-methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816588.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 gene fliB CDS 83628..84317 product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087453.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS 84376..84927 product flagella biosynthesis regulatory protein FliZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218080.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 gene fliZ CDS 85074..85874 product cystine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761628.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 gene tcyJ CDS 86028..87014 product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128192.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 gene dcyD CDS 87035..87703 product cystine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158238.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 gene tcyL CDS 87700..88452 product L-cystine ABC transporter ATP-binding protein YecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273033.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 gene yecC CDS 88685..89407 product transcriptional regulator SdiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157173.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 gene sdiA CDS complement(89474..89698) product DUF2594 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106483.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS 90162..90818 product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611323.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 gene uvrY CDS 90815..92647 product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289473.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 gene uvrC CDS 92704..93252 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160192.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 gene pgsA tRNA 93404..93479 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 tRNA 93531..93604 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 tRNA 93616..93702 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS 94058..94282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS 94502..95935 product SH3 domain-containing C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989033.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS 96148..96474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS 96713..97378 product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781529.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS complement(97453..98721) product tyrosine transporter TyrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001562965.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 gene tyrP CDS 98891..99130 product YecH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377238.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS complement(99176..99673) product non-heme ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920615.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 gene ftnA CDS complement(99913..100248) product YecR-like lipofamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803230.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS 100504..101142 product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705970.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS complement(101321..101824) product non-heme ferritin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741707.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS 102374..102931 product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754799.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS 103160..103342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17220 note possible pseudo, internal stop codon CDS 103565..104368 product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840119.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 gene otsB CDS 104343..105764 product alpha,alpha-trehalose-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089042.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 gene otsA CDS complement(105782..106210) product universal stress protein UspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122416.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 gene uspC CDS 107006..107347 product flagellar transcriptional regulator FlhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518146.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 gene flhD CDS 107344..107928 product flagellar transcriptional regulator FlhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605989.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 gene flhC CDS 108053..108940 product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906317.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 gene motA CDS 108937..109866 product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795656.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 gene motB CDS 109877..111886 product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061308.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 gene cheA CDS 111907..112410 product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147296.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 gene cheW CDS 112647..114308 product methyl-accepting chemotaxis protein II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483273.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 gene tar CDS 114462..115328 product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204368.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 gene cheR CDS 115325..116374 product protein-glutamate methylesterase/protein glutamine deamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036391.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 gene cheB CDS 116392..116781 product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763861.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 gene cheY CDS 116792..117436 product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983587.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 gene cheZ CDS 117630..118781 product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797087.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 gene flhB CDS 118774..120852 product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002392.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 gene flhA CDS 120852..121244 product flagellar protein FlhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233619.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 gene flhe CDS 121481..122620 product glycoside hydrolase family 105 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000989908.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS complement(122674..124545) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063446482.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 gene mrdA CDS complement(124734..126467) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025371.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 gene argS CDS 126704..127273 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024793.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS 127293..128039 product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185770.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 gene cutC CDS complement(128275..129246) product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569029.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 gene cmoB CDS complement(129243..129986) product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019609.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 gene cmoA CDS complement(130027..130422) product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000252975.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS complement(130475..131293) product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639226.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS complement(131290..131856) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916144.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS 132181..133953 product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258634.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 gene aspS CDS 134056..134508 product dihydroneopterin triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653696.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 gene nudB CDS 134538..135278 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907242.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS 135315..135836 product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022509.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 gene ruvC CDS complement(135838..136437) product YebB family permuted papain-like enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716741.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS 136955..137338 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS 137698..138309 product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580335.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 gene ruvA CDS 138318..139328 product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568508.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 gene ruvB CDS complement(139407..140192) product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571518.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 gene znuB CDS complement(140189..140995) product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203015.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 gene znuC CDS 141023..141967 product zinc ABC transporter substrate-binding protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625584.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 gene znuA CDS 141983..143302 product murein DD-endopeptidase MepM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001184019.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 gene mepM CDS 143419..144390 product lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448401.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 gene lpxM CDS complement(144463..145905) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091158.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 gene pyk CDS complement(146029..146898) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056719.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS 147240..148715 product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301712.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 gene zwf CDS 148950..150761 product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069125.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 gene edd CDS 150799..151440 product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800493.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 gene kdgA CDS complement(151540..152718) product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173426.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 gene purT CDS 152849..153139 product DNA damage-inducible protein YebG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257728.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 gene yebG CDS 153207..153560 product protein YebF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042123.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 gene yebF CDS 153654..154313 product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024713.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS 154526..156577 product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936997.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 gene ptrB CDS complement(156614..157312) product exodeoxyribonuclease X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944282.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 gene exoX CDS complement(157336..157992) product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100250.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS complement(158100..158330) product DNA polymerase III subunit theta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856224.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS 158468..158842 product CopC domain-containing protein YobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168393.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 gene yobA CDS 158843..159718 product copper homeostasis membrane protein CopD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979693.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 gene copD CDS 159735..160088 product YebY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722366.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS complement(160471..161550) product phage integrase Arm DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189090.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS complement(161525..161803) product excisionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311878.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS 162217..164196 product alkyl sulfatase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237518.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS 164885..165133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023517636.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS 165197..165796 product DUF1367 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940329.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS 165793..166020 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS 166150..166839 product bacteriophage antitermination protein Q inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705893.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS 166936..167460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS complement(167834..168283) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798706.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS complement(168644..169330) product type III secretion system effector protease PipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938184.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 gene pipA CDS 169600..169935 product phage holin, lambda family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120501.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS 169922..170371 product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095605.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS 170368..170868 product prophage endopeptidase RzpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082739.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 gene rzpD CDS 171076..171390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS 171467..171646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS complement(171763..172296) product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161597822.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS 172386..173081 product phage minor tail protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001152615.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS 173366..174316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17960 note possible pseudo, internal stop codon CDS 174359..175726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17970 note possible pseudo, internal stop codon CDS 175869..176585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17980 note possible pseudo, frameshifted CDS 176641..176934 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS complement(177136..177858) product SPI-1 type III secretion system guanine nucleotide exchange factor SopE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161708.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 gene sopE CDS 178071..178223 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18010 note possible pseudo, internal stop codon, frameshifted CDS complement(178338..179138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS complement(180083..180352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18030 note possible pseudo, frameshifted CDS complement(180367..180978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18040 note possible pseudo, frameshifted CDS complement(180996..181649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS 181680..181910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18060 note possible pseudo, internal stop codon CDS 182000..182497 product DUF2514 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050879.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS complement(182754..182921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS 183229..183720 product DUF1441 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348565.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS 183707..183886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS 183906..184280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS 184273..184869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS 184959..185135 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18130 note possible pseudo, internal stop codon CDS 185190..185876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18140 note possible pseudo, internal stop codon CDS 185825..186325 product tail fiber assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885577.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 sequence08 source 1..171462 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 626..2260 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000946075.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS 2257..3234 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001520270.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS 3224..4036 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966645.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS 4030..4827 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950217.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS 4821..5411 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947464.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS complement(5493..6626) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456065.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS 6820..7146 product four-helix bundle copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183698.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 tRNA 7155..7231 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS 7340..7990 product metal-binding protein ZinT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234684.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 gene zinT CDS 8099..8887 product cryptic aminoglycoside nucleotidyltransferase ANT(3'')/ANT(9) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175788.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 gene aadA CDS 8978..9625 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001787632.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS 9694..10542 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190268.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS complement(10796..11044) product biofilm/acid-resistance regulator YmgB/AriR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208085.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS 11360..11905 product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617989.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS 12102..12740 product leucine efflux protein LeuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457190.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 gene leuE CDS 12914..13276 product DUF1971 domain-containing protein YeaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248993.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 gene yeaR CDS 13279..13461 product DUF1869 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513734.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS 13691..14332 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762776.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS 14646..14894 product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512149.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS 15327..15578 product DUF333 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673491.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS 15647..15958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487129.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS complement(15944..16291) product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222524.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS complement(16410..17594) product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205360.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS 17695..18489 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579795.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS complement(18469..18915) product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460698.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS complement(19225..19752) product YbaK/prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989016.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS complement(19793..21286) product diguanylate cyclase DgcJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766137.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 gene dgcJ CDS 21581..21781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS complement(21926..23212) product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219724.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS complement(23335..25269) product protein kinase YeaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001764228.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 gene yeaG CDS 25697..26443 product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163762.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS 26733..27929 product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029244.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS 28035..28883 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843742.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS complement(28982..29866) product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366147.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS complement(30195..31190) product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153505.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 gene gapA CDS 31532..31945 product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519539.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 gene msrB CDS 31987..32265 product YeaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046864.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS complement(32438..32851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS 33159..34235 product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645203.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS 34262..35641 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435315.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS 35652..36695 product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798110.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS 36717..37553 product ketose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878893.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS 37558..38505 product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309545.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS 38515..39498 product NADH-dependent methylglyoxal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723717.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 gene ydjG CDS 39628..40386 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719088.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS 40522..41880 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438819.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS complement(41983..42639) product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184700.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 gene pncA CDS complement(42666..43682) product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170143.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 gene ansA CDS complement(43778..45634) product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259874.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 gene sppA CDS 45808..46359 product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339313.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS 46477..47520 product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043069.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 gene selD CDS 47525..49474 product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235869.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 gene topB CDS complement(49504..50847) product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372866.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 gene gdhA CDS 51086..51361 product YnjH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254672.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS complement(51321..51737) product pyrimidine (deoxy)nucleoside triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592145.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS complement(51810..52616) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673954.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 gene xthA CDS 53062..54288 product bifunctional succinylornithine transaminase/acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059512.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS 54279..55313 product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001263882.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 gene astA CDS 55310..56788 product succinylglutamate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177206.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 gene astD CDS 56785..58128 product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123947.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 gene astB CDS 58121..59089 product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368452.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 gene astE CDS 59425..59910 product ATP-independent periplasmic protein-refolding chaperone Spy inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001228995.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 gene spy CDS complement(59985..60866) product excinuclease Cho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518228.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 gene cho CDS complement(60987..61814) product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174989.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 gene nadE CDS 62033..62374 product osmotically-inducible lipoprotein OsmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039301.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 gene osmE CDS 62675..62995 product PTS N,N'-diacetylchitobiose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412161.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 gene chbB CDS 63078..64436 product PTS N,N'-diacetylchitobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073015.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 gene chbC CDS 64487..64834 product PTS N,N'-diacetylchitobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459882.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 gene chbA CDS 64848..65687 product transcriptional regulator ChbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983393.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 gene chbR CDS 65812..67167 product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078788.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS 67180..67938 product chitin disaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442732.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 gene chbG CDS complement(67982..70234) product catalase HPII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019093.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 gene katE CDS 70599..70841 product cell division activator CedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977510.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 gene cedA CDS complement(70944..72335) product cystine/sulfocysteine:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001010658.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 gene tcyP CDS complement(72472..73071) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505801.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS complement(73209..73877) product hexitol phosphatase HxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106859.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 gene hxpB CDS 74026..74562 product YniB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222158.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS complement(74605..75465) product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000267686.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS complement(75572..75862) product type V toxin-antitoxin system endoribonuclease antitoxin GhoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146133.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 gene ghoS CDS complement(75958..76890) product 6-phosphofructokinase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251706.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 gene pfkB CDS 77179..77937 product YdiY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000770984.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS complement(77986..78945) product lipid A deacylase LpxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046434.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS 79088..79336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS 79398..80252 product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816806.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS complement(80937..81527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS 81568..81726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS 83058..84986 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144226.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 gene thrS CDS 85098..85532 product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058403.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 gene infC CDS 85628..85825 product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124225.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 gene rpmI CDS 85876..86232 product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124850.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 gene rplT CDS 86534..87517 product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018570.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 gene pheS CDS 87533..89920 product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672399.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 gene pheT CDS 89925..90224 product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229266.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 gene ihfA CDS 90427..91407 product vitamin B12 ABC transporter permease BtuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954986.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 gene btuC CDS 91499..92050 product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181565.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS 92050..92799 product vitamin B12 ABC transporter ATP-binding protein BtuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080607.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 gene btuD CDS 92876..93340 product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213259.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS 93654..94367 product anti-FlhDC factor YdiV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561998.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 gene ydiV CDS 94429..95871 product protein adenylyltransferase SelO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175658.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 gene selO CDS complement(95906..96097) product hemin uptake protein HemP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089115.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 gene hemP CDS complement(96254..97300) product 3-deoxy-7-phosphoheptulonate synthase AroH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082192.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 gene aroH CDS complement(97456..98289) product posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000370992.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 gene ppsR CDS 98626..101004 product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069332.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 gene ppsA CDS complement(101046..102686) product medium-chain fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302824.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 gene fadK CDS complement(102924..103217) product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081072.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS complement(103214..104500) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278481.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS complement(104557..104859) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19210 note possible pseudo, internal stop codon, frameshifted CDS complement(104935..105492) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19220 note possible pseudo, internal stop codon, frameshifted CDS complement(105514..106278) product electron transfer flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692160.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS 106741..107631 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284799.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS complement(107707..108858) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347850.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS complement(108872..110467) product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805700.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS complement(110621..111352) product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860197.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 gene aroD CDS complement(111424..112290) product quinate/shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383485.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 gene ydiB CDS complement(112357..113592) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296106.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS complement(113956..115167) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795534.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS complement(115308..115667) product YdiL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602304.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS complement(116125..117243) product AI-2E family transporter YdiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248612.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 gene ydiK CDS 117508..120564 product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612899.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS 120561..120971 product 1,4-dihydroxy-2-naphthoyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637930.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 gene menI CDS 121070..121258 product YdiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638607.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS complement(121546..122892) product L-cystine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000261850.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS 123319..123687 product Fe-S cluster assembly scaffold SufA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000418973.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 gene sufA CDS 123696..125183 product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089373.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 gene sufB CDS 125200..125946 product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948895.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 gene sufC CDS 125921..127192 product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907921.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 gene sufD CDS 127189..128409 product cysteine desulfurase SufS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000143859.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 gene sufS CDS 128422..128838 product cysteine desulfuration protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729470.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 gene sufE CDS 128993..129994 product L,D-transpeptidase LdtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817111.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 gene ldtE CDS complement(130060..130302) product major outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082326.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS complement(130385..130621) product murein lipoprotein Lpp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082307.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 gene lpp CDS complement(130932..132344) product pyruvate kinase PykF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000751448.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 gene pykF CDS complement(132746..134089) product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000756081.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS complement(134111..135004) product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037942.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS complement(135063..135800) product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697190.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS complement(135812..137038) product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703938.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS complement(137361..140423) product tetrathionate reductase subunit TtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002364.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 gene ttrA CDS complement(140416..141438) product tetrathionate reductase subunit TtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149765.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 gene ttrC CDS complement(141439..142173) product tetrathionate reductase subunit TtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269830.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 gene ttrB CDS 142385..144133 product tetrathionate respiration histidine kinase TtrS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816070.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 gene ttrS CDS 144108..144728 product tetrathionate respiration response regulator TtrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190927.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 gene ttrR CDS 144826..145038 product fumarate hydratase FumD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165779.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 gene fumD CDS complement(145160..146119) product transcriptional regulator MlrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060717.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 gene mlrB CDS complement(146291..147019) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122320.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS complement(147198..147836) product two component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666335.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS complement(147867..150020) product two component system sensor kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050754.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS complement(150424..150690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS 151048..151431 product SPI-2 type III secretion system protein SpiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001738217.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 gene spiC CDS 151433..152926 product SPI-2 type III secretion system protein SpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000261287.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 gene spiA CDS 152907..154118 product SctD family type III secretion system inner membrane ring subunit SsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323784.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 gene ssaD CDS 154126..154368 product YscE family type III secretion system co-chaperone SsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210204.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 gene ssaE CDS 154574..154897 product SPI-2 type III secretion system chaperone SseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000972855.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 gene sseA CDS 154904..155494 product SPI-2 type III secretion system translocon protein SseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094422.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 gene sseB CDS 155491..155964 product SycD/LcrH family type III secretion system chaperone SscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711030.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 gene sscA CDS 155967..157421 product SPI-2 type III secretion system translocon protein SseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079758.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 gene sseC CDS 157437..158024 product SPI-2 type III secretion system translocon protein SseD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388328.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 gene sseD CDS 158027..158443 product LcrR family type III secretion system chaperone SseE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249605.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 gene sseE CDS 158495..158929 product SycD/LcrH family type III secretion system chaperone SscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979964.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 gene sscB CDS 159871..160413 product pathogenicity island 2 effector protein SseG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805847.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 gene sseG CDS 160507..160722 product type III secretion system needle filament protein SsaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350226.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 gene ssaG CDS 160700..160990 product EscG/YscG/SsaH family type III secretion system needle protein co-chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457355.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS 160987..161250 product SctI family type III secretion system inner rod subunit SsaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989174.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 gene ssaI CDS 161349..161996 product SPI-2 type III secretion system apparatus lipoprotein SsaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862869.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 gene ssaJ CDS 162559..163233 product SPI-2 type III secretion system apparatus protein SsaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011199.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 gene ssaK CDS 163223..164215 product SPI-2 type III secretion system apparatus protein SsaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238877.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 gene ssaL CDS 164273..164641 product SPI-2 type III secretion system apparatus protein SsaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383695.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 gene ssaM CDS 164626..166671 product SPI-2 type III secretion system apparatus protein SsaV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258227.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 gene ssaV CDS 166937..167962 product SctN family type III secretion system ATPase SsaN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787208.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 gene ssaN CDS 167965..168342 product SPI-2 type III secretion system apparatus protein SsaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449096.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 gene ssaO CDS 168323..168697 product SPI-2 type III secretion system apparatus protein SsaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223304.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 gene ssaP CDS 168678..169646 product SPI-2 type III secretion system cytoplasmic ring protein SsaQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944194.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 gene ssaQ CDS 169714..170361 product SPI-2 type III secretion system export apparatus protein SsaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056360.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 gene ssaR CDS 170358..170624 product SPI-2 type III secretion system apparatus protein SsaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999977.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 gene ssas CDS 170625..171404 product SPI-2 type III secretion system apparatus protein SsaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194051.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 gene ssaT sequence09 source 1..165758 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(244..483) product oxaloacetate decarboxylase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001151.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS complement(642..1982) product citrate/sodium symporter CitS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183602.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 gene citS CDS 2281..3270 product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181444.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 gene citC CDS 3300..3593 product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691461.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 gene citD CDS 3590..4459 product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247810.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 gene citE CDS 4470..5990 product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665586.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 gene citF CDS 5990..6541 product citrate lyase holo-[acyl-carrier protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000679050.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 gene citX CDS 6519..7427 product triphosphoribosyl-dephospho-CoA synthase CitG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103241.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 gene citG CDS 7607..8428 product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544030.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 gene dapB CDS 9290..10438 product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597281.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 gene carA CDS 10457..13684 product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126321.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 gene carB CDS 13958..14353 product carnitine metabolism transcriptional regulator CaiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333324.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 gene caiF CDS complement(14431..15027) product carnitine operon protein CaiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122865.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 gene caiE CDS complement(15137..15922) product crotonobetainyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004377.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 gene caiD CDS complement(15976..17529) product crotonobetaine/carnitine-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355790.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 gene caiC CDS complement(17592..18809) product L-carnitine CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016209.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 gene caiB CDS complement(18921..20063) product crotonobetainyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347135.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 gene caiA CDS complement(20098..21615) product L-carnitine/gamma-butyrobetaine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787084.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 gene caiT CDS 22096..22866 product electron transfer flavoprotein FixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692187.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS 22882..23823 product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032189.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS 23873..25159 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287774.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS 25156..25443 product ferredoxin-like protein FixX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203737.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 gene fixX CDS 25590..26930 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136163.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS 27019..27249 product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001172089.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS 27535..27957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802644.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS complement(28181..28471) product DUF1471 family virulence protein SrfN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745961.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 gene srfN CDS 29369..31258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS 31665..32195 product glutathione-regulated potassium-efflux system oxidoreductase KefF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600696.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 gene kefF CDS 32188..34050 product glutathione-regulated potassium-efflux system protein KefC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377172.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 gene kefC CDS 34248..34727 product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624378.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 gene folA CDS complement(34833..35681) product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257211.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 gene apaH CDS complement(35692..36069) product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610896.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 gene apaG CDS complement(36072..36893) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065397.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 gene rsmA CDS complement(36890..37879) product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093001.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 gene pdxA CDS complement(37879..39165) product peptidylprolyl isomerase SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800482.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 gene surA CDS complement(39219..41579) product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000746124.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 gene lptD CDS 41833..42645 product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200595.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 gene djlA CDS complement(42740..43399) product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525195.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 gene rluA CDS complement(43411..46317) product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116972.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 gene rapA CDS complement(46491..48842) product DNA polymerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000035599.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 gene polB CDS complement(48886..49506) product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035634.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS 50024..50443 product DUF4751 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103153.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS complement(50449..51144) product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888641.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 gene araD CDS complement(51285..52787) product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151698.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 gene araA CDS complement(52798..54507) product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951805.