COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..388208 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1016..1465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00010 note possible pseudo, internal stop codon CDS complement(1847..3112) product DUF1479 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210972.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS 3374..4183 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217910.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS complement(4261..6693) product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192654.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS complement(6699..7598) product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576948.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS complement(7876..8625) product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829275.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 gene moeB CDS complement(8625..9860) product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014343820.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 gene moeA CDS 10063..11004 product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030503.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 gene iaaA CDS 11015..12886 product glutathione ABC transporter ATP-binding protein GsiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120605.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 gene gsiA CDS 12919..14457 product glutathione ABC transporter substrate-binding protein GsiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191432.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 gene gsiB CDS 14515..15438 product glutathione ABC transporter permease GsiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936066.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 gene gsiC CDS 15441..16352 product glutathione ABC transporter permease GsiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236024.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 gene gsiD CDS complement(16443..17768) product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073304.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 gene rimO CDS 17999..18382 product biofilm formation regulator BssR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000259651.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 gene bssR CDS 19095..19610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS 19633..20382 product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447049.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS 20393..21346 product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189890.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS 21379..21642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS 21639..22802 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085913.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS 23251..24936 product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033449775.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS complement(24942..25832) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811152.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS complement(26094..26519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS 26866..27363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00230 note possible pseudo, internal stop codon, frameshifted CDS 27381..27545 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00240 note possible pseudo, internal stop codon, frameshifted CDS complement(27542..28168) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631908.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS 28544..29614 product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195712.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 gene dacC CDS complement(29659..30417) product DNA-binding transcriptional repressor DeoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450106.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 gene deoR CDS complement(30489..31163) product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001520197.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 gene ybjG CDS 31410..32642 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181284.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS complement(32696..33511) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023559.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS complement(33508..34719) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217437.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS 34875..35507 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661882.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS complement(35624..37111) product aspartate:alanine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024851.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS complement(37151..37309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00340 note possible pseudo, internal stop codon CDS 37580..37957 product inner membrane protein YbjM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680848.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS complement(37989..38252) product GrxA family glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495513.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS 38422..38712 product YbjC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259133.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS 38696..39418 product nitroreductase NfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075306.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 gene nfsA CDS 39476..40378 product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684361.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 gene rimK CDS 40475..40951 product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624817.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS 41300..42412 product spermidine/putrescine ABC transporter substrate-binding protein PotF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125773.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 gene potF CDS 42500..43633 product putrescine ABC transporter ATP-binding subunit PotG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996054.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 gene potG CDS 43643..44596 product putrescine ABC transporter permease PotH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105449.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 gene potH CDS 44593..45438 product putrescine ABC transporter permease PotI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061634.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 gene potI CDS 45512..45985 product DUF2593 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001763976.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS 46028..47155 product 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001149787.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 gene rlmC CDS 47450..48793 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399316.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS 48823..49143 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655400.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS 49153..50640 product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644028.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS complement(50859..51590) product ABC transporter substrate-binding protein ArtJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737538.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 gene artJ CDS complement(51827..52495) product arginine ABC transporter permease ArtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895396.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 gene artM CDS complement(52495..53211) product arginine ABC transporter permease ArtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001677.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 gene artQ CDS complement(53218..53949) product arginine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000756586.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 gene artJ CDS complement(53967..54695) product arginine ABC transporter ATP-binding protein ArtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027186.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 gene artP CDS complement(54925..55440) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270727.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS 55568..55891 product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160725.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS 55888..56718 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645850.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS complement(56715..57728) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866904.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS complement(57824..59257) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079004.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS complement(59268..60269) product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566341.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 gene ltaE CDS complement(60308..62026) product ubiquinone-dependent pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815309.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 gene poxB CDS complement(62184..63152) product NADH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988821.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 gene hcr CDS complement(63164..64816) product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000458773.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 gene hcp CDS complement(64960..65859) product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491116.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS 66061..67719 product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599771.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS complement(67716..68666) product VirK/YbjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001682088.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS 68812..69930 product macrolide transporter subunit MacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201759.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 gene macA CDS 69927..71873 product macrolide ABC transporter ATP-binding protein/permease MacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125880.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 gene macB CDS complement(72003..72224) product cold shock-like protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447499.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 gene cspD CDS 72548..72868 product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000520789.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 gene clpS CDS 72899..75175 product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934058.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 gene clpA CDS complement(75388..75585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS complement(75747..76124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00730 tRNA complement(76555..76642) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS complement(76791..77468) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097901.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS complement(77488..78348) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809962.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS 78457..79368 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597928.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS complement(79459..79677) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040187.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 gene infA CDS complement(79989..80693) product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241650.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 gene aat CDS complement(80738..82459) product cysteine/glutathione ABC transporter ATP-binding protein/permease CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202266.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 gene cydC CDS complement(82460..84226) product cysteine/glutathione ABC transporter permease/ATP-binding protein CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044527.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 gene cydD CDS complement(84340..85308) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000537407.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 gene trxB CDS 85854..86348 product leucine-responsive transcriptional regulator Lrp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228469.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 gene lrp CDS 86483..90604 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS 90747..91358 product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001765126.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 gene lolA CDS 91368..92711 product replication-associated recombination protein RarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067785.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 gene rarA CDS 92970..94262 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886697.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 gene serS CDS 94499..96943 product dimethylsulfoxide reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850260.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 gene dmsA CDS 96954..97571 product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213069.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 gene dmsB CDS 97573..98436 product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534681.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS 98786..99934 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029921.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS 100152..101573 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001134259.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS complement(101866..102663) product pyruvate formate lyase 1-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067928.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 gene pflA CDS 103239..104198 product SPI-1 type III secretion system effector SopD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145541.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 gene sopD CDS complement(104274..106556) product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292799.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 gene pflB CDS complement(106616..107473) product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642539.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 gene focA CDS complement(107878..109638) product 30S ribosomal protein S12 methylthiotransferase accessory protein YcaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194823.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS 109775..110467 product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642873.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS 110653..111741 product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079590.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 gene serC CDS 111812..113095 product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445205.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 gene aroA CDS 113238..113999 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792300.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS 114172..114855 product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125007.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 gene cmk CDS 114969..116642 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140324.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 gene rpsA CDS 116798..117082 product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167332.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 gene ihfB CDS complement(117465..117656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS 117702..119576 product ComEC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705794.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS 119613..121361 product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551246.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 gene msbA CDS 121358..122335 product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561698.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 gene lpxK CDS 122379..123611 product crosslink repair DNA glycosylase YcaQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056498.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 gene ycaQ CDS 123663..123845 product protein YcaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350061.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 gene ycaR CDS 123842..124588 product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011583.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 gene kdsB CDS 124799..125692 product YcbJ family phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436890.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS complement(125672..126448) product envelope biogenesis factor ElyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899546.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 gene elyC CDS 126584..127387 product tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154025.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 gene cmoM CDS 127380..128702 product chromosome partition protein MukF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288827.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 gene mukF CDS 128683..129387 product chromosome partition protein MukE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295931.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 gene mukE CDS 129387..133853 product chromosome partition protein MukB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572729.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 gene mukB CDS 134198..136048 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925899.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 gene ldtD CDS 136308..136856 product YcbK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357053.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS 136884..137531 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109472.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS complement(137593..138783) product aspartate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462648.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 gene aspC CDS complement(138968..140059) product porin OmpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977709.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 gene ompF CDS complement(140653..142053) product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117867.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 gene asnS CDS complement(142254..142715) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762345.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS complement(142779..142946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS 143033..144247 product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047950.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 gene dpaL CDS 144493..145929 product amino acid carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893189.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS complement(146007..147209) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191411.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 gene pncB CDS complement(147294..147503) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS complement(147404..147814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS 147835..148464 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS 148448..149074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS 149071..150780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS 150780..151361 product tail fiber assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885576.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS 152235..152807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS 153075..153323 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01350 note possible pseudo, frameshifted CDS complement(153455..154081) product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419689.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(154441..155127) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS complement(155398..155652) product DinI-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497441.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS 156016..158628 product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193884.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 gene pepN CDS 158836..159846 product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291724.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 gene pyrD CDS 160012..160554 product cell division protein ZapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220671.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 gene zapC CDS complement(160551..161660) product YcbX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224084.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS 161759..163867 product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086472.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 gene rlmKL CDS 163880..165787 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053045.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS 165802..167055 product membrane integrity-associated transporter subunit PqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333152.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 gene pqiA CDS 167060..168700 product intermembrane transport protein PqiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433416.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 gene pqiB CDS 168697..169260 product membrane integrity-associated transporter subunit PqiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759136.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 gene pqiC CDS complement(169783..170301) product bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227928.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 gene fabA CDS complement(170370..172130) product Lon protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156455.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS 172316..172768 product macrodomain Ter protein MatP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877174.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 gene matP CDS complement(172840..173892) product porin OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989142.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 gene ompA CDS complement(174249..174629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS 174975..175580 product TfoX/Sxy family DNA transformation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202371.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS complement(175567..177720) product YccS family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950867.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 gene yccS CDS complement(177739..178185) product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261222.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS 178309..180363 product DNA helicase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000420526.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 gene helD CDS complement(180399..180857) product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424187.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 gene mgsA CDS complement(180952..181614) product DUF2057 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847719.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS 181788..182201 product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000975203.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS complement(182246..182563) product heat shock protein HspQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561983.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 gene hspQ CDS complement(182621..183832) product 23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140485.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 gene rlmI CDS 184047..184595 product Raf kinase inhibitor-like protein YbcL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001313946.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 gene ybcL CDS 184612..185400 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330817.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS 185449..185730 product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072884.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 gene yccX CDS complement(185727..186056) product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904446.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 gene tusE CDS complement(186143..186802) product FtsH protease modulator YccA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000374046.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 gene yccA tRNA 187197..187284 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS complement(187421..188101) product type III secretion system effector protease PipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938184.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 gene pipA CDS complement(188321..189196) product SPI-2 type III secretion system effector PipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123042.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 gene pipB CDS complement(189744..190085) product type III secretion system chaperone SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444726.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 gene sigE CDS complement(190102..191787) product SPI-1 type III secretion system effector inositol phosphate phosphatase SopB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166955.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 gene sopB CDS complement(192509..194071) product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760238.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS complement(194151..195515) product heavy metal sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240036.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS complement(195508..196176) product response regulator transcription factor HprR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014343829.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 gene hprR CDS 196324..196734 product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833187.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 gene hiuH CDS complement(197067..197579) product 4-hydroxyphenylacetate 3-monooxygenase reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195559.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS complement(197597..199159) product 4-hydroxyphenylacetate 3-monooxygenase, oxygenase component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801496.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 gene hpaB CDS complement(199377..199817) product homoprotocatechuate degradation operon regulator HpaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543921.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 gene hpaR CDS 200092..201381 product 4-hydroxyphenylacetate degradation bifunctional isomerase/decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000679210.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 gene hpaG CDS 201378..202844 product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723530.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 gene hpaE CDS 202846..203697 product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516973.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 gene hpaD CDS 203707..204087 product 5-carboxymethyl-2-hydroxymuconate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119858.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS 204230..205033 product 2-oxo-hepta-3-ene-1,7-dioic acid hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884795.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 gene hpaH CDS 205044..205835 product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785061.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 gene hpaI CDS 205908..207284 product 4-hydroxyphenylacetate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285789.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 gene hpaX CDS 207294..208190 product 4-hydroxyphenylacetate catabolism regulatory protein HpaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000336599.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 gene hpaA CDS 208204..209142 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976557.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(209550..209912) product anti-adapter protein IraM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307134.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 gene iraM CDS complement(210566..210871) product chaperone modulator CbpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284251.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 gene cbpM CDS complement(210871..211791) product curved DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000420603.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 gene cbpA CDS 212027..212389 product copper resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118904.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS 212438..214324 product protein-disulfide reductase DsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000972986.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS 214321..214944 product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876697.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS 214934..215440 product protein disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907521.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS 215573..215989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01940 note possible pseudo, internal stop codon CDS 215996..216814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01950 note possible pseudo, internal stop codon CDS complement(216848..217075) product YccJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143126.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS complement(217096..217692) product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062894.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 gene wrbA CDS 218077..218244 product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273665.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS 218381..219019 product HTH-type transcriptional regulator RutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083125.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 gene rutR CDS complement(219016..219411) product lysozyme inhibitor LprI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821059.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS complement(219470..223450) product trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000537509.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 gene putA CDS 223872..225380 product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018468.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 gene putP CDS 225998..226294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS 226273..227061 product phosphate starvation-inducible protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001617488.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 gene phoH CDS complement(227167..228048) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433673.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS complement(228334..229830) product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261398.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(230167..230847) product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054243.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS 231365..232507 product N-acetylneuraminate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525766.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS 232553..233245 product oligogalacturonate-specific porin KdgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700857.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS 233528..234808 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560763.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS 234819..235925 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988585.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS complement(236092..236385) product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096224.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS 236416..236634 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS complement(237236..237694) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS complement(237818..238189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS complement(238198..238638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS complement(238658..239530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS complement(239563..240042) product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284958.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS complement(240030..241421) product type VI secretion system ImpA and VasL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087741.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS complement(241432..243978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02200 tRNA 242177..242263 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS 244101..244499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS 244718..244969 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS 245294..245590 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS 245658..246110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02240 note possible pseudo, frameshifted CDS 246173..246622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02250 note possible pseudo, frameshifted CDS 246816..247115 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169527.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS 247112..247603 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02270 note possible pseudo, frameshifted CDS 247600..247965 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02280 note possible pseudo, frameshifted CDS complement(248104..248883) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086142.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS 249151..249429 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02300 note possible pseudo, frameshifted CDS 249486..249803 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02310 note possible pseudo, internal stop codon, frameshifted CDS 250343..250555 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208507.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS complement(250580..250759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS complement(251013..252209) product porin OmpS1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080666.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 gene ompS1 CDS 252859..253170 product cell division protein DrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107435.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 gene drpB CDS 253250..253945 product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377043.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS 254019..255449 product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157299.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS 255430..255900 product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785981.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS complement(255889..256809) product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212262.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 gene yedA CDS 256985..257896 product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922683.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS 257973..258158 product YodC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001178602.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS 258323..260035 product cellulose biosynthesis regulator diguanylate cyclase DgcQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119838.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 gene dgcQ CDS complement(260014..260511) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS complement(260619..261356) product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253411.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 gene fliP CDS complement(261356..261733) product flagellar biosynthetic protein FliO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978276.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 gene fliO CDS complement(261733..262146) product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282109.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 gene fliN CDS complement(262143..263147) product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502815.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 gene fliM CDS complement(263152..263619) product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132172.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 gene fliL CDS complement(263724..264941) product flagellar hook length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631663.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 gene fliK CDS complement(264938..265381) product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046981.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 gene fliJ CDS complement(265403..266773) product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213259.