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 gene araB CDS 54847..55692 product arabinose operon transcriptional regulator AraC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852388.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 gene araC CDS 55811..56578 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148375.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS complement(56617..57324) product thiamine ABC transporter ATP-binding protein ThiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000915973.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 gene thiQ CDS complement(57308..58918) product thiamine/thiamine pyrophosphate ABC transporter permease ThiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235645.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 gene thiP CDS complement(58894..59877) product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000915326.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 gene thiB CDS complement(60055..61713) product HTH-type transcriptional regulator SgrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139028.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 gene sgrR CDS 62248..62529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS complement(62583..63188) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818262.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 gene leuD CDS complement(63199..64599) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140632.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 gene leuC CDS complement(64602..65693) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042333.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 gene leuB CDS complement(65693..67264) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082813.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 gene leuA CDS 68077..69039 product transcriptional regulator LeuO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115424.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 gene leuO CDS 69448..71085 product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425609.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 gene ilvI CDS 71085..71579 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001563086.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 gene ilvN CDS 71863..72867 product catabolite repressor/activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762406.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 gene cra CDS 73473..73931 product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488291.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 gene mraZ CDS 73933..74874 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970440.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 gene rsmH CDS 74871..75236 product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625651.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 gene ftsL CDS 75252..77018 product peptidoglycan glycosyltransferase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642235.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 gene ftsI CDS 77005..78492 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775075.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 gene murE CDS 78489..79847 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626645.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 gene murF CDS 79841..80923 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964138.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 gene mraY CDS 80926..82242 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796441.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 gene murD CDS 82242..83486 product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239803.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 gene ftsW CDS 83483..84550 product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016622.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 gene murG CDS 84669..86144 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096072.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 gene murC CDS 86137..87057 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763895.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS 87059..87889 product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075728.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 gene ftsQ CDS 87886..89148 product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588463.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 gene ftsA CDS 89209..90360 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462798.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 gene ftsZ CDS 90461..91378 product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595474.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 gene lpxC CDS 91657..92154 product secA translation cis-regulator SecM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014320.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 gene secM CDS 92216..94921 product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905763.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 gene secA CDS 95073..95468 product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000736063.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 gene mutT CDS complement(95502..96491) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200039.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS 96634..97518 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001802116.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS complement(97515..97706) product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286419.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 gene yacG CDS complement(97716..98459) product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557441.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 gene zapD CDS complement(98459..99079) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270913.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 gene coaE CDS 99305..100348 product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217357.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS complement(100379..101581) product protein transport protein HofC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114107.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 gene hofC CDS complement(101571..102956) product type II secretion system protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650611.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 gene gspE CDS complement(102966..103403) product prepilin peptidase-dependent pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414989.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 gene ppdD CDS complement(103625..104518) product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135134.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 gene nadC CDS 104606..105169 product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936326.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 gene ampD CDS 105166..106020 product beta-lactamase regulator AmpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172040.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 gene ampE CDS complement(106112..107062) product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024772.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS complement(107062..108468) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357550.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS complement(108632..110002) product aromatic amino acid transporter AroP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969487.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 gene aroP CDS 110568..111332 product pyruvate dehydrogenase complex transcriptional repressor PdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331771.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 gene pdhR CDS 111492..114155 product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003851.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 gene aceE CDS 114170..116053 product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963602.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 gene aceF CDS 116255..117679 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519338.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 gene lpdA CDS 117968..118252 product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765363.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS complement(118290..119081) product DUF2950 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757452.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS complement(119094..120716) product DUF3300 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174529.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS 121105..123702 product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888954.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 gene acnB CDS complement(124624..124782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS 125218..125580 product protein YacL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384314.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 gene yacL CDS 125815..126768 product 2-keto-3-deoxygluconate permease 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001022089.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS 126765..128036 product D-threonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783298.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS 128026..129009 product D-threonate 4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448742.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS 129019..129786 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678254.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS complement(129816..130610) product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734279.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 gene speD CDS complement(130631..131491) product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829972.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 gene speE CDS complement(131598..131984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS 132147..133757 product multicopper oxidase CueO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000946058.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 gene cueO CDS complement(133835..136189) product pyrroloquinoline quinone-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829735.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS 136431..136967 product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683333.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 gene hpt CDS complement(137025..137639) product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651585.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 gene can CDS 137796..138722 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150644.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS 138719..139489 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983419.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 CDS complement(139609..140688) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301944.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS complement(140697..143243) product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097475.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS complement(143270..143953) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097474.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS complement(144001..144540) product type 1 fimbrial major subunit FimA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369870.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 gene fimA CDS 144910..145350 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901966.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS 145412..146641 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000245304.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS complement(146648..147028) product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621526.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 gene panD CDS complement(147123..147977) product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905353.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 gene panC CDS complement(148103..148894) product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043003.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 gene panB CDS complement(149015..149494) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150775.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 gene folK CDS complement(149491..150855) product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204100700.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 gene pcnB CDS complement(151050..151991) product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001763945.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 gene gluQRS CDS complement(152015..152470) product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001155232.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 gene dksA CDS complement(152647..153351) product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899414.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 gene sfsA CDS complement(153368..153898) product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294175.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 gene thpR CDS 153926..156400 product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938517.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 gene hrpB CDS 156541..159063 product bifunctional glycosyl transferase/transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918132.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 gene mrcB CDS 159356..161599 product ferrichrome porin FhuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124438.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 gene fhuA CDS 161648..162445 product Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157197.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 gene fhuC CDS 162445..163335 product Fe(3+)-hydroxamate ABC transporter substrate-binding protein FhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208784.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 gene fhuD CDS 163332..165389 product Fe(3+)-hydroxamate ABC transporter permease FhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088086.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 gene fhuB sequence10 source 1..140410 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(851..1867) product CDP-paratose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000770936.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS complement(1864..2688) product CDP-paratose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697757.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS complement(2740..4053) product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126347.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 gene rfbH CDS complement(4080..5159) product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565909.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 gene rfbG CDS complement(5164..5937) product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648783.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 gene rfbF CDS complement(5953..6927) product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018226.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS complement(6933..7484) product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973711.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 gene rfbC CDS complement(7485..8369) product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857536.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 gene rfbA CDS complement(8411..9310) product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023656.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 gene rfbD CDS complement(9310..10395) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697846.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 gene rfbB CDS complement(10772..11665) product GalU regulator GalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981469.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 gene galF CDS complement(11843..13246) product colanic acid biosynthesis protein WcaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001111852.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 gene wcaM CDS complement(13257..14477) product colanic acid biosynthesis glycosyltransferase WcaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868505.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 gene wcaL CDS complement(14474..15754) product colanic acid biosynthesis pyruvyl transferase WcaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097868.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 gene wcaK CDS complement(15776..17254) product colanic acid undecaprenyl disphosphate flippase WzxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058696.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 gene wzxC CDS complement(17356..18750) product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183160.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 gene wcaJ CDS complement(18804..20174) product colanic acid biosynthesis phosphomannomutase CpsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164216.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 gene cpsG CDS complement(20285..21721) product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605946.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 gene cpsB CDS complement(21724..22947) product colanic acid biosynthesis fucosyltransferase WcaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699650.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 gene wcaI CDS complement(22944..23417) product GDP-mannose mannosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001688181.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS complement(23420..24385) product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041701.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS complement(24388..25509) product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048162.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 gene gmd CDS complement(25533..26087) product colanic acid biosynthesis acetyltransferase WcaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153597.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 gene wcaF CDS complement(26103..26849) product colanic acid biosynthesis glycosyltransferase WcaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480132.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 gene wcaE CDS complement(26862..28076) product colanic acid polymerase WcaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107842.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 gene wcaD CDS complement(28051..29268) product colanic acid biosynthesis glycosyltransferase WcaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023824.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 gene wcaC CDS complement(29265..29753) product colanic acid biosynthesis acetyltransferase WcaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888724.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 gene wcaB CDS complement(29756..30598) product colanic acid biosynthesis glycosyltransferase WcaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097880.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 gene wcaA CDS complement(30685..32844) product tyrosine-protein kinase Wzc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137223.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 gene wzc CDS complement(32841..33290) product low molecular weight protein-tyrosine-phosphatase Wzb inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000482225.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 gene wzb CDS complement(33296..34342) product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978074.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS 35110..36690 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454718.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS complement(36776..38632) product outer membrane assembly protein AsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252274.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 gene asmA CDS complement(38671..39252) product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234783.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 gene dcd CDS complement(39343..39984) product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132082.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 gene udk CDS 40315..43305 product MASE1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042960.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS complement(43273..44142) product DNA-3-methyladenine glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494720.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 gene alkA CDS 44276..45628 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469615.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 gene yegD CDS 46069..47310 product multidrug efflux RND transporter subunit MdtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678826.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 gene mdtA CDS 47310..50432 product multidrug efflux RND transporter permease subunit MdtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197813.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 gene mdtB CDS 50433..53513 product multidrug efflux RND transporter permease subunit MdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001210089.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 gene mdtC CDS 53510..54922 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134351.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS 54922..56325 product two-component system sensor histidine kinase BaeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870082.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 gene baeS CDS 56322..57044 product two-component system response regulator BaeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137847.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 gene baeR CDS complement(57433..57600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS 57631..58515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989040.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS 58515..59231 product DUF1266 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498586.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS 59242..61353 product DUF4034 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434232.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS 61469..62830 product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001517981.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 gene yegQ CDS complement(63469..63885) product CesT family type III secretion system chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287291.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS 64904..65803 product lipid kinase YegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273393.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 gene yegS CDS complement(65856..66908) product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000129590.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 gene fbaB CDS 67162..68433 product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858692.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS 68430..69434 product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642789.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS 69431..70396 product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012656.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS complement(70370..71116) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434062.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS complement(71152..71952) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188955.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 gene thiD CDS complement(71939..72736) product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182157.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 gene thiM CDS complement(72835..73020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS 73146..73460 product Ni(II)/Co(II) efflux transporter accessory subunit RcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837534.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 gene rcnB CDS complement(73504..74526) product putative fimbrial-like adhesin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702202.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS complement(74542..77028) product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000945390.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS complement(77057..77737) product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677183.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS complement(77799..78332) product fimbrial protein YehD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830686.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 gene yehD CDS complement(78611..78892) product YehE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760404.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS complement(79170..80279) product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005426.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 gene apbC CDS 80444..82477 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195338.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 gene metG CDS 82718..83176 product YehR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703137.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS 83348..83878 product YehR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197951.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS complement(83935..84459) product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950413.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS complement(84449..85168) product two-component system response regulator BtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598632.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 gene btsR CDS complement(85165..86850) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272839.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS 87073..87804 product HTH-type transcriptional regulator MlrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240415.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 gene mlrA CDS complement(87952..88683) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824854.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS complement(88667..89614) product glycine betaine ABC transporter ATP binding protein YehX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569315.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 gene yehX CDS complement(89607..90776) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278105.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS complement(90780..91697) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155871.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS complement(91878..94175) product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871556.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 gene bglX CDS 94442..96172 product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095234.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 gene dld CDS complement(96231..97178) product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001319943.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 gene pbpG CDS complement(97344..97931) product Yip1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017057.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS 98090..98659 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000930540.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS complement(98708..99469) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169612.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS complement(99535..100971) product multidrug resistance outer membrane protein MdtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081453.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 gene mdtQ CDS 101162..101359 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS complement(101430..102368) product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001802202.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 gene dusC CDS complement(102477..103670) product 3-hydroxybenzoate 6-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150113.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS complement(103685..104329) product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781184.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 gene maiA CDS complement(104338..105039) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170621.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS complement(105055..106092) product gentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289858.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 gene gtdA CDS complement(106104..107462) product aromatic acid/H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194222.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 CDS 107588..108496 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024658.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS 108628..109026 product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045719.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 CDS 109023..109718 product CidB/LrgB family autolysis modulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000989296.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS 109872..110756 product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553529.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 gene cdd CDS 110933..111652 product outer membrane permeability protein SanA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920079.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 gene sanA CDS 111649..111894 product DUF2542 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605187.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS 112099..113340 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136400.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS 113334..114569 product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956072.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 gene preA CDS complement(114644..115654) product galactose/methyl galactoside ABC transporter permease MglC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275103.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 gene mglC CDS complement(115670..117190) product galactose/methyl galactoside ABC transporter ATP-binding protein MglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255032.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 gene mglA CDS complement(117324..118322) product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036947.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 gene mglB CDS complement(118821..119843) product HTH-type transcriptional regulator GalS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628627.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 gene galS CDS complement(119993..121135) product DUF418 domain-containing protein YeiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001765111.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 gene yeiB CDS complement(121150..121818) product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139611.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 gene folE CDS 122148..123005 product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425481.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 gene fghA CDS complement(122994..123383) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876815.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS complement(123388..124689) product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443204.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS 124972..125859 product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022911.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 gene serB CDS 125892..127214 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174929.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 CDS complement(127258..129249) product catecholate siderophore receptor CirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488257.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 gene cirA CDS complement(129595..131064) product lysine-specific permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534995.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 gene lysP CDS complement(131254..132117) product DNA-binding transcriptional regulator YeiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548316.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 gene yieE CDS 132238..133287 product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137966.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS 133366..134223 product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873905.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 gene nfo CDS complement(134288..135976) product PTS fructose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854408.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 gene fruA CDS complement(135993..136931) product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091249.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 gene fruK CDS complement(136931..138061) product fused PTS fructose transporter subunit IIA/HPr protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487294.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 gene fruB CDS 138430..139611 product sugar efflux transporter SetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551934.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 gene setB CDS complement(139675..140340) product GNVR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213885.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 sequence11 source 1..128154 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 174..905 product ABC transporter substrate-binding protein ArtJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737538.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 gene artJ CDS complement(1124..2611) product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644028.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS complement(2621..2941) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655400.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS complement(2971..4314) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399316.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS complement(4609..5736) product 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001149787.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 gene rlmC CDS complement(5779..6180) product DUF2593 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001763976.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS complement(6326..7171) product putrescine ABC transporter permease PotI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061634.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 gene potI CDS complement(7168..8121) product putrescine ABC transporter permease PotH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105449.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 gene potH CDS complement(8131..9264) product putrescine ABC transporter ATP-binding subunit PotG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996054.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 gene potG CDS complement(9352..10464) product spermidine/putrescine ABC transporter substrate-binding protein PotF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125773.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 gene potF CDS complement(10813..11289) product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624817.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS complement(11386..12288) product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684361.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 gene rimK CDS complement(12346..13068) product nitroreductase NfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075306.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 gene nfsA CDS complement(13052..13342) product YbjC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259133.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS 13512..13775 product GrxA family glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495513.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS complement(13807..14184) product inner membrane protein YbjM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680848.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS 14455..14613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22630 note possible pseudo, internal stop codon CDS 14653..16140 product aspartate:alanine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024851.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS complement(16257..16889) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661882.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 CDS 17045..18256 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217437.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS 18253..19068 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023559.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 CDS complement(19122..20354) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181284.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS 20601..21275 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001520197.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 gene ybjG CDS 21347..22105 product DNA-binding transcriptional repressor DeoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450106.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 gene deoR CDS complement(22150..23220) product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195712.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 gene dacC CDS 23596..24222 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631908.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS complement(24219..24383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22730 note possible pseudo, internal stop codon, frameshifted CDS complement(24401..24901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22740 note possible pseudo, internal stop codon, frameshifted CDS 25245..25670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS 25932..26822 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811152.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS complement(26828..28513) product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033449775.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS complement(28962..30125) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085913.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS complement(30122..30385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS complement(30418..31371) product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189890.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS complement(31382..32131) product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447049.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS complement(32154..32669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS complement(33382..33765) product biofilm formation regulator BssR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000259651.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 gene bssR CDS 33996..35321 product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073304.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 gene rimO CDS complement(35412..36323) product glutathione ABC transporter permease GsiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236024.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 gene gsiD CDS complement(36326..37246) product glutathione ABC transporter permease GsiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936066.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 gene gsiC CDS complement(37307..38845) product glutathione ABC transporter substrate-binding protein GsiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191432.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 gene gsiB CDS complement(38878..40749) product glutathione ABC transporter ATP-binding protein GsiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120605.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 gene gsiA CDS complement(40760..41701) product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030503.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 gene iaaA CDS 41904..43139 product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014343820.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 gene moeA CDS 43139..43888 product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829275.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 gene moeB CDS 44166..45065 product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576948.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS 45071..47503 product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192654.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS complement(47581..48390) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217910.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS 48652..49917 product DUF1479 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210972.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 CDS 50299..50748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22960 note possible pseudo, internal stop codon CDS complement(50870..51766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS complement(52013..53605) product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961480.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS 53824..54744 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056404.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 gene ldtB CDS complement(54788..55900) product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046516.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS complement(55897..56370) product manganese-binding transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533542.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 gene mntR CDS 56556..56684 product manganase accumulation protein MntS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001761.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 gene mntS CDS 56949..58529 product phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089326.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS complement(58591..59106) product outer membrane protein OmpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716763.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 gene ompX CDS 59459..60346 product threonine/homoserine exporter RhtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119558.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 gene rhtA CDS 60649..61152 product DNA starvation/stationary phase protection protein Dps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100805.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 gene dps CDS 61629..62375 product glutamine ABC transporter substrate-binding protein GlnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838671.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 gene glnH CDS 62519..63178 product glutamine ABC transporter permease GlnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159076.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 gene glnP CDS 63175..63897 product glutamine ABC transporter ATP-binding protein GlnQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569093.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 gene glnQ CDS 64016..66232 product mechanosensitive channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267712.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 gene ybiO CDS complement(66229..67155) product 23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305954.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 gene rlmF CDS 67360..67626 product DksA/TraR family C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146332.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS 67911..68171 product DUF1471 family protein YbiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000849089.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 gene ybiJ CDS complement(68327..69301) product DNA-binding protein YbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386513.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 gene ybiB CDS complement(69331..71475) product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704815.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 gene dinG CDS complement(71683..73044) product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007058.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 gene rhlE CDS 73274..73948 product transcriptional regulator CecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025256.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 gene cecR CDS 73948..74943 product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743445.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 gene hlyD CDS 74936..76672 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287626.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS 76665..77795 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045765.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS 77911..79017 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469048.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS complement(78979..79389) product YbhQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871970.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS 79522..80280 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192041.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS 80277..81518 product cardiolipin synthase ClsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649638.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 gene clsB CDS 81518..82480 product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129824.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS complement(82483..83043) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS complement(83051..83641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS complement(83683..84204) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS complement(84535..85239) product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367602.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS complement(85287..85739) product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545202.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 gene moaE CDS complement(85741..85986) product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001575835.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 gene moaD CDS complement(85979..86464) product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080893.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 gene moaC CDS complement(86467..86979) product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084604.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 gene moaB CDS complement(87001..88023) product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168180.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 gene moaA CDS 88387..89295 product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246034.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 gene yvcK CDS complement(89387..89971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23360 note possible pseudo, frameshifted CDS complement(90061..90717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23370 note possible pseudo, internal stop codon, frameshifted CDS complement(90805..91641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23380 note possible pseudo, internal stop codon, frameshifted CDS complement(92131..94152) product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042501.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 gene uvrB CDS complement(94803..95489) product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167219.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 gene bioD CDS complement(95482..96237) product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079913.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 gene bioC CDS complement(96221..97378) product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118943.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 gene bioF CDS complement(97375..98415) product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090724.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 gene bioB CDS 98502..99791 product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205503.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 gene bioA CDS 99849..100325 product kinase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767403.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 CDS complement(100410..101930) product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095232.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 gene hutH CDS complement(101932..103617) product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115205.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 gene hutU CDS complement(103814..104539) product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287410.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 CDS complement(104584..105525) product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195673.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 gene hutG CDS complement(105522..106691) product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249497.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 gene hutI CDS 106983..108266 product putative acyl-CoA thioester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094768.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS complement(108410..109405) product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815470.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 gene pgl CDS 109527..110387 product pyridoxal phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989132.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS complement(110388..111446) product molybdenum ABC transporter ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891721.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 gene modC CDS complement(111449..112138) product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604026.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 gene modB CDS complement(112138..112911) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951413.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 gene modA CDS complement(113078..113329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS 113356..114144 product molybdenum-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147416.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 gene modE CDS 114212..115687 product molybdate ABC transporter ATP-binding protein ModF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096923.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 gene modF CDS 115858..116766 product DUF2167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885529.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS 116989..118005 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001265456.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 gene galE CDS 118016..119062 product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187468.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 gene galT CDS 119065..120213 product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049364.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 gene galK CDS 120207..121247 product galactose-1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931431.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 gene galM CDS 121471..122223 product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301554.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 gene gpmA CDS complement(122314..123090) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253471.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 CDS complement(123090..124073) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128344.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS complement(124549..125247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703615.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS complement(125366..126667) product oxalacetate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444843.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 misc_feature complement(126680..>128154) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000150450.1:sodium-extruding oxaloacetate decarboxylase subunit alpha locus_tag LOCUS_23700 sequence12 source 1..123737 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 348..905 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS 921..2759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23720 CDS 2827..3105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23730 CDS complement(3333..4214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23740 CDS 4580..5188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS 5550..6047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23760 CDS 6526..6777 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212204.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 CDS complement(6849..8123) product integrase arm-type DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032666220.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 tRNA complement(8303..8378) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 tRNA complement(9273..9348) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 CDS complement(9449..10246) product DgsA anti-repressor MtfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598924.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 gene mtfA tRNA 10335..10424 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 CDS 11439..12257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23800 CDS 12719..13741 product IS110-like element IS1111A family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041952483.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 CDS complement(13914..14063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23820 tRNA complement(14936..15023) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 CDS 15259..16197 product glyoxylate/hydroxypyruvate reductase GhrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402555.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 gene ghrA CDS 16282..17019 product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283643.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS 17043..17597 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001883.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS 17698..18180 product DUF1097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337814.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS complement(18219..19052) product curli production assembly/transport protein CsgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137620.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 gene csgG CDS complement(19079..19495) product curli production assembly/transport protein CsgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264073.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 gene csgF CDS complement(19522..19917) product curli production assembly/transport protein CsgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833307.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 gene csgE CDS complement(19922..20572) product biofilm master transcriptional regulator CsgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481516.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 gene csgD CDS 21300..21782 product curli minor subunit CsgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791653.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 gene csgB CDS 21824..22279 product curli major subunit CsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771416.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 gene csgA CDS 22341..22667 product curli assembly chaperone CsgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557254.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 gene csgC CDS 22798..23118 product type 1 fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111254.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS 23205..23744 product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203944.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 gene ymdB CDS 23680..25167 product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976323.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS complement(25184..26338) product glucans biosynthesis protein MdoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100054.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 gene mdoC CDS 26613..28145 product glucans biosynthesis protein MdoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001562609.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 gene mdoG CDS 28138..30681 product glucans biosynthesis glucosyltransferase MdoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044602.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 gene mdoH CDS 30755..30982 product YceK/YidQ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217832.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS complement(30983..31357) product MysB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180050.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 CDS complement(31439..32653) product multidrug efflux MFS transporter MdtG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075040.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 gene mdtG CDS complement(32808..33728) product Kdo(2)-lipid IV(A) acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163974.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 CDS 33948..35000 product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144640.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS complement(35052..35627) product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739886.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 CDS complement(35624..36196) product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011132.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 CDS complement(36613..37731) product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872781.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 gene solA CDS complement(37844..38098) product biofilm formation regulator BssS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414441.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 gene bssS CDS complement(38388..38633) product DNA damage-inducible protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217768.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 gene dinI CDS complement(38707..39753) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126592.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 gene pyrC CDS complement(39857..40417) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713057.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 CDS complement(40542..41189) product glutaredoxin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780893.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 gene grxB CDS complement(41253..42461) product multidrug efflux MFS transporter MdtH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092170.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 gene mdtH CDS 42698..43282 product ribosomal protein S5-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468201.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 gene rimJ CDS 43318..43965 product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873047.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 CDS 43967..44890 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259737.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 CDS 45155..46729 product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001155214.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 gene murJ CDS complement(46811..47233) product flagella biosynthesis chaperone FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197547.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 gene flgN CDS complement(47238..47531) product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020892.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 gene flgM CDS complement(47623..48282) product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194076.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 gene flgA CDS 48439..48855 product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887042.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 gene flgB CDS 48859..49263 product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196448.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 gene flgC CDS 49275..49973 product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020450.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 gene flgD CDS 50000..51211 product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010567.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 gene flgE CDS 51232..51987 product flagellar basal body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349284.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS 52001..52783 product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625851.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 gene flgG CDS 52838..53536 product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174897.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 gene flgH CDS 53542..54645 product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518955.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS 54645..55595 product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578683.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 gene flgJ CDS 55660..57321 product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096425.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 gene flgK CDS 57336..58289 product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223025.1 transl_table 11 codon_start 1 locus_tag LOCUS_24310 gene flgL CDS complement(58536..61742) product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827472.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 gene rne CDS 62316..63275 product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846324.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 gene rluC CDS 63413..64174 product DUF3053 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094974.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 CDS 64377..64601 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24350 CDS complement(64672..65256) product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137608.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 CDS 65454..65975 product 23S rRNA accumulation protein YceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174492.1 transl_table 11 codon_start 1 locus_tag LOCUS_24370 gene yceD CDS 66027..66200 product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290727.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 gene rpmF CDS 66334..67413 product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518286.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 gene plsX CDS 67493..68446 product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288151.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 gene fabH CDS 68462..69391 product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191346.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 gene fabD CDS 69404..70138 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007236.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 gene fabG CDS 70294..70530 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103754.1 transl_table 11 codon_start 1 locus_tag LOCUS_24430 gene acpP CDS 70616..71857 product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044667.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 gene fabF CDS 71981..72790 product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478660.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 gene pabC CDS 72793..73815 product cell division protein YceG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000736473.1 transl_table 11 codon_start 1 locus_tag LOCUS_24460 gene yceG CDS 73805..74446 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535399.1 transl_table 11 codon_start 1 locus_tag LOCUS_24470 gene tmk CDS 74443..75447 product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872450.1 transl_table 11 codon_start 1 locus_tag LOCUS_24480 gene holB CDS 75458..76255 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480274.1 transl_table 11 codon_start 1 locus_tag LOCUS_24490 CDS 76550..77983 product PTS glucose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000475735.1 transl_table 11 codon_start 1 locus_tag LOCUS_24500 gene ptsG CDS complement(78068..80242) product ferric-rhodotorulic acid/ferric-coprogen receptor FhuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953420.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 gene fhuE CDS 80584..80943 product purine nucleoside phosphoramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001532068.1 transl_table 11 codon_start 1 locus_tag LOCUS_24520 gene hinT CDS 80946..81320 product YcfL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589560.1 transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS 81334..81972 product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164360.1 transl_table 11 codon_start 1 locus_tag LOCUS_24540 gene lpoB CDS 81953..82777 product thiamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257320.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 gene thiK CDS 82788..83813 product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529339.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 gene nagZ CDS 83838..84380 product alpha/beta hydrolase YcfP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587943.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 gene ycfP CDS 84635..85939 product NADH-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211053.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 gene ndh CDS 86118..86657 product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043449.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 CDS complement(86731..87366) product TetR family copper-responsive transcriptional repressor ComR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205980.1 transl_table 11 codon_start 1 locus_tag LOCUS_24600 gene comR CDS 87608..87865 product multiple stress resistance protein BhsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800134.1 transl_table 11 codon_start 1 locus_tag LOCUS_24610 gene bhsA CDS complement(87962..88927) product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000482967.1 transl_table 11 codon_start 1 locus_tag LOCUS_24620 CDS complement(89075..92521) product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114340.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 gene mfd CDS 92859..94058 product lipoprotein-releasing ABC transporter permease subunit LolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272105.1 transl_table 11 codon_start 1 locus_tag LOCUS_24640 gene lolC CDS 94051..94752 product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033714.1 transl_table 11 codon_start 1 locus_tag LOCUS_24650 gene lolD CDS 94752..95996 product lipoprotein-releasing ABC transporter permease subunit LolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168092.1 transl_table 11 codon_start 1 locus_tag LOCUS_24660 gene lolE CDS 96025..96936 product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291327.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 gene nagK CDS 96955..97776 product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191856.1 transl_table 11 codon_start 1 locus_tag LOCUS_24680 gene cobB CDS complement(97858..98904) product spermidine/putrescine ABC transporter substrate-binding protein PotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759329.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 gene potD CDS complement(98929..99708) product spermidine/putrescine ABC transporter permease PotC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580299.1 transl_table 11 codon_start 1 locus_tag LOCUS_24700 gene potC CDS complement(100024..101034) product SPI-2 type III secretion system effector SifA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001682002.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 gene sifA CDS complement(101363..102226) product spermidine/putrescine ABC transporter permease PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799391.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 gene potB CDS complement(102210..103346) product spermidine/putrescine ABC transporter ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531581.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 gene potA CDS 103597..104826 product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359416.1 transl_table 11 codon_start 1 locus_tag LOCUS_24740 gene pepT CDS 104830..106164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902462.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 CDS complement(106204..107325) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456524.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 CDS complement(107406..108869) product two-component system sensor histidine kinase PhoQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031689.1 transl_table 11 codon_start 1 locus_tag LOCUS_24770 gene phoQ CDS complement(108869..109543) product two-component system response regulator PhoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986522.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 gene phoP CDS complement(109667..111037) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423756.1 transl_table 11 codon_start 1 locus_tag LOCUS_24790 gene purB CDS complement(111041..111688) product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024131182.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 gene hflD CDS complement(111769..112920) product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004540.1 transl_table 11 codon_start 1 locus_tag LOCUS_24810 gene mnmA CDS complement(112929..113390) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476064.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS complement(113402..113731) product lysozyme inhibitor LprI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825956.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS complement(113728..114267) product 23S rRNA pseudouridine(2457) synthase RluE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249410.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 gene rluE CDS 114565..115815 product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444506.1 transl_table 11 codon_start 1 locus_tag LOCUS_24850 gene icd CDS 116276..117400 product type III secretion system effector SopF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917281.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 gene sopF CDS complement(117855..118061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24870 CDS complement(118491..119171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS complement(119661..119900) product virulence protein MsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497451.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 gene msgA CDS complement(120091..120513) product RICIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001537478.1 transl_table 11 codon_start 1 locus_tag LOCUS_24900 CDS complement(121028..121240) product cold shock-like protein CspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001537306.1 transl_table 11 codon_start 1 locus_tag LOCUS_24910 gene cspF CDS 122447..123004 product virulence membrane protein PagC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789474.1 transl_table 11 codon_start 1 locus_tag LOCUS_24920 gene pagC tRNA 123395..123471 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 sequence13 source 1..123551 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(697..2679) product two-partner secretion translocator ZirT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000232040.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 gene zirT CDS complement(2754..3512) product two-partner-like secretion system exoprotein ZirU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273672.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 gene zirU CDS 3899..4750 product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989022.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 CDS 5634..6251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24960 CDS complement(6465..6701) product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168017.1 transl_table 11 codon_start 1 locus_tag LOCUS_24970 CDS complement(6830..7420) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208481.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 CDS 7498..8211 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979081.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 gene bdcA CDS complement(8302..9138) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456775.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 CDS complement(9447..10352) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359197.1 transl_table 11 codon_start 1 locus_tag LOCUS_25010 CDS 10471..11400 product aromatic alcohol reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814344.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 CDS complement(11497..13110) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216556.1 transl_table 11 codon_start 1 locus_tag LOCUS_25030 CDS 13300..14028 product murein tripeptide amidase MpaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219125.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 gene mpaA CDS complement(14003..14968) product L-Ala-D/L-Glu epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258077.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 gene ycjG CDS 15084..15590 product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084375.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 gene tpx CDS complement(15680..17221) product transcriptional regulator TyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235493.1 transl_table 11 codon_start 1 locus_tag LOCUS_25070 gene tyrR CDS complement(17369..18430) product YcjF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294457.1 transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS complement(18427..19824) product YcjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825858.1 transl_table 11 codon_start 1 locus_tag LOCUS_25090 CDS complement(19973..20287) product thiosulfate sulfurtransferase PspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913432.1 transl_table 11 codon_start 1 locus_tag LOCUS_25100 gene pspE CDS complement(20363..20581) product phage shock protein PspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097607.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 gene pspD CDS complement(20604..20963) product envelope stress response membrane protein PspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014347.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 gene pspC CDS complement(20963..21187) product envelope stress response membrane protein PspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274953.1 transl_table 11 codon_start 1 locus_tag LOCUS_25130 gene pspB CDS complement(21247..21915) product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511000.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 gene pspA CDS 22086..23066 product phage shock protein operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001764157.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 gene pspF CDS 23178..24827 product peptide ABC transporter substrate-binding protein SapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241626.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 gene sapA CDS 24824..25789 product peptide ABC transporter permease SapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583298.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 gene sapB CDS 25776..26666 product peptide ABC transporter permease SapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146150.1 transl_table 11 codon_start 1 locus_tag LOCUS_25180 gene sapC CDS 26666..27658 product peptide ABC transporter ATP-binding protein SapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128869.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 gene sapD CDS 27660..28466 product peptide ABC transporter ATP-binding protein SapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230463.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 gene sapF CDS complement(28482..29189) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268399.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS complement(29656..30633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS 31634..32422 product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506501.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 gene fabI CDS 32622..33755 product CMD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298115.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS 33844..35778 product exoribonuclease II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000485046.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 CDS 36040..38022 product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989147.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 gene pdeR CDS 38144..38323 product protein YciZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069350.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 gene yciZ CDS 38410..39162 product DNA-binding transcriptional regulator YciT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088593.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 CDS 39421..39639 product osmotically-inducible lipoprotein OsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480930.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 gene osmB CDS complement(39759..40085) product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285199.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 gene yciH CDS complement(40085..40822) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001763993.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 gene pyrF CDS complement(41013..42182) product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891378.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 gene lapB CDS complement(42189..42497) product LapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876301.1 transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS complement(42647..43411) product phosphatidylglycerophosphatase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948651.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 gene pgpB CDS 43607..44197 product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176284.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 gene ribA CDS complement(44253..46928) product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099459.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 gene acnA CDS complement(47905..48879) product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776231.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 gene cysB CDS complement(49290..51887) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513593.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 gene topA CDS 52290..52541 product YciN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548616.1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 CDS complement(52583..53629) product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422082.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 gene sohB CDS 53867..54628 product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559310.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 CDS 54625..55215 product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278854.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 gene cobO CDS complement(55302..56177) product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291232.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 gene rluB CDS complement(56278..56898) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077250.1 transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS complement(56906..57787) product RNase AM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000500433.1 transl_table 11 codon_start 1 locus_tag LOCUS_25450 gene rnm CDS 58048..59610 product anthranilate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194375.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 CDS 59610..61205 product bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763483.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 gene trpD CDS 61209..62567 product bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195287.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 gene trpCF CDS 62577..63770 product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209485.1 transl_table 11 codon_start 1 locus_tag LOCUS_25490 gene trpB CDS 63770..64576 product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443029.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 gene trpA CDS 65056..65238 product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807657.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 CDS 65328..65831 product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001022822.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 CDS 65905..66411 product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109977.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 CDS 66431..67309 product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488351.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS complement(67391..68029) product outer membrane protein OmpW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714798.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 gene ompW CDS 68797..69540 product YciC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028506.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 CDS 69597..70136 product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808682.1 transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS 70297..70698 product acyl-CoA thioester hydrolase YciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210317.1 transl_table 11 codon_start 1 locus_tag LOCUS_25580 gene yciA CDS complement(70757..71485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25590 CDS 71709..72005 product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000967605.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 CDS 72365..73825 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206886.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 gene cls CDS 73838..74188 product HI1450 family dsDNA-mimic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069343.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 note possible pseudo, internal stop codon, frameshifted CDS complement(74236..75072) product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045367413.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 CDS complement(75120..76124) product murein tripeptide/oligopeptide ABC transporter ATP-binding protein OppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994698.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 gene oppF CDS complement(76121..77128) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058853.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS complement(77140..78036) product oligopeptide ABC transporter permease OppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096272.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 gene oppC CDS complement(78051..78971) product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911094.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 gene oppB CDS complement(79093..80724) product oligopeptide ABC transporter substrate-binding protein OppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560668.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 gene oppA CDS complement(81488..82135) product YchE family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615840.1 transl_table 11 codon_start 1 locus_tag LOCUS_25690 CDS 82612..85290 product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301680.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 gene adhE CDS complement(85487..86104) product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068097.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 gene tdk CDS 86767..87180 product DNA-binding transcriptional regulator H-NS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287383.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 gene hns CDS complement(87312..88220) product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729450.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 gene galU CDS complement(88423..89436) product two-component system response regulator RssB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193432.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 gene rssB CDS complement(89527..90423) product patatin-like phospholipase RssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230581.1 transl_table 11 codon_start 1 locus_tag LOCUS_25750 gene rssA CDS 90543..91001 product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001361954.1 transl_table 11 codon_start 1 locus_tag LOCUS_25760 CDS 91052..91894 product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191159.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 gene purU tRNA 92235..92319 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 tRNA 92530..92614 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 CDS complement(93241..94770) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212716.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 CDS complement(95012..95689) product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545591.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 gene narI CDS complement(95689..96399) product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571671.1 transl_table 11 codon_start 1 locus_tag LOCUS_25800 gene narJ CDS complement(96396..97934) product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702629.1 transl_table 11 codon_start 1 locus_tag LOCUS_25810 gene narH CDS complement(97931..101674) product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032878.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 CDS complement(102062..103459) product nitrate transporter NarK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019848.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 gene narK CDS 103800..105596 product nitrate/nitrite two-component system sensor histidine kinase NarX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476239.1 transl_table 11 codon_start 1 locus_tag LOCUS_25840 gene narX CDS 105589..106239 product two-component system response regulator NarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064595.1 transl_table 11 codon_start 1 locus_tag LOCUS_25850 gene narL CDS complement(106240..107664) product YchO/YchP family invasin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008985.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 CDS 107841..108194 product DsrE/DsrF/TusD sulfur relay family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179794.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 CDS complement(108274..108504) product putative cation transport regulator ChaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146392.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 gene chaB CDS 108771..109871 product sodium-potassium/proton antiporter ChaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148419.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 gene chaA CDS complement(109925..110779) product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811046.1 transl_table 11 codon_start 1 locus_tag LOCUS_25900 gene kdsA CDS complement(110817..111626) product invasion regulator SirB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257065.1 transl_table 11 codon_start 1 locus_tag LOCUS_25910 gene sirB1 CDS complement(111630..112019) product invasion regulator SirB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150667.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 gene sirB2 CDS complement(112016..112849) product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347320.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 gene prmC CDS complement(112849..113931) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804703.1 transl_table 11 codon_start 1 locus_tag LOCUS_25940 gene prfA CDS complement(113972..115228) product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173208.1 transl_table 11 codon_start 1 locus_tag LOCUS_25950 gene hemA CDS 115542..116165 product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174482.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 gene lolB CDS 116162..117013 product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988253.1 transl_table 11 codon_start 1 locus_tag LOCUS_25970 gene ispE CDS 117261..118226 product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119392.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 gene prs CDS 118351..120036 product C4-dicarboxylic acid transporter DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037188.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 gene dauA CDS complement(120081..120359) product stress-induced protein YchH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823885.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 gene ychH CDS 120635..121219 product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985595.1 transl_table 11 codon_start 1 locus_tag LOCUS_26010 gene pth CDS 121336..122427 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505850.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 gene ychF sequence14 source 1..114591 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 392..1384 product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194451.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 CDS 1387..3189 product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089679.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 CDS 3209..3883 product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924456.1 transl_table 11 codon_start 1 locus_tag LOCUS_26050 gene cybH CDS 3889..4497 product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852667.1 transl_table 11 codon_start 1 locus_tag LOCUS_26060 gene hybD CDS 4497..4796 product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334908.1 transl_table 11 codon_start 1 locus_tag LOCUS_26070 gene hypC CDS 4793..5203 product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155978.1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS 5221..6282 product hydrogenase expression/formation C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016742.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 CDS 6254..6442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26100 CDS 6456..7157 product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189412.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 CDS 7170..7511 product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544945.1 transl_table 11 codon_start 1 locus_tag LOCUS_26120 gene hypA CDS complement(7652..8770) product porin OmpN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837937.1 transl_table 11 codon_start 1 locus_tag LOCUS_26130 gene ompN CDS 9402..9599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26140 CDS 9553..10029 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513115.1 transl_table 11 codon_start 1 locus_tag LOCUS_26150 CDS complement(10085..10999) product bestrophin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001670736.1 transl_table 11 codon_start 1 locus_tag LOCUS_26160 CDS complement(11254..11613) product DUF4186 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992456.1 transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS complement(11613..12539) product glutaminase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257409.1 transl_table 11 codon_start 1 locus_tag LOCUS_26180 gene glsB CDS complement(12612..14000) product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178397.1 transl_table 11 codon_start 1 locus_tag LOCUS_26190 gene sad CDS 14103..14975 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366540.1 transl_table 11 codon_start 1 locus_tag LOCUS_26200 CDS 15091..16281 product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154617.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 CDS complement(16328..16993) product MarC family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968968.1 transl_table 11 codon_start 1 locus_tag LOCUS_26220 CDS 17252..17686 product multiple antibiotic resistance transcriptional regulator MarR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843434.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 gene marR CDS 17706..18089 product MDR efflux pump AcrAB transcriptional activator MarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091194.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 gene marA CDS 18124..18333 product multiple antibiotic resistance protein MarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783049.1 transl_table 11 codon_start 1 locus_tag LOCUS_26250 gene marB CDS complement(18452..19354) product O-acetylserine/cysteine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987753.1 transl_table 11 codon_start 1 locus_tag LOCUS_26260 gene eamA CDS 19582..20769 product efflux MFS transporter YdeE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068053.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 gene ydeE CDS complement(21460..21852) product YdeI family stress tolerance OB fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776348.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 CDS 22280..22807 product 2-oxo-tetronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235351.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 CDS complement(22943..23125) product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807642.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 CDS complement(23469..25511) product peptidyl-dipeptidase Dcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106277.1 transl_table 11 codon_start 1 locus_tag LOCUS_26310 gene dcp CDS 25650..26396 product bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636564.1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 gene ydfG CDS 26526..27212 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215563.1 transl_table 11 codon_start 1 locus_tag LOCUS_26330 CDS 27394..27597 product putative selenium delivery protein YdfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000989267.1 transl_table 11 codon_start 1 locus_tag LOCUS_26340 gene ydfZ CDS complement(27664..29130) product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181244.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS complement(29274..30653) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192118.1 transl_table 11 codon_start 1 locus_tag LOCUS_26360 CDS complement(30707..31726) product Zn-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096790.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 CDS complement(31737..32951) product starvation-sensing protein RspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706283.1 transl_table 11 codon_start 1 locus_tag LOCUS_26380 gene rspA CDS complement(33073..33399) product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921383.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 CDS 33551..33892 product DUF1283 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066440.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 CDS 33928..34488 product spermidine N1-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199998.1 transl_table 11 codon_start 1 locus_tag LOCUS_26410 gene speG CDS complement(34529..35206) product YnfC family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743128.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 CDS 35346..35651 product DUF1161 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059218804.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 CDS 35808..38246 product DmsA/YnfE/YnfF family dimethyl sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117601.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 CDS 38345..40780 product DmsA/YnfE/YnfF family dimethyl sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705268.1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 CDS 40791..41408 product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213069.1 transl_table 11 codon_start 1 locus_tag LOCUS_26460 gene dmsB CDS 41410..42267 product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534718.1 transl_table 11 codon_start 1 locus_tag LOCUS_26470 CDS 42310..42924 product Tat proofreading chaperone DmsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206559.1 transl_table 11 codon_start 1 locus_tag LOCUS_26480 gene dmsD CDS 43229..43939 product osmoprotectant ABC transporter permease OsmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547814.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 gene osmY CDS 43968..44870 product osmoprotectant ABC transporter substrate-binding protein OsmX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211196.1 transl_table 11 codon_start 1 locus_tag LOCUS_26500 gene osmX CDS 44880..45527 product osmoprotectant ABC transporter permease OsmW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379676.1 transl_table 11 codon_start 1 locus_tag LOCUS_26510 gene osmW CDS 45527..46675 product osmoprotectant ABC transporter ATP-binding protein OsmV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593089.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 gene osmV CDS 46811..48100 product voltage-gated ClC-type chloride channel ClcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000554911.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 gene clcB CDS complement(48056..48751) product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919236.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 gene bioD CDS complement(48877..50097) product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225096.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 CDS complement(50225..51124) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019571.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 CDS complement(51408..51602) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26570 CDS 51601..52497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26580 CDS 52892..53140 product acid resistance repetitive basic protein Asr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001766314.1 transl_table 11 codon_start 1 locus_tag LOCUS_26590 gene asr CDS 53409..54230 product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549642.1 transl_table 11 codon_start 1 locus_tag LOCUS_26600 CDS complement(54270..54599) product multidrug/spermidine efflux SMR transporter subunit MdtI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183821.1 transl_table 11 codon_start 1 locus_tag LOCUS_26610 gene mdtI CDS complement(54586..54948) product multidrug/spermidine efflux SMR transporter subunit MdtJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000500278.1 transl_table 11 codon_start 1 locus_tag LOCUS_26620 gene mdtJ CDS 55366..56400 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118268.1 transl_table 11 codon_start 1 locus_tag LOCUS_26630 CDS complement(56575..57963) product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014056.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 gene pntB CDS complement(57974..59503) product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219360.1 transl_table 11 codon_start 1 locus_tag LOCUS_26650 gene pntA CDS 60030..60974 product DUF1471 family protein YdgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769298.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 gene ydgH CDS 61273..62655 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412353.1 transl_table 11 codon_start 1 locus_tag LOCUS_26670 CDS complement(62717..63052) product GlpM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524877.1 transl_table 11 codon_start 1 locus_tag LOCUS_26680 CDS 63179..63910 product two-component system response regulator RstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080045.1 transl_table 11 codon_start 1 locus_tag LOCUS_26690 gene rstA CDS complement(64088..64333) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26700 CDS 64390..65541 product porin OmpS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824321.1 transl_table 11 codon_start 1 locus_tag LOCUS_26710 gene ompS2 CDS 65700..67400 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928668.1 transl_table 11 codon_start 1 locus_tag LOCUS_26720 CDS 67511..68812 product two-component system sensor histidine kinase RstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732951.1 transl_table 11 codon_start 1 locus_tag LOCUS_26730 gene rstB CDS 68888..69817 product DNA replication terminus site-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092483.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 gene tus CDS complement(69814..71217) product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000259129.1 transl_table 11 codon_start 1 locus_tag LOCUS_26750 gene fumC CDS complement(71385..73031) product class I fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066606.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 gene fumB CDS 73231..74406 product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170615.1 transl_table 11 codon_start 1 locus_tag LOCUS_26770 gene manA CDS 74509..76017 product YdgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753325.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 CDS 76207..76356 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26790 note possible pseudo, frameshifted CDS 76712..77713 product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565566.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 gene add CDS complement(77788..78828) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014343837.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 CDS 79459..79674 product transcription modulator YdgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217946.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 gene ydgT CDS 79730..80203 product DUF2569 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214061.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 CDS 80280..80861 product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133179.1 transl_table 11 codon_start 1 locus_tag LOCUS_26840 gene rsxA CDS 80861..81439 product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092600.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 gene rsxB CDS 81432..83546 product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000915582.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 gene rsxC CDS 83547..84605 product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000231887.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 gene rsxD CDS 84609..85229 product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920820.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 gene rsxG CDS 85232..85924 product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289628.1 transl_table 11 codon_start 1 locus_tag LOCUS_26890 CDS 85924..86559 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030324.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 gene nth CDS 87160..88665 product dipeptide/tripeptide permease DtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100913.1 transl_table 11 codon_start 1 locus_tag LOCUS_26910 gene dtpA CDS 88770..89375 product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765713.