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 gene fliI CDS complement(266773..267480) product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064158.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 gene fliH CDS complement(267473..268468) product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067735.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 gene fliG CDS complement(268461..270143) product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276841.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 gene fliF CDS 270360..270674 product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719033.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 gene fliE CDS complement(270794..271180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639596.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS complement(271445..271678) product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790504.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 gene yedF CDS complement(271675..272880) product selenium metabolism membrane protein YedE/FdhT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580669.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 gene yedE CDS 273066..273479 product lipoprotein YedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754694.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 gene yedD CDS complement(273519..275003) product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795470.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 gene amyA CDS complement(275075..275443) product flagella biosynthesis regulatory protein FliT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204899.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 gene fliT CDS complement(275443..275850) product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287765.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 gene fliS CDS complement(275865..277271) product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146805.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 gene fliD CDS 277171..277509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS 277527..279044 product FliC/FljB family flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079784.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS 279123..280328 product flagellin lysine-N-methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816588.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 gene fliB CDS 280555..281244 product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087453.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS 281303..281854 product flagella biosynthesis regulatory protein FliZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218080.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 gene fliZ CDS 282001..282801 product cystine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761628.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 gene tcyJ CDS 282955..283941 product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128192.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 gene dcyD CDS 283962..284630 product cystine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158238.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 gene tcyL CDS 284627..285379 product L-cystine ABC transporter ATP-binding protein YecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273033.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 gene yecC CDS 285612..286334 product transcriptional regulator SdiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157173.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 gene sdiA CDS complement(286401..286625) product DUF2594 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106483.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS 287089..287745 product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611323.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 gene uvrY CDS 287742..289574 product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289473.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 gene uvrC CDS 289631..290179 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160192.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 gene pgsA tRNA 290331..290406 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 tRNA 290458..290531 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 tRNA 290543..290629 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS 290985..291209 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS 291429..292862 product SH3 domain-containing C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989033.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS 293075..293401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS 293640..294305 product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781529.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS complement(294380..295648) product tyrosine transporter TyrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001562965.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 gene tyrP CDS 295818..296057 product YecH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377238.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS complement(296103..296600) product non-heme ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920615.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 gene ftnA CDS complement(296840..297175) product YecR-like lipofamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803230.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS 297431..298069 product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705970.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS complement(298248..298751) product non-heme ferritin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741707.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS 299301..299858 product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754799.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS 300087..300269 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02890 note possible pseudo, internal stop codon CDS 300492..301295 product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840119.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 gene otsB CDS 301270..302691 product alpha,alpha-trehalose-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089042.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 gene otsA CDS complement(302709..303137) product universal stress protein UspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122416.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 gene uspC CDS 303933..304274 product flagellar transcriptional regulator FlhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518146.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 gene flhD CDS 304277..304855 product flagellar transcriptional regulator FlhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605989.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 gene flhC CDS 304980..305867 product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906317.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 gene motA CDS 305864..306793 product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795656.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 gene motB CDS 306804..308813 product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061308.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 gene cheA CDS 308834..309337 product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147296.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 gene cheW CDS 309574..311235 product methyl-accepting chemotaxis protein II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483273.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 gene tar CDS 311389..312255 product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204368.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 gene cheR CDS 312252..313301 product protein-glutamate methylesterase/protein glutamine deamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036391.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 gene cheB CDS 313319..313708 product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763861.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 gene cheY CDS 313719..314363 product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983587.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 gene cheZ CDS 314557..315708 product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797087.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 gene flhB CDS 315701..317779 product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002392.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 gene flhA CDS 317779..318171 product flagellar protein FlhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233619.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 gene flhe CDS 318408..319547 product glycoside hydrolase family 105 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000989908.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS complement(319601..321472) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063446482.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 gene mrdA CDS complement(321661..323394) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025371.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 gene argS CDS 323631..324200 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024793.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS 324220..324966 product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185770.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 gene cutC CDS complement(325202..326173) product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569029.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 gene cmoB CDS complement(326170..326913) product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019609.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 gene cmoA CDS complement(326954..327349) product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000252975.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS complement(327402..328220) product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639226.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS complement(328217..328783) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916144.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS 329108..330880 product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258634.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 gene aspS CDS 330983..331435 product dihydroneopterin triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653696.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 gene nudB CDS 331465..332205 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907242.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS 332242..332763 product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022509.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 gene ruvC CDS complement(332765..333364) product YebB family permuted papain-like enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716741.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS 333882..334265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS 334625..335236 product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580335.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 gene ruvA CDS 335245..336255 product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568508.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 gene ruvB CDS complement(336334..337119) product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571518.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 gene znuB CDS complement(337116..337922) product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203015.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 gene znuC CDS 337950..338894 product zinc ABC transporter substrate-binding protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625584.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 gene znuA CDS 338910..340229 product murein DD-endopeptidase MepM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001184019.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 gene mepM CDS 340346..341317 product lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448401.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 gene lpxM CDS complement(341390..342832) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091158.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 gene pyk CDS complement(342956..343825) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056719.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS 344167..345642 product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301712.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 gene zwf CDS 345877..347688 product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069125.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 gene edd CDS 347726..348367 product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800493.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 gene kdgA CDS complement(348467..349645) product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173426.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 gene purT CDS 349776..350066 product DNA damage-inducible protein YebG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257728.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 gene yebG CDS 350134..350487 product protein YebF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042123.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 gene yebF CDS 350581..351240 product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024713.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS 351453..353504 product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936997.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 gene ptrB CDS complement(353541..354239) product exodeoxyribonuclease X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944282.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 gene exoX CDS complement(354263..354919) product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100250.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS complement(355027..355257) product DNA polymerase III subunit theta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856224.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS 355395..355769 product CopC domain-containing protein YobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168393.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 gene yobA CDS 355770..356645 product copper homeostasis membrane protein CopD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979693.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 gene copD CDS 356662..357015 product YebY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722366.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS complement(357398..358477) product phage integrase Arm DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189090.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS complement(358452..358724) product excisionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311878.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS 359144..361123 product alkyl sulfatase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237518.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS 361812..362060 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023517636.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS 362124..362723 product DUF1367 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940329.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS 362720..362947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS 363077..363766 product bacteriophage antitermination protein Q inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705893.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS 363863..364387 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS complement(364761..365210) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798706.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS complement(365571..366257) product type III secretion system effector protease PipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938184.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 gene pipA CDS 366527..366862 product phage holin, lambda family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120501.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS 366849..367298 product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095605.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS 367295..367795 product prophage endopeptidase RzpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082739.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 gene rzpD CDS 368003..368317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS 368394..368573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS complement(368690..369223) product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161597822.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS 369313..370008 product phage minor tail protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001152615.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS 370293..371243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03630 note possible pseudo, internal stop codon CDS 371286..372653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03640 note possible pseudo, internal stop codon CDS 372796..373512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03650 note possible pseudo, frameshifted CDS 373568..373861 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS complement(374063..374785) product SPI-1 type III secretion system guanine nucleotide exchange factor SopE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161708.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 gene sopE CDS 374998..375150 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03680 note possible pseudo, internal stop codon, frameshifted CDS complement(375265..376065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS complement(377010..377279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03700 note possible pseudo, frameshifted CDS complement(377294..377905) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03710 note possible pseudo, frameshifted CDS complement(377923..378576) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS 378607..378837 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03730 note possible pseudo, internal stop codon CDS 378927..379424 product DUF2514 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050879.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS complement(379681..379848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS 380156..380647 product DUF1441 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348565.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS 380634..380813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS 381200..381796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS 381886..382062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03790 note possible pseudo, internal stop codon CDS 382117..382803 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03800 note possible pseudo, internal stop codon CDS 382752..383252 product tail fiber assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885577.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS complement(383349..383549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS complement(385379..385777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS complement(386003..386161) product DUF5993 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480735.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS 386988..387224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS 387808..388026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03860 sequence02 source 1..285462 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..5190 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001189075.1:autotransporter outer membrane beta-barrel domain-containing protein locus_tag LOCUS_03870 CDS 5383..5553 product YhfL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472323.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS complement(5698..6702) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165562.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 gene trpS CDS complement(6695..7453) product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038040.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 gene gph CDS complement(7446..8123) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816285.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 gene rpe CDS complement(8141..8977) product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742132.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 gene dam CDS complement(9158..10435) product cell division protein DamX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343137.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 gene damX CDS complement(10533..11510) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439825.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 gene aroB CDS complement(11678..12199) product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818621.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 gene aroK CDS complement(12664..13866) product DNA uptake porin HofQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832818.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 gene hofQ CDS complement(13817..14218) product HofP DNA utilization family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868832.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS complement(14208..14681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992480.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS complement(14665..15204) product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951390.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS complement(15204..15983) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000874746.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS 16125..18656 product peptidoglycan glycosyltransferase/peptidoglycan DD-transpeptidase MrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013215.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 gene mrcA CDS complement(18752..19315) product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519362.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 gene nudE CDS 19638..21770 product intracellular growth attenuator protein IgaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104086.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 gene igaA CDS 21835..22503 product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001520508.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 gene yrfG CDS 22514..22915 product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660720.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 gene hslR CDS 22940..23818 product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001775502.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 gene hslO CDS complement(23927..25636) product DUF4153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446446.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS 26016..27623 product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001265689.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 gene pckA CDS complement(27698..29041) product two-component system sensor histidine kinase EnvZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253815.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 gene envZ CDS complement(29047..29766) product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157751.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 gene ompR CDS 29992..30465 product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856695.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 gene greB CDS 30564..32894 product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980674.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS 33331..33558 product ferrous iron transporter A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160955.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 gene feoA CDS 33577..35895 product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000736984.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 gene feoB CDS 35908..36144 product [Fe-S]-dependent transcriptional repressor FeoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157589.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 gene feoC CDS 36379..37305 product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235943.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS complement(37341..38111) product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998145.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 gene bioH CDS 38169..38354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS 38341..38832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS 38891..39466 product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619394.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 gene nfuA CDS 39843..41159 product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131741.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 gene gntT CDS complement(41278..43356) product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428711.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 gene malQ CDS complement(43366..45759) product maltodextrin phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082255.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 gene malP CDS 46353..49058 product HTH-type transcriptional regulator MalT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907046.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 gene malT CDS complement(49146..49421) product type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170383.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS complement(49424..49684) product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816235.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS complement(49793..50812) product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827117.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 gene rtcA CDS complement(50816..52033) product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105467.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 gene rtcB CDS complement(52378..53931) product TROVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123257.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS 54121..55704 product DNA-binding transcriptional regulator RtcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232919.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 gene rtcR CDS complement(55701..56288) product DeoR/GlpR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815087.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 note possible pseudo, frameshifted CDS complement(56270..56458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04320 note possible pseudo, frameshifted CDS complement(56552..57382) product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928705.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 gene glpG CDS complement(57458..57784) product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434523.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 gene glpE CDS 57983..59500 product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448178.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 gene glpD CDS complement(59547..60092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS complement(60102..61598) product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982774.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS complement(61756..62865) product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083283.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS 63203..64537 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094951.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS 64534..66249 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966867.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS 66293..67198 product 2-keto-3-deoxygluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136613.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 gene yagE CDS complement(67242..67997) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894191.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS complement(68175..70622) product glycogen phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993423.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 gene glgP CDS complement(70642..72075) product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197660.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 gene glgA CDS complement(72075..73370) product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253993.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 gene glgC CDS complement(73385..75361) product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192475.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 gene glgX CDS complement(75358..77544) product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098552.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 gene glgB CDS complement(77891..78997) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799940.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 gene asd CDS 79027..79191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS complement(79421..80761) product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105950.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 gene gntU CDS complement(80758..81252) product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108342.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 gene gntK CDS complement(81430..82383) product gluconate operon transcriptional repressor GntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730239.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 gene gntR CDS complement(82796..83491) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639789.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS complement(83615..84652) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172399.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS 85121..85609 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290280.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 gene yhhY CDS 85874..87088 product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667442.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS 87104..87865 product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066512.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS 87919..88890 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038946.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS 88887..89921 product phosphotriesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675710.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS complement(89966..91708) product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805086.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 gene ggt CDS 91834..92250 product DUF2756 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826039.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS complement(92263..93003) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073552.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 gene ugpQ CDS complement(93000..94070) product sn-glycerol-3-phosphate import ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907851.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS complement(94072..94917) product sn-glycerol-3-phosphate ABC transporter permease UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572199.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 gene ugpE CDS complement(94914..95801) product sn-glycerol-3-phosphate ABC transporter permease UgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099302.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 gene ugpA CDS complement(95906..97222) product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624747.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 gene ugpB CDS complement(97481..97849) product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816307.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS complement(97846..98067) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS complement(98198..98899) product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416114.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 gene livF CDS complement(98913..99680) product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082083.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 gene livG CDS complement(99677..100954) product branched chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803764.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 gene livM CDS complement(100951..101877) product high-affinity branched-chain amino acid ABC transporter permease LivH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003007.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 gene livH CDS complement(101937..103046) product high-affinity branched-chain amino acid ABC transporter substrate-binding protein LivK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822976.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 gene livK CDS 103467..103850 product aspartate 1-decarboxylase autocleavage activator PanM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778873.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 gene panM CDS complement(104046..105143) product branched chain amino acid ABC transporter substrate-binding protein LivJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021996.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 gene livJ CDS complement(105471..106325) product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159621.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 gene rpoH CDS complement(106571..107626) product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081708.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 gene ftsX CDS complement(107619..108287) product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617729.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 gene ftsE CDS complement(108290..109765) product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118701.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 gene ftsY CDS 109891..110487 product 16S rRNA (guanine(966)-N(2))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743275.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 gene rsmD CDS 110477..110746 product DUF1145 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001575094.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS complement(110768..111139) product DUF2500 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042855.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS 111281..111907 product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964735.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS 111988..114186 product Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106671.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 gene zntA CDS 114386..116029 product methyl-accepting chemotaxis citrate transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789682.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS complement(116053..116298) product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001541054.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 gene tusA CDS 116468..117133 product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187489.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 117206..117763 product DcrB family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245277.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS complement(117767..118984) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001576500.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS 119116..120165 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179588.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS 120217..120795 product 4'-phosphopantetheinyl transferase AcpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284366.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 gene acpT CDS 120851..121288 product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190057.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 gene nikR CDS complement(121377..122501) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001314210.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS complement(122501..125242) product ribosome-associated ATPase/putative transporter RbbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202935.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 gene rbbA CDS complement(125239..126306) product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359835.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS complement(126612..127808) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439232.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS 128039..129535 product inorganic phosphate transporter PitA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902764.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 gene pitA CDS complement(129676..130011) product universal stress protein UspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626193.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 gene uspB CDS 130399..130833 product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323571.