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 gene gstA CDS complement(89434..90294) product pyridoxal kinase PdxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789751.1 transl_table 11 codon_start 1 locus_tag LOCUS_26930 gene pdxY CDS complement(90354..91628) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168626.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 gene tyrS CDS complement(91755..92411) product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282834.1 transl_table 11 codon_start 1 locus_tag LOCUS_26950 gene pdxH CDS complement(92470..92775) product C-type lysozyme inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061974.1 transl_table 11 codon_start 1 locus_tag LOCUS_26960 gene mliC CDS complement(92887..94008) product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835021.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 gene anmK CDS 94280..94747 product outer membrane lipoprotein SlyB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597179.1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 gene slyB CDS complement(94795..95229) product transcriptional regulator SlyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445639.1 transl_table 11 codon_start 1 locus_tag LOCUS_26990 gene slyA CDS 95669..96529 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016506.1 transl_table 11 codon_start 1 locus_tag LOCUS_27000 CDS 96529..98568 product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777620.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 CDS complement(98544..99065) product superoxide dismutase [Cu-Zn] SodC2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826818.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 gene sodC2 CDS complement(99145..100041) product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250718.1 transl_table 11 codon_start 1 locus_tag LOCUS_27030 CDS 100434..101033 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041823.1 transl_table 11 codon_start 1 locus_tag LOCUS_27040 CDS 101092..102189 product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092935.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 CDS 102258..102665 product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237787.1 transl_table 11 codon_start 1 locus_tag LOCUS_27060 gene gloA CDS 102766..103413 product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282267.1 transl_table 11 codon_start 1 locus_tag LOCUS_27070 gene rnt CDS complement(103491..103838) product monothiol glutaredoxin 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108176.1 transl_table 11 codon_start 1 locus_tag LOCUS_27080 gene grxD CDS complement(104083..104268) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27090 CDS 104552..104995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS 105122..105703 product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007299.1 transl_table 11 codon_start 1 locus_tag LOCUS_27110 gene sodB CDS 106171..107196 product HTH-type transcriptional repressor PurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190992.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 gene purR CDS complement(107193..108125) product DNA-binding transcriptional activator PunR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269528.1 transl_table 11 codon_start 1 locus_tag LOCUS_27130 gene punR CDS 108238..109443 product purine nucleoside transporter PunC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182326.1 transl_table 11 codon_start 1 locus_tag LOCUS_27140 gene punC CDS 109733..110881 product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098879.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 gene cfa CDS complement(110923..111564) product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493973.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 CDS 111781..113154 product multidrug efflux MATE transporter MdtK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001175077.1 transl_table 11 codon_start 1 locus_tag LOCUS_27170 tRNA 113306..113382 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 tRNA 113393..113469 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 misc_feature complement(113627..>114591) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001291715.1:SPI-2 type III secretion system apparatus protein SsaU locus_tag LOCUS_27180 sequence15 source 1..104078 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(92..943) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201804.1 transl_table 11 codon_start 1 locus_tag LOCUS_27190 gene murI CDS complement(888..2732) product TonB-dependent vitamin B12 receptor BtuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000591414.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 gene btuB CDS 3106..4206 product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186987.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 gene trmA CDS complement(4253..4612) product YijD family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813838.1 transl_table 11 codon_start 1 locus_tag LOCUS_27220 CDS complement(4628..5263) product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001537960.1 transl_table 11 codon_start 1 locus_tag LOCUS_27230 gene fabR CDS 5528..6862 product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120789.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 gene sthA CDS complement(6845..7762) product DNA-binding transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025919.1 transl_table 11 codon_start 1 locus_tag LOCUS_27250 gene oxyR CDS complement(8046..9422) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230038.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 gene argH CDS complement(9540..10313) product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001575262.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 gene argB CDS complement(10324..11328) product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935332.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 gene argC CDS complement(11519..11719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27290 CDS 11639..12568 product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800207.1 transl_table 11 codon_start 1 locus_tag LOCUS_27300 gene argE CDS 12937..15588 product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005544.1 transl_table 11 codon_start 1 locus_tag LOCUS_27310 gene ppc CDS 15799..17532 product phosphoethanolamine transferase CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192092.1 transl_table 11 codon_start 1 locus_tag LOCUS_27320 CDS 17693..18544 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000274601.1 transl_table 11 codon_start 1 locus_tag LOCUS_27330 CDS complement(18531..18884) product PTS fructose-like transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323848.1 transl_table 11 codon_start 1 locus_tag LOCUS_27340 CDS complement(18886..19764) product [formate-C-acetyltransferase]-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204105.1 transl_table 11 codon_start 1 locus_tag LOCUS_27350 CDS complement(19730..22027) product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184831.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 CDS complement(22126..22446) product PTS fructose-like transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161259.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 CDS complement(22461..23540) product PTS fructose transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001004469.1 transl_table 11 codon_start 1 locus_tag LOCUS_27380 CDS 23849..26350 product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174077.1 transl_table 11 codon_start 1 locus_tag LOCUS_27390 gene ptsP CDS 26361..27023 product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424865.1 transl_table 11 codon_start 1 locus_tag LOCUS_27400 gene fsa CDS 27035..28138 product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000374033.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 CDS 28397..29020 product DUF1287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647891.1 transl_table 11 codon_start 1 locus_tag LOCUS_27420 CDS complement(29078..31258) product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108110.1 transl_table 11 codon_start 1 locus_tag LOCUS_27430 gene katG CDS complement(31423..32313) product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007509.1 transl_table 11 codon_start 1 locus_tag LOCUS_27440 gene metF CDS 32592..34073 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090459.1 transl_table 11 codon_start 1 locus_tag LOCUS_27450 CDS complement(34018..35124) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976816.1 transl_table 11 codon_start 1 locus_tag LOCUS_27460 gene alr CDS complement(35121..36359) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087881318.1 transl_table 11 codon_start 1 locus_tag LOCUS_27470 CDS complement(36624..38180) product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865256.1 transl_table 11 codon_start 1 locus_tag LOCUS_27480 CDS 38316..39440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001134817.1 transl_table 11 codon_start 1 locus_tag LOCUS_27490 CDS 40467..40673 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27500 CDS 40676..41533 product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369769.1 transl_table 11 codon_start 1 locus_tag LOCUS_27510 CDS complement(41649..44081) product bifunctional aspartate kinase/homoserine dehydrogenase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110811.1 transl_table 11 codon_start 1 locus_tag LOCUS_27520 gene metL CDS complement(44084..45244) product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197208.1 transl_table 11 codon_start 1 locus_tag LOCUS_27530 gene metB CDS 45509..45826 product met regulon transcriptional regulator MetJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852811.1 transl_table 11 codon_start 1 locus_tag LOCUS_27540 gene metJ CDS 46424..48073 product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669894.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 CDS 48274..48936 product TIGR02117 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792797.1 transl_table 11 codon_start 1 locus_tag LOCUS_27560 CDS complement(48981..49193) product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715284.1 transl_table 11 codon_start 1 locus_tag LOCUS_27570 gene rpmE CDS 49397..51595 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109394.1 transl_table 11 codon_start 1 locus_tag LOCUS_27580 gene priA CDS 51750..52775 product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841337.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 gene cytR CDS 52962..53843 product cell division protein FtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068798.1 transl_table 11 codon_start 1 locus_tag LOCUS_27600 gene ftsN CDS 53935..54465 product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208240.1 transl_table 11 codon_start 1 locus_tag LOCUS_27610 gene hslV CDS 54475..55806 product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293355.1 transl_table 11 codon_start 1 locus_tag LOCUS_27620 gene hslU CDS 55873..56802 product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139635.1 transl_table 11 codon_start 1 locus_tag LOCUS_27630 gene menA CDS 56895..57380 product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872918.1 transl_table 11 codon_start 1 locus_tag LOCUS_27640 gene rraA CDS complement(57602..57841) product septal ring assembly protein ZapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051368.1 transl_table 11 codon_start 1 locus_tag LOCUS_27650 gene zapB CDS 58240..59085 product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084284.1 transl_table 11 codon_start 1 locus_tag LOCUS_27660 CDS 59106..60614 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137244.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 gene glpK CDS 60726..61736 product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250625.1 transl_table 11 codon_start 1 locus_tag LOCUS_27680 gene glpX CDS 61833..62579 product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796307.1 transl_table 11 codon_start 1 locus_tag LOCUS_27690 gene fpr CDS complement(62685..63113) product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155237.1 transl_table 11 codon_start 1 locus_tag LOCUS_27700 CDS 63214..63810 product YiiQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802241.1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 CDS 63923..64690 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216342.1 transl_table 11 codon_start 1 locus_tag LOCUS_27720 gene tpiA CDS complement(64782..65546) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088043.1 transl_table 11 codon_start 1 locus_tag LOCUS_27730 CDS complement(65556..65849) product (4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001543603.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 gene lsrG CDS complement(65928..66803) product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774152.1 transl_table 11 codon_start 1 locus_tag LOCUS_27750 gene lsrF CDS complement(66832..67854) product autoinducer 2 ABC transporter substrate-binding protein LsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090739.1 transl_table 11 codon_start 1 locus_tag LOCUS_27760 gene lsrB CDS complement(67883..68884) product autoinducer 2 ABC transporter permease LsrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981826.1 transl_table 11 codon_start 1 locus_tag LOCUS_27770 gene lsrD CDS complement(68881..69924) product autoinducer 2 ABC transporter permease LsrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911130.1 transl_table 11 codon_start 1 locus_tag LOCUS_27780 gene lsrC CDS complement(69918..71453) product autoinducer 2 ABC transporter ATP-binding protein LsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167253.1 transl_table 11 codon_start 1 locus_tag LOCUS_27790 gene lsrA CDS 71710..72669 product transcriptional regulator LsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283049.1 transl_table 11 codon_start 1 locus_tag LOCUS_27800 gene lsrR CDS 72798..74348 product autoinducer-2 kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113082.1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 gene lsrK CDS 74362..74712 product dimethylsulfonioproprionate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000909989.1 transl_table 11 codon_start 1 locus_tag LOCUS_27820 CDS complement(74949..75119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27830 CDS complement(75217..75948) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001764005.1 transl_table 11 codon_start 1 locus_tag LOCUS_27840 CDS complement(76002..77042) product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557877.1 transl_table 11 codon_start 1 locus_tag LOCUS_27850 CDS complement(77052..78011) product aminoimidazole riboside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646490.1 transl_table 11 codon_start 1 locus_tag LOCUS_27860 CDS complement(78022..79356) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095593.1 transl_table 11 codon_start 1 locus_tag LOCUS_27870 CDS complement(79620..80375) product CDP-diacylglycerol diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750765.1 transl_table 11 codon_start 1 locus_tag LOCUS_27880 CDS complement(80476..81465) product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758715.1 transl_table 11 codon_start 1 locus_tag LOCUS_27890 CDS complement(81669..82631) product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000591793.1 transl_table 11 codon_start 1 locus_tag LOCUS_27900 gene pfkA CDS complement(82816..83718) product CDF family cation-efflux transporter FieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077323.1 transl_table 11 codon_start 1 locus_tag LOCUS_27910 gene fieF CDS complement(83866..84366) product cell-envelope stress modulator CpxP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233466.1 transl_table 11 codon_start 1 locus_tag LOCUS_27920 gene cpxP CDS 84517..85215 product envelope stress response regulator transcription factor CpxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033727.1 transl_table 11 codon_start 1 locus_tag LOCUS_27930 gene cpxR CDS 85212..86585 product envelope stress sensor histidine kinase CpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580402.1 transl_table 11 codon_start 1 locus_tag LOCUS_27940 gene cpxA CDS complement(86633..86836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27950 CDS complement(86957..87352) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133445.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 CDS complement(87364..88053) product 6-hydroxyaminopurine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014343930.1 transl_table 11 codon_start 1 locus_tag LOCUS_27970 gene yiiM CDS complement(88123..88743) product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122632.1 transl_table 11 codon_start 1 locus_tag LOCUS_27980 gene sodA CDS 89073..89888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27990 CDS 89794..90963 product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566798.1 transl_table 11 codon_start 1 locus_tag LOCUS_28000 CDS complement(91121..91792) product oligogalacturonate-specific porin KdgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378721.1 transl_table 11 codon_start 1 locus_tag LOCUS_28010 CDS 92423..93457 product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063537.1 transl_table 11 codon_start 1 locus_tag LOCUS_28020 gene rhaT CDS complement(93454..94302) product HTH-type transcriptional activator RhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013291.1 transl_table 11 codon_start 1 locus_tag LOCUS_28030 gene rhaR CDS complement(94455..95291) product HTH-type transcriptional activator RhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217112.1 transl_table 11 codon_start 1 locus_tag LOCUS_28040 gene rhaS CDS 95579..97048 product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000143961.1 transl_table 11 codon_start 1 locus_tag LOCUS_28050 gene rhaB CDS 97045..98304 product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211475.1 transl_table 11 codon_start 1 locus_tag LOCUS_28060 CDS 98447..99274 product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179732.1 transl_table 11 codon_start 1 locus_tag LOCUS_28070 gene rhaD CDS 99401..100549 product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009255.1 transl_table 11 codon_start 1 locus_tag LOCUS_28080 gene fucO CDS 100546..100860 product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619478.1 transl_table 11 codon_start 1 locus_tag LOCUS_28090 gene rhaM CDS complement(100949..101497) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989088.1 transl_table 11 codon_start 1 locus_tag LOCUS_28100 CDS 101598..102257 product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683586.1 transl_table 11 codon_start 1 locus_tag LOCUS_28110 CDS 102257..102580 product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368956.1 transl_table 11 codon_start 1 locus_tag LOCUS_28120 CDS complement(102936..104036) product YiiG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828045.1 transl_table 11 codon_start 1 locus_tag LOCUS_28130 sequence16 source 1..98417 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 645..2843 product ornithine decarboxylase SpeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046082898.1 transl_table 11 codon_start 1 locus_tag LOCUS_28140 gene speF CDS 2840..4159 product putrescine-ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042659.1 transl_table 11 codon_start 1 locus_tag LOCUS_28150 gene potE CDS 4224..4709 product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070053.1 transl_table 11 codon_start 1 locus_tag LOCUS_28160 CDS complement(4824..6464) product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974369.1 transl_table 11 codon_start 1 locus_tag LOCUS_28170 gene pgm CDS complement(6489..7031) product replication initiation negative regulator SeqA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848395.1 transl_table 11 codon_start 1 locus_tag LOCUS_28180 gene seqA CDS 7216..7986 product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000773252.1 transl_table 11 codon_start 1 locus_tag LOCUS_28190 gene ybfF CDS 8120..8413 product LexA regulated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040939.1 transl_table 11 codon_start 1 locus_tag LOCUS_28200 gene ybfE CDS 8564..9094 product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018622.1 transl_table 11 codon_start 1 locus_tag LOCUS_28210 gene fldA CDS 9376..9828 product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131699.1 transl_table 11 codon_start 1 locus_tag LOCUS_28220 gene fur CDS 9943..10869 product tricarballylate utilization LysR family transcriptional regulator TcuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423368.1 transl_table 11 codon_start 1 locus_tag LOCUS_28230 gene tcuR CDS 10967..12370 product FAD-dependent tricarballylate dehydrogenase TcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228705.1 transl_table 11 codon_start 1 locus_tag LOCUS_28240 gene tcuA CDS 12357..13496 product tricarballylate utilization protein TcuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811143.1 transl_table 11 codon_start 1 locus_tag LOCUS_28250 gene tcuB CDS 13547..14851 product tricarballylate/proton symporter TcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057014.1 transl_table 11 codon_start 1 locus_tag LOCUS_28260 gene tcuC CDS complement(14900..15232) product ChiQ/YbfN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722260.1 transl_table 11 codon_start 1 locus_tag LOCUS_28270 gene chiQ CDS complement(15282..16688) product chitoporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258803.1 transl_table 11 codon_start 1 locus_tag LOCUS_28280 gene chiP CDS complement(17349..19016) product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287188.1 transl_table 11 codon_start 1 locus_tag LOCUS_28290 gene glnS CDS complement(19227..21179) product PTS N-acetyl glucosamine transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023150.1 transl_table 11 codon_start 1 locus_tag LOCUS_28300 gene nagE CDS 21506..22306 product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237064.1 transl_table 11 codon_start 1 locus_tag LOCUS_28310 gene nagB CDS 22366..23520 product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271187.1 transl_table 11 codon_start 1 locus_tag LOCUS_28320 gene nagA CDS 23525..24745 product DNA-binding transcriptional regulator NagC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187578.1 transl_table 11 codon_start 1 locus_tag LOCUS_28330 gene nagC CDS 24792..25544 product ribonucleotide monophosphatase NagD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153143.1 transl_table 11 codon_start 1 locus_tag LOCUS_28340 gene nagD CDS 25834..27498 product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337026.1 transl_table 11 codon_start 1 locus_tag LOCUS_28350 gene asnB tRNA 27720..27796 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 tRNA 27805..27889 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 tRNA 27913..27987 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 tRNA 28023..28097 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 tRNA 28113..28189 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 tRNA 28236..28310 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 tRNA 28354..28428 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 CDS 28747..29139 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28360 CDS complement(29206..30381) product 3-demethoxyubiquinol 3-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184625.1 transl_table 11 codon_start 1 locus_tag LOCUS_28370 gene ubiF CDS 30525..31949 product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519200.1 transl_table 11 codon_start 1 locus_tag LOCUS_28380 gene miaB CDS 32154..33200 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493272.1 transl_table 11 codon_start 1 locus_tag LOCUS_28390 CDS 33197..33670 product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084477.1 transl_table 11 codon_start 1 locus_tag LOCUS_28400 gene ybeY CDS 33828..34706 product CNNM family magnesium/cobalt transport protein CorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278615.1 transl_table 11 codon_start 1 locus_tag LOCUS_28410 gene corC CDS 34726..36264 product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853074.1 transl_table 11 codon_start 1 locus_tag LOCUS_28420 gene lnt CDS 36619..37527 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588823.1 transl_table 11 codon_start 1 locus_tag LOCUS_28430 CDS 37687..38427 product glutamate/aspartate ABC transporter permease GltJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020930.1 transl_table 11 codon_start 1 locus_tag LOCUS_28440 gene gltJ CDS 38427..39101 product glutamate/aspartate ABC transporter permease GltK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272799.1 transl_table 11 codon_start 1 locus_tag LOCUS_28450 gene gltK CDS 39101..39826 product glutamate/aspartate ABC transporter ATP-binding protein GltL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631369.1 transl_table 11 codon_start 1 locus_tag LOCUS_28460 gene gltL CDS 39943..40878 product pyrimidine-specific ribonucleoside hydrolase RihA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207423.1 transl_table 11 codon_start 1 locus_tag LOCUS_28470 gene rihA CDS 40910..42148 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191774878.1 transl_table 11 codon_start 1 locus_tag LOCUS_28480 CDS 42224..43903 product molecular chaperone HscC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367875.1 transl_table 11 codon_start 1 locus_tag LOCUS_28490 gene hscC CDS complement(43925..45397) product co-chaperone DjlC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300403.1 transl_table 11 codon_start 1 locus_tag LOCUS_28500 gene djlC CDS complement(45394..46089) product DUF1266 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030930.1 transl_table 11 codon_start 1 locus_tag LOCUS_28510 CDS complement(46101..47534) product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786582.1 transl_table 11 codon_start 1 locus_tag LOCUS_28520 CDS complement(47531..48238) product DUF1266 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367041.1 transl_table 11 codon_start 1 locus_tag LOCUS_28530 CDS 48363..49358 product Sel1 family TPR-like repeat protein YbeQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578153.1 transl_table 11 codon_start 1 locus_tag LOCUS_28540 gene ybeQ CDS complement(49397..49870) product zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044885.1 transl_table 11 codon_start 1 locus_tag LOCUS_28550 CDS complement(49963..51891) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044179.1 transl_table 11 codon_start 1 locus_tag LOCUS_28560 CDS complement(51959..52912) product 2-keto-3-deoxygluconate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000694473.1 transl_table 11 codon_start 1 locus_tag LOCUS_28570 CDS complement(52962..54134) product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460067.1 transl_table 11 codon_start 1 locus_tag LOCUS_28580 CDS complement(54151..54441) product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812779.1 transl_table 11 codon_start 1 locus_tag LOCUS_28590 CDS 54729..57311 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157907.1 transl_table 11 codon_start 1 locus_tag LOCUS_28600 gene leuS CDS 57326..57916 product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269949.1 transl_table 11 codon_start 1 locus_tag LOCUS_28610 gene lptE CDS 57916..58947 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620491.1 transl_table 11 codon_start 1 locus_tag LOCUS_28620 gene holA CDS 58949..59590 product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989126.1 transl_table 11 codon_start 1 locus_tag LOCUS_28630 gene nadD CDS complement(59565..60659) product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173241.1 transl_table 11 codon_start 1 locus_tag LOCUS_28640 gene cobD CDS 60756..61364 product adenosylcobalamin/alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241920.1 transl_table 11 codon_start 1 locus_tag LOCUS_28650 CDS 61693..62010 product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161670.1 transl_table 11 codon_start 1 locus_tag LOCUS_28660 gene rsfS CDS 62014..62481 product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776107.1 transl_table 11 codon_start 1 locus_tag LOCUS_28670 gene rlmH CDS 62512..64413 product peptidoglycan DD-transpeptidase MrdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828701.1 transl_table 11 codon_start 1 locus_tag LOCUS_28680 gene mrdA CDS 64416..65528 product peptidoglycan glycosyltransferase MrdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131713.1 transl_table 11 codon_start 1 locus_tag LOCUS_28690 gene mrdB CDS 65539..66672 product endolytic peptidoglycan transglycosylase RlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549517.1 transl_table 11 codon_start 1 locus_tag LOCUS_28700 gene rlpA CDS 66813..68024 product D-alanyl-D-alanine carboxypeptidase DacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858714.1 transl_table 11 codon_start 1 locus_tag LOCUS_28710 gene dacA CDS 68132..68395 product DUF493 family protein YbeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850547.1 transl_table 11 codon_start 1 locus_tag LOCUS_28720 gene ybeD CDS 68495..69136 product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284017.1 transl_table 11 codon_start 1 locus_tag LOCUS_28730 gene lipB CDS 69438..70391 product YbeF family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282817.1 transl_table 11 codon_start 1 locus_tag LOCUS_28740 CDS 70597..71562 product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042639.1 transl_table 11 codon_start 1 locus_tag LOCUS_28750 gene lipA CDS complement(71648..71851) product twin-arginine translocase subunit TatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503938.1 transl_table 11 codon_start 1 locus_tag LOCUS_28760 gene tatE CDS complement(71980..72768) product deaminated glutathione amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000959109.1 transl_table 11 codon_start 1 locus_tag LOCUS_28770 CDS 72859..73242 product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939753.1 transl_table 11 codon_start 1 locus_tag LOCUS_28780 gene crcB CDS complement(73300..73509) product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034826.1 transl_table 11 codon_start 1 locus_tag LOCUS_28790 gene cspE CDS complement(73697..74215) product lipid IV(A) palmitoyltransferase PagP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001784638.1 transl_table 11 codon_start 1 locus_tag LOCUS_28800 gene pagP CDS 74648..76033 product anaerobic C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958619.1 transl_table 11 codon_start 1 locus_tag LOCUS_28810 gene dcuC CDS complement(76087..76767) product two-component response regulator DpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138786.1 transl_table 11 codon_start 1 locus_tag LOCUS_28820 gene dpiA CDS complement(76736..78397) product sensor histidine kinase DpiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121811.1 transl_table 11 codon_start 1 locus_tag LOCUS_28830 gene dpiB CDS 78782..79858 product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001723760.1 transl_table 11 codon_start 1 locus_tag LOCUS_28840 gene citC CDS 79855..80151 product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700679.1 transl_table 11 codon_start 1 locus_tag LOCUS_28850 gene citD CDS 80148..81056 product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622336.1 transl_table 11 codon_start 1 locus_tag LOCUS_28860 CDS 81066..82595 product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192347.1 transl_table 11 codon_start 1 locus_tag LOCUS_28870 gene citF CDS 82599..83150 product citrate lyase holo-[acyl-carrier protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236063.1 transl_table 11 codon_start 1 locus_tag LOCUS_28880 gene citX CDS 83122..84018 product triphosphoribosyl-dephospho-CoA synthase CitG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982670.1 transl_table 11 codon_start 1 locus_tag LOCUS_28890 gene citG CDS 84056..85519 product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059033.1 transl_table 11 codon_start 1 locus_tag LOCUS_28900 CDS 85629..86435 product ribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092588.1 transl_table 11 codon_start 1 locus_tag LOCUS_28910 gene rna CDS 86670..87080 product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089748.1 transl_table 11 codon_start 1 locus_tag LOCUS_28920 gene rnk CDS complement(87163..88401) product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646123.1 transl_table 11 codon_start 1 locus_tag LOCUS_28930 CDS 88624..89052 product universal stress protein UspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278499.1 transl_table 11 codon_start 1 locus_tag LOCUS_28940 gene uspG CDS complement(89120..89887) product dimethyl sulfoxide reductase anchor subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417104.1 transl_table 11 codon_start 1 locus_tag LOCUS_28950 CDS complement(89887..90444) product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250378.1 transl_table 11 codon_start 1 locus_tag LOCUS_28960 CDS complement(90441..92720) product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064331.1 transl_table 11 codon_start 1 locus_tag LOCUS_28970 CDS complement(92713..93273) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377438.1 transl_table 11 codon_start 1 locus_tag LOCUS_28980 CDS complement(93606..95171) product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887645.1 transl_table 11 codon_start 1 locus_tag LOCUS_28990 gene ahpF CDS complement(95413..95976) product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052802.1 transl_table 11 codon_start 1 locus_tag LOCUS_29000 gene ahpC CDS 96417..97163 product thiol:disulfide interchange protein DsbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597117.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 gene dsbG CDS 97480..98382 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002489.1 transl_table 11 codon_start 1 locus_tag LOCUS_29020 sequence17 source 1..89182 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(21..566) product menaquinone-dependent protoporphyrinogen IX dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853982.1 transl_table 11 codon_start 1 locus_tag LOCUS_29030 gene hemG CDS complement(578..2029) product Trk system potassium transporter TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545686.1 transl_table 11 codon_start 1 locus_tag LOCUS_29040 gene trkH CDS complement(2068..2682) product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378910.1 transl_table 11 codon_start 1 locus_tag LOCUS_29050 CDS complement(2682..4013) product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444529.1 transl_table 11 codon_start 1 locus_tag LOCUS_29060 gene pepQ CDS 4203..6392 product fatty acid oxidation complex subunit alpha FadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966004.1 transl_table 11 codon_start 1 locus_tag LOCUS_29070 gene fadB CDS 6402..7565 product acetyl-CoA C-acyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438778.1 transl_table 11 codon_start 1 locus_tag LOCUS_29080 gene fadA CDS complement(7762..9585) product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669894.1 transl_table 11 codon_start 1 locus_tag LOCUS_29090 CDS complement(9839..10540) product NAD(P)H-flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209828.1 transl_table 11 codon_start 1 locus_tag LOCUS_29100 gene fre CDS complement(10626..12104) product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339760.1 transl_table 11 codon_start 1 locus_tag LOCUS_29110 gene ubiD CDS 12290..12778 product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192407.1 transl_table 11 codon_start 1 locus_tag LOCUS_29120 gene rfaH CDS complement(12786..13580) product 3'-5' ssDNA/RNA exonuclease TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459642.1 transl_table 11 codon_start 1 locus_tag LOCUS_29130 gene tatD CDS complement(13610..14389) product Sec-independent protein translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257554.1 transl_table 11 codon_start 1 locus_tag LOCUS_29140 gene tatC CDS complement(14392..14940) product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459611.1 transl_table 11 codon_start 1 locus_tag LOCUS_29150 gene tatB CDS complement(14944..15198) product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000508972.1 transl_table 11 codon_start 1 locus_tag LOCUS_29160 gene tatA CDS complement(15404..17044) product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187559.1 transl_table 11 codon_start 1 locus_tag LOCUS_29170 gene ubiB CDS complement(17041..17646) product ubiquinone biosynthesis protein UbiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116094.1 transl_table 11 codon_start 1 locus_tag LOCUS_29180 gene ubiJ CDS complement(17656..18411) product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229009.1 transl_table 11 codon_start 1 locus_tag LOCUS_29190 gene ubiE CDS complement(18507..19937) product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355562.1 transl_table 11 codon_start 1 locus_tag LOCUS_29200 gene rmuC CDS complement(20077..20838) product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045169.1 transl_table 11 codon_start 1 locus_tag LOCUS_29210 gene udp CDS 21220..21909 product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213961.1 transl_table 11 codon_start 1 locus_tag LOCUS_29220 CDS complement(21989..23284) product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017936.1 transl_table 11 codon_start 1 locus_tag LOCUS_29230 CDS complement(23676..25940) product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154198.1 transl_table 11 codon_start 1 locus_tag LOCUS_29240 gene metE CDS 26189..27142 product HTH-type transcriptional regulator MetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569786.1 transl_table 11 codon_start 1 locus_tag LOCUS_29250 gene metR CDS complement(27030..27929) product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196257.1 transl_table 11 codon_start 1 locus_tag LOCUS_29260 CDS complement(28010..28810) product sugar/pyridoxal phosphate phosphatase YigL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285338.1 transl_table 11 codon_start 1 locus_tag LOCUS_29270 gene yigL CDS complement(28826..29842) product lysophospholipase L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487681.1 transl_table 11 codon_start 1 locus_tag LOCUS_29280 gene pldB CDS 29953..30573 product homoserine/homoserine lactone efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000142520.1 transl_table 11 codon_start 1 locus_tag LOCUS_29290 gene rhtB CDS complement(30613..31116) product threonine export protein RhtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928814.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 gene rhtC CDS complement(31297..33144) product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001533487.1 transl_table 11 codon_start 1 locus_tag LOCUS_29310 gene recQ CDS complement(33210..34079) product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201692.1 transl_table 11 codon_start 1 locus_tag LOCUS_29320 gene pldA CDS 34244..34711 product acyl-CoA thioesterase YigI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277136.1 transl_table 11 codon_start 1 locus_tag LOCUS_29330 gene yigI CDS 34755..35642 product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339085.1 transl_table 11 codon_start 1 locus_tag LOCUS_29340 gene rarD CDS complement(35682..35978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000526434.1 transl_table 11 codon_start 1 locus_tag LOCUS_29350 CDS complement(36581..37531) product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947139.1 transl_table 11 codon_start 1 locus_tag LOCUS_29360 gene corA CDS complement(38003..40165) product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383444.1 transl_table 11 codon_start 1 locus_tag LOCUS_29370 gene uvrD CDS complement(40301..41017) product 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213563.1 transl_table 11 codon_start 1 locus_tag LOCUS_29380 gene yigB CDS complement(41017..41919) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141123.1 transl_table 11 codon_start 1 locus_tag LOCUS_29390 gene xerC CDS complement(41916..42623) product DUF484 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812770.1 transl_table 11 codon_start 1 locus_tag LOCUS_29400 CDS complement(42620..43444) product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160671.1 transl_table 11 codon_start 1 locus_tag LOCUS_29410 gene dapF CDS complement(43481..43684) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799903.1 transl_table 11 codon_start 1 locus_tag LOCUS_29420 CDS 44160..44393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29430 note possible pseudo, internal stop codon CDS 44390..44770 product DUF3021 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125556.1 transl_table 11 codon_start 1 locus_tag LOCUS_29440 CDS 44840..45160 product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999925.1 transl_table 11 codon_start 1 locus_tag LOCUS_29450 gene cyaY CDS complement(45238..47784) product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281718.1 transl_table 11 codon_start 1 locus_tag LOCUS_29460 gene cyaA CDS 48242..49102 product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001521319.1 transl_table 11 codon_start 1 locus_tag LOCUS_29470 gene hemC CDS 49099..49839 product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025500.1 transl_table 11 codon_start 1 locus_tag LOCUS_29480 gene hemD CDS 49861..51030 product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138976.1 transl_table 11 codon_start 1 locus_tag LOCUS_29490 gene hemX CDS 51030..52229 product protoheme IX biogenesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979262.1 transl_table 11 codon_start 1 locus_tag LOCUS_29500 gene hemY tRNA complement(52811..52887) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 tRNA complement(52930..53016) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 tRNA complement(53037..53112) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 tRNA complement(53167..53243) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 CDS complement(53346..54731) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818378.1 transl_table 11 codon_start 1 locus_tag LOCUS_29510 CDS complement(54938..55678) product lipopolysaccharide N-acetylmannosaminouronosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183613.1 transl_table 11 codon_start 1 locus_tag LOCUS_29520 gene wecG CDS complement(55675..57033) product ECA oligosaccharide polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055604.1 transl_table 11 codon_start 1 locus_tag LOCUS_29530 gene wzyE CDS complement(57030..58109) product TDP-N-acetylfucosamine:lipid II N-acetylfucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217177.1 transl_table 11 codon_start 1 locus_tag LOCUS_29540 CDS complement(58106..59356) product lipid III flippase WzxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050302.1 transl_table 11 codon_start 1 locus_tag LOCUS_29550 gene wzxE CDS complement(59358..60488) product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612080.1 transl_table 11 codon_start 1 locus_tag LOCUS_29560 gene rffA CDS complement(60493..61170) product dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012539915.1 transl_table 11 codon_start 1 locus_tag LOCUS_29570 gene rffC CDS complement(61148..61372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29580 CDS complement(61405..62472) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822139.1 transl_table 11 codon_start 1 locus_tag LOCUS_29590 gene rffG CDS complement(62472..63734) product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011236.1 transl_table 11 codon_start 1 locus_tag LOCUS_29600 gene wecC CDS complement(63731..64861) product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866686.1 transl_table 11 codon_start 1 locus_tag LOCUS_29610 gene wecB CDS complement(64917..65963) product ECA polysaccharide chain length modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193415.1 transl_table 11 codon_start 1 locus_tag LOCUS_29620 gene wzzE CDS complement(65975..66814) product UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771938.1 transl_table 11 codon_start 1 locus_tag LOCUS_29630 gene wecA CDS complement(67308..68567) product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054532.1 transl_table 11 codon_start 1 locus_tag LOCUS_29640 gene rho CDS complement(68986..69315) product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305383.1 transl_table 11 codon_start 1 locus_tag LOCUS_29650 gene trxA CDS 69459..70724 product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047525.1 transl_table 11 codon_start 1 locus_tag LOCUS_29660 gene rhlB CDS 70861..72342 product guanosine-5'-triphosphate,3'-diphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089447.1 transl_table 11 codon_start 1 locus_tag LOCUS_29670 gene gppA CDS complement(72382..74406) product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238841.1 transl_table 11 codon_start 1 locus_tag LOCUS_29680 gene rep CDS 74944..75225 product peptidylprolyl isomerase PpiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096806.1 transl_table 11 codon_start 1 locus_tag LOCUS_29690 gene ppiC CDS complement(75317..76792) product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024943.1 transl_table 11 codon_start 1 locus_tag LOCUS_29700 gene ilvC CDS 76957..77844 product HTH-type transcriptional activator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365798.1 transl_table 11 codon_start 1 locus_tag LOCUS_29710 gene ilvY CDS complement(77847..78188) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560819.1 transl_table 11 codon_start 1 locus_tag LOCUS_29720 CDS complement(78185..78547) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001779357.1 transl_table 11 codon_start 1 locus_tag LOCUS_29730 CDS 78537..78716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29740 CDS complement(78785..80329) product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989250.1 transl_table 11 codon_start 1 locus_tag LOCUS_29750 gene ilvA CDS complement(80332..82182) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127449.1 transl_table 11 codon_start 1 locus_tag LOCUS_29760 gene ilvD CDS complement(82342..83271) product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208528.1 transl_table 11 codon_start 1 locus_tag LOCUS_29770 gene ilvE CDS complement(83289..83552) product acetolactate synthase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001576447.1 transl_table 11 codon_start 1 locus_tag LOCUS_29780 gene ilvM CDS complement(83549..85195) product acetolactate synthase 2 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012560.1 transl_table 11 codon_start 1 locus_tag LOCUS_29790 gene ilvG CDS 85785..87305 product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058995.1 transl_table 11 codon_start 1 locus_tag LOCUS_29800 CDS complement(87330..87668) product macrodomain Ori organization protein MaoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840996.1 transl_table 11 codon_start 1 locus_tag LOCUS_29810 gene maoP CDS 87787..88623 product HTH-type transcriptional regulator HdfR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001541181.1 transl_table 11 codon_start 1 locus_tag LOCUS_29820 gene hdfR tRNA complement(88726..88801) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 tRNA complement(88810..88886) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00560 rRNA complement(88944..89054) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00050 sequence18 source 1..86853 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 230..1456 product DUF3748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809957.1 transl_table 11 codon_start 1 locus_tag LOCUS_29830 CDS complement(1458..1718) product YceK/YidQ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012543411.1 transl_table 11 codon_start 1 locus_tag LOCUS_29840 CDS 2094..2513 product heat shock chaperone IbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001532742.1 transl_table 11 codon_start 1 locus_tag LOCUS_29850 gene ibpA CDS 2623..3051 product heat shock chaperone IbpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001766501.1 transl_table 11 codon_start 1 locus_tag LOCUS_29860 gene ibpB CDS 3240..4901 product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279784.1 transl_table 11 codon_start 1 locus_tag LOCUS_29870 CDS 5345..5692 product YidH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640235.1 transl_table 11 codon_start 1 locus_tag LOCUS_29880 CDS 5682..6044 product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113457.1 transl_table 11 codon_start 1 locus_tag LOCUS_29890 CDS 6041..6571 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147843.1 transl_table 11 codon_start 1 locus_tag LOCUS_29900 CDS complement(6653..7975) product D-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427787.1 transl_table 11 codon_start 1 locus_tag LOCUS_29910 gene dsdA CDS complement(7993..9330) product D-serine transporter DsdX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543313.1 transl_table 11 codon_start 1 locus_tag LOCUS_29920 gene dsdX CDS 9541..10479 product DNA-binding transcriptional regulator DsdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989264.1 transl_table 11 codon_start 1 locus_tag LOCUS_29930 gene dsdC CDS 10567..11628 product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238915.1 transl_table 11 codon_start 1 locus_tag LOCUS_29940 CDS complement(11555..12739) product multidrug efflux MFS transporter EmrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828742.1 transl_table 11 codon_start 1 locus_tag LOCUS_29950 gene emrD CDS complement(12942..13775) product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094802.1 transl_table 11 codon_start 1 locus_tag LOCUS_29960 CDS 14823..16511 product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168445.1 transl_table 11 codon_start 1 locus_tag LOCUS_29970 gene ilvB CDS 16515..16805 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171826.1 transl_table 11 codon_start 1 locus_tag LOCUS_29980 gene ilvN CDS complement(16807..17592) product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448638.1 transl_table 11 codon_start 1 locus_tag LOCUS_29990 CDS 17917..18837 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350272.1 transl_table 11 codon_start 1 locus_tag LOCUS_30000 gene rbsK CDS 18868..20184 product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998359.1 transl_table 11 codon_start 1 locus_tag LOCUS_30010 gene fucP CDS 20196..21209 product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213216.1 transl_table 11 codon_start 1 locus_tag LOCUS_30020 CDS 21363..21953 product transcriptional regulator UhpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633674.1 transl_table 11 codon_start 1 locus_tag LOCUS_30030 gene uhpA CDS 21953..23455 product signal transduction histidine-protein kinase/phosphatase UhpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091255.1 transl_table 11 codon_start 1 locus_tag LOCUS_30040 gene uhpB CDS 23465..24757 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948180.1 transl_table 11 codon_start 1 locus_tag LOCUS_30050 CDS 24935..26326 product hexose-6-phosphate:phosphate antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879212.1 transl_table 11 codon_start 1 locus_tag LOCUS_30060 gene uhpT CDS 26519..26971 product DUF1198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519640.1 transl_table 11 codon_start 1 locus_tag LOCUS_30070 CDS complement(27404..27727) product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274842.1 transl_table 11 codon_start 1 locus_tag LOCUS_30080 CDS complement(27711..28115) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001263506.1 transl_table 11 codon_start 1 locus_tag LOCUS_30090 CDS 28286..29479 product purine ribonucleoside efflux pump NepI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001004798.1 transl_table 11 codon_start 1 locus_tag LOCUS_30100 gene nepI CDS