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 gene uspA CDS 131158..132630 product dipeptide/tripeptide permease DtpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098284.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 gene dtpB CDS complement(132722..133465) product 16S rRNA (guanine(1516)-N(2))-methyltransferase RsmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001165126.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 gene rsmJ CDS complement(133487..135529) product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184173.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 gene prlC CDS complement(135711..136982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS 137193..138035 product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954235.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS 138140..139492 product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160779.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 gene gorA CDS complement(139539..140564) product asparaginase AnsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246337.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 gene ansZ CDS complement(140641..141960) product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498698.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS complement(142014..142859) product fructoselysine 6-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966764.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS complement(142923..143897) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966767.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS complement(144076..144795) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572570.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS 145121..146770 product alpha,alpha-trehalase TreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934251.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 gene treF CDS complement(146783..148372) product STY4199 family HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099200.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS 148653..149009 product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120250.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS complement(149015..149617) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196086.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS 150248..151147 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358042.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 151220..152248 product inner membrane protein YhjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191231.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 gene yhjD CDS 152599..153921 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148985.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS complement(153961..156021) product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158664.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS complement(156131..156898) product cyclic-guanylate-specific phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595629.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 gene pdeH CDS 157127..158056 product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037582.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS complement(158110..159597) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163190.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS complement(159817..161103) product C4-dicarboxylate transporter DctC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858232.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 gene dctA CDS complement(161261..163267) product biofilm formation regulator HmsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014344205.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 gene hmsP CDS complement(163441..166893) product cellulose synthase complex outer membrane protein BcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225124.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 gene bcsC CDS complement(166965..168074) product cellulose synthase complex periplasmic endoglucanase BcsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988805.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 gene bcsZ CDS complement(168078..170228) product cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823808.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 gene bcsB CDS complement(170389..173013) product UDP-forming cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275344.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 gene bcsA CDS complement(173010..173762) product cellulose biosynthesis protein BcsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996130.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 gene bcsQ CDS complement(173763..173966) product cellulose biosynthesis protein BcsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282616.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 gene bcsR CDS 174223..175782 product cellulose biosynthesis c-di-GMP-binding protein BcsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205773.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 gene bcsE CDS 175779..175970 product cellulose biosynthesis protein BcsF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988321.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 gene bcsF CDS 175967..177646 product cellulose biosynthesis protein BcsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192026.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 gene bcsG CDS complement(177728..177859) product type I toxin-antitoxin system toxin Ldr family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001541083.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS 178478..179776 product aromatic amino acid transport family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001150177.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS complement(179877..180890) product dipeptide ABC transporter ATP-binding subunit DppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103568.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 gene dppF CDS complement(180887..181870) product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196507.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 gene dppD CDS complement(181881..182783) product dipeptide ABC transporter permease DppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084689.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 gene dppC CDS complement(182793..183812) product dipeptide ABC transporter permease DppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938843.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 gene dppB CDS complement(183969..185549) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028045.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS complement(186132..187457) product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975177.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS complement(187515..188639) product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940824.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS 188789..189796 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290717.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 tRNA complement(190111..190187) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS complement(190278..191951) product kdo(2)-lipid A phosphoethanolamine 7''-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269253.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 gene eptB CDS complement(192187..192714) product long polar fimbrial protein LpfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831422.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 gene lpfE CDS complement(192720..193799) product long polar fimbrial protein LpfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000694929.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 gene lpfD CDS complement(193817..196345) product outer membrane usher protein LpfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558664.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 gene lpfC CDS complement(196368..197066) product long polar fimbrial biogenesis chaperone LpfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836900.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 gene lpfB CDS complement(197151..197675) product long polar fimbria major subunit LpfA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758167.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 gene lpfA1 CDS 198003..198191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS complement(198193..198843) product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637074.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS 199054..199635 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188408.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 gene tag CDS 199613..200053 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619903.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS complement(200022..202355) product molybdopterin guanine dinucleotide-containing S/N-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148449.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS 202508..203170 product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747548.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS 203389..204363 product glyoxylate/hydroxypyruvate reductase GhrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804690.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 gene ghrB CDS complement(204413..205123) product DUF3053 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190524.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS 205520..205852 product HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455790.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS 206140..206352 product RNA chaperone/antiterminator CspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014594.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 gene cspA CDS 206526..207065 product copper-binding periplasmic metallochaperone CueP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047148.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 gene cueP CDS complement(207436..207921) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533908.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS complement(207909..208175) product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965889.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS complement(208374..208841) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702452.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS complement(209013..209204) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05630 note possible pseudo, internal stop codon CDS complement(209801..211870) product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291805.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 gene glyS CDS complement(211880..212791) product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168544.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 gene glyQ CDS complement(212930..213232) product YsaB family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605592.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS 213398..214393 product O-acetyltransferase WecH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182662.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 gene wecH CDS complement(214416..214769) product YiaA/YiaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340932.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS complement(214944..216398) product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000275331.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 gene xylB CDS complement(216498..217820) product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001149568.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 gene xylA CDS 218183..219361 product XylR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459824.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS complement(219422..219994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 220562..222589 product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761327.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS 222763..224013 product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144384.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 gene avtA CDS complement(224050..224523) product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078818.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS complement(224640..225440) product IclR family transcriptional regulator YiaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081338.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 gene yiaJ CDS 225670..226668 product 3-dehydro-L-gulonate 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869006.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 gene yiaK CDS 226680..227144 product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576062.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS 227168..228100 product DUF4862 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000794971.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS 228239..228712 product 2,3-diketo-L-gulonate TRAP transporter small permease YiaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832313.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 gene yiaM CDS 228715..229992 product 2,3-diketo-L-gulonate transporter large permease YiaN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301825.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 gene yiaN CDS 230004..230990 product 2,3-diketo-L-gulonate transporter substrate-binding protein YiaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776928.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 gene yiaO CDS 230994..232490 product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074072.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS 232487..233149 product 3-keto-L-gulonate-6-phosphate decarboxylase UlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089538.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 gene ulaD CDS 233142..234002 product L-ribulose-5-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244034.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS 233996..234691 product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893174.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 gene araD CDS complement(234852..235667) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891802.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS 235931..237886 product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101526.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS complement(238004..239542) product aldehyde dehydrogenase AldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183998.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 gene aldB CDS 239711..240592 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188270.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS complement(240840..242690) product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582376.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 gene selB CDS complement(242687..244078) product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200188.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 gene selA CDS complement(244177..244785) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766681.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS 245261..247177 product PTS mannitol transporter subunit IICBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093287.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 gene mtlA CDS 247398..248546 product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645390.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 gene mtlD CDS 248609..249133 product mannitol operon repressor MtlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193201.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 gene mtlR CDS complement(249143..249352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062561.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS 249643..250005 product YibL family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665687.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS 250493..251176 product DUF3251 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277586.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS 251220..255605 product trimeric autotransporter adhesin SadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079584.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 gene sadA CDS 255904..257559 product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055299.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 gene lldP CDS 257556..258332 product transcriptional regulator LldR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636695.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 gene lldR CDS 258329..259519 product FMN-dependent L-lactate dehydrogenase LldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587027.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 gene lldD CDS 259585..260058 product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932331.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 gene trmL CDS complement(260126..261130) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981551.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS 261448..262644 product L-talarate/galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218254.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS 262718..264028 product glucarate transporter GudP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234818.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 gene gudP CDS complement(264111..264932) product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112114.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 gene cysE CDS complement(265010..266029) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076596.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 gene gpsA CDS complement(266029..266496) product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003370.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 gene secB CDS complement(266540..266791) product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273795.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 gene grxC CDS complement(266878..267309) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156179.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS 267557..269101 product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116577.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 gene gpmM CDS 269111..270394 product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001214137.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 gene envC CDS 270398..271360 product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135520.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS complement(271347..272381) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798185.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS complement(272675..273700) product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645995.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 gene tdh CDS complement(273710..274906) product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213794.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 gene kbl CDS 275109..276041 product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587771.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 gene rfaD CDS 276044..277090 product ADP-heptose--LPS heptosyltransferase RfaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699210.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 gene rfaF CDS 277090..278043 product lipopolysaccharide heptosyltransferase RfaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264610.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 gene rfaC CDS 278083..279297 product O-antigen ligase RfaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958453.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 gene rfaL CDS complement(279355..280500) product lipopolysaccharide N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000591814.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS complement(280600..281409) product 3-deoxy-D-manno-oct-2-ulosonate III transferase WaaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000536021.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 gene waaZ CDS complement(281559..282257) product lipopolysaccharide core heptose(II) kinase RfaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582822.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 gene rfaY CDS complement(282280..283293) product lipopolysaccharide 1,2-glucosyltransferase RfaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000376863.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 gene rfaJ CDS complement(283311..284324) product lipopolysaccharide 3-alpha-galactosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088491.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 gene waaO CDS complement(284330..285409) product lipopolysaccharide 1,6-galactosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704702.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 gene waaB sequence03 source 1..267893 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 643..2841 product ornithine decarboxylase SpeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046082898.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 gene speF CDS 2838..4157 product putrescine-ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042659.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 gene potE CDS 4222..4707 product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070053.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS complement(4822..6462) product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974369.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 gene pgm CDS complement(6487..7029) product replication initiation negative regulator SeqA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848395.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 gene seqA CDS 7214..7984 product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000773252.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 gene ybfF CDS 8118..8411 product LexA regulated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040939.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 gene ybfE CDS 8562..9092 product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018622.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 gene fldA CDS 9374..9826 product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131699.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 gene fur CDS 9941..10867 product tricarballylate utilization LysR family transcriptional regulator TcuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423368.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 gene tcuR CDS 10965..12368 product FAD-dependent tricarballylate dehydrogenase TcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228705.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 gene tcuA CDS 12355..13494 product tricarballylate utilization protein TcuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811143.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 gene tcuB CDS 13545..14849 product tricarballylate/proton symporter TcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057014.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 gene tcuC CDS complement(14898..15230) product ChiQ/YbfN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722260.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 gene chiQ CDS complement(15280..16686) product chitoporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258803.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 gene chiP CDS complement(17347..19014) product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287188.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 gene glnS CDS complement(19225..21177) product PTS N-acetyl glucosamine transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023150.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 gene nagE CDS 21504..22304 product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237064.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 gene nagB CDS 22364..23518 product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271187.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 gene nagA CDS 23523..24743 product DNA-binding transcriptional regulator NagC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187578.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 gene nagC CDS 24790..25542 product ribonucleotide monophosphatase NagD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153143.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 gene nagD CDS 25832..27496 product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337026.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 gene asnB tRNA 27718..27794 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA 27803..27887 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 tRNA 27911..27985 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 tRNA 28021..28095 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 tRNA 28111..28187 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 tRNA 28234..28308 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 tRNA 28352..28426 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS 28745..29137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS complement(29204..30379) product 3-demethoxyubiquinol 3-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184625.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 gene ubiF CDS 30523..31947 product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519200.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 gene miaB CDS 32152..33198 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493272.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS 33195..33668 product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084477.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 gene ybeY CDS 33826..34704 product CNNM family magnesium/cobalt transport protein CorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278615.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 gene corC CDS 34724..36262 product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853074.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 gene lnt CDS 36617..37525 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588823.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS 37685..38425 product glutamate/aspartate ABC transporter permease GltJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020930.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 gene gltJ CDS 38425..39099 product glutamate/aspartate ABC transporter permease GltK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272799.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 gene gltK CDS 39099..39824 product glutamate/aspartate ABC transporter ATP-binding protein GltL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631369.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 gene gltL CDS 39941..40876 product pyrimidine-specific ribonucleoside hydrolase RihA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207423.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 gene rihA CDS 40908..42146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191774878.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS 42222..43901 product molecular chaperone HscC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367875.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 gene hscC CDS complement(43923..45395) product co-chaperone DjlC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300403.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 gene djlC CDS complement(45392..46087) product DUF1266 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030930.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS complement(46099..47532) product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786582.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS complement(47529..48236) product DUF1266 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367041.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS 48361..49356 product Sel1 family TPR-like repeat protein YbeQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578153.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 gene ybeQ CDS complement(49395..49868) product zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044885.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS complement(49961..51889) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044179.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS complement(51957..52910) product 2-keto-3-deoxygluconate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000694473.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS complement(52960..54126) product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460067.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS complement(54149..54439) product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812779.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS 54727..57309 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157907.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 gene leuS CDS 57324..57914 product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269949.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 gene lptE CDS 57914..58945 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620491.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 gene holA CDS 58947..59588 product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989126.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 gene nadD CDS complement(59563..60657) product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173241.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 gene cobD CDS 60754..61362 product adenosylcobalamin/alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241920.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS 61691..62008 product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161670.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 gene rsfS CDS 62012..62479 product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776107.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 gene rlmH CDS 62510..64411 product peptidoglycan DD-transpeptidase MrdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828701.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 gene mrdA CDS 64414..65526 product peptidoglycan glycosyltransferase MrdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131713.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 gene mrdB CDS 65537..66670 product endolytic peptidoglycan transglycosylase RlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549517.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 gene rlpA CDS 66811..68022 product D-alanyl-D-alanine carboxypeptidase DacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858714.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 gene dacA CDS 68130..68393 product DUF493 family protein YbeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850547.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 gene ybeD CDS 68493..69134 product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284017.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 gene lipB CDS 69436..70389 product YbeF family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282817.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS 70595..71560 product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042639.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 gene lipA CDS complement(71646..71849) product twin-arginine translocase subunit TatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503938.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 gene tatE CDS complement(71978..72766) product deaminated glutathione amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000959109.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS 72857..73240 product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939753.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 gene crcB CDS complement(73298..73507) product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034826.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 gene cspE CDS complement(73695..74213) product lipid IV(A) palmitoyltransferase PagP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001784638.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 gene pagP CDS 74646..76031 product anaerobic C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958619.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 gene dcuC CDS complement(76085..76765) product two-component response regulator DpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138786.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 gene dpiA CDS complement(76734..78395) product sensor histidine kinase DpiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121811.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 gene dpiB CDS 78780..79856 product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001723760.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 gene citC CDS 79853..80149 product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700679.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 gene citD CDS 80146..81054 product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622336.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS 81064..82593 product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192347.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 gene citF CDS 82597..83148 product citrate lyase holo-[acyl-carrier protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236063.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 gene citX CDS 83120..84016 product triphosphoribosyl-dephospho-CoA synthase CitG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982670.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 gene citG CDS 84054..85517 product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059033.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS 85627..86433 product ribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092588.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 gene rna CDS 86668..87078 product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089748.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 gene rnk CDS complement(87161..88399) product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646123.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS 88622..89050 product universal stress protein UspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278499.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 gene uspG CDS complement(89118..89885) product dimethyl sulfoxide reductase anchor subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417104.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS complement(89885..90442) product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250378.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS complement(90439..92718) product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064331.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS complement(92711..93271) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377438.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS complement(93604..95169) product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887645.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 gene ahpF CDS complement(95411..95974) product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052802.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 gene ahpC CDS 96415..97161 product thiol:disulfide interchange protein DsbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597117.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 gene dsbG CDS 97478..98380 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002489.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS 98546..99646 product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118148.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 note possible pseudo, frameshifted CDS 99753..100370 product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001164761.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS complement(100371..101531) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245604.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS 101658..102746 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016858.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS complement(102782..102979) product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460619.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS complement(103043..105148) product pyruvate/proton symporter CstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043112.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 gene cstA CDS complement(105330..105743) product proofreading thioesterase EntH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637966.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 gene entH CDS complement(105746..106501) product 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase EntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135726.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 gene entA CDS complement(106501..107358) product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007162.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS complement(107372..108982) product (2,3-dihydroxybenzoyl)adenylate synthase EntE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222445.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 gene entE CDS complement(108992..110167) product isochorismate synthase EntC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367601.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 gene entC CDS 110476..111432 product Fe2+-enterobactin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239614.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 gene fepB CDS complement(111495..112739) product enterobactin transporter EntS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081657.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 gene entS CDS 112850..113857 product Fe(3+)-siderophore ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277880.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 gene fepD CDS 113854..114846 product iron-enterobactin ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480067.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 gene fepG CDS 114843..115637 product iron-enterobactin ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140620.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 gene fepC CDS complement(115690..116826) product LPS O-antigen length regulator Wzz(fepE) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096767.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 gene wzz(fepE) CDS complement(117076..120960) product enterobactin non-ribosomal peptide synthetase EntF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194158.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 gene entF CDS complement(120957..121175) product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000396011.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS complement(121206..122420) product enterochelin esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656592.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 gene fes CDS 122609..124864 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034967.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS 124910..125614 product enterobactin synthase subunit EntD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001681620.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 gene entD CDS 125626..126744 product YbdK family carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196914.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS 126811..127059 product DUF1158 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682500.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS complement(127065..127406) product RamA family antibiotic efflux transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155638.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS 127695..128276 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113603.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS 128276..128644 product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348987.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS 128741..129394 product oxygen-insensitive NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355874.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 gene nfsB CDS complement(129661..131631) product autotransporter domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192421.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS 131942..133189 product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156971.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS complement(133231..134625) product phenylalanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786293.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 gene pheP CDS 134951..136126 product DNA repair ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816311.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS complement(136213..136773) product reactive chlorine resistance membrane protein RclC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362177.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 gene rclC CDS complement(136786..137022) product reactive chlorine resistance periplasmic protein RclB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922170.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 gene rclB CDS complement(137179..138504) product reactive chlorine resistance oxidoreductase RclA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195937.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 gene rclA CDS 138720..139574 product reactive chlorine-specific transcriptional regulator RclR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339629.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 gene rclR CDS complement(139625..139804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS 139913..140242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS 140481..140687 product copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445906.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 141110..141472 product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000915523.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS 141469..142395 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703607.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS complement(142606..142731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS complement(142813..143076) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS 143321..144028 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS complement(144085..144243) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS 144415..144633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07630 note possible pseudo, internal stop codon, frameshifted CDS 144810..145082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07640 note possible pseudo, internal stop codon, frameshifted tRNA complement(145176..145252) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS 145507..146103 product fimbria biosynthesis transcriptional regulator FimW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948632.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 gene fimW CDS 146268..146576 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226497.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS 146595..147317 product fimbria biosynthesis regulator FimY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258098.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 gene fimY CDS 147921..148553 product fimbria biosynthesis transcriptional regulator FimZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801270.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 gene fimZ CDS complement(148599..149117) product fimbria assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000603408.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 gene sfmF CDS complement(149127..150134) product type 1 fimbria D-mannose specific adhesin FimH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708646.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 gene fimH CDS complement(150149..152761) product fimbrial biogenesis usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754216.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS complement(152792..153505) product type 1 fimbria chaperone FimC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001764009.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 gene fimC CDS complement(153528..154061) product type 1 fimbrial protein subunit FimI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095931.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 gene fimI CDS complement(154135..154692) product type 1 fimbrial protein subunit FimA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681037.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 gene fimA CDS 155239..156105 product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729163.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 gene folD CDS 156107..156319 product ribosome-associated protein YbcJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190278.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 gene ybcJ CDS 156446..156991 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143573.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS 156984..157421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS 157418..158242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS complement(158286..159671) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912377.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 gene cysS CDS 159844..160338 product peptidylprolyl isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255991.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 gene ppiB CDS 160341..161063 product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212291.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 gene lpxH CDS 161181..161690 product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098739.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 gene purE CDS 161687..162754 product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815594.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 gene purK CDS complement(162795..163688) product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855341.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS complement(163692..164501) product DUF2877 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821188.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS complement(164513..165772) product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495330.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS complement(165782..167446) product acyl-CoA synthetase FdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580919.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS 167762..168811 product ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703940.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 gene allD CDS 168833..170068 product allantoate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589772.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 gene allC CDS 170079..170864 product (S)-ureidoglycine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540981.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 gene allE CDS complement(170944..172092) product glycerate 3-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706333.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 gene glxK CDS complement(172115..173413) product uracil/xanthine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484506.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS complement(173472..174833) product allantoinase AllB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006865.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 gene allB CDS complement(174912..176366) product putative allantoin permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401139.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS complement(176462..177709) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005062.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS complement(177775..178653) product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765818.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 gene glxR CDS complement(178754..179530) product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943597.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 gene hyi CDS complement(179543..181324) product glyoxylate carboligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096863.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 gene gcl CDS complement(181409..182227) product HTH-type transcriptional repressor AllR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141266.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 gene allR CDS complement(182306..182788) product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776388.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 gene allA CDS 183015..183941 product HTH-type transcriptional activator AllS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460171.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 gene allS CDS 184011..185105 product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154074.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 gene mnmH CDS complement(185144..185803) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342247.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS complement(185796..186812) product virulence-associated ABC transporter ATP-binding protein SfbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569655.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 gene sfbB CDS complement(186849..187679) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524312.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS complement(187936..189069) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152873.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS complement(189255..191669) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561782.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS complement(191666..192352) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110598.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS 192290..192937 product multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001010578.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 gene tesA CDS 193092..193862 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001172802.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS 193922..194776 product chaperedoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116065.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 gene cnoX CDS complement(194862..195641) product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002130.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 gene fetB CDS complement(195628..196305) product iron ABC transporter ATP-binding protein FetA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166987.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 gene fetA CDS 196452..197369 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906145.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS 197366..197818 product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561177.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS complement(197819..198235) product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026762.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 gene cueR CDS 198345..200846 product copper-exporting P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083904.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 gene copA CDS 201000..201827 product DUF1311 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488556.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS 201913..202707 product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421856.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS 202909..203388 product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186620.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 gene ybaK CDS complement(203505..205157) product bifunctional UDP-sugar hydrolase/5'-nucleotidase UshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095904.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 gene ushA CDS 205330..206550 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251598.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS 206765..208441 product YbaL family putative K(+) efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000546202.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 gene ybaL CDS complement(208490..209794) product inosine/guanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001766867.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 gene gsk CDS 209947..210918 product acetyl esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801788.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 gene aes CDS complement(210915..211877) product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250076.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 gene hemH CDS complement(212106..212750) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220237.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 gene adk CDS complement(213108..214982) product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001682145.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 gene htpG CDS complement(215093..215698) product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195023.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 gene recR CDS complement(215698..216027) product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467098.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS complement(216073..218001) product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121969.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 gene dnaX CDS complement(218115..218666) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127348.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 gene apt CDS complement(218819..219196) product DUF454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189860.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS 219277..219792 product primosomal replication protein N'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844854.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 gene priC CDS 219806..219973 product pleiotropic regulatory protein RsmS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051161.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 gene rsmS CDS 220043..220978 product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440515.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS complement(221020..224376) product mechanosensitive channel MscK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178244.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 gene mscK CDS complement(224501..225154) product multidrug efflux transporter transcriptional repressor AcrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101755.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 gene acrR CDS 225404..226489 product multidrug efflux RND transporter periplasmic adaptor subunit AcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039199.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 gene acrA CDS 226512..229661 product efflux RND transporter permease AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132507.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 gene acrB CDS 230157..230531 product Hha toxicity modulator TomB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344807.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 gene tomB CDS 230559..230777 product HHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280991.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS 230956..231507 product maltose O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278793.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 gene maa CDS 231625..232095 product YlaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136183.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS complement(232297..232557) product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801415.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS 232782..234332 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213129.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS 234563..234952 product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961285.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS complement(234985..235554) product YbaY family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779802.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS 235769..236629 product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084179.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 gene tesB CDS complement(236729..238015) product ammonium transporter AmtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684912.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 gene amtB CDS complement(238047..238385) product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780341.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 gene glnK CDS complement(238598..240379) product SmdB family multidrug efflux ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256093.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS complement(240372..242144) product SmdA family multidrug ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235563.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(242185..242643) product DNA-binding transcriptional regulator DecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884593.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 gene decR CDS 242759..243811 product cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987843.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 gene cdsH CDS complement(243861..244679) product HMP-PP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113040.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 gene cof CDS 244765..246480 product SgrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238179.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS 246545..247240 product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817201.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 gene queC CDS complement(247346..247744) product long-chain acyl-CoA thioesterase FadM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194543.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 gene fadM CDS complement(247848..248222) product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680322.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS complement(248372..250243) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969436.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 gene ppiD CDS complement(250534..250806) product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043544.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 gene hupB CDS complement(251015..253369) product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067728.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 gene lon CDS complement(253555..254826) product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130316.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 gene clpX CDS complement(255078..255701) product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122257.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 gene clpP CDS complement(255949..257247) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198406.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 gene tig CDS complement(257594..257911) product transcriptional regulator BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973433.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 gene bolA CDS 258164..258793 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001539323.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS 258837..260312 product muropeptide MFS transporter AmpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098484.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 gene ampG CDS 260765..261721 product cytochrome o ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239449.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 gene cyoA CDS 261732..263723 product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467158.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 gene cyoB CDS 263812..264327 product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179831.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS 264327..264656 product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019878.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS 264668..265558 product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971351.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 gene cyoE CDS complement(265640..267133) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08760 misc_feature complement(267145..>267893) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001297127.1:tetratricopeptide repeat protein locus_tag LOCUS_08770 sequence04 source 1..264615 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(412..2985) product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235094.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 gene clpB CDS complement(3115..3846) product purine nucleoside phosphorylase YfiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992642.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 gene yfiH CDS complement(3843..4823) product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079130.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 gene rluD CDS 4955..5692 product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197667.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 gene bamD CDS 5964..6302 product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178449.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 gene raiA CDS 6553..7713 product bifunctional chorismate mutase/prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200079.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 gene pheA CDS complement(7674..8582) product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210976.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS complement(8640..9761) product bifunctional chorismate mutase/prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225191.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 gene tyrA CDS complement(9771..10841) product 3-deoxy-7-phosphoheptulonate synthase AroF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168062.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 gene aroF CDS 11275..11799 product YfiR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212373.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS 11792..13012 product diguanylate cyclase DgcN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030993.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 gene dgcN CDS complement(13169..13516) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065257.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 gene rplS CDS complement(13557..14324) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469802.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 gene trmD CDS complement(14369..14917) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043266.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 gene rimM CDS complement(14936..15184) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256453.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 gene rpsP CDS complement(15437..16798) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460052.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 gene ffh CDS 16964..17755 product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001537507.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 17820..19061 product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519447.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS 19182..19787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS complement(19822..20574) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518875.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 gene grpE CDS 20536..21414 product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059155.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 gene nadK CDS 21500..23161 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880973.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 gene recN CDS 23310..23648 product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001203445.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 gene bamE CDS complement(23814..24104) product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112990.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS complement(24094..24531) product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242603.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS 24675..25202 product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518569.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 gene smpB CDS 25817..37291 product Ig-like domain repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237656.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS 37437..38765 product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533850.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS 38762..40942 product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196137.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS 40950..42113 product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989217.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 tmRNA 42185..42547 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(42952..44052) product phage late control D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098779.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS complement(44049..44534) product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098780.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS complement(44531..47338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS complement(47465..47767) product phage tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280965.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS complement(47822..48337) product phage major tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207653.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS complement(48347..49519) product phage tail sheath protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046101.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS complement(49622..49846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS complement(50716..51291) product tail fiber assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885577.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS complement(51291..53144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS complement(53141..53746) product phage tail protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098785.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS complement(53739..54647) product baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268327.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS complement(54634..54993) product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177408.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS complement(54990..55568) product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993749.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS 55646..56497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS complement(56499..56945) product phage virion morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343944.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS complement(56938..57369) product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039939.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS complement(57465..57893) product Rz-like lysis system protein LysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162926034.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 gene lysB CDS complement(57890..58405) product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069919.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS complement(58386..58601) product HP1 family phage holin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171565.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS complement(58605..58808) product tail protein X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868184.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS complement(58808..59272) product head completion/stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010835209.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS complement(59366..60016) product terminase endonuclease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059175.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS complement(60020..61081) product phage major capsid protein, P2 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098795.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS complement(61098..61931) product GPO family capsid scaffolding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098796.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS 62074..63840 product terminase ATPase subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098452.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS 63840..64880 product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040233361.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS complement(64984..66648) product AIPR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994298.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS complement(66962..67693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS complement(67753..67986) product DinI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217561.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS complement(67997..68185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001580533.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS complement(68338..70752) product replication endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017503.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS complement(70749..71606) product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104152.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS complement(71603..71830) product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000752613.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS complement(71830..72063) product DUF2732 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244218.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS complement(72131..72472) product DUF5347 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996717.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS complement(72644..73153) product phage regulatory CII family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460893.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS complement(73187..73429) product Rha family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102106.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS 73551..74183 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052560.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS 74186..75202 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027757.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS 75212..76417 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS 76679..77272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS 77671..78474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS 79023..79214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167337863.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS complement(79270..79893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09510 note possible pseudo, frameshifted CDS complement(80115..80381) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139109819.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS 80643..80840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS 81466..82581 product salmochelin biosynthesis C-glycosyltransferase IroB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221113.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 gene iroB CDS 82662..86318 product salmochelin/enterobactin export ABC transporter IroC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001111827.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 gene iroC CDS 86428..87672 product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239947.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS 87704..88633 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000274373.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS complement(88675..90750) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001682025.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS complement(91381..91692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS complement(91888..92940) product SPI-2 type III secretion system effector PipB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001801692.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 gene pipB2 CDS 93546..94475 product VirK family antimicrobial peptide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178741.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS complement(96387..97400) product HoxN/HupN/NixA family nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212234.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS complement(97533..98948) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872343.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS complement(98935..99609) product transcriptional regulator TctD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237936.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 gene tctD CDS 99764..100741 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098088.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS 100756..101187 product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283754.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS 101198..102712 product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382024.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS 103016..103993 product glutarate dioxygenase GlaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993092.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 gene glaH CDS 104019..105287 product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271916.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 gene lhgO CDS 105309..106757 product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176534.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 gene gabD CDS 106772..108055 product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095643.