complement(29539..30921) product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270464.1 transl_table 11 codon_start 1 locus_tag LOCUS_30110 CDS complement(31027..31320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824217.1 transl_table 11 codon_start 1 locus_tag LOCUS_30120 CDS 31517..34315 product transcriptional regulator DagR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063446280.1 transl_table 11 codon_start 1 locus_tag LOCUS_30130 gene dagR CDS 34534..34959 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214106.1 transl_table 11 codon_start 1 locus_tag LOCUS_30140 CDS 34970..35455 product PTS system mannose/fructose/N-acetylgalactosamine-transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284295.1 transl_table 11 codon_start 1 locus_tag LOCUS_30150 CDS 35601..36350 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380259.1 transl_table 11 codon_start 1 locus_tag LOCUS_30160 CDS 36350..37207 product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093404.1 transl_table 11 codon_start 1 locus_tag LOCUS_30170 CDS 37211..38320 product D-glucosaminate-6-phosphate ammonia lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188469.1 transl_table 11 codon_start 1 locus_tag LOCUS_30180 gene dgaE CDS 38307..39050 product 2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186142.1 transl_table 11 codon_start 1 locus_tag LOCUS_30190 CDS 39286..40227 product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749532.1 transl_table 11 codon_start 1 locus_tag LOCUS_30200 CDS complement(40270..41172) product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535970.1 transl_table 11 codon_start 1 locus_tag LOCUS_30210 CDS 41696..42379 product MgtC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392697.1 transl_table 11 codon_start 1 locus_tag LOCUS_30220 CDS 42599..45325 product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131278.1 transl_table 11 codon_start 1 locus_tag LOCUS_30230 gene mgtA CDS 45640..46119 product anti-virulence regulator CigR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705491.1 transl_table 11 codon_start 1 locus_tag LOCUS_30240 CDS complement(46287..46967) product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106461.1 transl_table 11 codon_start 1 locus_tag LOCUS_30250 CDS 47751..48608 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098484.1 transl_table 11 codon_start 1 locus_tag LOCUS_30260 CDS 48601..49083 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001521985.1 transl_table 11 codon_start 1 locus_tag LOCUS_30270 CDS complement(49178..52045) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30280 CDS complement(52120..52737) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000984810.1 transl_table 11 codon_start 1 locus_tag LOCUS_30290 CDS 53751..53924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30300 CDS complement(54036..55073) product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703846.1 transl_table 11 codon_start 1 locus_tag LOCUS_30310 CDS complement(55260..55610) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30320 note possible pseudo, internal stop codon CDS complement(55607..56107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30330 note possible pseudo, internal stop codon, frameshifted CDS complement(56104..56601) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30340 CDS complement(56616..56792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30350 CDS 57470..57814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30360 tRNA complement(58131..58225) product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00570 CDS 58513..59895 product glycoside-pentoside-hexuronide family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834259.1 transl_table 11 codon_start 1 locus_tag LOCUS_30370 CDS 59907..62225 product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703001.1 transl_table 11 codon_start 1 locus_tag LOCUS_30380 gene yicI CDS complement(62328..64037) product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766661.1 transl_table 11 codon_start 1 locus_tag LOCUS_30390 CDS complement(64158..65549) product xanthine/proton symporter XanP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115428.1 transl_table 11 codon_start 1 locus_tag LOCUS_30400 gene xanP CDS 65777..66982 product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462252.1 transl_table 11 codon_start 1 locus_tag LOCUS_30410 gene gltS CDS complement(67018..69099) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016758.1 transl_table 11 codon_start 1 locus_tag LOCUS_30420 gene recG CDS complement(69105..69794) product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068431.1 transl_table 11 codon_start 1 locus_tag LOCUS_30430 gene trmH CDS complement(69799..71910) product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280498.1 transl_table 11 codon_start 1 locus_tag LOCUS_30440 gene spoT CDS complement(71929..72204) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135058.1 transl_table 11 codon_start 1 locus_tag LOCUS_30450 gene rpoZ CDS complement(72259..72882) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046966.1 transl_table 11 codon_start 1 locus_tag LOCUS_30460 gene gmk CDS 73139..74824 product NAD-dependent DNA ligase LigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309848.1 transl_table 11 codon_start 1 locus_tag LOCUS_30470 gene ligB CDS complement(74821..75438) product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924333.1 transl_table 11 codon_start 1 locus_tag LOCUS_30480 CDS complement(75689..76570) product HARLDQ motif MBL-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083230.1 transl_table 11 codon_start 1 locus_tag LOCUS_30490 CDS 76644..77546 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050861.1 transl_table 11 codon_start 1 locus_tag LOCUS_30500 CDS complement(77596..78459) product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621352.1 transl_table 11 codon_start 1 locus_tag LOCUS_30510 CDS 78585..79301 product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247078.1 transl_table 11 codon_start 1 locus_tag LOCUS_30520 gene rph CDS 79380..80021 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806169.1 transl_table 11 codon_start 1 locus_tag LOCUS_30530 gene pyrE CDS complement(80099..80695) product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818596.1 transl_table 11 codon_start 1 locus_tag LOCUS_30540 gene slmA CDS complement(80803..81261) product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717792.1 transl_table 11 codon_start 1 locus_tag LOCUS_30550 gene dut CDS complement(81239..82462) product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001541625.1 transl_table 11 codon_start 1 locus_tag LOCUS_30560 gene coaBC CDS 82635..83300 product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380129.1 transl_table 11 codon_start 1 locus_tag LOCUS_30570 gene radC CDS 83518..83754 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519051.1 transl_table 11 codon_start 1 locus_tag LOCUS_30580 gene rpmB CDS 83775..83942 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051798.1 transl_table 11 codon_start 1 locus_tag LOCUS_30590 gene rpmG CDS 84040..84849 product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114515.1 transl_table 11 codon_start 1 locus_tag LOCUS_30600 gene mutM CDS complement(84877..85356) product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171888.1 transl_table 11 codon_start 1 locus_tag LOCUS_30610 gene coaD CDS complement(85365..86642) product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891584.1 transl_table 11 codon_start 1 locus_tag LOCUS_30620 gene waaA sequence19 source 1..81495 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 432..1370 product transcriptional regulator LrhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606282.1 transl_table 11 codon_start 1 locus_tag LOCUS_30630 gene lrhA CDS 1997..2440 product NADH-quinone oxidoreductase subunit NuoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062993.1 transl_table 11 codon_start 1 locus_tag LOCUS_30640 gene nuoA CDS 2456..3118 product NADH-quinone oxidoreductase subunit NuoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386728.1 transl_table 11 codon_start 1 locus_tag LOCUS_30650 gene nuoB CDS 3217..5007 product NADH-quinone oxidoreductase subunit C/D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247855.1 transl_table 11 codon_start 1 locus_tag LOCUS_30660 gene nuoC CDS 5010..5510 product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545038.1 transl_table 11 codon_start 1 locus_tag LOCUS_30670 gene nuoE CDS 5507..6844 product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800046.1 transl_table 11 codon_start 1 locus_tag LOCUS_30680 gene nuoF CDS 6875..9601 product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518099.1 transl_table 11 codon_start 1 locus_tag LOCUS_30690 gene nuoG CDS 9598..10575 product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118517.1 transl_table 11 codon_start 1 locus_tag LOCUS_30700 gene nuoH CDS 10590..11132 product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172747.1 transl_table 11 codon_start 1 locus_tag LOCUS_30710 gene nuoI CDS 11143..11697 product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393522.1 transl_table 11 codon_start 1 locus_tag LOCUS_30720 gene nuoJ CDS 11694..11996 product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612687.1 transl_table 11 codon_start 1 locus_tag LOCUS_30730 gene nuoK CDS 11993..13834 product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056574.1 transl_table 11 codon_start 1 locus_tag LOCUS_30740 gene nuoL CDS 14148..15677 product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926422.1 transl_table 11 codon_start 1 locus_tag LOCUS_30750 gene nuoM CDS 15684..17141 product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156669.1 transl_table 11 codon_start 1 locus_tag LOCUS_30760 gene nuoN CDS 18030..19820 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244800.1 transl_table 11 codon_start 1 locus_tag LOCUS_30770 CDS complement(19861..20862) product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368546.1 transl_table 11 codon_start 1 locus_tag LOCUS_30780 CDS complement(20928..21854) product ribonuclease BN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000419093.1 transl_table 11 codon_start 1 locus_tag LOCUS_30790 gene rbn CDS 21906..22367 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568155.1 transl_table 11 codon_start 1 locus_tag LOCUS_30800 CDS 22422..22727 product stress response protein ElaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242981.1 transl_table 11 codon_start 1 locus_tag LOCUS_30810 gene elaB CDS 22828..24123 product isochorismate synthase MenF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000555672.1 transl_table 11 codon_start 1 locus_tag LOCUS_30820 gene menF CDS 24209..25879 product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116387.1 transl_table 11 codon_start 1 locus_tag LOCUS_30830 gene menD CDS 25876..26634 product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979148.1 transl_table 11 codon_start 1 locus_tag LOCUS_30840 gene menH CDS 26649..27506 product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640013.1 transl_table 11 codon_start 1 locus_tag LOCUS_30850 gene menB CDS 27506..28468 product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255562.1 transl_table 11 codon_start 1 locus_tag LOCUS_30860 gene menC CDS 28465..29832 product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144672.1 transl_table 11 codon_start 1 locus_tag LOCUS_30870 gene menE CDS 29930..30187 product signal transduction protein PmrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455131.1 transl_table 11 codon_start 1 locus_tag LOCUS_30880 gene pmrD CDS complement(30182..30559) product 4-amino-4-deoxy-L-arabinose-phosphoundecaprenol flippase subunit ArnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538693.1 transl_table 11 codon_start 1 locus_tag LOCUS_30890 gene arnF CDS complement(30559..30894) product 4-amino-4-deoxy-L-arabinose-phosphoundecaprenol flippase subunit ArnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579483.1 transl_table 11 codon_start 1 locus_tag LOCUS_30900 gene arnE CDS complement(30891..32537) product lipid IV(A) 4-amino-4-deoxy-L-arabinosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024131156.1 transl_table 11 codon_start 1 locus_tag LOCUS_30910 gene arnT CDS complement(32534..33433) product 4-deoxy-4-formamido-L-arabinose-phosphoundecaprenol deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169759.1 transl_table 11 codon_start 1 locus_tag LOCUS_30920 gene arnD CDS complement(33430..35412) product bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648774.1 transl_table 11 codon_start 1 locus_tag LOCUS_30930 gene arnA CDS complement(35409..36392) product undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000458894.1 transl_table 11 codon_start 1 locus_tag LOCUS_30940 gene arnC CDS complement(36395..37534) product UDP-4-amino-4-deoxy-L-arabinose aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279286.1 transl_table 11 codon_start 1 locus_tag LOCUS_30950 gene arnB CDS 37833..38438 product lipopolysaccharide core heptose(II)-phosphate phosphatase PmrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879245.1 transl_table 11 codon_start 1 locus_tag LOCUS_30960 gene pmrG CDS complement(38483..38908) product nucleoside triphosphatase NudI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249902.1 transl_table 11 codon_start 1 locus_tag LOCUS_30970 gene nudI CDS 39055..39729 product YfaZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001574701.1 transl_table 11 codon_start 1 locus_tag LOCUS_30980 CDS 39844..41040 product nicotinamide mononucleotide deamidase-related protein YfaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935685.1 transl_table 11 codon_start 1 locus_tag LOCUS_30990 CDS 41290..42072 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894172.1 transl_table 11 codon_start 1 locus_tag LOCUS_31000 CDS 42086..43291 product L-rhamnonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427822.1 transl_table 11 codon_start 1 locus_tag LOCUS_31010 gene rhmD CDS 43347..44636 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028931.1 transl_table 11 codon_start 1 locus_tag LOCUS_31020 CDS 44662..45465 product 2-keto-3-deoxy-L-rhamnonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992948.1 transl_table 11 codon_start 1 locus_tag LOCUS_31030 gene yfaU CDS 45471..45647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31040 CDS complement(45734..46756) product SPI-2 type III secretion system effector deubiquitinase SseL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017745.1 transl_table 11 codon_start 1 locus_tag LOCUS_31050 gene sseL CDS complement(47182..48372) product anaerobic glycerol-3-phosphate dehydrogenase subunit GlpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285727.1 transl_table 11 codon_start 1 locus_tag LOCUS_31060 gene glpC CDS complement(48369..49628) product glycerol-3-phosphate dehydrogenase subunit GlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667159.1 transl_table 11 codon_start 1 locus_tag LOCUS_31070 gene glpB CDS complement(49705..51246) product anaerobic glycerol-3-phosphate dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857213.1 transl_table 11 codon_start 1 locus_tag LOCUS_31080 gene glpA CDS 51519..52877 product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948703.1 transl_table 11 codon_start 1 locus_tag LOCUS_31090 gene glpT CDS 52882..53952 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858949.1 transl_table 11 codon_start 1 locus_tag LOCUS_31100 gene glpQ CDS complement(54068..54946) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176728.1 transl_table 11 codon_start 1 locus_tag LOCUS_31110 CDS 55108..56298 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660244.1 transl_table 11 codon_start 1 locus_tag LOCUS_31120 CDS complement(56300..56554) product ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533921.1 transl_table 11 codon_start 1 locus_tag LOCUS_31130 gene yfaE CDS complement(56554..57684) product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000332020.1 transl_table 11 codon_start 1 locus_tag LOCUS_31140 gene nrdB CDS complement(57797..60082) product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076502.1 transl_table 11 codon_start 1 locus_tag LOCUS_31150 gene nrdA CDS complement(60438..61166) product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091011.1 transl_table 11 codon_start 1 locus_tag LOCUS_31160 CDS complement(61249..61944) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944714.1 transl_table 11 codon_start 1 locus_tag LOCUS_31170 CDS 62183..63508 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098092.1 transl_table 11 codon_start 1 locus_tag LOCUS_31180 CDS 63523..64725 product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705579.1 transl_table 11 codon_start 1 locus_tag LOCUS_31190 CDS 65135..67771 product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281282.1 transl_table 11 codon_start 1 locus_tag LOCUS_31200 gene gyrA CDS 67889..70735 product two-component system sensor histidine kinase RcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876074.1 transl_table 11 codon_start 1 locus_tag LOCUS_31210 gene rcsC CDS complement(70838..71488) product response regulator transcription factor RcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061910.1 transl_table 11 codon_start 1 locus_tag LOCUS_31220 gene rcsB CDS complement(71505..74174) product phosphotransferase RcsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083209.1 transl_table 11 codon_start 1 locus_tag LOCUS_31230 gene rcsD CDS 74902..76038 product porin OmpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865526.1 transl_table 11 codon_start 1 locus_tag LOCUS_31240 CDS 76153..77205 product FAD:protein FMN transferase ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784304.1 transl_table 11 codon_start 1 locus_tag LOCUS_31250 gene apbE CDS 77289..78347 product bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000975974.1 transl_table 11 codon_start 1 locus_tag LOCUS_31260 gene ada CDS 78350..79000 product DNA oxidative demethylase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884984.1 transl_table 11 codon_start 1 locus_tag LOCUS_31270 gene alkB CDS 79074..80717 product multidrug ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421580.1 transl_table 11 codon_start 1 locus_tag LOCUS_31280 CDS complement(80900..81406) product serine protease inhibitor ecotin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001764187.1 transl_table 11 codon_start 1 locus_tag LOCUS_31290 gene eco sequence20 source 1..76955 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(80..1480) product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724476.1 transl_table 11 codon_start 1 locus_tag LOCUS_31300 CDS complement(1670..2302) product molecular chaperone TorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595416.1 transl_table 11 codon_start 1 locus_tag LOCUS_31310 gene torD CDS complement(2295..4847) product trimethylamine-N-oxide reductase TorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790669.1 transl_table 11 codon_start 1 locus_tag LOCUS_31320 gene torA CDS complement(4837..6021) product pentaheme c-type cytochrome TorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230242.1 transl_table 11 codon_start 1 locus_tag LOCUS_31330 gene torC CDS 6151..6843 product two-component system response regulator TorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120125.1 transl_table 11 codon_start 1 locus_tag LOCUS_31340 gene torR CDS complement(6816..7856) product TMAO reductase system periplasmic protein TorT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259560.1 transl_table 11 codon_start 1 locus_tag LOCUS_31350 gene torT CDS 7936..10671 product TMAO reductase system sensor histidine kinase/response regulator TorS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106933.1 transl_table 11 codon_start 1 locus_tag LOCUS_31360 gene torS CDS complement(10697..11989) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032706561.1 transl_table 11 codon_start 1 locus_tag LOCUS_31370 CDS complement(12119..13267) product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703894.1 transl_table 11 codon_start 1 locus_tag LOCUS_31380 gene dgoD CDS complement(13264..13881) product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703895.1 transl_table 11 codon_start 1 locus_tag LOCUS_31390 CDS complement(13865..14743) product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703896.1 transl_table 11 codon_start 1 locus_tag LOCUS_31400 CDS complement(14740..15429) product D-galactonate utilization transcriptional regulator DgoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369039.1 transl_table 11 codon_start 1 locus_tag LOCUS_31410 gene dgoR CDS complement(15690..16535) product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985571.1 transl_table 11 codon_start 1 locus_tag LOCUS_31420 gene yidA CDS 16840..18102 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061243.1 transl_table 11 codon_start 1 locus_tag LOCUS_31430 CDS 18116..19309 product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000975831.1 transl_table 11 codon_start 1 locus_tag LOCUS_31440 CDS 19424..20320 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054598.1 transl_table 11 codon_start 1 locus_tag LOCUS_31450 CDS complement(20339..22753) product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072047.1 transl_table 11 codon_start 1 locus_tag LOCUS_31460 gene gyrB CDS complement(22782..23855) product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059373.1 transl_table 11 codon_start 1 locus_tag LOCUS_31470 gene recF CDS complement(24003..25103) product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673474.1 transl_table 11 codon_start 1 locus_tag LOCUS_31480 gene dnaN CDS complement(25108..26439) product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059095.1 transl_table 11 codon_start 1 locus_tag LOCUS_31490 gene dnaA CDS 27359..27685 product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239725.1 transl_table 11 codon_start 1 locus_tag LOCUS_31500 gene rnpA CDS 27909..29555 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378272.1 transl_table 11 codon_start 1 locus_tag LOCUS_31510 gene yidC CDS complement(29439..29645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31520 CDS 29697..31061 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019075.1 transl_table 11 codon_start 1 locus_tag LOCUS_31530 gene mnmE CDS 31244..32431 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819608.1 transl_table 11 codon_start 1 locus_tag LOCUS_31540 CDS 32400..33359 product HTH-type transcriptional regulator YidZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749373.1 transl_table 11 codon_start 1 locus_tag LOCUS_31550 gene yidZ CDS 33517..34272 product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190678.1 transl_table 11 codon_start 1 locus_tag LOCUS_31560 CDS 34290..34856 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013212.1 transl_table 11 codon_start 1 locus_tag LOCUS_31570 CDS complement(34901..36238) product adenine permease AdeP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001214973.1 transl_table 11 codon_start 1 locus_tag LOCUS_31580 gene adeP CDS 36407..37072 product 6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078084.1 transl_table 11 codon_start 1 locus_tag LOCUS_31590 gene yieH CDS complement(37167..37892) product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377800.1 transl_table 11 codon_start 1 locus_tag LOCUS_31600 gene phoU CDS complement(37907..38674) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063118.1 transl_table 11 codon_start 1 locus_tag LOCUS_31610 gene pstB CDS complement(38767..39657) product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212190.1 transl_table 11 codon_start 1 locus_tag LOCUS_31620 gene pstA CDS complement(39657..40616) product phosphate ABC transporter permease PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741630.1 transl_table 11 codon_start 1 locus_tag LOCUS_31630 gene pstC CDS complement(40752..41792) product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867129.1 transl_table 11 codon_start 1 locus_tag LOCUS_31640 gene pstS CDS complement(41958..43331) product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162538.1 transl_table 11 codon_start 1 locus_tag LOCUS_31650 CDS complement(43380..44198) product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166706.1 transl_table 11 codon_start 1 locus_tag LOCUS_31660 CDS 44260..46050 product SgrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235491.1 transl_table 11 codon_start 1 locus_tag LOCUS_31670 CDS complement(46201..48030) product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334049.1 transl_table 11 codon_start 1 locus_tag LOCUS_31680 gene glmS CDS complement(48219..49589) product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934853.1 transl_table 11 codon_start 1 locus_tag LOCUS_31690 gene glmU CDS complement(49909..50607) product Bax inhibitor-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009901.1 transl_table 11 codon_start 1 locus_tag LOCUS_31700 CDS complement(50837..51256) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251971.1 transl_table 11 codon_start 1 locus_tag LOCUS_31710 CDS complement(51277..52659) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190499.1 transl_table 11 codon_start 1 locus_tag LOCUS_31720 gene atpD CDS complement(52686..53549) product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896504.1 transl_table 11 codon_start 1 locus_tag LOCUS_31730 gene atpG CDS complement(53600..55141) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176751.1 transl_table 11 codon_start 1 locus_tag LOCUS_31740 gene atpA CDS complement(55154..55687) product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288957.1 transl_table 11 codon_start 1 locus_tag LOCUS_31750 gene atpH CDS complement(55702..56172) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052212.1 transl_table 11 codon_start 1 locus_tag LOCUS_31760 gene atpF CDS complement(56232..56471) product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429386.1 transl_table 11 codon_start 1 locus_tag LOCUS_31770 gene atpE CDS complement(56518..57333) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135632.1 transl_table 11 codon_start 1 locus_tag LOCUS_31780 gene atpB CDS complement(57342..57722) product F0F1 ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145371.1 transl_table 11 codon_start 1 locus_tag LOCUS_31790 gene atpI CDS complement(58338..58967) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519938.1 transl_table 11 codon_start 1 locus_tag LOCUS_31800 gene rsmG CDS complement(59064..60953) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499882.1 transl_table 11 codon_start 1 locus_tag LOCUS_31810 gene mnmG CDS complement(61332..61775) product FMN-binding protein MioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763722.1 transl_table 11 codon_start 1 locus_tag LOCUS_31820 gene mioC CDS complement(61865..62323) product transcriptional regulator AsnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433016.1 transl_table 11 codon_start 1 locus_tag LOCUS_31830 gene asnC CDS 62474..63466 product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845119.1 transl_table 11 codon_start 1 locus_tag LOCUS_31840 gene asnA CDS complement(63471..64922) product ATPase RavA stimulator ViaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956591.1 transl_table 11 codon_start 1 locus_tag LOCUS_31850 gene viaA CDS complement(64916..66412) product ATPase RavA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940993.1 transl_table 11 codon_start 1 locus_tag LOCUS_31860 gene ravA CDS 66760..68628 product low affinity potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102337.1 transl_table 11 codon_start 1 locus_tag LOCUS_31870 gene kup CDS 68845..69264 product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715950.1 transl_table 11 codon_start 1 locus_tag LOCUS_31880 gene rbsD CDS 69272..70777 product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339360.1 transl_table 11 codon_start 1 locus_tag LOCUS_31890 gene rbsA CDS 70783..71748 product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211345.1 transl_table 11 codon_start 1 locus_tag LOCUS_31900 gene rbsC CDS 71773..72663 product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056260.1 transl_table 11 codon_start 1 locus_tag LOCUS_31910 gene rbsB CDS 72796..73725 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844732.1 transl_table 11 codon_start 1 locus_tag LOCUS_31920 gene rbsK CDS 73729..74727 product ribose operon transcriptional repressor RbsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224487.1 transl_table 11 codon_start 1 locus_tag LOCUS_31930 gene rbsR CDS complement(74693..75883) product multidrug transporter subunit MdtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099391.1 transl_table 11 codon_start 1 locus_tag LOCUS_31940 gene mdtD note possible pseudo, frameshifted CDS complement(75871..76116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31950 note possible pseudo, frameshifted CDS complement(76128..76832) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131144.1 transl_table 11 codon_start 1 locus_tag LOCUS_31960 sequence21 source 1..68488 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 91..636 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000482234.1 transl_table 11 codon_start 1 locus_tag LOCUS_31970 CDS 707..1390 product fimbrial biogenesis chaperone SthA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680527.1 transl_table 11 codon_start 1 locus_tag LOCUS_31980 gene sthA CDS 1565..3973 product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097475.1 transl_table 11 codon_start 1 locus_tag LOCUS_31990 CDS 3991..4548 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056988.1 transl_table 11 codon_start 1 locus_tag LOCUS_32000 CDS 4589..5674 product type 1 fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703282.1 transl_table 11 codon_start 1 locus_tag LOCUS_32010 CDS complement(5732..7081) product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920380.1 transl_table 11 codon_start 1 locus_tag LOCUS_32020 gene creD CDS complement(7139..8563) product two-component system sensor histidine kinase CreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219536.1 transl_table 11 codon_start 1 locus_tag LOCUS_32030 gene creC CDS complement(8563..9252) product two-component system response regulator CreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187043.1 transl_table 11 codon_start 1 locus_tag LOCUS_32040 gene creB CDS complement(9265..9753) product protein CreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875811.1 transl_table 11 codon_start 1 locus_tag LOCUS_32050 gene creA CDS 9950..10819 product MDR efflux pump AcrAB transcriptional activator RobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371679.1 transl_table 11 codon_start 1 locus_tag LOCUS_32060 gene robA tRNA complement(11059..11152) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00580 CDS 11314..11460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32070 CDS 11512..12027 product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001341279.1 transl_table 11 codon_start 1 locus_tag LOCUS_32080 gene yjjX CDS complement(12129..12455) product trp operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192005.1 transl_table 11 codon_start 1 locus_tag LOCUS_32090 gene trpR CDS complement(12513..14450) product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014343943.1 transl_table 11 codon_start 1 locus_tag LOCUS_32100 gene sltY CDS 14659..16326 product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046772.1 transl_table 11 codon_start 1 locus_tag LOCUS_32110 gene ettA CDS complement(16444..17676) product multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001532645.1 transl_table 11 codon_start 1 locus_tag LOCUS_32120 gene nadR CDS complement(17827..19209) product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029720.1 transl_table 11 codon_start 1 locus_tag LOCUS_32130 gene radA CDS complement(19293..20261) product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132983.1 transl_table 11 codon_start 1 locus_tag LOCUS_32140 gene serB CDS 20378..21022 product YtjB family periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090067.1 transl_table 11 codon_start 1 locus_tag LOCUS_32150 CDS 21056..22072 product lipoate--protein ligase LplA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209755.1 transl_table 11 codon_start 1 locus_tag LOCUS_32160 gene lplA CDS complement(22077..23405) product type II toxin-antitoxin system HipA family toxin YjjJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293112.1 transl_table 11 codon_start 1 locus_tag LOCUS_32170 gene yjjJ CDS complement(23584..24303) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224864.1 transl_table 11 codon_start 1 locus_tag LOCUS_32180 gene deoD CDS complement(24513..25736) product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816454.1 transl_table 11 codon_start 1 locus_tag LOCUS_32190 gene deoB CDS complement(25788..27110) product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477838.1 transl_table 11 codon_start 1 locus_tag LOCUS_32200 gene deoA CDS complement(27234..28013) product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031624265.1 transl_table 11 codon_start 1 locus_tag LOCUS_32210 gene deoC CDS 28273..29823 product YjjI family glycine radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001111683.1 transl_table 11 codon_start 1 locus_tag LOCUS_32220 CDS 30071..30658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32230 CDS complement(30691..31464) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119010.1 transl_table 11 codon_start 1 locus_tag LOCUS_32240 CDS complement(31461..32534) product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531551.1 transl_table 11 codon_start 1 locus_tag LOCUS_32250 CDS complement(32658..32819) product DUF1328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490276.1 transl_table 11 codon_start 1 locus_tag LOCUS_32260 CDS complement(32948..33565) product molecular chaperone OsmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178963.1 transl_table 11 codon_start 1 locus_tag LOCUS_32270 gene osmY CDS complement(33967..35556) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175968.1 transl_table 11 codon_start 1 locus_tag LOCUS_32280 gene prfC CDS complement(35648..36328) product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978805.1 transl_table 11 codon_start 1 locus_tag LOCUS_32290 gene yjjG CDS complement(36347..36850) product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092432.1 transl_table 11 codon_start 1 locus_tag LOCUS_32300 gene rimI CDS complement(36738..37175) product DNA polymerase III subunit psi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203999.1 transl_table 11 codon_start 1 locus_tag LOCUS_32310 CDS 37278..38306 product 16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272292.1 transl_table 11 codon_start 1 locus_tag LOCUS_32320 gene rsmC tRNA 38497..38583 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00590 tRNA 38611..38697 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00600 tRNA 38729..38815 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00610 CDS complement(38847..39083) product DUF1435 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941878.1 transl_table 11 codon_start 1 locus_tag LOCUS_32330 CDS 39484..40398 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211217.1 transl_table 11 codon_start 1 locus_tag LOCUS_32340 CDS 40519..41307 product siderophore-iron reductase FhuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331545.1 transl_table 11 codon_start 1 locus_tag LOCUS_32350 gene fhuF CDS 41466..41924 product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058267.1 transl_table 11 codon_start 1 locus_tag LOCUS_32360 CDS complement(41975..42598) product DNA-binding transcriptional activator BglJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431550.1 transl_table 11 codon_start 1 locus_tag LOCUS_32370 gene bglJ CDS complement(42610..43335) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936654.1 transl_table 11 codon_start 1 locus_tag LOCUS_32380 CDS 44048..44824 product threonine/serine exporter ThrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989102.1 transl_table 11 codon_start 1 locus_tag LOCUS_32390 CDS 44815..45288 product threonine/serine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511327.1 transl_table 11 codon_start 1 locus_tag LOCUS_32400 CDS 45381..45920 product primosomal protein DnaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098578.1 transl_table 11 codon_start 1 locus_tag LOCUS_32410 gene dnaT CDS 45923..46660 product DNA replication protein DnaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799923.1 transl_table 11 codon_start 1 locus_tag LOCUS_32420 gene dnaC CDS 46718..47179 product DUF2501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090314.1 transl_table 11 codon_start 1 locus_tag LOCUS_32430 CDS 47462..49753 product phosphatidylglycerol--membrane-oligosaccharide glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292715.1 transl_table 11 codon_start 1 locus_tag LOCUS_32440 gene opgB CDS complement(49887..50897) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236585662.1 transl_table 11 codon_start 1 locus_tag LOCUS_32450 CDS complement(50915..51973) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016539.1 transl_table 11 codon_start 1 locus_tag LOCUS_32460 CDS complement(51986..52834) product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002401797.1 transl_table 11 codon_start 1 locus_tag LOCUS_32470 CDS complement(52812..53591) product PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357107.1 transl_table 11 codon_start 1 locus_tag LOCUS_32480 CDS complement(53617..54078) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287114.1 transl_table 11 codon_start 1 locus_tag LOCUS_32490 CDS complement(54093..54515) product PTS mannose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287112.1 transl_table 11 codon_start 1 locus_tag LOCUS_32500 CDS complement(54617..57382) product sigma-54-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287111.1 transl_table 11 codon_start 1 locus_tag LOCUS_32510 CDS complement(57705..59366) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919571.1 transl_table 11 codon_start 1 locus_tag LOCUS_32520 gene tsr CDS 59733..61883 product pyruvate/proton symporter BtsT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379928.1 transl_table 11 codon_start 1 locus_tag LOCUS_32530 gene btsT CDS 61978..62181 product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460616.1 transl_table 11 codon_start 1 locus_tag LOCUS_32540 CDS 62192..63148 product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187846.1 transl_table 11 codon_start 1 locus_tag LOCUS_32550 gene yjiA CDS complement(63223..63525) product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063142.1 transl_table 11 codon_start 1 locus_tag LOCUS_32560 CDS complement(63512..63799) product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131963.1 transl_table 11 codon_start 1 locus_tag LOCUS_32570 CDS 64237..66078 product nuclease-related domain-containing DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263035.1 transl_table 11 codon_start 1 locus_tag LOCUS_32580 CDS 66521..66691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32590 CDS 66691..67266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32600 sequence22 source 1..67512 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(180..851) product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811633.1 transl_table 11 codon_start 1 locus_tag LOCUS_32610 CDS complement(1817..2533) product two-component system response regulator ArcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194359.1 transl_table 11 codon_start 1 locus_tag LOCUS_32620 gene arcA CDS 3169..3855 product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266768.1 transl_table 11 codon_start 1 locus_tag LOCUS_32630 CDS 4216..6678 product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264731.1 transl_table 11 codon_start 1 locus_tag LOCUS_32640 gene thrA CDS 6680..7609 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241685.1 transl_table 11 codon_start 1 locus_tag LOCUS_32650 gene thrB CDS 7613..8899 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781103.1 transl_table 11 codon_start 1 locus_tag LOCUS_32660 gene thrC CDS complement(8993..9766) product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906171.1 transl_table 11 codon_start 1 locus_tag LOCUS_32670 gene yaaA CDS complement(9845..11275) product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113816.1 transl_table 11 codon_start 1 locus_tag LOCUS_32680 CDS 11544..12497 product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130175.1 transl_table 11 codon_start 1 locus_tag LOCUS_32690 gene tal CDS 12608..13198 product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094677.1 transl_table 11 codon_start 1 locus_tag LOCUS_32700 gene mog CDS complement(13255..13821) product acetate uptake transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528527.1 transl_table 11 codon_start 1 locus_tag LOCUS_32710 gene satP CDS complement(13971..14684) product acidic protein MsyB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103477.1 transl_table 11 codon_start 1 locus_tag LOCUS_32720 gene msyB CDS complement(14720..15124) product DUF2541 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258093.1 transl_table 11 codon_start 1 locus_tag LOCUS_32730 CDS 15473..17389 product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516126.1 transl_table 11 codon_start 1 locus_tag LOCUS_32740 gene dnaK CDS 17475..18614 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119009.1 transl_table 11 codon_start 1 locus_tag LOCUS_32750 gene dnaJ CDS 18895..19842 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534904.1 transl_table 11 codon_start 1 locus_tag LOCUS_32760 CDS 19969..20313 product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026890.1 transl_table 11 codon_start 1 locus_tag LOCUS_32770 CDS complement(20374..20907) product glycoside hydrolase family 108 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068133.1 transl_table 11 codon_start 1 locus_tag LOCUS_32780 CDS complement(20924..21367) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860681.1 transl_table 11 codon_start 1 locus_tag LOCUS_32790 CDS 21748..23847 product glycosyl hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235792.1 transl_table 11 codon_start 1 locus_tag LOCUS_32800 CDS 23939..26935 product chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704341.1 transl_table 11 codon_start 1 locus_tag LOCUS_32810 CDS 27228..27920 product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738610.1 transl_table 11 codon_start 1 locus_tag LOCUS_32820 CDS 28350..28892 product fimbrial protein BcfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743355.1 transl_table 11 codon_start 1 locus_tag LOCUS_32830 CDS 28993..29679 product fimbrial biogenesis chaperone BcfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742560.1 transl_table 11 codon_start 1 locus_tag LOCUS_32840 gene bcfB CDS 29684..32305 product fimbrial biogenesis usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123830139.1 transl_table 11 codon_start 1 locus_tag LOCUS_32850 CDS 32306..33313 product fimbrial protein BcfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701249.1 transl_table 11 codon_start 1 locus_tag LOCUS_32860 CDS 33314..33859 product fimbrial protein BcfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082042.1 transl_table 11 codon_start 1 locus_tag LOCUS_32870 CDS 33875..34393 product fimbrial protein BcfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243237.1 transl_table 11 codon_start 1 locus_tag LOCUS_32880 CDS 34455..35090 product fimbrial chaperone BcfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135039.1 transl_table 11 codon_start 1 locus_tag LOCUS_32890 gene bcfG CDS 35154..35999 product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291399.1 transl_table 11 codon_start 1 locus_tag LOCUS_32900 CDS 36038..36325 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839835.1 transl_table 11 codon_start 1 locus_tag LOCUS_32910 CDS complement(36425..36874) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250363.1 transl_table 11 codon_start 1 locus_tag LOCUS_32920 CDS 37236..38240 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247397.1 transl_table 11 codon_start 1 locus_tag LOCUS_32930 CDS complement(38248..38688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32940 CDS 39211..40929 product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001035853.1 transl_table 11 codon_start 1 locus_tag LOCUS_32950 CDS complement(40975..42537) product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262866.1 transl_table 11 codon_start 1 locus_tag LOCUS_32960 CDS complement(42645..43406) product outer membrane protein OmpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791535.1 transl_table 11 codon_start 1 locus_tag LOCUS_32970 CDS 44000..45493 product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831876.1 transl_table 11 codon_start 1 locus_tag LOCUS_32980 CDS 45592..46782 product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971151.1 transl_table 11 codon_start 1 locus_tag LOCUS_32990 CDS 46807..48054 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494928.1 transl_table 11 codon_start 1 locus_tag LOCUS_33000 CDS 48181..49896 product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094796.1 transl_table 11 codon_start 1 locus_tag LOCUS_33010 CDS 50059..51225 product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681337.1 transl_table 11 codon_start 1 locus_tag LOCUS_33020 gene nhaA CDS 51287..52186 product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062872.1 transl_table 11 codon_start 1 locus_tag LOCUS_33030 gene nhaR CDS complement(52241..54280) product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116444.1 transl_table 11 codon_start 1 locus_tag LOCUS_33040 CDS complement(54320..55693) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989104.1 transl_table 11 codon_start 1 locus_tag LOCUS_33050 CDS complement(56149..56412) product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518655.1 transl_table 11 codon_start 1 locus_tag LOCUS_33060 gene rpsT CDS 56741..57679 product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767311.1 transl_table 11 codon_start 1 locus_tag LOCUS_33070 gene ribF CDS 57688..60558 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989105.1 transl_table 11 codon_start 1 locus_tag LOCUS_33080 gene ileS CDS 60558..61058 product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042743.1 transl_table 11 codon_start 1 locus_tag LOCUS_33090 gene lspA CDS 61213..61662 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047269.1 transl_table 11 codon_start 1 locus_tag LOCUS_33100 gene fkpB CDS 61665..62615 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166426.1 transl_table 11 codon_start 1 locus_tag LOCUS_33110 gene ispH CDS 62815..63810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516332.1 transl_table 11 codon_start 1 locus_tag LOCUS_33120 note possible pseudo, frameshifted CDS 63776..64018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33130 note possible pseudo, frameshifted CDS 64034..64954 product ribonucleoside hydrolase RihC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127280.1 transl_table 11 codon_start 1 locus_tag LOCUS_33140 gene rihC CDS complement(64976..65662) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377415.1 transl_table 11 codon_start 1 locus_tag LOCUS_33150 CDS complement(65664..67322) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989106.1 transl_table 11 codon_start 1 locus_tag LOCUS_33160 sequence23 source 1..66094 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(305..2878) product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235094.1 transl_table 11 codon_start 1 locus_tag LOCUS_33170 gene clpB CDS complement(3008..3739) product purine nucleoside phosphorylase YfiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992642.1 transl_table 11 codon_start 1 locus_tag LOCUS_33180 gene yfiH CDS complement(3736..4716) product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079130.1 transl_table 11 codon_start 1 locus_tag LOCUS_33190 gene rluD CDS 4848..5585 product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197667.1 transl_table 11 codon_start 1 locus_tag LOCUS_33200 gene bamD CDS 5857..6195 product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178449.1 transl_table 11 codon_start 1 locus_tag LOCUS_33210 gene raiA CDS 6446..7606 product bifunctional chorismate mutase/prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200079.1 transl_table 11 codon_start 1 locus_tag LOCUS_33220 gene pheA CDS complement(7567..8475) product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210976.1 transl_table 11 codon_start 1 locus_tag LOCUS_33230 CDS complement(8533..9654) product bifunctional chorismate mutase/prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225191.1 transl_table 11 codon_start 1 locus_tag LOCUS_33240 gene tyrA CDS complement(9664..10734) product 3-deoxy-7-phosphoheptulonate synthase AroF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168062.1 transl_table 11 codon_start 1 locus_tag LOCUS_33250 gene aroF CDS 11168..11692 product YfiR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212373.1 transl_table 11 codon_start 1 locus_tag LOCUS_33260 CDS 11754..12905 product diguanylate cyclase DgcN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030993.1 transl_table 11 codon_start 1 locus_tag LOCUS_33270 gene dgcN CDS complement(13062..13409) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065257.1 transl_table 11 codon_start 1 locus_tag LOCUS_33280 gene rplS CDS complement(13450..14217) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469802.1 transl_table 11 codon_start 1 locus_tag LOCUS_33290 gene trmD CDS complement(14262..14810) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043266.1 transl_table 11 codon_start 1 locus_tag LOCUS_33300 gene rimM CDS complement(14829..15077) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256453.1 transl_table 11 codon_start 1 locus_tag LOCUS_33310 gene rpsP CDS complement(15330..16691) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460052.1 transl_table 11 codon_start 1 locus_tag LOCUS_33320 gene ffh CDS 16857..17648 product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001537507.1 transl_table 11 codon_start 1 locus_tag LOCUS_33330 CDS 17713..18954 product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519447.1 transl_table 11 codon_start 1 locus_tag LOCUS_33340 CDS 19075..19680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33350 CDS complement(19715..20467) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518875.1 transl_table 11 codon_start 1 locus_tag LOCUS_33360 gene grpE CDS 20429..21307 product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059155.1 transl_table 11 codon_start 1 locus_tag LOCUS_33370 gene nadK CDS 21393..23054 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880973.1 transl_table 11 codon_start 1 locus_tag LOCUS_33380 gene recN CDS 23203..23541 product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001203445.1 transl_table 11 codon_start 1 locus_tag LOCUS_33390 gene bamE CDS complement(23707..23997) product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112990.1 transl_table 11 codon_start 1 locus_tag LOCUS_33400 CDS complement(23987..24436) product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242603.1 transl_table 11 codon_start 1 locus_tag LOCUS_33410 CDS 24568..25095 product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518569.1 transl_table 11 codon_start 1 locus_tag LOCUS_33420 gene smpB CDS 25710..37184 product Ig-like domain repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237656.1 transl_table 11 codon_start 1 locus_tag LOCUS_33430 CDS 37330..38658 product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533850.1 transl_table 11 codon_start 1 locus_tag LOCUS_33440 CDS 38655..40835 product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196137.1 transl_table 11 codon_start 1 locus_tag LOCUS_33450 CDS 40816..42006 product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989217.1 transl_table 11 codon_start 1 locus_tag LOCUS_33460 tmRNA 42078..42440 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(42845..43945) product phage late control D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098779.1 transl_table 11 codon_start 1 locus_tag LOCUS_33470 CDS complement(43942..44427) product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098780.1 transl_table 11 codon_start 1 locus_tag LOCUS_33480 CDS complement(44424..47231) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33490 CDS complement(47358..47660) product phage tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280965.1 transl_table 11 codon_start 1 locus_tag LOCUS_33500 CDS complement(47715..48230) product phage major tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207653.1 transl_table 11 codon_start 1 locus_tag LOCUS_33510 CDS complement(48240..49412) product phage tail sheath protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046101.1 transl_table 11 codon_start 1 locus_tag LOCUS_33520 CDS complement(49515..49739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33530 CDS complement(50609..51184) product tail fiber assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885577.1 transl_table 11 codon_start 1 locus_tag LOCUS_33540 CDS complement(51184..53037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33550 CDS complement(53034..53639) product phage tail protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098785.1 transl_table 11 codon_start 1 locus_tag LOCUS_33560 CDS complement(53632..54540) product baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268327.1 transl_table 11 codon_start 1 locus_tag LOCUS_33570 CDS complement(54527..54886) product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177408.1 transl_table 11 codon_start 1 locus_tag LOCUS_33580 CDS complement(54883..55461) product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993749.1 transl_table 11 codon_start 1 locus_tag LOCUS_33590 CDS 55539..56390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33600 CDS complement(56392..56838) product phage virion morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343944.1 transl_table 11 codon_start 1 locus_tag LOCUS_33610 CDS complement(56831..57262) product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039939.1 transl_table 11 codon_start 1 locus_tag LOCUS_33620 CDS complement(57358..57786) product Rz-like lysis system protein LysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162926034.1 transl_table 11 codon_start 1 locus_tag LOCUS_33630 gene lysB CDS complement(57783..58298) product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069919.1 transl_table 11 codon_start 1 locus_tag LOCUS_33640 CDS complement(58279..58494) product HP1 family phage holin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171565.1 transl_table 11 codon_start 1 locus_tag LOCUS_33650 CDS complement(58498..58701) product tail protein X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868184.1 transl_table 11 codon_start 1 locus_tag LOCUS_33660 CDS complement(58701..59165) product head completion/stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010835209.1 transl_table 11 codon_start 1 locus_tag LOCUS_33670 CDS complement(59259..59909) product terminase endonuclease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059175.1 transl_table 11 codon_start 1 locus_tag LOCUS_33680 CDS complement(59913..60974) product phage major capsid protein, P2 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098795.1 transl_table 11 codon_start 1 locus_tag LOCUS_33690 CDS complement(60991..61824) product GPO family capsid scaffolding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098796.1 transl_table 11 codon_start 1 locus_tag LOCUS_33700 CDS 61967..63733 product terminase ATPase subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098452.1 transl_table 11 codon_start 1 locus_tag LOCUS_33710 CDS 63733..64773 product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040233361.1 transl_table 11 codon_start 1 locus_tag LOCUS_33720 misc_feature complement(64877..