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 gene gabT CDS 108185..109585 product GABA permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531291.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 gene gabP CDS 109627..110304 product DNA-binding transcriptional regulator CsiR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126152.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 gene csiR CDS complement(110326..110775) product potassium binding protein Kbp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522413.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 gene kbp CDS complement(110875..111033) product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000508175.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS 111216..111515 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137417.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS 111525..112052 product rhodanese family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022010.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS 112131..112310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370085.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS complement(112400..112801) product DNA-binding protein StpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051100.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 gene stpA CDS 113294..113473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS 113499..113948 product L-alanine exporter AlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000492647.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 gene alaE CDS complement(113983..114333) product DUF2002 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281304.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS 114495..114821 product DUF883 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519557.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS complement(114905..116239) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138449.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS 116328..116759 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209805.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS 117031..117276 product glutaredoxin-like protein NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028873.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 gene nrdH CDS 117273..117683 product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275403.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 gene nrdI CDS 117656..119800 product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201426.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 gene nrdE CDS 119811..120770 product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777898.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 gene nrdF CDS 121331..122326 product glycine betaine/L-proline ABC transporter ATP-binding protein ProV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985490.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 gene proV note possible pseudo, frameshifted CDS 122319..123383 product glycine betaine/L-proline ABC transporter permease ProW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775015.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 gene proW CDS 123453..124448 product glycine betaine/L-proline ABC transporter substrate-binding protein ProX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216613.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 gene proX CDS 124613..125797 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165770.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS 126294..126824 product transcriptional repressor MprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378431.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 gene mprA CDS 126951..128123 product multidrug efflux MFS transporter periplasmic adaptor subunit EmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275597.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 gene emrA CDS 128140..129678 product multidrug efflux MFS transporter permease subunit EmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187289.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 gene emrB CDS complement(129727..131097) product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645128.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS complement(131443..131958) product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130191.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 gene luxS CDS complement(132108..133664) product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611827.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 gene gshA CDS complement(133741..134166) product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279499.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS complement(134163..134729) product fructose-1-phosphate/6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271296.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 gene yqaB tRNA complement(134966..135042) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 tRNA complement(135236..135312) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 tRNA complement(135375..135451) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA complement(135513..135589) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 tRNA complement(135593..135685) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS complement(135989..136174) product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906486.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 gene csrA CDS complement(136409..139039) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047238.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 gene alaS CDS complement(139275..139775) product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294863.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 gene recX CDS complement(139892..140953) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963150.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 gene recA CDS complement(141038..141535) product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132240.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 gene pncC CDS 141731..141976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS complement(142014..143093) product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476820.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 gene mltB CDS 143347..143910 product PTS glucitol/sorbitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573335.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 gene srlA CDS 143907..144878 product PTS glucitol/sorbitol transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199043.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS 144890..145252 product PTS glucitol/sorbitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111554.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 gene srlB CDS 145264..146043 product sorbitol-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077371.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 gene srlD CDS 146120..146479 product transcriptional regulator GutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255198.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 gene gutM CDS 146677..147450 product glucitol operon DNA-binding transcriptional repressor SrlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804536.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 gene srlR CDS 147443..148408 product arabinose-5-phosphate isomerase GutQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278206.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 gene gutQ CDS complement(148405..149925) product nitric oxide reductase transcriptional regulator NorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010816.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 gene norR CDS 150111..151550 product anaerobic nitric oxide reductase flavorubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025997.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 gene norV CDS 151547..152680 product NADH:flavorubredoxin reductase NorW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086352.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 gene norW CDS complement(152777..155017) product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963417.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 gene hypF CDS complement(155163..155708) product electron transport protein HydN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078791.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 gene hydN CDS complement(155909..156193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10210 note possible pseudo, frameshifted CDS complement(156237..156719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10220 note possible pseudo, frameshifted CDS complement(156746..157216) product hydrogenase maturation peptidase HycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132980.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 gene hycI CDS complement(157209..157619) product formate hydrogenlyase maturation HycH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003725.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS complement(157616..158383) product formate hydrogenlyase subunit HycG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067418.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 gene hycG CDS complement(158383..158925) product formate hydrogenlyase subunit HycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493767.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 gene hycF CDS complement(158935..160644) product formate hydrogenlyase subunit HycE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000461354.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 gene hycE CDS complement(160662..161585) product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110563.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS complement(161588..163414) product formate hydrogenlyase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097032.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 gene hycC CDS complement(163414..164022) product formate hydrogenlyase subunit HycB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079164.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 gene hycB CDS complement(164168..164629) product formate hydrogenlyase regulator HycA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158074.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 gene hycA CDS 164839..165195 product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544461.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 gene hypA CDS 165264..166136 product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337646.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 gene hypB CDS 166127..166399 product hydrogenase 3 maturation protein HypC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334871.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 gene hypC CDS 166399..167520 product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212958.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 gene hypD CDS 167517..168527 product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014343887.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 gene hypE CDS 168746..170824 product formate hydrogenlyase transcriptional activator FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122695.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 gene flhA CDS complement(170886..171230) product nitrous oxide-stimulated promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117938.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS 171412..172329 product iron/manganese ABC transporter substrate-binding protein SitA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182930.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 gene sitA CDS 172326..173147 product iron/manganese ABC transporter ATP-binding protein SitB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083163.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 gene sitB CDS 173144..174004 product iron/manganese ABC transporter permease subunit SitC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104338.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 gene sitC CDS 173995..174843 product iron/manganese ABC transporter permease subunit SitD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477918.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 gene sitD CDS complement(174942..175808) product type III secretion system YopJ family effector YopP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117648.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 gene yopP CDS complement(176011..176766) product transcriptional regulator SprB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246664.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 gene sprB CDS complement(177151..178038) product invasion transcriptional regulator HilC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000243995.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 gene hilC CDS complement(178383..178835) product type III secretion system effector protein OrgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612184.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS complement(178832..179512) product type III secretion system linker protein OrgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916657.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 gene orgB CDS complement(179469..180047) product oxygen-regulated invasion protein OrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001574876.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 gene orgA CDS complement(180040..180798) product type III secretion system inner membrane ring lipoprotein PrgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621241.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 gene prgK CDS complement(180795..181100) product type III secretion system inner rod protein PrgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020428.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 gene prgJ CDS complement(181119..181361) product type III secretion system needle filament protein PrgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143299.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 gene prgI CDS complement(181386..182450) product type III secretion system inner membrane ring protein PrgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450189.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 gene prgH CDS 182880..183809 product transcriptional regulator HilD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432696.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 gene hilD CDS 184901..186562 product transcriptional regulator HilA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120092.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 gene hilA CDS 186661..187062 product SPI-1 type III secretion system invasion protein IagB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558926.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 gene iagB CDS complement(187116..188723) product SPI-1 type III secretion system effector GTPase-activating protein SptP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000946989.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 gene sptP CDS complement(188734..189126) product chaperone SicP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147852.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 gene sicP CDS complement(189153..189413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692253.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS complement(189457..189705) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055579.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS complement(189724..191736) product SPI-1 type III secretion system effector SipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258814.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 gene sipA CDS complement(191800..192831) product SPI-1 type III secretion system needle tip complex protein SipD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932243.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 gene sipD CDS complement(192902..194131) product SPI-1 type III secretion system needle tip complex protein SipC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000909023.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 gene sipC CDS complement(194159..195940) product SPI-1 type III secretion system needle tip complex protein SipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000245782.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 gene sipB CDS complement(195943..196440) product SycD/LcrH family type III secretion system chaperone SicA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386309.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 gene sicA CDS complement(196578..197648) product SPI-1 type III secretion system export apparatus protein SpaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097721.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 gene spaS CDS complement(197635..198426) product SPI-1 type III secretion system export apparatus protein SpaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964941.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 gene spaR CDS complement(198430..198690) product SPI-1 type III secretion system export apparatus protein SpaQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342503.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 gene spaQ CDS complement(198716..199390) product SPI-1 type III secretion system export apparatus protein SpaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000526019.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 gene spaP CDS complement(199380..200291) product SPI-1 type III secretion system protein SpaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058738.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 gene spaO CDS complement(200291..201301) product SPI-1 type III secretion system protein SpaN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503113.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 gene spaN CDS complement(201301..201744) product SPI-1 type III secretion system protein SpaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000555884.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 gene spaM CDS complement(201722..203017) product SctN family type III secretion system ATPase InvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856766.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 gene invC CDS complement(203014..203421) product SPI-1 type III secretion system chaperone SpaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001164066.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 gene spaK CDS complement(203445..205502) product type III secretion system export apparatus protein InvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000927219.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 gene invA CDS complement(205527..206645) product type III secretion system gatekeeper InvE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612166.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 gene invE CDS complement(206642..208186) product type III secretion system outer membrane ring protein InvG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848103.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 gene invG CDS complement(208327..209088) product type III secretion system transcriptional activator InvF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001674874.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 gene invF CDS 209433..209876 product SPI-1 type III secretion system invasion lipoprotein InvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715096.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 gene invH CDS 210748..211029 product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855694.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS 211029..211553 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971655.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(211626..211802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS 212190..212846 product protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000420463.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 gene pphB CDS complement(213091..213585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS complement(213612..214280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS complement(214510..214662) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS complement(214854..215264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS 215422..217989 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005807.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 gene mutS CDS complement(218045..218425) product DUF4440 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703291.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS complement(218422..219630) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222405.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS 219739..220650 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216318.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS complement(220692..222188) product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202725.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS complement(222185..223135) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001165737.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS complement(223175..223951) product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136884.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS complement(223956..224594) product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153636.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS complement(224591..225853) product 3-oxo-tetronate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590392.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS complement(225847..226770) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847985.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS 226967..227731 product DNA-binding transcriptional repressor YgbI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613182.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 gene ygbI CDS complement(227750..228154) product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423338.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS 228325..228918 product non-oxidative hydroxyarylic acid decarboxylases subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001764801.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS 228918..230345 product non-oxidative hydroxyarylic acid decarboxylases subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863165.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS 230356..230592 product non-oxidative hydroxyarylic acid decarboxylases subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562964.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS complement(230637..231629) product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081498.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 gene rpoS CDS complement(231692..232546) product murein hydrolase activator NlpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272624.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 gene nlpD CDS 232665..232862 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS complement(233001..233627) product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253542.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS complement(233621..234382) product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221538.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 gene surE CDS complement(234363..235412) product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134253.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 gene truD CDS complement(235409..235888) product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219244.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 gene ispF CDS complement(235888..236598) product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741649.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 gene ispD CDS complement(236617..236928) product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517480.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 gene ftsB CDS complement(237119..237397) product DUF3561 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118109.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS complement(237493..238098) product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173663.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 gene cysC CDS complement(238085..239524) product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092273.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 gene cysN CDS complement(239534..240442) product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372384.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 gene cysD CDS 240693..241739 product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490486.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 repeat_region 241754..242331 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggtttatccccgctggcgcggggaacac CDS complement(242428..242721) product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063176.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 gene cas2e CDS complement(242721..243641) product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144875.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 gene cas1e CDS complement(243638..244288) product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281434.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 gene cas6e CDS complement(244270..245016) product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000085058.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 gene cas5e CDS complement(245027..246085) product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206445.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 gene cas7e CDS complement(246099..246653) product type I-E CRISPR-associated protein Cse2/CasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029331.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 gene casB CDS complement(246650..248206) product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084093.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 gene casA CDS complement(248218..250770) product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233965.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS 251325..252278 product SPI-1 type III secretion system effector SopD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145541.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 gene sopD CDS complement(252366..253100) product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080392.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 gene cysH CDS complement(253202..254914) product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291998.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 gene cysI CDS complement(254914..256713) product NADPH-dependent assimilatory sulfite reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210901.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 gene cysJ CDS 257137..257499 product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108313.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 gene queD CDS complement(257587..258384) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208015.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 repeat_region 258485..259183 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttatccccgctggcgcggggaacac CDS complement(259480..260151) product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199961.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 gene queE CDS complement(260287..261585) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036734.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 gene eno CDS complement(261668..263305) product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210863.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 gene pyrG CDS complement(263533..264333) product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210450.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 gene mazG sequence05 source 1..262909 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(26..523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS 971..1504 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11350 note possible pseudo, frameshifted CDS 1797..2012 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11360 note possible pseudo, frameshifted CDS complement(2026..2184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS complement(2590..2898) product CcdB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817079.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(2901..3140) product type II toxin-antitoxin system CcdA family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817080.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS complement(3249..3497) product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141823.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS complement(3574..4074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11410 note possible pseudo, internal stop codon tRNA complement(4569..4653) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS 4876..5895 product NADPH-dependent aldehyde reductase Ahr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301967.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 gene ahr CDS complement(5923..6453) product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896738.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 gene idnK CDS 6670..7701 product L-idonate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197416.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 gene idnD CDS 7726..8490 product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998695.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 gene idnO CDS 8552..9871 product gnt-II system L-idonate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128336.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 gene idnT CDS 9935..10933 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244064.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS complement(11139..12221) product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182241.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 gene lptG CDS complement(12221..13300) product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000584132.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 gene lptF CDS 13716..15227 product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397157.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 gene pepA CDS 15364..15807 product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190722.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 gene holC CDS 15807..18662 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416348.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS complement(18804..19991) product YjgN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066967.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS 20186..20689 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519079.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS 20796..20990 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11550 note possible pseudo, frameshifted CDS 20944..21285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11560 note possible pseudo, frameshifted CDS complement(21519..22283) product tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218459.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 gene miaE CDS complement(22343..22759) product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002940.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 gene rraB CDS 22925..23929 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103040.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene argF CDS complement(24003..24455) product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635207.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS 25128..26351 product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410840.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 gene arcA CDS 26362..27294 product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428744.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 gene arcC CDS 27406..28410 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237033.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 gene argF CDS 28466..29869 product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000514432.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS 30056..30544 product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666047.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS 30772..31707 product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013055.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 gene pyrB CDS 31720..32181 product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148566.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 gene pyrI CDS 32258..32644 product 2-iminobutanoate/2-iminopropanoate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047544.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 gene ridA CDS 32719..33165 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251083.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS complement(33281..35989) product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001775586.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 gene mgtA CDS 36373..37320 product trehalose operon repressor TreR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181306.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 gene treR CDS 37458..38876 product PTS trehalose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048822.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 gene treB CDS 38926..40578 product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155051.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 gene treC CDS 40987..43125 product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187820.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 gene nrdD CDS 43247..43711 product anaerobic ribonucleoside-triphosphate reductase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268860.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 gene nrdG CDS complement(43715..43999) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220578.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(43989..44231) product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212724.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS complement(44309..46222) product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989308.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS complement(46239..46979) product KDGP aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779260.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS complement(46976..48094) product DgaE family pyridoxal phosphate-dependent ammonia lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139189.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS complement(48078..49211) product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459938.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS complement(49270..49914) product DUF4310 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392129.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS complement(49926..50702) product DUF4311 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478578.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS complement(50725..51027) product DUF4312 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000975186.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS complement(51027..51389) product SFCGS family glycine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435389.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS complement(51400..51729) product glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255103.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS complement(52016..52402) product cytochrome b562 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232231.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 gene cybC CDS complement(52501..53841) product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852994.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 gene pmbA CDS 53949..54500 product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166287.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 gene yjgA CDS complement(54607..55980) product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219848.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 gene mpl CDS 56155..57153 product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853761.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 gene fbp CDS 57380..57910 product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055079.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 gene ppa CDS 58323..59483 product metallo-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977198.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS 59480..60688 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203124.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS complement(60742..61086) product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219167.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS complement(61089..64868) product autotransporter assembly complex protein TamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060812.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 gene tamB CDS complement(64865..66598) product autotransporter assembly complex protein TamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120231.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 gene tamA CDS 66811..67449 product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051467.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 gene msrA CDS 67632..68975 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934974.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS complement(69060..69266) product DUF1107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689229.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS 69593..70150 product YtfJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175301.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS complement(70140..70880) product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893400.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 gene cysQ CDS 71148..73091 product bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589381.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS complement(73149..73535) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201297.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS 73623..74471 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560623.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS 74552..75517 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623287.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS 75620..76282 product iron-sulfur cluster repair protein YtfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331469.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 gene ytfE CDS complement(76349..77737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944334.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS complement(77752..78891) product DKNYY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155542.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS complement(79229..80632) product D-serine/D-alanine/glycine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228328.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 gene cycA CDS complement(80928..81548) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001663320.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 gene fklB CDS 81768..82403 product OapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119449.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS complement(82453..83379) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381071.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS complement(83527..83976) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196065.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 gene rplI CDS complement(84018..84245) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135199.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 gene rpsR CDS complement(84250..84564) product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001768658.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 gene priB CDS complement(84571..84966) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216673.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 gene rpsF CDS 85436..85711 product DUF1471 family protein YjfY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001756165.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 gene yjfY CDS complement(85840..86526) product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170772.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS complement(86526..87380) product L-ribulose-5-phosphate 3-epimerase UlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949528.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 gene ulaE CDS complement(87390..88040) product 3-keto-L-gulonate-6-phosphate decarboxylase UlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056755.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 gene ulaD CDS complement(88054..88518) product PTS ascorbate transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776536.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 gene ulaC CDS complement(88528..88833) product PTS ascorbate transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218362.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 gene ulaB CDS complement(88849..90246) product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000404875.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 gene ulaA CDS 90609..91673 product L-ascorbate 6-phosphate lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049161.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 gene ulaG CDS 91778..92533 product HTH-type transcriptional regulator UlaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133618.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 gene ulaR CDS complement(92530..93279) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560304.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 gene yjfP CDS 93490..93792 product biofilm peroxide resistance protein BsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586831.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 gene bsmA CDS 93923..94198 product DUF1471 family protease activator YjfN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000441025.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 gene yjfN CDS complement(94243..95865) product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118984.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS complement(95950..97113) product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943948.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS complement(97116..97754) product DUF1190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085609.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS complement(97764..98162) product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547734.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS complement(98180..98839) product YjfK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090298.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS complement(98836..99906) product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037962.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS complement(99906..100604) product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511955.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS complement(100619..101023) product DUF2170 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000312608.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS complement(101156..101887) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293265.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 gene rlmB CDS complement(101978..104416) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076357.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 gene rnr CDS complement(104454..104879) product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177630.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 gene nsrR CDS complement(105087..106385) product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000527972.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 gene purA CDS complement(106488..106685) product DUF2065 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089290.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS complement(106764..107768) product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232417.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 gene hflC CDS complement(107771..109030) product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000312504.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 gene hflK CDS complement(109245..110525) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460344.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 gene hflX CDS complement(110597..110905) product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051875.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 gene hfq CDS complement(110988..111938) product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000739.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 gene miaA CDS complement(111931..113787) product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122547.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 gene mutL CDS complement(113797..115116) product N-acetylmuramoyl-L-alanine amidase AmiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640365.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 gene amiB CDS complement(115133..115594) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981984.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 gene tsaE CDS complement(115566..117113) product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968671.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 gene nnr CDS 117112..118251 product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964745.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 gene queG tRNA complement(118521..118596) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 tRNA complement(118753..118828) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 tRNA complement(118985..119060) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS 119356..120075 product arginine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922806.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(120137..120682) product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271546.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 gene orn CDS 120789..121841 product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041948.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 gene rsgA CDS 121933..122901 product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934955.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 gene asd CDS 122920..126246 product miniconductance mechanosensitive channel MscM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236760.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 gene mscM CDS complement(126313..126627) product YjeO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276180.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS complement(126679..128181) product glutamate/gamma-aminobutyrate family transporter YjeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149876.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 gene yjeM CDS complement(128407..129384) product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004789.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 gene epmA CDS 129707..131497 product fumarate reductase (quinol) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192954.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 gene frdA CDS 131490..132224 product fumarate reductase iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829507.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 gene frdB CDS 132235..132630 product fumarate reductase subunit FrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208749.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 gene frdC CDS 132641..133000 product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609650.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 gene frdD CDS 133112..133645 product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238395.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS complement(133662..133979) product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118469.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 gene sugE CDS 134284..134823 product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001763937.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS complement(134854..135000) product lipoprotein toxin entericidin B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239598.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 gene ecnB CDS complement(135108..135284) product entericidin A/B family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977686.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS complement(135303..135869) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257282.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 gene efp CDS 135910..136938 product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940490.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 gene epmB CDS 137220..138077 product YjeJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229237.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS complement(138125..138478) product DUF4156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605289.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS complement(138722..140368) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729126.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 gene groL CDS complement(140412..140705) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027827.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS 140960..142222 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989305.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS complement(142281..142757) product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267291.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 gene fxsA CDS 143098..144534 product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069440.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 gene aspA CDS 144649..145950 product anaerobic C4-dicarboxylate transporter DcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637594.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 gene dcuA CDS 146071..146418 product divalent cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887832.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 gene cutA CDS 146394..148097 product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068881.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS 148134..148709 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188506.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 tRNA 148825..148900 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS 149611..150363 product non-specific acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001785756.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS complement(150611..151102) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626103.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS complement(151099..151392) product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110456.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS 152388..153071 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921674.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS 153083..153355 product transcriptional regulator RtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269916.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 gene rtsB CDS complement(153348..153722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS 153655..153927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS complement(154440..155300) product YjiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268195.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS 155649..157049 product DUF1996 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000773796.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS complement(157133..157726) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112218.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS complement(157801..158574) product dimethyl sulfoxide reductase anchor subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544919.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS complement(158567..159193) product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211603.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 gene dmsB CDS complement(159207..161411) product DmsA/YnfE/YnfF family dimethyl sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211602.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS 161343..161552 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS 162053..163642 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682899.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS 163639..164358 product two-component system response regulator DcuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611308.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 gene dcuR CDS 164675..164941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS 165088..166428 product anaerobic C4-dicarboxylate transporter DcuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899146.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 gene dcuB CDS 166524..168170 product class I fumarate hydratase FumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037190.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 gene fumA CDS complement(168268..169698) product melibiose:sodium transporter MelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028072.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 gene melB CDS complement(169782..171134) product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001520868.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 gene melA CDS 171406..172338 product transcriptional regulator MelR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106992.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 gene melR CDS 172568..174838 product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978690.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 gene adiA CDS 175238..175897 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217076.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS 176037..177374 product arginine/agmatine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093130.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 gene adiC CDS 177508..179151 product phosphoethanolamine transferase EptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919286.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 gene eptA CDS 179148..179816 product two-component system response regulator PmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697895.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 gene pmrA CDS 179817..180896 product two-component system sensor histidine kinase PmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212189.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 gene pmrB CDS complement(181063..182565) product glycine betaine/L-proline transporter ProP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919708.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 gene proP CDS 183033..183368 product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056482.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS 183488..183931 product VOC family metalloprotein YjdN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131301.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 gene yjdN CDS 184083..184517 product aminoalkylphosphonate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602318.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 gene phnO CDS 184775..185683 product lipid A hydroxylase LpxO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457029.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 gene lpxO CDS 186038..188185 product formate dehydrogenase N subunit alpha, selenocysteine-containing inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989279.1 transl_table 11 codon_start 1 transl_except (pos:186455..186457,aa:Sec) note codon on position 140 is selenocysteine opal codon. locus_tag LOCUS_13160 CDS 188362..189051 product Sel1 family TPR-like repeat protein YjcO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803225.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 gene yjcO CDS complement(189209..190519) product glutamate/aspartate:proton symporter GltP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793283.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 gene gltP CDS complement(190428..190631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS complement(190864..191484) product heme lyase NrfEFG subunit NrfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083247.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 gene nrfG CDS complement(191481..191990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13210 note possible pseudo, internal stop codon, frameshifted CDS complement(191983..193719) product heme lyase NrfEFG subunit NrfEF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551709.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 gene nrfEF note possible pseudo, internal stop codon, frameshifted CDS complement(193712..194668) product cytochrome c nitrite reductase subunit NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199631.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 gene nrfD CDS complement(194665..195336) product cytochrome c nitrite reductase Fe-S protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278023.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 gene nrfC CDS complement(195333..195899) product cytochrome c nitrite reductase pentaheme subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115063.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 gene nrfB CDS complement(196011..197447) product ammonia-forming nitrite reductase cytochrome c552 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101783.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 gene nrfA CDS 197879..199837 product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083869.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 gene acs CDS 200083..200397 product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999620.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS 200394..202043 product cation/acetate symporter ActP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832531.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 gene actP CDS complement(202082..202771) product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067098.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS complement(202764..203174) product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257347.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS 203278..204165 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354962.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS complement(204260..205906) product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001536604.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS complement(206056..207405) product guanine/hypoxanthine transporter GhxP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106903.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 gene ghxP CDS complement(207753..208421) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958574.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS complement(208714..209172) product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412686.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 gene soxR CDS 209259..209582 product superoxide response transcriptional regulator SoxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019484.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 gene soxS CDS complement(209570..211171) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083646.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS 211734..212015 product YjcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719058.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS complement(212293..214359) product SPI-4 type I secretion system protein SiiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358570.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 gene siiF CDS complement(214399..231078) product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052484.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS complement(231095..232372) product SPI-4 type I secretion system protein SiiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081932.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 gene siiD CDS complement(232369..233688) product SPI-4 type I secretion system protein SiiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989277.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 gene siiC CDS complement(233678..235066) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875187.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS complement(235063..235695) product SPI-4 type I secretion system auxiliary protein SiiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389235.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 gene siiA CDS complement(236736..237266) product single-stranded DNA-binding protein SSB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209100.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 gene ssb1 CDS 237514..240339 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357724.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 gene uvrA CDS 240483..240926 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432193.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS 240913..241251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146604.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS complement(241252..241608) product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155664.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS complement(241611..242027) product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000270393.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS complement(242156..242869) product acid phosphatase AphA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724436.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 gene aphA CDS complement(243056..244249) product aromatic amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486904.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 gene tyrB CDS complement(244435..245514) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147297.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 gene alr CDS complement(245546..246961) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918353.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 gene dnaB CDS 247026..248009 product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235562.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS complement(248184..248426) product envelope stress response protein PspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891414.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 gene pspG CDS complement(248594..249592) product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182236.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 gene dusA CDS complement(249680..250990) product conjugal transfer protein TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039344.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS 251237..251752 product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416271.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 gene zur CDS complement(251851..252063) product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981150.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS complement(252082..252291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS complement(252192..253466) product MATE family efflux transporter DinF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128110.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 gene dinF CDS 253404..253625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS complement(253696..254304) product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646079.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 gene lexA CDS complement(254413..254781) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002902.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS 254952..257372 product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017366.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 gene plsB CDS complement(257471..258343) product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455249.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 gene ubiA CDS complement(258357..258854) product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019220.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 gene ubiC CDS complement(259035..259952) product maltose operon protein MalM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782497.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 gene malM CDS complement(260116..261474) product maltoporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973678.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS complement(261563..262672) product maltose/maltodextrin ABC transporter ATP-binding protein MalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179177.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 gene malK sequence06 source 1..232371 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(350..1030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS complement(1520..1759) product virulence protein MsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497451.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 gene msgA CDS complement(1950..2372) product RICIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001537478.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS complement(2887..3099) product cold shock-like protein CspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001537306.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 gene cspF CDS 4306..4863 product virulence membrane protein PagC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789474.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 gene pagC tRNA 5254..5330 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS complement(6085..6429) product c-type lysozyme inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977725.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS complement(7064..7237) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS 7557..8024 product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518864.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS 8363..9406 product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761737.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS complement(9489..10019) product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929974.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS complement(10168..10482) product TRL-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182479.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS 11164..12798 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000946075.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS 12795..13772 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001520270.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS 13762..14574 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966645.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS 14568..15365 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950217.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS 15359..15949 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947464.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS complement(16031..17164) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456065.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS 17358..17684 product four-helix bundle copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183698.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 tRNA 17693..17769 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS 17878..18528 product metal-binding protein ZinT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234684.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 gene zinT CDS 18637..19425 product cryptic aminoglycoside nucleotidyltransferase ANT(3'')/ANT(9) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175788.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 gene aadA CDS 19516..20163 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001787632.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS 20232..21080 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190268.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS complement(21334..21582) product biofilm/acid-resistance regulator YmgB/AriR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208085.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS 21898..22443 product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617989.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS 22640..23278 product leucine efflux protein LeuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457190.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 gene leuE CDS 23452..23814 product DUF1971 domain-containing protein YeaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248993.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 gene yeaR CDS 23817..23999 product DUF1869 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513734.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS 24229..24870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762776.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS 25184..25432 product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512149.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS 25865..26116 product DUF333 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673491.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS 26185..26496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487129.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS complement(26482..26829) product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222524.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS complement(26948..28132) product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205360.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS 28233..29027 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579795.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS complement(29007..29453) product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460698.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS complement(29763..30290) product YbaK/prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989016.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS complement(30331..31824) product diguanylate cyclase DgcJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766137.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 gene dgcJ CDS complement(32464..33750) product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219724.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS complement(33873..35807) product protein kinase YeaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001764228.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 gene yeaG CDS 36235..36981 product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163762.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS 37271..38467 product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029244.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS 38573..39421 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843742.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS complement(39520..40404) product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366147.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS 40306..40509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS complement(40733..41728) product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153505.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 gene gapA CDS 42070..42483 product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519539.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 gene msrB CDS 42525..42803 product YeaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046864.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS complement(42976..43389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS 43697..44773 product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645203.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS 44800..46179 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435315.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS 46190..47233 product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798110.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS 47255..48091 product ketose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878893.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS 48096..49043 product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309545.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS 49053..50036 product NADH-dependent methylglyoxal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723717.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 gene ydjG CDS 50166..50924 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719088.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS 51060..52418 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438819.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS complement(52521..53177) product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184700.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 gene pncA CDS complement(53204..54220) product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170143.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 gene ansA CDS complement(54316..56172) product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259874.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 gene sppA CDS 56346..56897 product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339313.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS 57015..58058 product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043069.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 gene selD CDS 58063..60012 product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235869.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 gene topB CDS complement(60042..61385) product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372866.