>66094) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009994298.1:AIPR family protein locus_tag LOCUS_33730 sequence24 source 1..65273 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 445..1659 product alanine transaminase AlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074540.1 transl_table 11 codon_start 1 locus_tag LOCUS_33740 gene alaA CDS 1753..2352 product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813878.1 transl_table 11 codon_start 1 locus_tag LOCUS_33750 gene yfbR CDS complement(2458..4284) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012871.1 transl_table 11 codon_start 1 locus_tag LOCUS_33760 CDS complement(4361..5020) product sugar phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013205.1 transl_table 11 codon_start 1 locus_tag LOCUS_33770 CDS complement(5031..5525) product YfbU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426135.1 transl_table 11 codon_start 1 locus_tag LOCUS_33780 CDS complement(5608..5985) product terminus macrodomain insulation protein YfbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106616.1 transl_table 11 codon_start 1 locus_tag LOCUS_33790 gene yfbV CDS 6403..7605 product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095689.1 transl_table 11 codon_start 1 locus_tag LOCUS_33800 gene ackA CDS 7682..9826 product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086690.1 transl_table 11 codon_start 1 locus_tag LOCUS_33810 gene pta CDS 10086..11564 product putative basic amino acid antiporter YfcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117932.1 transl_table 11 codon_start 1 locus_tag LOCUS_33820 gene yfcC CDS complement(11613..12566) product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098117.1 transl_table 11 codon_start 1 locus_tag LOCUS_33830 CDS complement(12559..13389) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103260.1 transl_table 11 codon_start 1 locus_tag LOCUS_33840 CDS complement(13386..14777) product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001681684.1 transl_table 11 codon_start 1 locus_tag LOCUS_33850 CDS complement(14798..15070) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699818.1 transl_table 11 codon_start 1 locus_tag LOCUS_33860 CDS complement(15151..15594) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901818.1 transl_table 11 codon_start 1 locus_tag LOCUS_33870 CDS 15847..16866 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026954.1 transl_table 11 codon_start 1 locus_tag LOCUS_33880 CDS complement(16872..17426) product NUDIX hydrolase YfcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230215.1 transl_table 11 codon_start 1 locus_tag LOCUS_33890 gene yfcD CDS complement(17483..18034) product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772458.1 transl_table 11 codon_start 1 locus_tag LOCUS_33900 gene yfcE CDS complement(18090..18734) product glutathione transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043013.1 transl_table 11 codon_start 1 locus_tag LOCUS_33910 gene yfcF CDS 18877..19524 product GSH-dependent disulfide bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566559.1 transl_table 11 codon_start 1 locus_tag LOCUS_33920 gene yfcG CDS 19650..20543 product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166265.1 transl_table 11 codon_start 1 locus_tag LOCUS_33930 CDS complement(20595..21371) product histidine ABC transporter ATP-binding protein HisP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986775.1 transl_table 11 codon_start 1 locus_tag LOCUS_33940 gene hisP CDS complement(21382..22089) product histidine ABC transporter permease HisM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569771.1 transl_table 11 codon_start 1 locus_tag LOCUS_33950 gene hisM CDS complement(22086..22772) product histidine ABC transporter permease HisQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965498.1 transl_table 11 codon_start 1 locus_tag LOCUS_33960 CDS complement(22955..23737) product histidine ABC transporter substrate-binding protein HisJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000731871.1 transl_table 11 codon_start 1 locus_tag LOCUS_33970 gene hisJ CDS complement(23975..24757) product lysine/arginine/ornithine ABC transporter substrate-binding protein ArgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754418.1 transl_table 11 codon_start 1 locus_tag LOCUS_33980 gene argT CDS complement(25046..25615) product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825682.1 transl_table 11 codon_start 1 locus_tag LOCUS_33990 CDS complement(25642..27048) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380357.1 transl_table 11 codon_start 1 locus_tag LOCUS_34000 CDS complement(27112..28215) product alanine/ornithine racemase family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281913.1 transl_table 11 codon_start 1 locus_tag LOCUS_34010 CDS complement(28217..29638) product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072509.1 transl_table 11 codon_start 1 locus_tag LOCUS_34020 CDS complement(29729..31126) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132306.1 transl_table 11 codon_start 1 locus_tag LOCUS_34030 CDS 31337..32764 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168932.1 transl_table 11 codon_start 1 locus_tag LOCUS_34040 CDS complement(32800..34317) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334231.1 transl_table 11 codon_start 1 locus_tag LOCUS_34050 gene purF CDS complement(34355..34843) product colicin V production protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262102.1 transl_table 11 codon_start 1 locus_tag LOCUS_34060 gene cvpA CDS complement(35154..35828) product cell division protein DedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157040.1 transl_table 11 codon_start 1 locus_tag LOCUS_34070 gene dedD CDS complement(35818..37086) product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792271.1 transl_table 11 codon_start 1 locus_tag LOCUS_34080 gene folC CDS complement(37154..38068) product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118383.1 transl_table 11 codon_start 1 locus_tag LOCUS_34090 gene accD CDS complement(38218..38877) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364318.1 transl_table 11 codon_start 1 locus_tag LOCUS_34100 CDS complement(38926..39738) product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016631.1 transl_table 11 codon_start 1 locus_tag LOCUS_34110 gene truA CDS complement(39738..40751) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289141.1 transl_table 11 codon_start 1 locus_tag LOCUS_34120 CDS complement(40819..41931) product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699178.1 transl_table 11 codon_start 1 locus_tag LOCUS_34130 gene pdxB CDS 42059..43060 product flagella biosynthesis regulator Flk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553395.1 transl_table 11 codon_start 1 locus_tag LOCUS_34140 gene flk CDS complement(43057..44232) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127714.1 transl_table 11 codon_start 1 locus_tag LOCUS_34150 CDS complement(44412..44786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051260.1 transl_table 11 codon_start 1 locus_tag LOCUS_34160 CDS 44959..45207 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433427.1 transl_table 11 codon_start 1 locus_tag LOCUS_34170 CDS 45376..45744 product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118257.1 transl_table 11 codon_start 1 locus_tag LOCUS_34180 CDS 45744..46262 product YbjP/YqhG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847532.1 transl_table 11 codon_start 1 locus_tag LOCUS_34190 CDS complement(47083..48297) product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817161.1 transl_table 11 codon_start 1 locus_tag LOCUS_34200 gene fabB CDS 48457..50457 product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816082.1 transl_table 11 codon_start 1 locus_tag LOCUS_34210 gene mnmC CDS complement(50509..50784) product YfcL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559749.1 transl_table 11 codon_start 1 locus_tag LOCUS_34220 CDS complement(50817..51365) product elongation factor P hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089233.1 transl_table 11 codon_start 1 locus_tag LOCUS_34230 gene epmC CDS complement(51365..52174) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368599.1 transl_table 11 codon_start 1 locus_tag LOCUS_34240 CDS complement(52174..52998) product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750429.1 transl_table 11 codon_start 1 locus_tag LOCUS_34250 gene mepA CDS complement(53002..54087) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918475.1 transl_table 11 codon_start 1 locus_tag LOCUS_34260 gene aroC CDS complement(54123..55055) product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001542329.1 transl_table 11 codon_start 1 locus_tag LOCUS_34270 gene prmB CDS 55221..55772 product endonuclease SmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730794.1 transl_table 11 codon_start 1 locus_tag LOCUS_34280 gene smrB CDS complement(55872..56357) product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195808.1 transl_table 11 codon_start 1 locus_tag LOCUS_34290 gene sixA CDS complement(56566..58713) product fatty acid oxidation complex subunit alpha FadJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214156.1 transl_table 11 codon_start 1 locus_tag LOCUS_34300 gene fadJ CDS complement(58713..60023) product acetyl-CoA C-acyltransferase FadI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248124.1 transl_table 11 codon_start 1 locus_tag LOCUS_34310 gene fadI CDS complement(60201..60485) product YfcZ/YiiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030904.1 transl_table 11 codon_start 1 locus_tag LOCUS_34320 CDS 60850..62163 product long-chain fatty acid transporter FadL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001766332.1 transl_table 11 codon_start 1 locus_tag LOCUS_34330 gene fadL CDS complement(62224..62979) product phospholipid-binding lipoprotein MlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776787.1 transl_table 11 codon_start 1 locus_tag LOCUS_34340 gene mlaA CDS 63268..64209 product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377769.1 transl_table 11 codon_start 1 locus_tag LOCUS_34350 tRNA 64285..64359 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00620 sequence25 source 1..64456 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 215..1558 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013762.1 transl_table 11 codon_start 1 locus_tag LOCUS_34360 CDS 1607..3115 product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933982.1 transl_table 11 codon_start 1 locus_tag LOCUS_34370 CDS 3371..4990 product glucan biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081955.1 transl_table 11 codon_start 1 locus_tag LOCUS_34380 CDS 5195..5761 product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024312.1 transl_table 11 codon_start 1 locus_tag LOCUS_34390 CDS complement(5939..6658) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027219.1 transl_table 11 codon_start 1 locus_tag LOCUS_34400 CDS complement(6749..7792) product L-idonate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197408.1 transl_table 11 codon_start 1 locus_tag LOCUS_34410 gene idnD CDS complement(7809..9170) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769658.1 transl_table 11 codon_start 1 locus_tag LOCUS_34420 CDS complement(9254..10021) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971598.1 transl_table 11 codon_start 1 locus_tag LOCUS_34430 CDS 10359..11612 product starvation-sensing protein RspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602314.1 transl_table 11 codon_start 1 locus_tag LOCUS_34440 gene rspA CDS complement(11753..12190) product cryptic aminoglycoside N-acetyltransferase AAC(6')-Iy/Iaa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354865.1 transl_table 11 codon_start 1 locus_tag LOCUS_34450 gene aac(6') CDS complement(12190..12987) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001670738.1 transl_table 11 codon_start 1 locus_tag LOCUS_34460 CDS complement(12997..13629) product ribulose-phosphate 3 epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600614.1 transl_table 11 codon_start 1 locus_tag LOCUS_34470 CDS complement(13641..14078) product SgcA family PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606458.1 transl_table 11 codon_start 1 locus_tag LOCUS_34480 gene sgcA CDS complement(14210..15016) product BtpA family protein SgcQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118614.1 transl_table 11 codon_start 1 locus_tag LOCUS_34490 gene sgcQ CDS complement(15030..16343) product PTS sugar transporter subunit IIC SgcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460840.1 transl_table 11 codon_start 1 locus_tag LOCUS_34500 gene sgcC CDS complement(16354..16635) product PTS sugar transporter subunit IIB SgcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976132.1 transl_table 11 codon_start 1 locus_tag LOCUS_34510 gene sgcB CDS complement(16632..17750) product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144622.1 transl_table 11 codon_start 1 locus_tag LOCUS_34520 CDS 17967..18506 product 50S ribosomal protein L7/L12-serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229308.1 transl_table 11 codon_start 1 locus_tag LOCUS_34530 gene rimL CDS complement(18503..19483) product YdcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599089.1 transl_table 11 codon_start 1 locus_tag LOCUS_34540 gene ydcK CDS 19590..20603 product dicarboxylate transporter/tellurite-resistance protein TehA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000336113.1 transl_table 11 codon_start 1 locus_tag LOCUS_34550 gene tehA CDS 20590..21186 product tellurite resistance methyltransferase TehB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218282.1 transl_table 11 codon_start 1 locus_tag LOCUS_34560 gene tehB CDS 21342..22010 product DUF3313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259016.1 transl_table 11 codon_start 1 locus_tag LOCUS_34570 CDS complement(22064..23242) product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238501.1 transl_table 11 codon_start 1 locus_tag LOCUS_34580 CDS 23335..23871 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000369547.1 transl_table 11 codon_start 1 locus_tag LOCUS_34590 CDS 23950..25914 product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249757.1 transl_table 11 codon_start 1 locus_tag LOCUS_34600 CDS complement(25915..26148) product DUF2554 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956438.1 transl_table 11 codon_start 1 locus_tag LOCUS_34610 CDS 26179..26367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34620 CDS complement(26419..26814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34630 CDS 27906..28304 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747901.1 transl_table 11 codon_start 1 locus_tag LOCUS_34640 CDS 28826..29596 product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237711.1 transl_table 11 codon_start 1 locus_tag LOCUS_34650 CDS 29732..31156 product GntR family transcriptional regulator YdcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760699.1 transl_table 11 codon_start 1 locus_tag LOCUS_34660 gene ycdR CDS 31271..32716 product aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158107.1 transl_table 11 codon_start 1 locus_tag LOCUS_34670 gene patD CDS complement(33333..35477) product virulence-associated effector SrfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165637.1 transl_table 11 codon_start 1 locus_tag LOCUS_34680 gene srfC CDS complement(35474..38467) product virulence factor SrfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000960825.1 transl_table 11 codon_start 1 locus_tag LOCUS_34690 CDS complement(38460..39785) product virulence-associated effector SrfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129948.1 transl_table 11 codon_start 1 locus_tag LOCUS_34700 gene srfA CDS 40009..40242 product YdcY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018716.1 transl_table 11 codon_start 1 locus_tag LOCUS_34710 CDS complement(40247..40696) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076571.1 transl_table 11 codon_start 1 locus_tag LOCUS_34720 CDS complement(40696..41211) product L-methionine sulfoximine/L-methionine sulfone acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155377.1 transl_table 11 codon_start 1 locus_tag LOCUS_34730 gene mddA CDS 41423..42460 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001682108.1 transl_table 11 codon_start 1 locus_tag LOCUS_34740 CDS 42794..43459 product colanic acid/biofilm transcriptional regulator McbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119592.1 transl_table 11 codon_start 1 locus_tag LOCUS_34750 gene mcbR CDS complement(43515..45533) product TonB-dependent receptor PqqU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692046.1 transl_table 11 codon_start 1 locus_tag LOCUS_34760 gene pqqU CDS 45899..46960 product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550638.1 transl_table 11 codon_start 1 locus_tag LOCUS_34770 CDS 47105..47326 product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732362.1 transl_table 11 codon_start 1 locus_tag LOCUS_34780 CDS complement(47403..48896) product L-asparagine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857112.1 transl_table 11 codon_start 1 locus_tag LOCUS_34790 gene ansP CDS 49409..50041 product type III secretion system effector SteA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147139.1 transl_table 11 codon_start 1 locus_tag LOCUS_34800 gene steA CDS 50324..51169 product N-hydroxyarylamine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200336.1 transl_table 11 codon_start 1 locus_tag LOCUS_34810 gene nhoA CDS complement(51205..52098) product PhzF family isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804298.1 transl_table 11 codon_start 1 locus_tag LOCUS_34820 CDS complement(52204..52884) product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617102.1 transl_table 11 codon_start 1 locus_tag LOCUS_34830 gene narI CDS complement(52881..53576) product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166289.1 transl_table 11 codon_start 1 locus_tag LOCUS_34840 gene narW CDS complement(53576..55120) product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702603.1 transl_table 11 codon_start 1 locus_tag LOCUS_34850 gene narH CDS complement(55117..58857) product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000040363.1 transl_table 11 codon_start 1 locus_tag LOCUS_34860 CDS complement(58949..60187) product NarK family nitrate/nitrite MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198245.1 transl_table 11 codon_start 1 locus_tag LOCUS_34870 CDS complement(60552..61130) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121044.1 transl_table 11 codon_start 1 locus_tag LOCUS_34880 CDS 61248..62735 product methyl viologen efflux MFS transporter SmvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489748.1 transl_table 11 codon_start 1 locus_tag LOCUS_34890 gene smvA CDS complement(62760..63200) product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338748.1 transl_table 11 codon_start 1 locus_tag LOCUS_34900 CDS complement(63284..64372) product porin OmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096520.1 transl_table 11 codon_start 1 locus_tag LOCUS_34910 sequence26 source 1..62860 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(536..1066) product single-stranded DNA-binding protein SSB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209100.1 transl_table 11 codon_start 1 locus_tag LOCUS_34920 gene ssb1 CDS 1314..4139 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357724.1 transl_table 11 codon_start 1 locus_tag LOCUS_34930 gene uvrA CDS 4283..4726 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432193.1 transl_table 11 codon_start 1 locus_tag LOCUS_34940 CDS 4713..5051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146604.1 transl_table 11 codon_start 1 locus_tag LOCUS_34950 CDS complement(5052..5408) product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155664.1 transl_table 11 codon_start 1 locus_tag LOCUS_34960 CDS complement(5411..5827) product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000270393.1 transl_table 11 codon_start 1 locus_tag LOCUS_34970 CDS complement(5956..6669) product acid phosphatase AphA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724436.1 transl_table 11 codon_start 1 locus_tag LOCUS_34980 gene aphA CDS complement(6856..8049) product aromatic amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486904.1 transl_table 11 codon_start 1 locus_tag LOCUS_34990 gene tyrB CDS complement(8235..9314) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147297.1 transl_table 11 codon_start 1 locus_tag LOCUS_35000 gene alr CDS complement(9346..10761) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918353.1 transl_table 11 codon_start 1 locus_tag LOCUS_35010 gene dnaB CDS 10826..11809 product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235562.1 transl_table 11 codon_start 1 locus_tag LOCUS_35020 CDS complement(11984..12226) product envelope stress response protein PspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891414.1 transl_table 11 codon_start 1 locus_tag LOCUS_35030 gene pspG CDS complement(12394..13392) product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182236.1 transl_table 11 codon_start 1 locus_tag LOCUS_35040 gene dusA CDS complement(13480..14790) product conjugal transfer protein TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039344.1 transl_table 11 codon_start 1 locus_tag LOCUS_35050 CDS 15037..15552 product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416271.1 transl_table 11 codon_start 1 locus_tag LOCUS_35060 gene zur CDS complement(15651..15863) product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981150.1 transl_table 11 codon_start 1 locus_tag LOCUS_35070 CDS complement(15882..16091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35080 CDS complement(15992..17317) product MATE family efflux transporter DinF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128110.1 transl_table 11 codon_start 1 locus_tag LOCUS_35090 gene dinF CDS 17204..17425 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35100 CDS complement(17496..18104) product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646079.1 transl_table 11 codon_start 1 locus_tag LOCUS_35110 gene lexA CDS complement(18213..18581) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002902.1 transl_table 11 codon_start 1 locus_tag LOCUS_35120 CDS 18752..21172 product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017366.1 transl_table 11 codon_start 1 locus_tag LOCUS_35130 gene plsB CDS complement(21271..22143) product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455249.1 transl_table 11 codon_start 1 locus_tag LOCUS_35140 gene ubiA CDS complement(22157..22654) product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019220.1 transl_table 11 codon_start 1 locus_tag LOCUS_35150 gene ubiC CDS complement(22835..23752) product maltose operon protein MalM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782497.1 transl_table 11 codon_start 1 locus_tag LOCUS_35160 gene malM CDS complement(23916..25274) product maltoporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973678.1 transl_table 11 codon_start 1 locus_tag LOCUS_35170 CDS complement(25363..26472) product maltose/maltodextrin ABC transporter ATP-binding protein MalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179177.1 transl_table 11 codon_start 1 locus_tag LOCUS_35180 gene malK CDS 26834..28024 product maltose/maltodextrin ABC transporter substrate-binding protein MalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695415.1 transl_table 11 codon_start 1 locus_tag LOCUS_35190 gene malE CDS 28156..29700 product maltose ABC transporter permease MalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382568.1 transl_table 11 codon_start 1 locus_tag LOCUS_35200 gene malF CDS 29715..30605 product maltose ABC transporter permease MalG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252081.1 transl_table 11 codon_start 1 locus_tag LOCUS_35210 gene malG CDS complement(30771..31181) product phosphate-starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982749.1 transl_table 11 codon_start 1 locus_tag LOCUS_35220 gene psiE CDS complement(31324..33420) product YjbH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750797.1 transl_table 11 codon_start 1 locus_tag LOCUS_35230 CDS complement(33420..34157) product capsule biosynthesis GfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977977.1 transl_table 11 codon_start 1 locus_tag LOCUS_35240 CDS complement(34154..34792) product YjbF family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824800.1 transl_table 11 codon_start 1 locus_tag LOCUS_35250 CDS complement(34856..35101) product exopolysaccharide production protein YjbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976742.1 transl_table 11 codon_start 1 locus_tag LOCUS_35260 gene yjbE CDS complement(35542..37191) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790033.1 transl_table 11 codon_start 1 locus_tag LOCUS_35270 gene pgi CDS 37579..38928 product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136394.1 transl_table 11 codon_start 1 locus_tag LOCUS_35280 gene lysC CDS complement(39059..39406) product Mor transcription activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619864.1 transl_table 11 codon_start 1 locus_tag LOCUS_35290 CDS 39856..40272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35300 note possible pseudo, frameshifted CDS 40851..41579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35310 CDS 42008..43597 product PTS sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099738.1 transl_table 11 codon_start 1 locus_tag LOCUS_35320 CDS 43621..44460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472332.1 transl_table 11 codon_start 1 locus_tag LOCUS_35330 CDS 44477..45340 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924650.1 transl_table 11 codon_start 1 locus_tag LOCUS_35340 CDS 45327..46085 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068169.1 transl_table 11 codon_start 1 locus_tag LOCUS_35350 CDS 46148..46420 product DUF3811 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207628.1 transl_table 11 codon_start 1 locus_tag LOCUS_35360 CDS complement(46417..47286) product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954615.1 transl_table 11 codon_start 1 locus_tag LOCUS_35370 gene rluF CDS complement(47333..47872) product DUF2058 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096724.1 transl_table 11 codon_start 1 locus_tag LOCUS_35380 CDS 48182..48784 product dipeptidase PepE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421788.1 transl_table 11 codon_start 1 locus_tag LOCUS_35390 gene pepE note possible pseudo, internal stop codon, frameshifted CDS complement(48844..50475) product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956807.1 transl_table 11 codon_start 1 locus_tag LOCUS_35400 CDS complement(50742..54425) product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095965.1 transl_table 11 codon_start 1 locus_tag LOCUS_35410 gene metH CDS 54729..55553 product glyoxylate bypass operon transcriptional repressor IclR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226433.1 transl_table 11 codon_start 1 locus_tag LOCUS_35420 gene iclR CDS 55537..55971 product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001412115.1 transl_table 11 codon_start 1 locus_tag LOCUS_35430 CDS complement(55935..57686) product bifunctional isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137261.1 transl_table 11 codon_start 1 locus_tag LOCUS_35440 gene aceK CDS complement(57788..59092) product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857886.1 transl_table 11 codon_start 1 locus_tag LOCUS_35450 gene aceA CDS complement(59124..60728) product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069369.1 transl_table 11 codon_start 1 locus_tag LOCUS_35460 gene aceB CDS complement(60994..61923) product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122765.1 transl_table 11 codon_start 1 locus_tag LOCUS_35470 gene metA CDS 62080..62517 product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973251.1 transl_table 11 codon_start 1 locus_tag LOCUS_35480 rRNA complement(62686..62796) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00060 sequence27 source 1..61886 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 327..887 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032645.1 transl_table 11 codon_start 1 locus_tag LOCUS_35490 CDS 973..3630 product outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181237660.1 transl_table 11 codon_start 1 locus_tag LOCUS_35500 CDS 3648..4400 product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281615.1 transl_table 11 codon_start 1 locus_tag LOCUS_35510 CDS 4419..4931 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178263.1 transl_table 11 codon_start 1 locus_tag LOCUS_35520 CDS 4928..5404 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822649.1 transl_table 11 codon_start 1 locus_tag LOCUS_35530 CDS 5404..5934 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050120.1 transl_table 11 codon_start 1 locus_tag LOCUS_35540 CDS 6003..6773 product StfH/YfcO family fimbrial adhesin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602831.1 transl_table 11 codon_start 1 locus_tag LOCUS_35550 CDS complement(6881..8161) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045264.1 transl_table 11 codon_start 1 locus_tag LOCUS_35560 gene hemL CDS 8331..9752 product H(+)/Cl(-) exchange transporter ClcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845433.1 transl_table 11 codon_start 1 locus_tag LOCUS_35570 gene clcA CDS 9834..10178 product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278668.1 transl_table 11 codon_start 1 locus_tag LOCUS_35580 gene erpA CDS complement(10279..10902) product TRIC cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964234.1 transl_table 11 codon_start 1 locus_tag LOCUS_35590 CDS complement(10939..11739) product vitamin B12 ABC transporter substrate-binding protein BtuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118833.1 transl_table 11 codon_start 1 locus_tag LOCUS_35600 gene btuF CDS complement(11732..12430) product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689821.1 transl_table 11 codon_start 1 locus_tag LOCUS_35610 gene mtnN CDS 12515..14032 product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146450.1 transl_table 11 codon_start 1 locus_tag LOCUS_35620 gene dgt CDS 14162..15589 product serine endoprotease DegP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753959.1 transl_table 11 codon_start 1 locus_tag LOCUS_35630 gene degP CDS 15742..16899 product DNA-binding transcriptional regulator CdaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929458.1 transl_table 11 codon_start 1 locus_tag LOCUS_35640 gene cdaR CDS complement(16956..19988) product putative mucin/carbohydrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704442.1 transl_table 11 codon_start 1 locus_tag LOCUS_35650 CDS complement(20174..20560) product DUF3461 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272193.1 transl_table 11 codon_start 1 locus_tag LOCUS_35660 CDS 20807..22108 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484585.1 transl_table 11 codon_start 1 locus_tag LOCUS_35670 CDS complement(22145..22969) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186669.1 transl_table 11 codon_start 1 locus_tag LOCUS_35680 gene dapD CDS complement(22999..25671) product bifunctional uridylyltransferase/uridylyl-removing protein GlnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094518.1 transl_table 11 codon_start 1 locus_tag LOCUS_35690 gene glnD CDS complement(25909..26703) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018214.1 transl_table 11 codon_start 1 locus_tag LOCUS_35700 gene map CDS 27154..27879 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246886.1 transl_table 11 codon_start 1 locus_tag LOCUS_35710 gene rpsB CDS 28065..28988 product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808106.1 transl_table 11 codon_start 1 locus_tag LOCUS_35720 gene tsf CDS 29133..29858 product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224567.1 transl_table 11 codon_start 1 locus_tag LOCUS_35730 gene pyrH CDS 30005..30562 product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622423.1 transl_table 11 codon_start 1 locus_tag LOCUS_35740 gene frr CDS 30703..31899 product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811892.1 transl_table 11 codon_start 1 locus_tag LOCUS_35750 gene ispC CDS 32281..32970 product (2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947409.1 transl_table 11 codon_start 1 locus_tag LOCUS_35760 gene ispU CDS 32983..33840 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922422.1 transl_table 11 codon_start 1 locus_tag LOCUS_35770 gene cdsA CDS 33852..35204 product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949016.1 transl_table 11 codon_start 1 locus_tag LOCUS_35780 gene rseP CDS 35236..37650 product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240921.1 transl_table 11 codon_start 1 locus_tag LOCUS_35790 gene bamA CDS 37773..38258 product molecular chaperone Skp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758966.1 transl_table 11 codon_start 1 locus_tag LOCUS_35800 gene skp CDS 38262..39287 product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139265.1 transl_table 11 codon_start 1 locus_tag LOCUS_35810 gene lpxD CDS 39393..39848 product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210741.1 transl_table 11 codon_start 1 locus_tag LOCUS_35820 gene fabZ CDS 39852..40640 product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566033.1 transl_table 11 codon_start 1 locus_tag LOCUS_35830 gene lpxA CDS 40640..41788 product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741216.1 transl_table 11 codon_start 1 locus_tag LOCUS_35840 gene lpxB CDS 41785..42381 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569412.1 transl_table 11 codon_start 1 locus_tag LOCUS_35850 gene rnhB CDS 42405..45887 product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294828.1 transl_table 11 codon_start 1 locus_tag LOCUS_35860 gene dnaE CDS 45900..46859 product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055753.1 transl_table 11 codon_start 1 locus_tag LOCUS_35870 gene accA CDS 47039..48802 product chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524168.1 transl_table 11 codon_start 1 locus_tag LOCUS_35880 CDS 48878..51019 product lysine decarboxylase LdcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021059.1 transl_table 11 codon_start 1 locus_tag LOCUS_35890 gene ldcC CDS 51075..51464 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901086.1 transl_table 11 codon_start 1 locus_tag LOCUS_35900 CDS 51527..52819 product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210062.1 transl_table 11 codon_start 1 locus_tag LOCUS_35910 gene tilS CDS complement(52903..53163) product Rho-binding antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062330.1 transl_table 11 codon_start 1 locus_tag LOCUS_35920 gene rof CDS complement(53150..53350) product YaeP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518678.1 transl_table 11 codon_start 1 locus_tag LOCUS_35930 CDS 53548..54093 product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185319.1 transl_table 11 codon_start 1 locus_tag LOCUS_35940 CDS 54090..54512 product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560526.1 transl_table 11 codon_start 1 locus_tag LOCUS_35950 gene arfB CDS 54544..55245 product envelope stress response activation lipoprotein NlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000252574.1 transl_table 11 codon_start 1 locus_tag LOCUS_35960 gene nlpE CDS complement(55319..57037) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260683.1 transl_table 11 codon_start 1 locus_tag LOCUS_35970 gene proS CDS complement(57148..57855) product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093978.1 transl_table 11 codon_start 1 locus_tag LOCUS_35980 gene tsaA CDS complement(57852..58256) product Rcs stress response system protein RcsF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202315.1 transl_table 11 codon_start 1 locus_tag LOCUS_35990 gene rcsF CDS complement(58375..59190) product methionine ABC transporter substrate-binding lipoprotein MetQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000874217.1 transl_table 11 codon_start 1 locus_tag LOCUS_36000 gene metQ CDS complement(59229..59882) product methionine ABC transporter permease MetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287483.1 transl_table 11 codon_start 1 locus_tag LOCUS_36010 CDS complement(59875..60906) product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594016.1 transl_table 11 codon_start 1 locus_tag LOCUS_36020 gene metN CDS 61096..61662 product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140158.1 transl_table 11 codon_start 1 locus_tag LOCUS_36030 gene gmhB sequence28 source 1..60263 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2271 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000028230.1:thiosulfate reductase PhsA locus_tag LOCUS_36040 CDS 2286..2864 product thiosulfate reductase electron transport protein PhsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016236.1 transl_table 11 codon_start 1 locus_tag LOCUS_36050 gene phsB CDS 2861..3625 product thiosulfate reductase cytochrome B subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092553.1 transl_table 11 codon_start 1 locus_tag LOCUS_36060 CDS 3749..4921 product serine-type D-Ala-D-Ala carboxypeptidase DacD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296209.1 transl_table 11 codon_start 1 locus_tag LOCUS_36070 gene dacD CDS 5072..5539 product DNA gyrase inhibitor SbmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384326.1 transl_table 11 codon_start 1 locus_tag LOCUS_36080 gene sbmC CDS 5658..6716 product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200856.1 transl_table 11 codon_start 1 locus_tag LOCUS_36090 CDS 6961..7296 product DUF496 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450405.1 transl_table 11 codon_start 1 locus_tag LOCUS_36100 CDS complement(7330..8196) product L-threonine kinase PduX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201312.1 transl_table 11 codon_start 1 locus_tag LOCUS_36110 CDS complement(8290..9504) product propanediol utilization propionate kinase PduW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120652.1 transl_table 11 codon_start 1 locus_tag LOCUS_36120 gene pduW CDS complement(9489..9941) product propanediol utilization protein PduV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826280.1 transl_table 11 codon_start 1 locus_tag LOCUS_36130 gene pduV CDS complement(9946..10296) product propanediol utilization microcompartment protein PduU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000441103.1 transl_table 11 codon_start 1 locus_tag LOCUS_36140 gene pduU CDS complement(10296..10850) product propanediol utilization microcompartment protein PduT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075775.1 transl_table 11 codon_start 1 locus_tag LOCUS_36150 gene pduT CDS complement(10853..12208) product cobalamin reductase PduS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058762.1 transl_table 11 codon_start 1 locus_tag LOCUS_36160 gene pduS CDS complement(12205..13317) product 1-propanol dehydrogenase PduQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091449.1 transl_table 11 codon_start 1 locus_tag LOCUS_36170 gene pduQ CDS complement(13329..14723) product CoA-acylating propionaldehyde dehydrogenase PduP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097666.1 transl_table 11 codon_start 1 locus_tag LOCUS_36180 gene pduP CDS complement(14720..15730) product two-domain cob(I)yrinic acid a,c-diamide adenosyltransferase PduO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029486.1 transl_table 11 codon_start 1 locus_tag LOCUS_36190 gene pduO CDS complement(15740..16015) product propanediol utilization microcompartment protein PduN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549827.1 transl_table 11 codon_start 1 locus_tag LOCUS_36200 gene pduN CDS complement(16019..16510) product propanediol utilization microcompartment protein PduM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012961.1 transl_table 11 codon_start 1 locus_tag LOCUS_36210 gene pduM CDS complement(16507..17139) product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356724.1 transl_table 11 codon_start 1 locus_tag LOCUS_36220 CDS complement(17139..17600) product propanediol utilization microcompartment protein PduK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284376.1 transl_table 11 codon_start 1 locus_tag LOCUS_36230 gene pduK CDS complement(17625..17900) product propanediol utilization microcompartment protein PduJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057755.1 transl_table 11 codon_start 1 locus_tag LOCUS_36240 gene pduJ CDS complement(17919..18269) product propanediol dehydratase reactivase beta subunit PduH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377971.1 transl_table 11 codon_start 1 locus_tag LOCUS_36250 gene pduH CDS complement(18259..20091) product propanediol dehydratase reactivase alpha subunit PduG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268875.1 transl_table 11 codon_start 1 locus_tag LOCUS_36260 gene pduG CDS complement(20101..20622) product propanediol dehydratase small subunit PduE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090601.1 transl_table 11 codon_start 1 locus_tag LOCUS_36270 gene pduE CDS complement(20637..21311) product propanediol dehydratase medium subunit PduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405054.1 transl_table 11 codon_start 1 locus_tag LOCUS_36280 gene pduD CDS complement(21322..22986) product propanediol dehydratase large subunit PduC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256897.1 transl_table 11 codon_start 1 locus_tag LOCUS_36290 gene pduC CDS complement(23005..23817) product propanediol utilization microcompartment protein PduB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097484.1 transl_table 11 codon_start 1 locus_tag LOCUS_36300 gene pduB CDS complement(23814..24098) product propanediol utilization microcompartment protein PduA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183618.1 transl_table 11 codon_start 1 locus_tag LOCUS_36310 gene pduA CDS 24623..25417 product propanediol diffusion facilitator PduF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000027.1 transl_table 11 codon_start 1 locus_tag LOCUS_36320 gene pduF CDS 25633..26544 product regulatory protein PocR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622328.1 transl_table 11 codon_start 1 locus_tag LOCUS_36330 gene pocR CDS 27142..28521 product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741259.1 transl_table 11 codon_start 1 locus_tag LOCUS_36340 CDS 28518..29477 product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153666.1 transl_table 11 codon_start 1 locus_tag LOCUS_36350 gene cbiB CDS 29488..30120 product cobalt-precorrin-8 methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816687.1 transl_table 11 codon_start 1 locus_tag LOCUS_36360 CDS 30120..31259 product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292925.1 transl_table 11 codon_start 1 locus_tag LOCUS_36370 gene cbiD CDS 31253..31858 product cobalt-precorrin-7 (C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958833.1 transl_table 11 codon_start 1 locus_tag LOCUS_36380 CDS 31848..32426 product decarboxylating cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650991.1 transl_table 11 codon_start 1 locus_tag LOCUS_36390 CDS 32410..33183 product cobalt-precorrin-4 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004870.1 transl_table 11 codon_start 1 locus_tag LOCUS_36400 CDS 33245..34219 product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098913.1 transl_table 11 codon_start 1 locus_tag LOCUS_36410 gene cbiG CDS 34219..34944 product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953643.1 transl_table 11 codon_start 1 locus_tag LOCUS_36420 CDS 34956..35732 product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816684.1 transl_table 11 codon_start 1 locus_tag LOCUS_36430 CDS 35735..36529 product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168485.1 transl_table 11 codon_start 1 locus_tag LOCUS_36440 CDS 36526..37239 product cobalt-factor II C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013551.1 transl_table 11 codon_start 1 locus_tag LOCUS_36450 CDS 37236..37973 product cobalt ECF transporter S component CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816682.1 transl_table 11 codon_start 1 locus_tag LOCUS_36460 gene cbiM CDS 37975..38256 product energy-coupling factor ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753216.1 transl_table 11 codon_start 1 locus_tag LOCUS_36470 CDS 38240..38920 product energy-coupling factor ABC transporter transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147138.1 transl_table 11 codon_start 1 locus_tag LOCUS_36480 CDS 38929..39744 product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881535.1 transl_table 11 codon_start 1 locus_tag LOCUS_36490 CDS 39741..41261 product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189676.1 transl_table 11 codon_start 1 locus_tag LOCUS_36500 CDS 41258..41803 product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973185.1 transl_table 11 codon_start 1 locus_tag LOCUS_36510 gene cobU CDS 41800..42543 product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039987.1 transl_table 11 codon_start 1 locus_tag LOCUS_36520 gene cobS CDS 42570..43640 product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193966.1 transl_table 11 codon_start 1 locus_tag LOCUS_36530 gene cobT CDS 43718..44647 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252822.1 transl_table 11 codon_start 1 locus_tag LOCUS_36540 gene ldtA tRNA complement(44873..44948) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00630 CDS 45039..46565 product EmmdR/YeeO family multidrug/toxin efflux MATE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989199.1 transl_table 11 codon_start 1 locus_tag LOCUS_36550 tRNA 46706..46781 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00640 CDS 47278..47664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133086100.1 transl_table 11 codon_start 1 locus_tag LOCUS_36560 note possible pseudo, frameshifted CDS 47658..47984 product DUF1493 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886449.1 transl_table 11 codon_start 1 locus_tag LOCUS_36570 CDS 48180..49634 product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428186.1 transl_table 11 codon_start 1 locus_tag LOCUS_36580 CDS 50014..50199 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36590 CDS complement(50156..50329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36600 CDS complement(50539..52269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645013.1 transl_table 11 codon_start 1 locus_tag LOCUS_36610 CDS complement(52326..54494) product SEL1-like repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211266.1 transl_table 11 codon_start 1 locus_tag LOCUS_36620 CDS complement(54837..55535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36630 CDS complement(56010..56534) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36640 CDS 57077..57952 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36650 CDS 58103..58321 product AlpA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071599.1 transl_table 11 codon_start 1 locus_tag LOCUS_36660 CDS 58403..58693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36670 CDS 58738..59034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36680 sequence29 source 1..58384 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 255..440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36690 CDS 491..1336 product YjiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490324.1 transl_table 11 codon_start 1 locus_tag LOCUS_36700 CDS 1426..1983 product virulence membrane protein PagC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789474.1 transl_table 11 codon_start 1 locus_tag LOCUS_36710 gene pagC CDS 2519..2995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36720 CDS complement(3092..3271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36730 CDS complement(4169..5038) product incFII family plasmid replication initiator RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213292.1 transl_table 11 codon_start 1 locus_tag LOCUS_36740 gene repA CDS complement(5358..5603) product replication regulatory protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229817.1 transl_table 11 codon_start 1 locus_tag LOCUS_36750 gene repA CDS complement(5803..5982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36760 note possible pseudo, frameshifted CDS complement(5999..6283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36770 note possible pseudo, frameshifted CDS complement(6405..6857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36780 CDS complement(6974..7396) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36790 CDS complement(7658..7990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36800 note possible pseudo, frameshifted CDS complement(7987..8202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36810 CDS complement(8189..8791) product conjugal transfer pilus-stabilizing protein TraP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002787.1 transl_table 11 codon_start 1 locus_tag LOCUS_36820 gene traP CDS complement(8775..10196) product F-type conjugal transfer pilus assembly protein TraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146665.1 transl_table 11 codon_start 1 locus_tag LOCUS_36830 gene traB CDS complement(10196..10936) product type-F conjugative transfer system secretin TraK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230787.1 transl_table 11 codon_start 1 locus_tag LOCUS_36840 gene traK CDS complement(10923..11489) product type IV conjugative transfer system protein TraE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399792.1 transl_table 11 codon_start 1 locus_tag LOCUS_36850 gene traE CDS complement(11511..11822) product type IV conjugative transfer system protein TraL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012100.1 transl_table 11 codon_start 1 locus_tag LOCUS_36860 gene traL CDS complement(11837..12199) product type IV conjugative transfer system pilin TraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994779.1 transl_table 11 codon_start 1 locus_tag LOCUS_36870 gene traA CDS complement(12241..12468) product conjugal transfer relaxosome protein TraY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254388.1 transl_table 11 codon_start 1 locus_tag LOCUS_36880 gene traY CDS complement(12562..12933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36890 note possible pseudo, frameshifted CDS complement(12936..13247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36900 note possible pseudo, frameshifted CDS complement(13441..13821) product conjugal transfer relaxosome DNA-binding protein TraM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151524.1 transl_table 11 codon_start 1 locus_tag LOCUS_36910 gene traM CDS 14174..14707 product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000243713.1 transl_table 11 codon_start 1 locus_tag LOCUS_36920 CDS complement(15230..15463) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36930 note possible pseudo, internal stop codon, frameshifted CDS complement(15567..15836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36940 note possible pseudo, internal stop codon, frameshifted CDS complement(15939..16097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36950 CDS complement(16346..16945) product plasmid SOS inhibition protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087158.1 transl_table 11 codon_start 1 locus_tag LOCUS_36960 CDS complement(16939..17103) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36970 CDS complement(17146..18843) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145488.1 transl_table 11 codon_start 1 locus_tag LOCUS_36980 CDS 19168..19590 product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109071.1 transl_table 11 codon_start 1 locus_tag LOCUS_36990 gene umuD CDS 19590..20864 product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457555.1 transl_table 11 codon_start 1 locus_tag LOCUS_37000 CDS complement(20946..21920) product ParB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431558.1 transl_table 11 codon_start 1 locus_tag LOCUS_37010 CDS complement(21920..23125) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200287.1 transl_table 11 codon_start 1 locus_tag LOCUS_37020 CDS 23540..24481 product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215065.1 transl_table 11 codon_start 1 locus_tag LOCUS_37030 CDS complement(24478..25083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37040 CDS complement(25140..25475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37050 CDS complement(25659..26168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37060 CDS complement(26161..27276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37070 CDS 27534..28022 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416123.1 transl_table 11 codon_start 1 locus_tag LOCUS_37080 CDS 28677..29417 product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817006.1 transl_table 11 codon_start 1 locus_tag LOCUS_37090 CDS 29762..30184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37100 CDS 30504..31832 product IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119264.1 transl_table 11 codon_start 1 locus_tag LOCUS_37110 CDS 31822..32790 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122320241.1 transl_table 11 codon_start 1 locus_tag LOCUS_37120 CDS complement(32979..34016) product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025381298.1 transl_table 11 codon_start 1 locus_tag LOCUS_37130 CDS 35122..35517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37140 CDS 35691..35855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37150 note possible pseudo, frameshifted CDS 36029..36796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37160 CDS 36759..36926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37170 CDS 36978..38753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37180 CDS 39034..39759 product type III secretion system effector phosphothreonine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001121867.1 transl_table 11 codon_start 1 locus_tag LOCUS_37190 CDS 40021..40671 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37200 CDS complement(40798..41157) product IS200/IS605-like element ISEc46 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064873.1 transl_table 11 codon_start 1 locus_tag LOCUS_37210 gene tnpA CDS 41280..41630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37220 note possible pseudo, frameshifted CDS complement(41697..42257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37230 CDS 42413..42700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37240 CDS complement(42780..43067) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37250 CDS complement(42977..43462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37260 CDS complement(43456..43944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37270 CDS complement(43969..44682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37280 CDS complement(44691..45473) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013214009.1 transl_table 11 codon_start 1 locus_tag LOCUS_37290 CDS complement(45508..46029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37300 CDS complement(46026..46316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37310 CDS complement(46318..46623) product type II toxin-antitoxin system toxin CcdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159868.1 transl_table 11 codon_start 1 locus_tag LOCUS_37320 gene ccdB CDS complement(46625..46843) product type II toxin-antitoxin system antitoxin CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813638.1 transl_table 11 codon_start 1 locus_tag LOCUS_37330 gene ccdA CDS complement(48174..48389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37340 CDS 48524..48712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37350 CDS 49313..50302 product RepB family plasmid replication initiator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361615.1 transl_table 11 codon_start 1 locus_tag LOCUS_37360 CDS complement(50843..51229) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37370 CDS 51936..52238 product adhesin biosynthesis transcription regulatory family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000930062.1 transl_table 11 codon_start 1 locus_tag LOCUS_37380 CDS 52513..53037 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37390 CDS 53264..55672 product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103899.1 transl_table 11 codon_start 1 locus_tag LOCUS_37400 CDS 55665..56357 product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094863.1 transl_table 11 codon_start 1 locus_tag LOCUS_37410 CDS 56354..56932 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37420 CDS 57115..57969 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37430 sequence30 source 1..52266 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(43..711) product arginine ABC transporter permease ArtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895396.1 transl_table 11 codon_start 1 locus_tag LOCUS_37440 gene artM CDS complement(711..1427) product arginine ABC transporter permease ArtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001677.1 transl_table 11 codon_start 1 locus_tag LOCUS_37450 gene artQ CDS complement(1434..2165) product arginine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000756586.1 transl_table 11 codon_start 1 locus_tag LOCUS_37460 gene artJ CDS complement(2183..2911) product arginine ABC transporter ATP-binding protein ArtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027186.1 transl_table 11 codon_start 1 locus_tag LOCUS_37470 gene artP CDS complement(3141..3656) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270727.1 transl_table 11 codon_start 1 locus_tag LOCUS_37480 CDS 3784..4107 product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160725.1 transl_table 11 codon_start 1 locus_tag LOCUS_37490 CDS 4104..4934 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645850.1 transl_table 11 codon_start 1 locus_tag LOCUS_37500 CDS complement(4931..5944) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866904.1 transl_table 11 codon_start 1 locus_tag LOCUS_37510 CDS complement(6040..7473) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079004.1 transl_table 11 codon_start 1 locus_tag LOCUS_37520 CDS complement(7484..8485) product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566341.1 transl_table 11 codon_start 1 locus_tag LOCUS_37530 gene ltaE CDS complement(8524..10242) product ubiquinone-dependent pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815309.1 transl_table 11 codon_start 1 locus_tag LOCUS_37540 gene poxB CDS complement(10400..11368) product NADH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988821.1 transl_table 11 codon_start 1 locus_tag LOCUS_37550 gene hcr CDS complement(11380..13032) product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000458773.1 transl_table 11 codon_start 1 locus_tag LOCUS_37560 gene hcp CDS complement(13176..14075) product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491116.1 transl_table 11 codon_start 1 locus_tag LOCUS_37570 CDS 14277..15935 product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599771.1 transl_table 11 codon_start 1 locus_tag LOCUS_37580 CDS complement(15932..16882) product VirK/YbjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001682088.1 transl_table 11 codon_start 1 locus_tag LOCUS_37590 CDS 17028..18146 product macrolide transporter subunit MacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201759.1 transl_table 11 codon_start 1 locus_tag LOCUS_37600 gene macA CDS 18143..20089 product macrolide ABC transporter ATP-binding protein/permease MacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125880.1 transl_table 11 codon_start 1 locus_tag LOCUS_37610 gene macB CDS complement(20219..20440) product cold shock-like protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447499.1 transl_table 11 codon_start 1 locus_tag LOCUS_37620 gene cspD CDS 20764..21084 product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000520789.1 transl_table 11 codon_start 1 locus_tag LOCUS_37630 gene clpS CDS 21115..23391 product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934058.1 transl_table 11 codon_start 1 locus_tag LOCUS_37640 gene clpA CDS complement(23604..23801) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37650 CDS complement(23963..24340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37660 tRNA complement(24771..24858) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00650 CDS complement(25007..25684) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097901.1 transl_table 11 codon_start 1 locus_tag LOCUS_37670 CDS complement(25704..26564) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809962.1 transl_table 11 codon_start 1 locus_tag LOCUS_37680 CDS 26673..27584 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597928.1 transl_table 11 codon_start 1 locus_tag LOCUS_37690 CDS complement(27675..27893) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040187.1 transl_table 11 codon_start 1 locus_tag LOCUS_37700 gene infA CDS complement(28205..28909) product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241650.1 transl_table 11 codon_start 1 locus_tag LOCUS_37710 gene aat CDS complement(28954..30675) product cysteine/glutathione ABC transporter ATP-binding protein/permease CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202266.1 transl_table 11 codon_start 1 locus_tag LOCUS_37720 gene cydC CDS complement(30676..32442) product cysteine/glutathione ABC transporter permease/ATP-binding protein CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044527.1 transl_table 11 codon_start 1 locus_tag LOCUS_37730 gene cydD CDS complement(32556..33524) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000537407.1 transl_table 11 codon_start 1 locus_tag LOCUS_37740 gene trxB CDS 34070..34564 product leucine-responsive transcriptional regulator Lrp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228469.1 transl_table 11 codon_start 1 locus_tag LOCUS_37750 gene lrp CDS 34699..38820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37760 CDS 38960..39574 product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001765126.1 transl_table 11 codon_start 1 locus_tag LOCUS_37770 gene lolA CDS 39584..40927 product replication-associated recombination protein RarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067785.1 transl_table 11 codon_start 1 locus_tag LOCUS_37780 gene rarA CDS 41186..42478 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886697.1 transl_table 11 codon_start 1 locus_tag LOCUS_37790 gene serS CDS 42715..45159 product dimethylsulfoxide reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850260.1 transl_table 11 codon_start 1 locus_tag LOCUS_37800 gene dmsA CDS 45170..45787 product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213069.1 transl_table 11 codon_start 1 locus_tag LOCUS_37810 gene dmsB CDS 45789..46652 product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534681.1 transl_table 11 codon_start 1 locus_tag LOCUS_37820 CDS 47002..48150 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029921.1 transl_table 11 codon_start 1 locus_tag LOCUS_37830 CDS 48368..49789 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001134259.1 transl_table 11 codon_start 1 locus_tag LOCUS_37840 CDS complement(50082..50879) product pyruvate formate lyase 1-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067928.1 transl_table 11 codon_start 1 locus_tag LOCUS_37850 gene pflA sequence31 source 1..50776 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(192..2474) product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292799.1 transl_table 11 codon_start 1 locus_tag LOCUS_37860 gene pflB CDS complement(2534..3391) product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642539.1 transl_table 11 codon_start 1 locus_tag LOCUS_37870 gene focA CDS complement(3796..5556) product 30S ribosomal protein S12 methylthiotransferase accessory protein YcaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194823.1 transl_table 11 codon_start 1 locus_tag LOCUS_37880 CDS 5693..6385 product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642873.1 transl_table 11 codon_start 1 locus_tag LOCUS_37890 CDS 6571..7659 product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079590.1 transl_table 11 codon_start 1 locus_tag LOCUS_37900 gene serC CDS 7730..9013 product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445205.1 transl_table 11 codon_start 1 locus_tag LOCUS_37910 gene aroA CDS 9156..9917 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792300.1 transl_table 11 codon_start 1 locus_tag LOCUS_37920 CDS 10090..10773 product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125007.1 transl_table 11 codon_start 1 locus_tag LOCUS_37930 gene cmk CDS 10887..12560 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140324.1 transl_table 11 codon_start 1 locus_tag LOCUS_37940 gene rpsA CDS 12716..13000 product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167332.1 transl_table 11 codon_start 1 locus_tag LOCUS_37950 gene ihfB CDS complement(13383..13574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37960 CDS 13620..15494 product ComEC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705794.1 transl_table 11 codon_start 1 locus_tag LOCUS_37970 CDS 15531..17279 product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551246.1 transl_table 11 codon_start 1 locus_tag LOCUS_37980 gene msbA CDS 17276..18253 product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561698.1 transl_table 11 codon_start 1 locus_tag LOCUS_37990 gene lpxK CDS 18297..19529 product crosslink repair DNA glycosylase YcaQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056498.1 transl_table 11 codon_start 1 locus_tag LOCUS_38000 gene ycaQ CDS 19581..19763 product protein YcaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350061.1 transl_table 11 codon_start 1 locus_tag LOCUS_38010 gene ycaR CDS 19760..20506 product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011583.1 transl_table 11 codon_start 1 locus_tag LOCUS_38020 gene kdsB CDS 20717..21610 product YcbJ family phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436890.1 transl_table 11 codon_start 1 locus_tag LOCUS_38030 CDS complement(21590..22366) product envelope biogenesis factor ElyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899546.1 transl_table 11 codon_start 1 locus_tag LOCUS_38040 gene elyC CDS 22502..23305 product tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154025.1 transl_table 11 codon_start 1 locus_tag LOCUS_38050 gene cmoM CDS 23298..24620 product chromosome partition protein MukF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288827.1 transl_table 11 codon_start 1 locus_tag LOCUS_38060 gene mukF CDS 24601..25305 product chromosome partition protein MukE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295931.1 transl_table 11 codon_start 1 locus_tag LOCUS_38070 gene mukE CDS 25305..29771 product chromosome partition protein MukB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572729.1 transl_table 11 codon_start 1 locus_tag LOCUS_38080 gene mukB CDS 30116..31966 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925899.1 transl_table 11 codon_start 1 locus_tag LOCUS_38090 gene ldtD CDS 32226..32774 product YcbK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357053.1 transl_table 11 codon_start 1 locus_tag LOCUS_38100 CDS 32802..33449 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109472.1 transl_table 11 codon_start 1 locus_tag LOCUS_38110 CDS complement(33511..34701) product aspartate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462648.1 transl_table 11 codon_start 1 locus_tag LOCUS_38120 gene aspC CDS complement(34886..35977) product porin OmpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977709.1 transl_table 11 codon_start 1 locus_tag LOCUS_38130 gene ompF CDS complement(36571..37971) product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117867.1 transl_table 11 codon_start 1 locus_tag LOCUS_38140 gene asnS CDS complement(38172..38633) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762345.1 transl_table 11 codon_start 1 locus_tag LOCUS_38150 CDS complement(38697..38864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38160 CDS 38951..40165 product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047950.1 transl_table 11 codon_start 1 locus_tag LOCUS_38170 gene dpaL CDS 40411..41847 product amino acid carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893189.1 transl_table 11 codon_start 1 locus_tag LOCUS_38180 CDS complement(41925..43127) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191411.1 transl_table 11 codon_start 1 locus_tag LOCUS_38190 gene pncB CDS complement(43212..43421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38200 CDS complement(43322..43732) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38210 CDS 43753..44382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38220 CDS 44366..44992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38230 CDS 44989..46698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38240 CDS 46698..47279 product tail fiber assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885576.1 transl_table 11 codon_start 1 locus_tag LOCUS_38250 CDS 48153..48725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38260 CDS 48993..49241 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38270 note possible pseudo, frameshifted CDS complement(49373..49999) product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419689.1 transl_table 11 codon_start 1 locus_tag LOCUS_38280 sequence32 source 1..48831 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(294..824) product molybdopterin-guanine dinucleotide biosynthesis protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989262.1 transl_table 11 codon_start 1 locus_tag LOCUS_38290 gene mobB CDS complement(806..1390) product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046874.1 transl_table 11 codon_start 1 locus_tag LOCUS_38300 gene mobA CDS 1460..1729 product YihD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649858.1 transl_table 11 codon_start 1 locus_tag LOCUS_38310 CDS 1806..2792 product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999265.1 transl_table 11 codon_start 1 locus_tag LOCUS_38320 CDS 2809..3432 product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725369.1 transl_table 11 codon_start 1 locus_tag LOCUS_38330 gene dsbA CDS complement(3445..4194) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196902.1 transl_table 11 codon_start 1 locus_tag LOCUS_38340 CDS 4741..7527 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249956.1 transl_table 11 codon_start 1 locus_tag LOCUS_38350 gene polA CDS complement(7862..8494) product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183327.1 transl_table 11 codon_start 1 locus_tag LOCUS_38360 gene yihA CDS 8761..8958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38370 CDS 9077..9592 product Der GTPase-activating protein YihI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743292.1 transl_table 11 codon_start 1 locus_tag LOCUS_38380 gene yihI CDS 9781..11154 product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003520.1 transl_table 11 codon_start 1 locus_tag LOCUS_38390 gene hemN CDS complement(11467..12876) product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188774.1 transl_table 11 codon_start 1 locus_tag LOCUS_38400 gene glnG CDS complement(12885..13934) product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146194.1 transl_table 11 codon_start 1 locus_tag LOCUS_38410 gene glnL CDS complement(14209..15618) product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271699.1 transl_table 11 codon_start 1 locus_tag LOCUS_38420 gene glnA CDS 15994..17817 product ribosome-dependent GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572064.1 transl_table 11 codon_start 1 locus_tag LOCUS_38430 gene typA CDS complement(17872..18606) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270591.1 transl_table 11 codon_start 1 locus_tag LOCUS_38440 CDS complement(18591..19469) product STM4011 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001681897.1 transl_table 11 codon_start 1 locus_tag LOCUS_38450 CDS complement(19466..20707) product STM4012 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058547.1 transl_table 11 codon_start 1 locus_tag LOCUS_38460 CDS complement(20709..21584) product STM4013/SEN3800 family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282797.1 transl_table 11 codon_start 1 locus_tag LOCUS_38470 CDS complement(21577..22563) product STM4014 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631310.1 transl_table 11 codon_start 1 locus_tag LOCUS_38480 CDS complement(22615..23463) product STM4015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042080.1 transl_table 11 codon_start 1 locus_tag LOCUS_38490 CDS complement(23620..24312) product porin OmpL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838825.1 transl_table 11 codon_start 1 locus_tag LOCUS_38500 gene ompL CDS complement(24380..24958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38510 note possible pseudo, frameshifted CDS complement(24943..25800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38520 note possible pseudo, frameshifted CDS complement(25846..27228) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084241.1 transl_table 11 codon_start 1 locus_tag LOCUS_38530 CDS complement(27274..29310) product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087028.1 transl_table 11 codon_start 1 locus_tag LOCUS_38540 CDS complement(29354..30196) product aldose-1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005052848.1 transl_table 11 codon_start 1 locus_tag LOCUS_38550 CDS complement(30215..31456) product sulfoquinovose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870897.1 transl_table 11 codon_start 1 locus_tag LOCUS_38560 gene yihS CDS complement(31472..32350) product sulfofructosephosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067413.1 transl_table 11 codon_start 1 locus_tag LOCUS_38570 gene yihT CDS complement(32373..33269) product sulfolactaldehyde 3-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268240.1 transl_table 11 codon_start 1 locus_tag LOCUS_38580 gene yihU CDS 33434..34330 product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001520529.1 transl_table 11 codon_start 1 locus_tag LOCUS_38590 CDS 34364..35167 product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059689.1 transl_table 11 codon_start 1 locus_tag LOCUS_38600 CDS 35358..35957 product glucose-1-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965695.1 transl_table 11 codon_start 1 locus_tag LOCUS_38610 gene yihX CDS 36044..36823 product virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921423.1 transl_table 11 codon_start 1 locus_tag LOCUS_38620 CDS 36820..37257 product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560975.1 transl_table 11 codon_start 1 locus_tag LOCUS_38630 gene dtd CDS 37302..38243 product fatty acid biosynthesis protein FabY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080770.1 transl_table 11 codon_start 1 locus_tag LOCUS_38640 gene fabY CDS complement(38258..38686) product type II toxin-antitoxin system HigA family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259009.1 transl_table 11 codon_start 1 locus_tag LOCUS_38650 CDS complement(38701..39012) product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558160.1 transl_table 11 codon_start 1 locus_tag LOCUS_38660 CDS complement(39098..40027) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162859.1 transl_table 11 codon_start 1 locus_tag LOCUS_38670 CDS 40245..40556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099360.1 transl_table 11 codon_start 1 locus_tag LOCUS_38680 CDS 40557..40847 product NadS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356397.1 transl_table 11 codon_start 1 locus_tag LOCUS_38690 gene nadS CDS complement(40894..41823) product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027727.1 transl_table 11 codon_start 1 locus_tag LOCUS_38700 gene fdhE CDS complement(41820..42455) product formate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829025.1 transl_table 11 codon_start 1 locus_tag LOCUS_38710 gene fdoI CDS complement(42452..43354) product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331359.1 transl_table 11 codon_start 1 locus_tag LOCUS_38720 gene fdxH CDS complement(43367..46417) product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989259.1 transl_table 11 codon_start 1 transl_except (pos:45830..45832,aa:Sec) note codon on position 196 is selenocysteine opal codon. locus_tag LOCUS_38730 gene fdnG CDS 46645..47448 product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059746.1 transl_table 11 codon_start 1 locus_tag LOCUS_38740 gene fdhD CDS complement(47716..48195) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38750 note possible pseudo, frameshifted CDS complement(48137..48736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38760 note possible pseudo, frameshifted sequence33 source 1..48502 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 238..690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38770 CDS 1215..1424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38780 CDS 1605..2723 product hydrogenase 1 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058323.1 transl_table 11 codon_start 1 locus_tag LOCUS_38790 gene hyaA CDS 2720..4513 product Ni/Fe-hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070982.1 transl_table 11 codon_start 1 locus_tag LOCUS_38800 gene hyaB CDS 4532..5263 product Ni/Fe-hydrogenase b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147028.1 transl_table 11 codon_start 1 locus_tag LOCUS_38810 gene hyaC CDS 5260..5856 product hydrogenase 1 maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993803.1 transl_table 11 codon_start 1 locus_tag LOCUS_38820 CDS 5846..6250 product hydrogenase-1 operon protein HyaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262577.1 transl_table 11 codon_start 1 locus_tag LOCUS_38830 gene hyaE CDS 6247..7095 product hydrogenase expression/formation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063377.1 transl_table 11 codon_start 1 locus_tag LOCUS_38840 CDS 7170..8714 product cytochrome bd-II oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000263597.1 transl_table 11 codon_start 1 locus_tag LOCUS_38850 gene appC CDS 8726..9862 product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888121.1 transl_table 11 codon_start 1 locus_tag LOCUS_38860 gene appB CDS 10359..11633 product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366353.1 transl_table 11 codon_start 1 locus_tag LOCUS_38870 CDS 11847..13559 product alpha,alpha-trehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841738.1 transl_table 11 codon_start 1 locus_tag LOCUS_38880 gene treA CDS complement(13622..13876) product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511323.1 transl_table 11 codon_start 1 locus_tag LOCUS_38890 CDS 14045..14779 product flagellar brake protein YcgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017410.1 transl_table 11 codon_start 1 locus_tag LOCUS_38900 gene ycgR CDS complement(14793..15296) product membrane-bound lytic murein transglycosylase EmtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776974.1 transl_table 11 codon_start 1 locus_tag LOCUS_38910 gene emtA CDS 15575..16489 product muramoyltetrapeptide carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051613.1 transl_table 11 codon_start 1 locus_tag LOCUS_38920 gene ldcA CDS 16586..18319 product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000338376.1 transl_table 11 codon_start 1 locus_tag LOCUS_38930 CDS complement(18382..19452) product catabolic alanine racemase DadX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197904.1 transl_table 11 codon_start 1 locus_tag LOCUS_38940 gene dadX CDS complement(19466..20764) product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266934.1 transl_table 11 codon_start 1 locus_tag LOCUS_38950 CDS 21087..22619 product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240763.1 transl_table 11 codon_start 1 locus_tag LOCUS_38960 CDS complement(22666..23385) product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234821.1 transl_table 11 codon_start 1 locus_tag LOCUS_38970 gene fadR CDS 23605..25149 product Na(+)/H(+) antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406446.1 transl_table 11 codon_start 1 locus_tag LOCUS_38980 gene nhaB CDS 25291..25821 product disulfide bond formation protein DsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943475.1 transl_table 11 codon_start 1 locus_tag LOCUS_38990 gene dsbB CDS 25930..26271 product DUF1971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018971.1 transl_table 11 codon_start 1 locus_tag LOCUS_39000 CDS complement(26343..26516) product addiction module toxin, GnsA/GnsB family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083582.1 transl_table 11 codon_start 1 locus_tag LOCUS_39010 CDS complement(26708..26845) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39020 CDS complement(27197..27658) product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785857.1 transl_table 11 codon_start 1 locus_tag LOCUS_39030 CDS complement(27736..28395) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519895.1 transl_table 11 codon_start 1 locus_tag LOCUS_39040 CDS complement(28445..28738) product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250286.1 transl_table 11 codon_start 1 locus_tag LOCUS_39050 CDS 28864..29571 product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072527.1 transl_table 11 codon_start 1 locus_tag LOCUS_39060 gene minC CDS 29595..30407 product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101048.1 transl_table 11 codon_start 1 locus_tag LOCUS_39070 gene minD CDS 30411..30677 product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185666.1 transl_table 11 codon_start 1 locus_tag LOCUS_39080 gene minE CDS complement(30799..31926) product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109129.1 transl_table 11 codon_start 1 locus_tag LOCUS_39090 gene rnd CDS complement(31999..33684) product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758418.1 transl_table 11 codon_start 1 locus_tag LOCUS_39100 gene fadD CDS complement(33889..34470) product Slp family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290594.1 transl_table 11 codon_start 1 locus_tag LOCUS_39110 CDS complement(34542..35237) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221014.1 transl_table 11 codon_start 1 locus_tag LOCUS_39120 gene tsaB CDS complement(35295..37205) product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128807.1 transl_table 11 codon_start 1 locus_tag LOCUS_39130 CDS 37336..37680 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029549.1 transl_table 11 codon_start 1 locus_tag LOCUS_39140 CDS complement(37686..37865) product YoaH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457328.1 transl_table 11 codon_start 1 locus_tag LOCUS_39150 CDS 37946..39310 product aminodeoxychorismate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978456.1 transl_table 11 codon_start 1 locus_tag LOCUS_39160 gene pabB CDS 39314..39892 product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381544.1 transl_table 11 codon_start 1 locus_tag LOCUS_39170 CDS 40156..41520 product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624274.1 transl_table 11 codon_start 1 locus_tag LOCUS_39180 gene sdaA CDS complement(41778..41939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39190 CDS 41877..43259 product cyclic diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192512.1 transl_table 11 codon_start 1 locus_tag LOCUS_39200 CDS complement(43281..44840) product CNNM family cation transport protein YoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421821.1 transl_table 11 codon_start 1 locus_tag LOCUS_39210 gene yoaE CDS 45313..46281 product PTS mannose transporter subunit IIAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150523.1 transl_table 11 codon_start 1 locus_tag LOCUS_39220 gene manX CDS 46334..47134 product PTS mannose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406918.1 transl_table 11 codon_start 1 locus_tag LOCUS_39230 gene manY CDS 47147..47998 product PTS mannose transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518647.1 transl_table 11 codon_start 1 locus_tag LOCUS_39240 sequence34 source 1..41831 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(497..751) product DinI-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497441.1 transl_table 11 codon_start 1 locus_tag LOCUS_39250 CDS 1115..3727 product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193884.1 transl_table 11 codon_start 1 locus_tag LOCUS_39260 gene pepN CDS 3935..4945 product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291724.1 transl_table 11 codon_start 1 locus_tag LOCUS_39270 gene pyrD CDS 5111..5653 product cell division protein ZapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220671.1 transl_table 11 codon_start 1 locus_tag LOCUS_39280 gene zapC CDS complement(5650..6759) product YcbX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224084.1 transl_table 11 codon_start 1 locus_tag LOCUS_39290 CDS 6858..8966 product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086472.1 transl_table 11 codon_start 1 locus_tag LOCUS_39300 gene rlmKL CDS 8979..10886 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053045.1 transl_table 11 codon_start 1 locus_tag LOCUS_39310 CDS 10901..12154 product membrane integrity-associated transporter subunit PqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333152.1 transl_table 11 codon_start 1 locus_tag LOCUS_39320 gene pqiA CDS 12159..13799 product intermembrane transport protein PqiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433416.1 transl_table 11 codon_start 1 locus_tag LOCUS_39330 gene pqiB CDS 13796..14359 product membrane integrity-associated transporter subunit PqiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759136.1 transl_table 11 codon_start 1 locus_tag LOCUS_39340 gene pqiC CDS complement(14882..15400) product bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227928.1 transl_table 11 codon_start 1 locus_tag LOCUS_39350 gene fabA CDS complement(15469..17229) product Lon protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156455.1 transl_table 11 codon_start 1 locus_tag LOCUS_39360 CDS 17415..17867 product macrodomain Ter protein MatP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877174.1 transl_table 11 codon_start 1 locus_tag LOCUS_39370 gene matP CDS complement(17939..18991) product porin OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989142.1 transl_table 11 codon_start 1 locus_tag LOCUS_39380 gene ompA CDS complement(19348..19728) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39390 CDS 20074..20679 product TfoX/Sxy family DNA transformation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202371.1 transl_table 11 codon_start 1 locus_tag LOCUS_39400 CDS complement(20666..22819) product YccS family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950867.1 transl_table 11 codon_start 1 locus_tag LOCUS_39410 gene yccS CDS complement(22838..23284) product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261222.1 transl_table 11 codon_start 1 locus_tag LOCUS_39420 CDS 23408..25462 product DNA helicase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000420526.1 transl_table 11 codon_start 1 locus_tag LOCUS_39430 gene helD CDS complement(25498..25956) product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424187.1 transl_table 11 codon_start 1 locus_tag LOCUS_39440 gene mgsA CDS complement(26051..26713) product DUF2057 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847719.1 transl_table 11 codon_start 1 locus_tag LOCUS_39450 CDS 26887..27300 product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000975203.1 transl_table 11 codon_start 1 locus_tag LOCUS_39460 CDS complement(27345..27662) product heat shock protein HspQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561983.1 transl_table 11 codon_start 1 locus_tag LOCUS_39470 gene hspQ CDS complement(27720..28931) product 23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140485.1 transl_table 11 codon_start 1 locus_tag LOCUS_39480 gene rlmI CDS 29146..29694 product Raf kinase inhibitor-like protein YbcL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001313946.1 transl_table 11 codon_start 1 locus_tag LOCUS_39490 gene ybcL CDS 29711..30499 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330817.1 transl_table 11 codon_start 1 locus_tag LOCUS_39500 CDS 30548..30829 product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072884.1 transl_table 11 codon_start 1 locus_tag LOCUS_39510 gene yccX CDS complement(30826..31155) product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904446.1 transl_table 11 codon_start 1 locus_tag LOCUS_39520 gene tusE CDS complement(31242..31901) product FtsH protease modulator YccA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000374046.1 transl_table 11 codon_start 1 locus_tag LOCUS_39530 gene yccA tRNA 32296..32383 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00660 CDS complement(32520..33200) product type III secretion system effector protease PipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938184.1 transl_table 11 codon_start 1 locus_tag LOCUS_39540 gene pipA CDS complement(33420..34295) product SPI-2 type III secretion system effector PipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123042.1 transl_table 11 codon_start 1 locus_tag LOCUS_39550 gene pipB CDS complement(34843..35184) product type III secretion system chaperone SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444726.1 transl_table 11 codon_start 1 locus_tag LOCUS_39560 gene sigE CDS complement(35201..36886) product SPI-1 type III secretion system effector inositol phosphate phosphatase SopB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166955.1 transl_table 11 codon_start 1 locus_tag LOCUS_39570 gene sopB CDS complement(37608..39170) product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760238.1 transl_table 11 codon_start 1 locus_tag LOCUS_39580 CDS complement(39250..40614) product heavy metal sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240036.1 transl_table 11 codon_start 1 locus_tag LOCUS_39590 CDS complement(40607..41275) product response regulator transcription factor HprR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014343829.1 transl_table 11 codon_start 1 locus_tag LOCUS_39600 gene hprR sequence35 source 1..36088 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(36..170) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39610 CDS 289..735 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39620 CDS 707..1174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39630 CDS 1123..1461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39640 note possible pseudo, frameshifted CDS 1525..3144 product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257681.1 transl_table 11 codon_start 1 locus_tag LOCUS_39650 CDS 3134..4438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39660 CDS 4533..7799 product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858356.1 transl_table 11 codon_start 1 locus_tag LOCUS_39670 CDS 7963..8883 product DUF5655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554540.1 transl_table 11 codon_start 1 locus_tag LOCUS_39680 CDS complement(8960..9124) product DUF1127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704272.1 transl_table 11 codon_start 1 locus_tag LOCUS_39690 CDS complement(9329..10699) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095438.1 transl_table 11 codon_start 1 locus_tag LOCUS_39700 CDS complement(10880..11833) product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749985.1 transl_table 11 codon_start 1 locus_tag LOCUS_39710 CDS 12312..13553 product multidrug efflux MFS transporter MdtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188918.1 transl_table 11 codon_start 1 locus_tag LOCUS_39720 gene mdtM CDS 13640..14911 product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033044.1 transl_table 11 codon_start 1 locus_tag LOCUS_39730 CDS 15131..16315 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233270.1 transl_table 11 codon_start 1 locus_tag LOCUS_39740 CDS 17188..17859 product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068750.1 transl_table 11 codon_start 1 locus_tag LOCUS_39750 CDS 17856..18317 product YjiG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211979.1 transl_table 11 codon_start 1 locus_tag LOCUS_39760 CDS 18330..19502 product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113054.1 transl_table 11 codon_start 1 locus_tag LOCUS_39770 gene iadA CDS 19621..20529 product hypochlorite stress DNA-binding transcriptional regulator HypT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383509.1 transl_table 11 codon_start 1 locus_tag LOCUS_39780 gene hypT CDS complement(20535..21269) product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683258.1 transl_table 11 codon_start 1 locus_tag LOCUS_39790 CDS complement(21508..21954) product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907666.1 transl_table 11 codon_start 1 locus_tag LOCUS_39800 CDS 22756..23769 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094618.1 transl_table 11 codon_start 1 locus_tag LOCUS_39810 gene trpS CDS complement(23770..24495) product Uxu operon transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841652.1 transl_table 11 codon_start 1 locus_tag LOCUS_39820 gene uxuR CDS 25040..25558 product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588705.1 transl_table 11 codon_start 1 locus_tag LOCUS_39830 CDS complement(25575..25943) product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001796324.1 transl_table 11 codon_start 1 locus_tag LOCUS_39840 CDS complement(26241..27152) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000556762.1 transl_table 11 codon_start 1 locus_tag LOCUS_39850 CDS 28166..28357 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39860 CDS 28600..28857 product YjhX family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054380.1 transl_table 11 codon_start 1 locus_tag LOCUS_39870 CDS 28868..30493 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979786.1 transl_table 11 codon_start 1 locus_tag LOCUS_39880 CDS 31053..31769 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000532938.1 transl_table 11 codon_start 1 locus_tag LOCUS_39890 CDS complement(32249..32959) product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199879.1 transl_table 11 codon_start 1 locus_tag LOCUS_39900 note possible pseudo, internal stop codon CDS complement(32960..33124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39910 note possible pseudo, internal stop codon CDS complement(33593..33928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39920 note possible pseudo, internal stop codon CDS 33992..34228 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39930 CDS complement(34212..34490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39940 note possible pseudo, frameshifted CDS complement(34753..35598) product YjiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490324.1 transl_table 11 codon_start 1 locus_tag LOCUS_39950 CDS complement(35649..35834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39960 sequence36 source 1..35482 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..970 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015366376.1:LysR substrate-binding domain-containing protein locus_tag LOCUS_39970 CDS complement(1031..2656) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419375.1 transl_table 11 codon_start 1 locus_tag LOCUS_39980 CDS complement(2825..3943) product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366371.1 transl_table 11 codon_start 1 locus_tag LOCUS_39990 CDS complement(3975..4250) product metal/formaldehyde-sensitive transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096678.1 transl_table 11 codon_start 1 locus_tag LOCUS_40000 CDS 6445..7671 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40010 CDS complement(7792..8136) product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281194.1 transl_table 11 codon_start 1 locus_tag LOCUS_40020 CDS 9194..9805 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949382.1 transl_table 11 codon_start 1 locus_tag LOCUS_40030 CDS 9827..10459 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094452.1 transl_table 11 codon_start 1 locus_tag LOCUS_40040 CDS 10484..11215 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185897.1 transl_table 11 codon_start 1 locus_tag LOCUS_40050 CDS 11212..11892 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560165.1 transl_table 11 codon_start 1 locus_tag LOCUS_40060 CDS 12455..12958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40070 note possible pseudo, internal stop codon, frameshifted CDS 12988..13578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40080 note possible pseudo, frameshifted CDS 14042..14704 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239881.1 transl_table 11 codon_start 1 locus_tag LOCUS_40090 CDS complement(14975..15505) product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005022464.1 transl_table 11 codon_start 1 locus_tag LOCUS_40100 gene cybB CDS complement(15622..16422) product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098505.1 transl_table 11 codon_start 1 locus_tag LOCUS_40110 CDS complement(16486..20406) product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001785213.1 transl_table 11 codon_start 1 locus_tag LOCUS_40120 gene hrpA CDS 20589..21194 product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048924.1 transl_table 11 codon_start 1 locus_tag LOCUS_40130 gene azoR CDS complement(21191..21511) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40140 CDS complement(21783..22106) product YdbL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760346.1 transl_table 11 codon_start 1 locus_tag LOCUS_40150 CDS complement(22114..22305) product YnbE family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784063.1 transl_table 11 codon_start 1 locus_tag LOCUS_40160 CDS complement(22305..24941) product YdbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677026.1 transl_table 11 codon_start 1 locus_tag LOCUS_40170 CDS 25181..26170 product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762205.1 transl_table 11 codon_start 1 locus_tag LOCUS_40180 gene ldhA CDS 26281..26691 product heat shock protein HslJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725242.1 transl_table 11 codon_start 1 locus_tag LOCUS_40190 gene hslJ CDS 27277..30801 product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193255.1 transl_table 11 codon_start 1 locus_tag LOCUS_40200 gene nifJ CDS complement(30860..31069) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40210 CDS 31283..31717 product universal stress protein UspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082296.1 transl_table 11 codon_start 1 locus_tag LOCUS_40220 gene uspF CDS complement(31767..32105) product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159242.1 transl_table 11 codon_start 1 locus_tag LOCUS_40230 CDS complement(32745..32954) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40240 CDS complement(32951..33496) product putative peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166765.1 transl_table 11 codon_start 1 locus_tag LOCUS_40250 CDS complement(33493..33774) product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705707.1 transl_table 11 codon_start 1 locus_tag LOCUS_40260 CDS complement(33764..33952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40270 CDS complement(33874..34269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40280 sequence37 source 1..29825 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(649..3333) product two-component system sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997481.1 transl_table 11 codon_start 1 locus_tag LOCUS_40290 gene kdpD CDS