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 gene gdhA CDS 61624..61899 product YnjH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254672.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS complement(61859..62275) product pyrimidine (deoxy)nucleoside triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592145.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS complement(62348..63154) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673954.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 gene xthA CDS 63600..64826 product bifunctional succinylornithine transaminase/acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059512.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS 64817..65851 product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001263882.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 gene astA CDS 65848..67326 product succinylglutamate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177206.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 gene astD CDS 67323..68666 product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123947.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 gene astB CDS 68659..69627 product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368452.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 gene astE CDS 69963..70448 product ATP-independent periplasmic protein-refolding chaperone Spy inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001228995.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 gene spy CDS complement(70523..71404) product excinuclease Cho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518228.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 gene cho CDS complement(71525..72352) product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174989.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 gene nadE CDS 72571..72912 product osmotically-inducible lipoprotein OsmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039301.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 gene osmE CDS 73213..73533 product PTS N,N'-diacetylchitobiose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412161.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 gene chbB CDS 73616..74974 product PTS N,N'-diacetylchitobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073015.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 gene chbC CDS 75025..75372 product PTS N,N'-diacetylchitobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459882.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 gene chbA CDS 75386..76225 product transcriptional regulator ChbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983393.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 gene chbR CDS 76350..77705 product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078788.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS 77718..78476 product chitin disaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442732.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 gene chbG CDS complement(78520..80772) product catalase HPII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019093.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 gene katE CDS 81137..81379 product cell division activator CedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977510.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 gene cedA CDS complement(81482..82873) product cystine/sulfocysteine:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001010658.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 gene tcyP CDS complement(83010..83609) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505801.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS complement(83747..84415) product hexitol phosphatase HxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106859.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 gene hxpB CDS 84564..85100 product YniB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222158.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS complement(85143..86003) product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000267686.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS complement(86110..86400) product type V toxin-antitoxin system endoribonuclease antitoxin GhoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146133.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 gene ghoS CDS complement(86496..87428) product 6-phosphofructokinase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251706.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 gene pfkB CDS 87717..88475 product YdiY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000770984.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS complement(88524..89483) product lipid A deacylase LpxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046434.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS 89626..89874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS 89936..90790 product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816806.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS complement(91475..92065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS 92106..92264 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS 93596..95524 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144226.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 gene thrS CDS 95636..96070 product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058403.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 gene infC CDS 96166..96363 product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124225.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 gene rpmI CDS 96414..96770 product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124850.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 gene rplT CDS complement(96816..96980) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS 97072..98055 product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018570.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 gene pheS CDS 98071..100458 product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672399.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 gene pheT CDS 100463..100762 product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229266.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 gene ihfA CDS 100965..101945 product vitamin B12 ABC transporter permease BtuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954986.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 gene btuC CDS 102037..102588 product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181565.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS 102588..103337 product vitamin B12 ABC transporter ATP-binding protein BtuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080607.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 gene btuD CDS 103414..103878 product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213259.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS 104192..104905 product anti-FlhDC factor YdiV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561998.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 gene ydiV CDS 104967..106409 product protein adenylyltransferase SelO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175658.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 gene selO CDS complement(106444..106635) product hemin uptake protein HemP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089115.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 gene hemP CDS complement(106792..107838) product 3-deoxy-7-phosphoheptulonate synthase AroH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082192.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 gene aroH CDS complement(107994..108827) product posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000370992.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 gene ppsR CDS 109164..111542 product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069332.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 gene ppsA CDS complement(111584..113224) product medium-chain fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302824.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 gene fadK CDS complement(113462..113755) product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081072.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS complement(113752..115038) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278481.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS complement(115095..115397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14900 note possible pseudo, internal stop codon, frameshifted CDS complement(115473..116030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14910 note possible pseudo, internal stop codon, frameshifted CDS complement(116052..116816) product electron transfer flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692160.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS 117279..118169 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284799.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS complement(118245..119396) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347850.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS complement(119410..121005) product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805700.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS complement(121159..121890) product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860197.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 gene aroD CDS complement(121962..122828) product quinate/shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383485.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 gene ydiB CDS complement(122895..124130) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296106.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS complement(124494..125705) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795534.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS complement(125846..126205) product YdiL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602304.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS complement(126663..127781) product AI-2E family transporter YdiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248612.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 gene ydiK CDS 128046..131102 product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612899.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS 131099..131509 product 1,4-dihydroxy-2-naphthoyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637930.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 gene menI CDS 131608..131796 product YdiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638607.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS complement(132084..133430) product L-cystine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000261850.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS 133857..134225 product Fe-S cluster assembly scaffold SufA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000418973.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 gene sufA CDS 134234..135721 product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089373.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 gene sufB CDS 135738..136484 product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948895.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 gene sufC CDS 136459..137730 product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907921.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 gene sufD CDS 137727..138947 product cysteine desulfurase SufS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000143859.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 gene sufS CDS 138960..139376 product cysteine desulfuration protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729470.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 gene sufE CDS 139531..140532 product L,D-transpeptidase LdtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817111.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 gene ldtE CDS complement(140598..140840) product major outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082326.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS complement(140923..141159) product murein lipoprotein Lpp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082307.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 gene lpp CDS complement(141470..142882) product pyruvate kinase PykF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000751448.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 gene pykF CDS complement(143284..144627) product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000756081.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS complement(144649..145542) product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037942.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS complement(145601..146338) product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697190.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS complement(146350..147576) product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703938.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS complement(147899..150961) product tetrathionate reductase subunit TtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002364.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 gene ttrA CDS complement(150954..151976) product tetrathionate reductase subunit TtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149765.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 gene ttrC CDS complement(151977..152711) product tetrathionate reductase subunit TtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269830.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 gene ttrB CDS 152923..154671 product tetrathionate respiration histidine kinase TtrS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816070.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 gene ttrS CDS 154646..155266 product tetrathionate respiration response regulator TtrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190927.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 gene ttrR CDS 155364..155576 product fumarate hydratase FumD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165779.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 gene fumD CDS complement(155698..156657) product transcriptional regulator MlrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060717.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 gene mlrB CDS complement(156829..157557) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122320.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS complement(157736..158374) product two component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666335.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS complement(158405..160558) product two component system sensor kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050754.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS complement(160962..161228) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS 161586..161969 product SPI-2 type III secretion system protein SpiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001738217.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 gene spiC CDS 161971..163464 product SPI-2 type III secretion system protein SpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000261287.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 gene spiA CDS 163445..164656 product SctD family type III secretion system inner membrane ring subunit SsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323784.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 gene ssaD CDS 164664..164906 product YscE family type III secretion system co-chaperone SsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210204.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 gene ssaE CDS 165112..165435 product SPI-2 type III secretion system chaperone SseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000972855.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 gene sseA CDS 165442..166032 product SPI-2 type III secretion system translocon protein SseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094422.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 gene sseB CDS 166029..166502 product SycD/LcrH family type III secretion system chaperone SscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711030.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 gene sscA CDS 166505..167959 product SPI-2 type III secretion system translocon protein SseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079758.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 gene sseC CDS 167975..168562 product SPI-2 type III secretion system translocon protein SseD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388328.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 gene sseD CDS 168565..168981 product LcrR family type III secretion system chaperone SseE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249605.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 gene sseE CDS 169036..169467 product SycD/LcrH family type III secretion system chaperone SscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979964.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 gene sscB CDS 170409..170951 product pathogenicity island 2 effector protein SseG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805847.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 gene sseG CDS 171045..171260 product type III secretion system needle filament protein SsaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350226.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 gene ssaG CDS 171238..171528 product EscG/YscG/SsaH family type III secretion system needle protein co-chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457355.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS 171525..171788 product SctI family type III secretion system inner rod subunit SsaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989174.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 gene ssaI CDS 171887..172534 product SPI-2 type III secretion system apparatus lipoprotein SsaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862869.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 gene ssaJ CDS 173097..173771 product SPI-2 type III secretion system apparatus protein SsaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011199.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 gene ssaK CDS 173761..174753 product SPI-2 type III secretion system apparatus protein SsaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238877.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 gene ssaL CDS 174811..175179 product SPI-2 type III secretion system apparatus protein SsaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383695.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 gene ssaM CDS 175164..177209 product SPI-2 type III secretion system apparatus protein SsaV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258227.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 gene ssaV CDS 177475..178500 product SctN family type III secretion system ATPase SsaN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787208.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 gene ssaN CDS 178503..178880 product SPI-2 type III secretion system apparatus protein SsaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449096.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 gene ssaO CDS 178861..179235 product SPI-2 type III secretion system apparatus protein SsaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223304.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 gene ssaP CDS 179216..180184 product SPI-2 type III secretion system cytoplasmic ring protein SsaQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944194.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 gene ssaQ CDS 180252..180899 product SPI-2 type III secretion system export apparatus protein SsaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056360.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 gene ssaR CDS 180896..181162 product SPI-2 type III secretion system apparatus protein SsaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999977.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 gene ssas CDS 181163..181942 product SPI-2 type III secretion system apparatus protein SsaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194051.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 gene ssaT CDS 181939..182997 product SPI-2 type III secretion system apparatus protein SsaU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291715.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 gene ssaU tRNA complement(183155..183231) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA complement(183242..183318) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS complement(183470..184843) product multidrug efflux MATE transporter MdtK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001175077.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS 185060..185701 product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493973.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS complement(185743..186891) product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098879.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 gene cfa CDS complement(187181..188386) product purine nucleoside transporter PunC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182326.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 gene punC CDS 188499..189431 product DNA-binding transcriptional activator PunR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269528.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 gene punR CDS complement(189428..190453) product HTH-type transcriptional repressor PurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190992.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 gene purR CDS complement(190921..191502) product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007299.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 gene sodB CDS complement(191629..192072) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS 192356..192541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS 192786..193133 product monothiol glutaredoxin 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108176.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 gene grxD CDS complement(193211..193858) product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282267.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 gene rnt CDS complement(193959..194366) product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237787.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 gene gloA CDS complement(194435..195532) product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092935.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS complement(195591..196190) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041823.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS 196583..197479 product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250718.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS 197559..198080 product superoxide dismutase [Cu-Zn] SodC2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826818.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 gene sodC2 CDS complement(198056..200095) product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777620.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS complement(200095..200955) product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016506.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS 201395..201829 product transcriptional regulator SlyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445639.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 gene slyA CDS complement(201877..202344) product outer membrane lipoprotein SlyB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597179.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 gene slyB CDS 202616..203737 product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835021.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 gene anmK CDS 203849..204154 product C-type lysozyme inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061974.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 gene mliC CDS 204213..204869 product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282834.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 gene pdxH CDS 204996..206270 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168626.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 gene tyrS CDS 206330..207190 product pyridoxal kinase PdxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789751.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 gene pdxY CDS complement(207249..207854) product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765713.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 gene gstA CDS complement(207959..209464) product dipeptide/tripeptide permease DtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100913.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 gene dtpA CDS complement(210065..210700) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030324.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 gene nth CDS complement(210700..211392) product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289628.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS complement(211395..212015) product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920820.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 gene rsxG CDS complement(212019..213077) product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000231887.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 gene rsxD CDS complement(213078..215192) product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000915582.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 gene rsxC CDS complement(215185..215763) product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092600.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 gene rsxB CDS complement(215763..216344) product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133179.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 gene rsxA CDS complement(216421..216894) product DUF2569 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214061.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS complement(216950..217165) product transcription modulator YdgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217946.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 gene ydgT CDS 217796..218836 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014343837.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS complement(218911..219912) product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565566.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 gene add CDS complement(220268..220417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15970 note possible pseudo, frameshifted CDS complement(220607..222115) product YdgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753325.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS complement(222218..223393) product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170615.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 gene manA CDS 223593..225239 product class I fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066606.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 gene fumB CDS 225407..226810 product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000259129.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 gene fumC CDS complement(226807..227736) product DNA replication terminus site-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092483.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 gene tus CDS complement(227812..229113) product two-component system sensor histidine kinase RstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732951.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 gene rstB CDS complement(229224..230924) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928668.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS complement(231083..232234) product porin OmpS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824321.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 gene ompS2 sequence07 source 1..227880 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(244..483) product oxaloacetate decarboxylase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001151.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS complement(642..1982) product citrate/sodium symporter CitS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183602.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 gene citS CDS 2281..3270 product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181444.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 gene citC CDS 3300..3593 product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691461.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 gene citD CDS 3590..4459 product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247810.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 gene citE CDS 4470..5990 product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665586.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 gene citF CDS 5990..6541 product citrate lyase holo-[acyl-carrier protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000679050.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 gene citX CDS 6519..7427 product triphosphoribosyl-dephospho-CoA synthase CitG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103241.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 gene citG CDS 7607..8428 product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544030.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 gene dapB CDS 9290..10438 product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597281.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 gene carA CDS 10457..13684 product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126321.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 gene carB CDS 13958..14353 product carnitine metabolism transcriptional regulator CaiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333324.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 gene caiF CDS complement(14431..15027) product carnitine operon protein CaiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122865.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 gene caiE CDS complement(15137..15922) product crotonobetainyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004377.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 gene caiD CDS complement(15976..17529) product crotonobetaine/carnitine-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355790.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 gene caiC CDS complement(17592..18809) product L-carnitine CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016209.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 gene caiB CDS complement(18921..20063) product crotonobetainyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347135.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 gene caiA CDS complement(20098..21615) product L-carnitine/gamma-butyrobetaine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787084.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 gene caiT CDS 22096..22866 product electron transfer flavoprotein FixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692187.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS 22882..23823 product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032189.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS 23873..25159 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287774.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS 25156..25443 product ferredoxin-like protein FixX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203737.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 gene fixX CDS 25590..26930 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136163.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS 27019..27249 product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001172089.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS 27535..27957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802644.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS complement(28181..28471) product DUF1471 family virulence protein SrfN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745961.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 gene srfN CDS 29369..31258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS 31665..32195 product glutathione-regulated potassium-efflux system oxidoreductase KefF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600696.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 gene kefF CDS 32188..34050 product glutathione-regulated potassium-efflux system protein KefC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377172.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 gene kefC CDS 34248..34727 product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624378.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 gene folA CDS complement(34833..35681) product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257211.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 gene apaH CDS complement(35692..36069) product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610896.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 gene apaG CDS complement(36072..36893) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065397.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 gene rsmA CDS complement(36890..37879) product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093001.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 gene pdxA CDS complement(37879..39165) product peptidylprolyl isomerase SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800482.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 gene surA CDS complement(39219..41579) product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000746124.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 gene lptD CDS 41833..42645 product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200595.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 gene djlA CDS complement(42740..43399) product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525195.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 gene rluA CDS complement(43411..46317) product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116972.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 gene rapA CDS complement(46491..48842) product DNA polymerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000035599.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 gene polB CDS complement(48886..49506) product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035634.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS 50024..50443 product DUF4751 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103153.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS complement(50449..51144) product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888641.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 gene araD CDS complement(51285..52787) product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151698.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 gene araA CDS complement(52798..54507) product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951805.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 gene araB CDS 54847..55692 product arabinose operon transcriptional regulator AraC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852388.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 gene araC CDS 55811..56578 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148375.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS complement(56617..57324) product thiamine ABC transporter ATP-binding protein ThiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000915973.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 gene thiQ CDS complement(57308..58918) product thiamine/thiamine pyrophosphate ABC transporter permease ThiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235645.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 gene thiP CDS complement(58894..59877) product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000915326.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 gene thiB CDS complement(60055..61713) product HTH-type transcriptional regulator SgrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139028.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 gene sgrR CDS 61806..61928 product glucose uptake inhibitor SgrT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248768.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 gene sgrT CDS 62248..62529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS complement(62583..63188) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818262.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 gene leuD CDS complement(63199..64599) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140632.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 gene leuC CDS complement(64602..65693) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042333.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 gene leuB CDS complement(65693..67264) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082813.