complement(3330..3914) product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014341418.1 transl_table 11 codon_start 1 locus_tag LOCUS_40300 gene kdpC CDS complement(3923..5971) product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087964.1 transl_table 11 codon_start 1 locus_tag LOCUS_40310 gene kdpB CDS complement(5992..7671) product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730077.1 transl_table 11 codon_start 1 locus_tag LOCUS_40320 gene kdpA CDS 8097..8303 product YbfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401435.1 transl_table 11 codon_start 1 locus_tag LOCUS_40330 CDS 8415..9836 product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142014.1 transl_table 11 codon_start 1 locus_tag LOCUS_40340 gene phrB CDS complement(9875..11356) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041123.1 transl_table 11 codon_start 1 locus_tag LOCUS_40350 CDS 11685..12428 product radiation resistance protein YbgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798844.1 transl_table 11 codon_start 1 locus_tag LOCUS_40360 gene ybgI CDS 12444..13100 product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188364.1 transl_table 11 codon_start 1 locus_tag LOCUS_40370 gene pxpB CDS 13094..14026 product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932048.1 transl_table 11 codon_start 1 locus_tag LOCUS_40380 CDS 14016..14750 product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017910.1 transl_table 11 codon_start 1 locus_tag LOCUS_40390 gene pxpA CDS 14872..15663 product endonuclease VIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113965.1 transl_table 11 codon_start 1 locus_tag LOCUS_40400 gene nei CDS complement(15718..16764) product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122050.1 transl_table 11 codon_start 1 locus_tag LOCUS_40410 CDS complement(16901..18184) product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785816.1 transl_table 11 codon_start 1 locus_tag LOCUS_40420 CDS 18285..18530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40430 note possible pseudo, frameshifted CDS 18924..19328 product succinate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001539490.1 transl_table 11 codon_start 1 locus_tag LOCUS_40440 gene sdhC CDS 19322..19669 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40450 CDS 19669..21435 product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775523.1 transl_table 11 codon_start 1 locus_tag LOCUS_40460 gene sdhA CDS 21449..22168 product succinate dehydrogenase iron-sulfur subunit SdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976880.1 transl_table 11 codon_start 1 locus_tag LOCUS_40470 gene sdhB CDS 22692..25493 product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181500.1 transl_table 11 codon_start 1 locus_tag LOCUS_40480 gene sucA CDS 25508..26716 product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099858.1 transl_table 11 codon_start 1 locus_tag LOCUS_40490 gene odhB CDS 26858..28024 product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048590.1 transl_table 11 codon_start 1 locus_tag LOCUS_40500 gene sucC CDS 28024..28893 product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367669.1 transl_table 11 codon_start 1 locus_tag LOCUS_40510 gene sucD sequence38 source 1..28132 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 790..1362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40520 CDS 1575..2561 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169350.1 transl_table 11 codon_start 1 locus_tag LOCUS_40530 CDS 2597..3310 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178088.1 transl_table 11 codon_start 1 locus_tag LOCUS_40540 CDS 3724..4296 product bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241015.1 transl_table 11 codon_start 1 locus_tag LOCUS_40550 gene mepS CDS 4622..6178 product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957756.1 transl_table 11 codon_start 1 locus_tag LOCUS_40560 CDS 6285..8090 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561746.1 transl_table 11 codon_start 1 locus_tag LOCUS_40570 CDS 8100..9194 product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000501623.1 transl_table 11 codon_start 1 locus_tag LOCUS_40580 CDS 9194..10219 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137761.1 transl_table 11 codon_start 1 locus_tag LOCUS_40590 CDS 10221..11810 product microcin C ABC transporter ATP-binding protein YejF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203612.1 transl_table 11 codon_start 1 locus_tag LOCUS_40600 gene yejF CDS complement(11814..12158) product YejG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094639.1 transl_table 11 codon_start 1 locus_tag LOCUS_40610 CDS complement(12549..13739) product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213351.1 transl_table 11 codon_start 1 locus_tag LOCUS_40620 CDS complement(13767..14462) product 16S rRNA pseudouridine(516) synthase RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234836.1 transl_table 11 codon_start 1 locus_tag LOCUS_40630 gene rsuA CDS 14614..16374 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578121.1 transl_table 11 codon_start 1 locus_tag LOCUS_40640 CDS 16499..16783 product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494192.1 transl_table 11 codon_start 1 locus_tag LOCUS_40650 gene rplY CDS complement(16891..17511) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033434.1 transl_table 11 codon_start 1 locus_tag LOCUS_40660 CDS complement(17539..18546) product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050806.1 transl_table 11 codon_start 1 locus_tag LOCUS_40670 gene yejK CDS 18726..18953 product YejL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135904.1 transl_table 11 codon_start 1 locus_tag LOCUS_40680 CDS 18985..20745 product LPS biosynthesis-modulating metalloenzyme YejM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256152.1 transl_table 11 codon_start 1 locus_tag LOCUS_40690 gene yejM tRNA 20819..20895 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00670 CDS complement(21206..21355) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40700 note possible pseudo, frameshifted CDS complement(21516..23300) product SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115839.1 transl_table 11 codon_start 1 locus_tag LOCUS_40710 gene sspH2 CDS complement(24551..24835) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40720 note possible pseudo, internal stop codon CDS complement(24878..25393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40730 note possible pseudo, internal stop codon CDS 25471..25659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40740 CDS 25646..25849 product virulence protein MsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001653202.1 transl_table 11 codon_start 1 locus_tag LOCUS_40750 CDS complement(26041..26598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40760 CDS 27334..27981 product nitrate/nitrite response regulator protein NarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115500.1 transl_table 11 codon_start 1 locus_tag LOCUS_40770 gene narP sequence39 source 1..26921 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 215..1267 product SPI-2 type III secretion system effector PipB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001801692.1 transl_table 11 codon_start 1 locus_tag LOCUS_40780 gene pipB2 CDS 1463..1774 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40790 CDS 2405..4480 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001682025.1 transl_table 11 codon_start 1 locus_tag LOCUS_40800 CDS complement(4522..5451) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000274373.1 transl_table 11 codon_start 1 locus_tag LOCUS_40810 CDS complement(5483..6727) product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239947.1 transl_table 11 codon_start 1 locus_tag LOCUS_40820 CDS complement(6837..10493) product salmochelin/enterobactin export ABC transporter IroC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001111827.1 transl_table 11 codon_start 1 locus_tag LOCUS_40830 gene iroC CDS complement(10574..11689) product salmochelin biosynthesis C-glycosyltransferase IroB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221113.1 transl_table 11 codon_start 1 locus_tag LOCUS_40840 gene iroB CDS complement(12315..12512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40850 CDS 12774..13040 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139109819.1 transl_table 11 codon_start 1 locus_tag LOCUS_40860 CDS 13262..13885 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40870 note possible pseudo, frameshifted CDS complement(13941..14132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167337863.1 transl_table 11 codon_start 1 locus_tag LOCUS_40880 CDS complement(14681..15484) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40890 CDS complement(15883..16476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40900 CDS complement(16738..17943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40910 CDS complement(17953..18969) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027757.1 transl_table 11 codon_start 1 locus_tag LOCUS_40920 CDS complement(18972..19604) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052560.1 transl_table 11 codon_start 1 locus_tag LOCUS_40930 CDS 19726..19968 product Rha family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102106.1 transl_table 11 codon_start 1 locus_tag LOCUS_40940 CDS 20002..20511 product phage regulatory CII family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460893.1 transl_table 11 codon_start 1 locus_tag LOCUS_40950 CDS 20683..21024 product DUF5347 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996717.1 transl_table 11 codon_start 1 locus_tag LOCUS_40960 CDS 21092..21325 product DUF2732 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244218.1 transl_table 11 codon_start 1 locus_tag LOCUS_40970 CDS 21325..21552 product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000752613.1 transl_table 11 codon_start 1 locus_tag LOCUS_40980 CDS 21549..22406 product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104152.1 transl_table 11 codon_start 1 locus_tag LOCUS_40990 CDS 22403..24817 product replication endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017503.1 transl_table 11 codon_start 1 locus_tag LOCUS_41000 CDS 24970..25158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001580533.1 transl_table 11 codon_start 1 locus_tag LOCUS_41010 CDS 25169..25402 product DinI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217561.1 transl_table 11 codon_start 1 locus_tag LOCUS_41020 CDS 25462..26193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41030 sequence40 source 1..26371 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(61..213) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41040 CDS 327..881 product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285635.1 transl_table 11 codon_start 1 locus_tag LOCUS_41050 CDS complement(857..1114) product DUF1488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070570.1 transl_table 11 codon_start 1 locus_tag LOCUS_41060 CDS complement(1111..1932) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388662.1 transl_table 11 codon_start 1 locus_tag LOCUS_41070 gene aroE CDS complement(1934..2506) product L-threonylcarbamoyladenylate synthase type 1 TsaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063622.1 transl_table 11 codon_start 1 locus_tag LOCUS_41080 gene tsaC CDS complement(2511..3053) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129710.1 transl_table 11 codon_start 1 locus_tag LOCUS_41090 CDS complement(3080..3553) product DUF494 family protein Smg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460663.1 transl_table 11 codon_start 1 locus_tag LOCUS_41100 gene smg CDS complement(3525..4649) product DNA-protecting protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124521.1 transl_table 11 codon_start 1 locus_tag LOCUS_41110 gene dprA CDS 4781..5290 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114992.1 transl_table 11 codon_start 1 locus_tag LOCUS_41120 gene def CDS 5306..6253 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285161.1 transl_table 11 codon_start 1 locus_tag LOCUS_41130 gene fmt CDS 6305..7594 product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744595.1 transl_table 11 codon_start 1 locus_tag LOCUS_41140 gene rsmB CDS 7616..8992 product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691374.1 transl_table 11 codon_start 1 locus_tag LOCUS_41150 gene trkA CDS 9134..9547 product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008119.1 transl_table 11 codon_start 1 locus_tag LOCUS_41160 gene mscL CDS complement(9483..9752) product alternative ribosome-rescue factor ArfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092695.1 transl_table 11 codon_start 1 locus_tag LOCUS_41170 gene arfA CDS complement(9810..10235) product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285589.1 transl_table 11 codon_start 1 locus_tag LOCUS_41180 gene zntR CDS complement(10246..10614) product DUF1992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000266513.1 transl_table 11 codon_start 1 locus_tag LOCUS_41190 CDS complement(10722..11105) product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216370.1 transl_table 11 codon_start 1 locus_tag LOCUS_41200 gene rplQ CDS complement(11146..12135) product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162094.1 transl_table 11 codon_start 1 locus_tag LOCUS_41210 gene rpoA CDS complement(12161..12781) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135224.1 transl_table 11 codon_start 1 locus_tag LOCUS_41220 gene rpsD CDS complement(12815..13204) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029684.1 transl_table 11 codon_start 1 locus_tag LOCUS_41230 gene rpsK CDS complement(13221..13577) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090779.1 transl_table 11 codon_start 1 locus_tag LOCUS_41240 gene rpsM CDS complement(13872..15203) product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118861.1 transl_table 11 codon_start 1 locus_tag LOCUS_41250 gene secY CDS complement(15211..15645) product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238917.1 transl_table 11 codon_start 1 locus_tag LOCUS_41260 gene rplO CDS complement(15649..15828) product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140434.1 transl_table 11 codon_start 1 locus_tag LOCUS_41270 gene rpmD CDS complement(15832..16335) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940121.1 transl_table 11 codon_start 1 locus_tag LOCUS_41280 gene rpsE CDS complement(16350..16703) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358956.1 transl_table 11 codon_start 1 locus_tag LOCUS_41290 gene rplR CDS complement(16713..17246) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091939.1 transl_table 11 codon_start 1 locus_tag LOCUS_41300 gene rplF CDS complement(17259..17651) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062611.1 transl_table 11 codon_start 1 locus_tag LOCUS_41310 gene rpsH CDS complement(17685..17990) product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118932.1 transl_table 11 codon_start 1 locus_tag LOCUS_41320 gene rpsN CDS complement(18005..18544) product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096206.1 transl_table 11 codon_start 1 locus_tag LOCUS_41330 gene rplE CDS complement(18559..18873) product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729185.1 transl_table 11 codon_start 1 locus_tag LOCUS_41340 gene rplX CDS complement(18884..19255) product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613954.1 transl_table 11 codon_start 1 locus_tag LOCUS_41350 gene rplN CDS complement(19419..19673) product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130101.1 transl_table 11 codon_start 1 locus_tag LOCUS_41360 gene rpsQ CDS complement(19673..19864) product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644742.1 transl_table 11 codon_start 1 locus_tag LOCUS_41370 gene rpmC CDS complement(19864..20274) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941208.1 transl_table 11 codon_start 1 locus_tag LOCUS_41380 gene rplP CDS complement(20287..20988) product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529945.1 transl_table 11 codon_start 1 locus_tag LOCUS_41390 gene rpsC CDS complement(21006..21338) product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447529.1 transl_table 11 codon_start 1 locus_tag LOCUS_41400 gene rplV CDS complement(21353..21631) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138115.1 transl_table 11 codon_start 1 locus_tag LOCUS_41410 gene rpsS CDS complement(21648..22469) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301869.1 transl_table 11 codon_start 1 locus_tag LOCUS_41420 gene rplB CDS complement(22487..22789) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617546.1 transl_table 11 codon_start 1 locus_tag LOCUS_41430 gene rplW CDS complement(22786..23391) product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424395.1 transl_table 11 codon_start 1 locus_tag LOCUS_41440 gene rplD CDS complement(23402..24031) product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579838.1 transl_table 11 codon_start 1 locus_tag LOCUS_41450 gene rplC CDS complement(24064..24375) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181005.1 transl_table 11 codon_start 1 locus_tag LOCUS_41460 gene rpsJ CDS 24755..25222 product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495849.1 transl_table 11 codon_start 1 locus_tag LOCUS_41470 CDS complement(25219..25695) product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675528.1 transl_table 11 codon_start 1 locus_tag LOCUS_41480 gene bfr CDS complement(25768..25962) product bacterioferritin-associated ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000289082.1 transl_table 11 codon_start 1 locus_tag LOCUS_41490 gene bfd CDS 25897..26055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41500 sequence41 source 1..25742 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1605..2930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41510 CDS 3297..4727 product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216700.1 transl_table 11 codon_start 1 locus_tag LOCUS_41520 gene sbcB CDS complement(4863..6221) product putrescine/proton symporter PlaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178807.1 transl_table 11 codon_start 1 locus_tag LOCUS_41530 gene plaP CDS complement(6507..7421) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803316.1 transl_table 11 codon_start 1 locus_tag LOCUS_41540 CDS complement(7467..8291) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754712.1 transl_table 11 codon_start 1 locus_tag LOCUS_41550 CDS 8650..9549 product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886604.1 transl_table 11 codon_start 1 locus_tag LOCUS_41560 gene hisG CDS 9652..10956 product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009629.1 transl_table 11 codon_start 1 locus_tag LOCUS_41570 gene hisD CDS 10953..12032 product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102709.1 transl_table 11 codon_start 1 locus_tag LOCUS_41580 gene hisC CDS 12029..13096 product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080040.1 transl_table 11 codon_start 1 locus_tag LOCUS_41590 gene hisB CDS 13096..13686 product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103591.1 transl_table 11 codon_start 1 locus_tag LOCUS_41600 gene hisH CDS 13686..14423 product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586403.1 transl_table 11 codon_start 1 locus_tag LOCUS_41610 gene hisA CDS 14405..15181 product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880125.1 transl_table 11 codon_start 1 locus_tag LOCUS_41620 gene hisF CDS 15175..15786 product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954855.1 transl_table 11 codon_start 1 locus_tag LOCUS_41630 gene hisIE CDS complement(15865..16848) product LPS O-antigen chain length determinant protein WzzB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215243.1 transl_table 11 codon_start 1 locus_tag LOCUS_41640 gene wzzB CDS complement(16991..18157) product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704814.1 transl_table 11 codon_start 1 locus_tag LOCUS_41650 gene ugd CDS complement(18394..19800) product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043528.1 transl_table 11 codon_start 1 locus_tag LOCUS_41660 gene gndA CDS complement(19964..21394) product undecaprenyl-phosphate galactose phosphotransferase WbaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368710.1 transl_table 11 codon_start 1 locus_tag LOCUS_41670 CDS complement(21465..22898) product O-antigen biosynthesis phosphomannomutase RfbK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103638.1 transl_table 11 codon_start 1 locus_tag LOCUS_41680 gene rfbK CDS complement(22885..24324) product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009019.1 transl_table 11 codon_start 1 locus_tag LOCUS_41690 CDS complement(24325..25269) product O antigen biosynthesis rhamnosyltransferase RfbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705149.1 transl_table 11 codon_start 1 locus_tag LOCUS_41700 gene rfbN sequence42 source 1..24209 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 119..1207 product linear amide C-N hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976508.1 transl_table 11 codon_start 1 locus_tag LOCUS_41710 CDS 1373..2044 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518759.1 transl_table 11 codon_start 1 locus_tag LOCUS_41720 CDS complement(2103..3128) product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864933.1 transl_table 11 codon_start 1 locus_tag LOCUS_41730 CDS complement(3103..4389) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824230.1 transl_table 11 codon_start 1 locus_tag LOCUS_41740 CDS complement(4566..5948) product PhoPQ-activated pathogenicity-related family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476914.1 transl_table 11 codon_start 1 locus_tag LOCUS_41750 CDS complement(6192..7433) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095727.1 transl_table 11 codon_start 1 locus_tag LOCUS_41760 CDS complement(7423..8931) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223342.1 transl_table 11 codon_start 1 locus_tag LOCUS_41770 CDS 8976..9464 product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293639.1 transl_table 11 codon_start 1 locus_tag LOCUS_41780 CDS 9657..10730 product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954693.1 transl_table 11 codon_start 1 locus_tag LOCUS_41790 CDS complement(10788..10955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41800 CDS 11282..11614 product DUF1493 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704508.1 transl_table 11 codon_start 1 locus_tag LOCUS_41810 CDS complement(11545..11847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41820 CDS complement(11903..12184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41830 CDS 12442..13422 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211038.1 transl_table 11 codon_start 1 locus_tag LOCUS_41840 CDS 13566..15017 product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261868.1 transl_table 11 codon_start 1 locus_tag LOCUS_41850 gene nhaC CDS 15030..16232 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000336171.1 transl_table 11 codon_start 1 locus_tag LOCUS_41860 CDS complement(16345..18420) product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096571.1 transl_table 11 codon_start 1 locus_tag LOCUS_41870 gene glgX CDS complement(18477..21005) product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613170.1 transl_table 11 codon_start 1 locus_tag LOCUS_41880 gene treY CDS complement(21002..22786) product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095550.1 transl_table 11 codon_start 1 locus_tag LOCUS_41890 gene treZ CDS complement(22915..23700) product OBAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698597.1 transl_table 11 codon_start 1 locus_tag LOCUS_41900 sequence43 source 1..22601 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 309..941 product SPI-4 type I secretion system auxiliary protein SiiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389235.1 transl_table 11 codon_start 1 locus_tag LOCUS_41910 gene siiA CDS 938..2326 product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875187.1 transl_table 11 codon_start 1 locus_tag LOCUS_41920 CDS 2316..3635 product SPI-4 type I secretion system protein SiiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989277.1 transl_table 11 codon_start 1 locus_tag LOCUS_41930 gene siiC CDS 3632..4909 product SPI-4 type I secretion system protein SiiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081932.1 transl_table 11 codon_start 1 locus_tag LOCUS_41940 gene siiD CDS 4926..21605 product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052484.1 transl_table 11 codon_start 1 locus_tag LOCUS_41950 sequence44 source 1..21198 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 598..2166 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884372.1 transl_table 11 codon_start 1 locus_tag LOCUS_41960 gene cydA CDS 2182..3321 product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568258.1 transl_table 11 codon_start 1 locus_tag LOCUS_41970 gene cydB CDS 3449..3742 product cyd operon protein YbgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875303.1 transl_table 11 codon_start 1 locus_tag LOCUS_41980 gene ybgE CDS 3971..4375 product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046241.1 transl_table 11 codon_start 1 locus_tag LOCUS_41990 gene ybgC CDS 4381..5064 product Tol-Pal system protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131318.1 transl_table 11 codon_start 1 locus_tag LOCUS_42000 gene tolQ CDS 5068..5496 product colicin uptake protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124676.1 transl_table 11 codon_start 1 locus_tag LOCUS_42010 gene tolR CDS 5561..6739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42020 CDS 6851..8155 product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989131.1 transl_table 11 codon_start 1 locus_tag LOCUS_42030 gene tolB CDS 8190..8714 product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176621.1 transl_table 11 codon_start 1 locus_tag LOCUS_42040 gene pal CDS 8724..9512 product cell division protein CpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097547.1 transl_table 11 codon_start 1 locus_tag LOCUS_42050 gene cpoB tRNA 9677..9752 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00680 tRNA 9889..9964 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00690 tRNA 9968..10043 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00700 tRNA 10183..10258 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00710 tRNA 10393..10468 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00720 CDS 11073..12116 product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115355.1 transl_table 11 codon_start 1 locus_tag LOCUS_42060 gene nadA CDS 12141..12860 product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345378.1 transl_table 11 codon_start 1 locus_tag LOCUS_42070 gene pnuC CDS complement(12857..13795) product CDF family zinc transporter ZitB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951257.1 transl_table 11 codon_start 1 locus_tag LOCUS_42080 gene zitB CDS complement(13906..14292) product YbgS-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784380.1 transl_table 11 codon_start 1 locus_tag LOCUS_42090 CDS 14612..15664 product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109233.1 transl_table 11 codon_start 1 locus_tag LOCUS_42100 gene aroG CDS complement(15758..16303) product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881093.1 transl_table 11 codon_start 1 locus_tag LOCUS_42110 CDS complement(16318..17163) product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816933.1 transl_table 11 codon_start 1 locus_tag LOCUS_42120 CDS 17293..18183 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263794.1 transl_table 11 codon_start 1 locus_tag LOCUS_42130 CDS complement(18184..19110) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767508.1 transl_table 11 codon_start 1 locus_tag LOCUS_42140 CDS 19390..20658 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703620.1 transl_table 11 codon_start 1 locus_tag LOCUS_42150 CDS 20708..20956 product oxaloacetate decarboxylase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703617.1 transl_table 11 codon_start 1 locus_tag LOCUS_42160 sequence45 source 1..20271 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 391..957 product manganese efflux pump MntP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518359.1 transl_table 11 codon_start 1 locus_tag LOCUS_42170 gene mntP CDS complement(954..1763) product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010934.1 transl_table 11 codon_start 1 locus_tag LOCUS_42180 gene rlmA CDS complement(1829..3574) product peptidoglycan glycosyltransferase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730322.1 transl_table 11 codon_start 1 locus_tag LOCUS_42190 gene ftsI CDS complement(3794..4003) product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062678.1 transl_table 11 codon_start 1 locus_tag LOCUS_42200 gene cspE CDS complement(4808..5041) product YebO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000660.1 transl_table 11 codon_start 1 locus_tag LOCUS_42210 CDS 5467..5706 product invasion protein YobH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236782.1 transl_table 11 codon_start 1 locus_tag LOCUS_42220 gene yobH CDS complement(5918..6709) product DNA-binding transcriptional regulator KdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262197.1 transl_table 11 codon_start 1 locus_tag LOCUS_42230 gene kdgR CDS complement(6872..7075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42240 CDS 6963..8258 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296135.1 transl_table 11 codon_start 1 locus_tag LOCUS_42250 CDS complement(8306..9187) product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000984498.1 transl_table 11 codon_start 1 locus_tag LOCUS_42260 gene htpX CDS complement(9381..11429) product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091235.1 transl_table 11 codon_start 1 locus_tag LOCUS_42270 gene prc CDS complement(11449..12135) product RNA chaperone ProQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431401.1 transl_table 11 codon_start 1 locus_tag LOCUS_42280 gene proQ CDS complement(12233..12730) product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145727.1 transl_table 11 codon_start 1 locus_tag LOCUS_42290 CDS 12859..14142 product membrane integrity lipid transport subunit YebS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207300.1 transl_table 11 codon_start 1 locus_tag LOCUS_42300 gene yebS CDS 14111..16744 product PqiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551143.1 transl_table 11 codon_start 1 locus_tag LOCUS_42310 CDS 16720..18261 product 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989184.1 transl_table 11 codon_start 1 locus_tag LOCUS_42320 gene rsmF CDS 18376..18615 product YebV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978523.1 transl_table 11 codon_start 1 locus_tag LOCUS_42330 CDS 18726..18917 product DUF1482 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457838.1 transl_table 11 codon_start 1 locus_tag LOCUS_42340 CDS complement(18936..19583) product protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986169.1 transl_table 11 codon_start 1 locus_tag LOCUS_42350 gene pphA CDS complement(19604..19837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42360 CDS complement(19810..19974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42370 sequence46 source 1..19247 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 480..2069 product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187502.1 transl_table 11 codon_start 1 locus_tag LOCUS_42380 gene purH CDS 2081..3370 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866776.1 transl_table 11 codon_start 1 locus_tag LOCUS_42390 gene purD CDS complement(3367..4692) product sigma-54-dependent response regulator transcription factor ZraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617932.1 transl_table 11 codon_start 1 locus_tag LOCUS_42400 gene zraR CDS complement(4698..6095) product two-component system sensor histidine kinase ZraS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001772857.1 transl_table 11 codon_start 1 locus_tag LOCUS_42410 gene zraS CDS 6349..6804 product zinc resistance sensor/chaperone ZraP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828133.1 transl_table 11 codon_start 1 locus_tag LOCUS_42420 gene zraP CDS complement(6846..7538) product DUF1481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083923.1 transl_table 11 codon_start 1 locus_tag LOCUS_42430 CDS complement(7550..7822) product DNA-binding protein HU-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044509.1 transl_table 11 codon_start 1 locus_tag LOCUS_42440 gene hupA CDS complement(8009..8599) product YjaG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940092.1 transl_table 11 codon_start 1 locus_tag LOCUS_42450 CDS complement(8641..9312) product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362359.1 transl_table 11 codon_start 1 locus_tag LOCUS_42460 gene nfi CDS complement(9322..10386) product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137619.1 transl_table 11 codon_start 1 locus_tag LOCUS_42470 gene hemE CDS complement(10427..11200) product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373954.1 transl_table 11 codon_start 1 locus_tag LOCUS_42480 gene nudC CDS 11293..11781 product sigma D regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934311.1 transl_table 11 codon_start 1 locus_tag LOCUS_42490 gene rsd CDS 12145..14040 product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108425.1 transl_table 11 codon_start 1 locus_tag LOCUS_42500 gene thiC CDS 14040..14675 product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284626.1 transl_table 11 codon_start 1 locus_tag LOCUS_42510 gene thiE CDS 14668..15426 product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999774.1 transl_table 11 codon_start 1 locus_tag LOCUS_42520 CDS 15407..15607 product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035896383.1 transl_table 11 codon_start 1 locus_tag LOCUS_42530 gene thiS CDS 15609..16379 product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944065.1 transl_table 11 codon_start 1 locus_tag LOCUS_42540 gene thiG CDS 16376..17509 product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643282.1 transl_table 11 codon_start 1 locus_tag LOCUS_42550 gene thiH CDS complement(17660..17848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42560 CDS complement(18171..19199) product type III secretion system effector arginine glycosyltransferase NleB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953022.1 transl_table 11 codon_start 1 locus_tag LOCUS_42570 gene nleB sequence47 source 1..17532 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 261..779 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062616.1 transl_table 11 codon_start 1 locus_tag LOCUS_42580 CDS complement(886..1224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051816.1 transl_table 11 codon_start 1 locus_tag LOCUS_42590 CDS complement(1252..1938) product B3/4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097260.1 transl_table 11 codon_start 1 locus_tag LOCUS_42600 CDS 1982..2584 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163369.1 transl_table 11 codon_start 1 locus_tag LOCUS_42610 CDS complement(2666..3697) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493669.1 transl_table 11 codon_start 1 locus_tag LOCUS_42620 CDS 3936..4190 product DUF2534 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605645.1 transl_table 11 codon_start 1 locus_tag LOCUS_42630 CDS complement(4245..5192) product universal stress protein UspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262143.1 transl_table 11 codon_start 1 locus_tag LOCUS_42640 gene uspE CDS complement(5343..6095) product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611917.1 transl_table 11 codon_start 1 locus_tag LOCUS_42650 gene fnr CDS complement(6291..6806) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000945036.1 transl_table 11 codon_start 1 locus_tag LOCUS_42660 gene ogt CDS 7064..7627 product DNA endonuclease SmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046807.1 transl_table 11 codon_start 1 locus_tag LOCUS_42670 gene smrA CDS 8101..9192 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000945629.1 transl_table 11 codon_start 1 locus_tag LOCUS_42680 CDS 9338..10321 product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387372.1 transl_table 11 codon_start 1 locus_tag LOCUS_42690 gene zntB CDS 10808..12181 product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096453.1 transl_table 11 codon_start 1 locus_tag LOCUS_42700 gene dbpA CDS complement(12225..13160) product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156215.1 transl_table 11 codon_start 1 locus_tag LOCUS_42710 gene ttcA CDS complement(13212..13484) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42720 CDS complement(13477..14094) product exodeoxyribonuclease VIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105118.1 transl_table 11 codon_start 1 locus_tag LOCUS_42730 CDS complement(14122..14439) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42740 CDS complement(14524..14745) product killing protein KilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560226.1 transl_table 11 codon_start 1 locus_tag LOCUS_42750 gene kilR CDS 15183..15704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42760 CDS complement(15694..15819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42770 CDS complement(15812..15976) product YdaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169151.1 transl_table 11 codon_start 1 locus_tag LOCUS_42780 CDS complement(16352..16819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42790 CDS 17131..17421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42800 sequence48 source 1..13569 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 94..231 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42810 CDS 185..529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42820 CDS complement(900..5123) product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653965.1 transl_table 11 codon_start 1 locus_tag LOCUS_42830 gene rpoC CDS complement(5200..9228) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000263103.1 transl_table 11 codon_start 1 locus_tag LOCUS_42840 gene rpoB CDS complement(9546..9911) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028882.1 transl_table 11 codon_start 1 locus_tag LOCUS_42850 gene rplL CDS complement(9978..10475) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207203.1 transl_table 11 codon_start 1 locus_tag LOCUS_42860 gene rplJ CDS complement(10891..11595) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096676.1 transl_table 11 codon_start 1 locus_tag LOCUS_42870 gene rplA CDS complement(11599..12027) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085926.1 transl_table 11 codon_start 1 locus_tag LOCUS_42880 gene rplK CDS complement(12185..12730) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287521.1 transl_table 11 codon_start 1 locus_tag LOCUS_42890 gene nusG CDS complement(12732..13115) product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275691.1 transl_table 11 codon_start 1 locus_tag LOCUS_42900 gene secE sequence49 source 1..11121 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1346..1741 product DUF1398 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422884.1 transl_table 11 codon_start 1 locus_tag LOCUS_42910 CDS 2071..2547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030950.1 transl_table 11 codon_start 1 locus_tag LOCUS_42920 CDS complement(2920..3339) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354403.1 transl_table 11 codon_start 1 locus_tag LOCUS_42930 CDS complement(3471..3665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42940 CDS 4047..4226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42950 CDS complement(4480..5640) product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209743.1 transl_table 11 codon_start 1 locus_tag LOCUS_42960 CDS complement(6608..6826) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42970 CDS complement(7410..7646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42980 CDS 8473..8631 product DUF5993 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480735.1 transl_table 11 codon_start 1 locus_tag LOCUS_42990 CDS 8920..9255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43000 sequence50 source 1..11101 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(414..1295) product aromatic amino acid efflux DMT transporter YddG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198225.1 transl_table 11 codon_start 1 locus_tag LOCUS_43010 gene yddG CDS 1573..4620 product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602782.1 transl_table 11 codon_start 1 transl_except (pos:2158..2160,aa:Sec) note codon on position 196 is selenocysteine opal codon. locus_tag LOCUS_43020 gene fdnG CDS 4634..5518 product formate dehydrogenase N subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240581.1 transl_table 11 codon_start 1 locus_tag LOCUS_43030 gene fdnH CDS 5511..6167 product formate dehydrogenase-N subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045648.1 transl_table 11 codon_start 1 locus_tag LOCUS_43040 gene fdnI CDS complement(6258..7268) product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642447.1 transl_table 11 codon_start 1 locus_tag LOCUS_43050 gene adhP CDS complement(7550..9247) product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450511.1 transl_table 11 codon_start 1 locus_tag LOCUS_43060 CDS complement(9424..9567) product stationary-phase-induced ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841559.1 transl_table 11 codon_start 1 locus_tag LOCUS_43070 gene sra CDS complement(9662..9877) product biofilm-dependent modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495700.1 transl_table 11 codon_start 1 locus_tag LOCUS_43080 gene bdm CDS 10390..10821 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152297.1 transl_table 11 codon_start 1 locus_tag LOCUS_43090 sequence51 source 1..6964 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..759 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000958453.1:O-antigen ligase RfaL locus_tag LOCUS_43100 CDS complement(817..1962) product lipopolysaccharide N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000591814.1 transl_table 11 codon_start 1 locus_tag LOCUS_43110 CDS complement(2062..2871) product 3-deoxy-D-manno-oct-2-ulosonate III transferase WaaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000536021.1 transl_table 11 codon_start 1 locus_tag LOCUS_43120 gene waaZ CDS complement(3021..3719) product lipopolysaccharide core heptose(II) kinase RfaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582822.1 transl_table 11 codon_start 1 locus_tag LOCUS_43130 gene rfaY CDS complement(3742..4755) product lipopolysaccharide 1,2-glucosyltransferase RfaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000376863.1 transl_table 11 codon_start 1 locus_tag LOCUS_43140 gene rfaJ CDS complement(4773..5786) product lipopolysaccharide 3-alpha-galactosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088491.1 transl_table 11 codon_start 1 locus_tag LOCUS_43150 gene waaO CDS complement(5792..6871) product lipopolysaccharide 1,6-galactosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704702.1 transl_table 11 codon_start 1 locus_tag LOCUS_43160 gene waaB sequence52 source 1..6391 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(675..1052) product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001417601.1 transl_table 11 codon_start 1 locus_tag LOCUS_43170 gene bamE CDS complement(1156..1557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43180 CDS 1992..2522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43190 CDS 2533..2808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43200 CDS 3039..3884 product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470596.1 transl_table 11 codon_start 1 locus_tag LOCUS_43210 CDS complement(3908..5428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43220 CDS 6065..6370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43230 sequence53 source 1..6257 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 682..945 product chaperone NapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260058.1 transl_table 11 codon_start 1 locus_tag LOCUS_43240 gene napD CDS 942..3428 product nitrate reductase catalytic subunit NapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778090.1 transl_table 11 codon_start 1 locus_tag LOCUS_43250 gene napA CDS 3435..4130 product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091679.1 transl_table 11 codon_start 1 locus_tag LOCUS_43260 gene napG CDS 4117..4986 product quinol dehydrogenase ferredoxin subunit NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013528.1 transl_table 11 codon_start 1 locus_tag LOCUS_43270 gene napH CDS 5081..5551 product nitrate reductase cytochrome c-type subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835182.1 transl_table 11 codon_start 1 locus_tag LOCUS_43280 gene napB CDS 5561..6163 product cytochrome c-type protein NapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431773.1 transl_table 11 codon_start 1 locus_tag LOCUS_43290 gene napC sequence54 source 1..6044 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(911..1468) product thiol:disulfide interchange protein DsbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828299.1 transl_table 11 codon_start 1 locus_tag LOCUS_43300 gene dsbE CDS complement(1465..3396) product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982516.1 transl_table 11 codon_start 1 locus_tag LOCUS_43310 CDS complement(3393..3872) product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053607.1 transl_table 11 codon_start 1 locus_tag LOCUS_43320 gene ccmE CDS complement(3869..4081) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43330 CDS complement(4078..4824) product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000266010.1 transl_table 11 codon_start 1 locus_tag LOCUS_43340 CDS complement(4867..5526) product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990042.1 transl_table 11 codon_start 1 locus_tag LOCUS_43350 gene ccmB misc_feature complement(5523..>6044) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000888541.1:cytochrome c biogenesis heme-transporting ATPase CcmA locus_tag LOCUS_43360 sequence55 source 1..5000 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 305..415 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00070 CDS 600..1628 product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149790.1 transl_table 11 codon_start 1 locus_tag LOCUS_43370 gene murB CDS 1625..2587 product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655746.1 transl_table 11 codon_start 1 locus_tag LOCUS_43380 gene birA CDS complement(2622..3548) product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023068.1 transl_table 11 codon_start 1 locus_tag LOCUS_43390 gene coaA tRNA 3974..4049 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00730 tRNA 4058..4142 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00740 tRNA 4259..4333 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00750 tRNA 4340..4415 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00760 sequence56 source 1..4891 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(909..1445) product DUF1133 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640158.1 transl_table 11 codon_start 1 locus_tag LOCUS_43400 CDS complement(1442..1732) product DUF1364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228038.1 transl_table 11 codon_start 1 locus_tag LOCUS_43410 CDS complement(1732..2331) product DUF1367 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940304.1 transl_table 11 codon_start 1 locus_tag LOCUS_43420 CDS complement(2394..2564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43430 CDS complement(2855..3010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43440 CDS 3437..4369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43450 sequence57 source 1..4789 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(368..712) product c-type lysozyme inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977725.1 transl_table 11 codon_start 1 locus_tag LOCUS_43460 CDS 1090..1215 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758947.1 transl_table 11 codon_start 1 locus_tag LOCUS_43470 CDS complement(1347..1520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43480 CDS 1840..2307 product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518864.1 transl_table 11 codon_start 1 locus_tag LOCUS_43490 CDS 2646..3689 product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761737.1 transl_table 11 codon_start 1 locus_tag LOCUS_43500 CDS complement(3772..4302) product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929974.1 transl_table 11 codon_start 1 locus_tag LOCUS_43510 CDS complement(4451..4765) product TRL-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182479.1 transl_table 11 codon_start 1 locus_tag LOCUS_43520 sequence58 source 1..4397 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 257..805 product SLATT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039060.1 transl_table 11 codon_start 1 locus_tag LOCUS_43530 CDS complement(1221..1625) product H-NS family nucleoid-associated regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287388.1 transl_table 11 codon_start 1 locus_tag LOCUS_43540 CDS complement(1786..2265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43550 CDS complement(2351..3142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43560 CDS complement(3173..3907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43570 sequence59 source 1..3413 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(447..893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43580 CDS complement(890..3334) product SEF14/SEF18 fimbria usher protein SefC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753917.1 transl_table 11 codon_start 1 locus_tag LOCUS_43590 gene sefC sequence60 source 1..3358 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 222..1238 product lipopolysaccharide core heptosyltransferase RfaQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001210932.1 transl_table 11 codon_start 1 locus_tag LOCUS_43600 gene rfaQ CDS 1235..2359 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261571.1 transl_table 11 codon_start 1 locus_tag LOCUS_43610 CDS 2352..3149 product lipopolysaccharide core heptose(I) kinase RfaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229818.1 transl_table 11 codon_start 1 locus_tag LOCUS_43620 gene rfaP sequence61 source 1..3121 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(980..1942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43630 CDS complement(1998..2333) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43640 CDS complement(2469..2738) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43650 sequence62 source 1..1945 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 319..600 product YjcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719058.1 transl_table 11 codon_start 1 locus_tag LOCUS_43660 CDS complement(878..1312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43670 sequence63 source 1..1417 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence64 source 1..1367 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence65 source 1..1128 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(651..1127) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43680 sequence66 source 1..1055 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 526..645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43690 sequence67 source 1..944 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(453..596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43700 CDS complement(575..925) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135400.1 transl_table 11 codon_start 1 locus_tag LOCUS_43710 sequence68 source 1..482 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence69 source 1..469 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@