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 gene leuA CDS 68095..69039 product transcriptional regulator LeuO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115424.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 gene leuO CDS 69448..71085 product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425609.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 gene ilvI CDS 71085..71579 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001563086.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 gene ilvN CDS 71863..72867 product catabolite repressor/activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762406.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 gene cra CDS 73473..73931 product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488291.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 gene mraZ CDS 73936..74874 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970440.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 gene rsmH CDS 74871..75236 product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625651.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 gene ftsL CDS 75252..77018 product peptidoglycan glycosyltransferase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642235.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 gene ftsI CDS 77005..78492 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775075.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 gene murE CDS 78489..79847 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626645.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 gene murF CDS 79841..80923 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964138.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 gene mraY CDS 80926..82242 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796441.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 gene murD CDS 82242..83486 product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239803.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 gene ftsW CDS 83483..84550 product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016622.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 gene murG CDS 84669..86144 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096072.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 gene murC CDS 86137..87057 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763895.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS 87059..87889 product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075728.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 gene ftsQ CDS 87886..89148 product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588463.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 gene ftsA CDS 89209..90360 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462798.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 gene ftsZ CDS 90461..91378 product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595474.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 gene lpxC CDS 91657..92154 product secA translation cis-regulator SecM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014320.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 gene secM CDS 92216..94921 product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905763.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 gene secA CDS 95073..95468 product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000736063.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 gene mutT CDS complement(95502..96491) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200039.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS 96634..97518 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001802116.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS complement(97515..97706) product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286419.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 gene yacG CDS complement(97716..98459) product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557441.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 gene zapD CDS complement(98459..99079) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270913.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 gene coaE CDS 99305..100348 product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217357.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS complement(100379..101581) product protein transport protein HofC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114107.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 gene hofC CDS complement(101571..102956) product type II secretion system protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650611.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 gene gspE CDS complement(102966..103403) product prepilin peptidase-dependent pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414989.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 gene ppdD CDS complement(103625..104518) product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135134.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 gene nadC CDS 104606..105169 product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936326.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 gene ampD CDS 105166..106020 product beta-lactamase regulator AmpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172040.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 gene ampE CDS complement(106112..107062) product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024772.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS complement(107062..108468) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357550.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS complement(108632..110002) product aromatic amino acid transporter AroP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969487.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 gene aroP CDS 110568..111332 product pyruvate dehydrogenase complex transcriptional repressor PdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331771.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 gene pdhR CDS 111492..114155 product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003851.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 gene aceE CDS 114170..116053 product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963602.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 gene aceF CDS 116255..117679 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519338.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 gene lpdA CDS 117968..118252 product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765363.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS complement(118290..119081) product DUF2950 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757452.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS complement(119094..120716) product DUF3300 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174529.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS 121105..123702 product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888954.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 gene acnB CDS complement(124624..124947) product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122463.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS 125218..125580 product protein YacL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384314.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 gene yacL CDS 125815..126768 product 2-keto-3-deoxygluconate permease 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001022089.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS 126765..128036 product D-threonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783298.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS 128026..129009 product D-threonate 4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448742.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS 129019..129786 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678254.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS complement(129816..130610) product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734279.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 gene speD CDS complement(130631..131491) product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829972.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 gene speE CDS complement(131598..131984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS 132147..133757 product multicopper oxidase CueO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000946058.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 gene cueO CDS complement(133835..136189) product pyrroloquinoline quinone-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829735.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS 136431..136967 product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683333.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 gene hpt CDS complement(137025..137639) product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651585.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 gene can CDS 137796..138722 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150644.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS 138719..139489 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983419.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS complement(139609..140673) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301944.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS complement(140697..143243) product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097475.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS complement(143270..143953) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097474.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS complement(144001..144540) product type 1 fimbrial major subunit FimA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369870.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 gene fimA CDS 144910..145350 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901966.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS 145418..146641 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000245304.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS complement(146648..147028) product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621526.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 gene panD CDS complement(147123..147977) product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905353.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 gene panC CDS complement(148103..148894) product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043003.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 gene panB CDS complement(149015..149494) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150775.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 gene folK CDS complement(149491..150855) product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204100700.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 gene pcnB CDS complement(151050..151991) product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001763945.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 gene gluQRS CDS complement(152015..152470) product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001155232.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 gene dksA CDS complement(152647..153351) product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899414.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 gene sfsA CDS complement(153368..153898) product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294175.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 gene thpR CDS 153926..156400 product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938517.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 gene hrpB CDS 156541..159063 product bifunctional glycosyl transferase/transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918132.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 gene mrcB CDS 159356..161599 product ferrichrome porin FhuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124438.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 gene fhuA CDS 161648..162445 product Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157197.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 gene fhuC CDS 162445..163335 product Fe(3+)-hydroxamate ABC transporter substrate-binding protein FhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208784.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 gene fhuD CDS 163332..165389 product Fe(3+)-hydroxamate ABC transporter permease FhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088086.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 gene fhuB CDS 166326..166886 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032645.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS 166972..169629 product outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181237660.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS 169647..170399 product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281615.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS 170418..170930 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178263.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS 170927..171403 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822649.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS 171403..171933 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050120.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS 172002..172772 product StfH/YfcO family fimbrial adhesin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602831.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS complement(172880..174160) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045264.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 gene hemL CDS 174330..175751 product H(+)/Cl(-) exchange transporter ClcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845433.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 gene clcA CDS 175833..176177 product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278668.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 gene erpA CDS complement(176278..176901) product TRIC cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964234.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS complement(176938..177738) product vitamin B12 ABC transporter substrate-binding protein BtuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118833.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 gene btuF CDS complement(177731..178429) product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689821.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 gene mtnN CDS 178514..180031 product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146450.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 gene dgt CDS 180161..181588 product serine endoprotease DegP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753959.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 gene degP CDS 181741..182898 product DNA-binding transcriptional regulator CdaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929458.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 gene cdaR CDS complement(182955..185987) product putative mucin/carbohydrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704442.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS complement(186173..186559) product DUF3461 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272193.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS 186806..188107 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484585.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS complement(188144..188968) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186669.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 gene dapD CDS complement(188998..191670) product bifunctional uridylyltransferase/uridylyl-removing protein GlnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094518.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 gene glnD CDS complement(191908..192702) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018214.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 gene map CDS 193153..193878 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246886.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 gene rpsB CDS 194064..194987 product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808106.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 gene tsf CDS 195132..195857 product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224567.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 gene pyrH CDS 196004..196561 product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622423.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 gene frr CDS 196702..197898 product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811892.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 gene ispC CDS 198280..198969 product (2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947409.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 gene ispU CDS 198982..199839 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922422.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 gene cdsA CDS 199851..201203 product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949016.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 gene rseP CDS 201235..203649 product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240921.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 gene bamA CDS 203772..204257 product molecular chaperone Skp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758966.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 gene skp CDS 204261..205286 product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139265.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 gene lpxD CDS 205392..205847 product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210741.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 gene fabZ CDS 205851..206639 product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566033.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 gene lpxA CDS 206639..207787 product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741216.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 gene lpxB CDS 207784..208380 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569412.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 gene rnhB CDS 208404..211886 product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294828.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 gene dnaE CDS 211899..212858 product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055753.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 gene accA CDS 213038..214801 product chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524168.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS 214877..217018 product lysine decarboxylase LdcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021059.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 gene ldcC CDS 217074..217463 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901086.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS 217526..218818 product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210062.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 gene tilS CDS complement(218902..219162) product Rho-binding antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062330.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 gene rof CDS complement(219149..219349) product YaeP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518678.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS 219547..220092 product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185319.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS 220089..220511 product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560526.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 gene arfB CDS 220543..221244 product envelope stress response activation lipoprotein NlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000252574.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 gene nlpE CDS complement(221318..223036) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260683.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 gene proS CDS complement(223147..223854) product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093978.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 gene tsaA CDS complement(223851..224204) product Rcs stress response system protein RcsF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202315.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 gene rcsF CDS complement(224374..225189) product methionine ABC transporter substrate-binding lipoprotein MetQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000874217.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 gene metQ CDS complement(225228..225881) product methionine ABC transporter permease MetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287483.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS complement(225874..226905) product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594016.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 gene metN CDS 227095..227661 product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140158.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 gene gmhB sequence08 source 1..201977 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 424..1362 product transcriptional regulator TdcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094904.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 gene tdcA CDS 1460..2449 product bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548373.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 gene tdcB CDS 2470..3801 product threonine/serine transporter TdcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020078491.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 gene tdcC CDS 3868..5076 product propionate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001859.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 gene tdcD CDS 5110..7404 product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867312.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 gene pflB CDS 7474..8838 product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622070.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 gene tdcG CDS 9153..10484 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401598.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS 10510..11820 product serine dehydratase subunit alpha family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000463069.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS complement(11933..12097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS complement(12121..12822) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633552.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS 12927..13823 product DNA-binding transcriptional regulator YhaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041028.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 gene yhaJ CDS complement(13862..14227) product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384139.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS complement(14351..15337) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531164.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS complement(15405..15797) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000603920.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS complement(16045..16344) product YqjK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095496.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS complement(16341..16739) product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785626.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS complement(16742..17047) product YqjD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031219.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS complement(17089..17457) product DUF1090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877297.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS complement(17602..17985) product EnvZ/OmpR regulon moderator MzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917516.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 gene mzrA CDS complement(17989..18651) product DedA family general envelope maintenance protein YqjA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422141.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 gene yqjA CDS complement(19101..20345) product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235369.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 gene sstT CDS complement(20600..21568) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098834.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS complement(21839..22837) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617687.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS complement(22926..23558) product vancomycin high temperature exclusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951045.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS complement(23770..24267) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202966.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS 24353..25489 product 23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019992.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 gene rlmG CDS complement(25570..27588) product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121488.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 gene fadH CDS complement(27759..29048) product putrescine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001536702.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 gene ygjG CDS 29568..31088 product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094656.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS 31455..33044 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478457.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS complement(33041..33685) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983441.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS 33920..34687 product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213683.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 tRNA complement(34767..34842) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS 34968..35474 product G/U mismatch-specific DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237776.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 gene mug CDS complement(35598..37580) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519776.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 gene rpoD CDS complement(37595..39340) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918867.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 gene dnaG CDS complement(39575..39790) product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144069.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 gene rpsU CDS 40018..41031 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264383.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 gene tsaD CDS 41055..41234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS complement(41281..41892) product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272784.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 gene plsY CDS 41996..42358 product bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001540933.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 gene folB CDS 42456..43277 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281933.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 gene bacA CDS complement(43381..44622) product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708457.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS complement(44685..45299) product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125344.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS 45541..46842 product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046233.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS 46960..49803 product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188297.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 gene glnE CDS 49851..51284 product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867682.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 gene hldE CDS complement(51743..53422) product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342894.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS complement(53441..54061) product DUF1449 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171735.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS 54319..54528 product cell surface composition regulator GlgS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928927.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 gene glgS CDS complement(54603..54899) product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001537605.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS 55336..55989 product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076978.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 gene ribB CDS complement(56268..56837) product protein-disulfide oxidoreductase DsbI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345576.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 gene dsbI note possible pseudo, internal stop codon CDS complement(56852..57523) product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096232.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS complement(57543..59339) product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460261.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS 59739..59915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469259.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS complement(59982..60755) product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115874.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 gene zupT CDS 60896..61684 product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000245226.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 gene ygiD CDS complement(61746..62909) product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442833.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS complement(62915..63490) product DUF1190 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831528.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS complement(63799..65268) product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001663008.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 gene tolC CDS 65475..66107 product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001231952.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 gene nudF CDS 66104..66526 product DUF1249 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833403.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS 66551..67378 product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444734.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 gene cpdA CDS 67378..67959 product esterase YqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105725.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 gene yqiA CDS 67987..69879 product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195318.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 gene parE CDS complement(70004..70318) product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958587.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS complement(70350..70931) product NADPH:quinone oxidoreductase MdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065430.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 gene mdaB CDS complement(71038..72387) product quorum sensing histidine kinase QseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779337.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 gene qseC CDS complement(72384..73043) product quorum sensing response regulator transcription factor QseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221574.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 gene qseB CDS 73195..73587 product YgiW/YdeI family stress tolerance OB fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000731552.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS 73659..74525 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998802.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS 74636..76894 product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281905.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 gene parC CDS 77151..77888 product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965730.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 gene plsC CDS 77962..79374 product cell division protein FtsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010658.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 gene ftsP CDS complement(79419..80726) product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345269.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS complement(80737..81219) product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259757.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS complement(81261..82244) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645961.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS 82732..84903 product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274469.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS 85106..85300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS complement(85458..85913) product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128238.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS complement(85958..87412) product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818491.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS complement(87609..88436) product 2,5-didehydrogluconate reductase DkgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013149.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 gene dkgA CDS complement(88542..89705) product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787713.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 gene yqhD CDS 89880..90797 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759292.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS complement(90861..91520) product DedA family general envelope maintenance protein YghB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268441.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 gene yghB CDS complement(91660..92847) product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130268.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 gene metC CDS 93099..93833 product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000527859.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 gene exbB CDS 93840..94265 product TonB system transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251476.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 gene exbD CDS complement(94378..95262) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019040.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS complement(95386..95790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098710.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS complement(95777..96187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936453.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS 96291..96794 product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433046.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS 97074..97568 product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439337.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS 97875..99518 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098705.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS 99603..99890 product DUF2623 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059119.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS 100080..101198 product hydrogenase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145429.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 gene hybO CDS 101201..102187 product hydrogenase 2 operon protein HybA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081721.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 gene hybA CDS 102177..103355 product Ni/Fe-hydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017676.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 gene hybB CDS 103352..105055 product hydrogenase 2 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083046.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 gene hybC CDS 105055..105549 product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221964.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS 105542..106030 product hydrogenase-2 assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004951.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 gene hybE CDS 106023..106364 product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544945.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 gene hypA CDS 106392..106640 product hydrogenase maturation factor HybG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334887.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 gene hybG CDS 106716..107768 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032012.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS 107765..108478 product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220944.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS complement(108546..109412) product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774864.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 gene yghU CDS 109639..111495 product bifunctional glutathionylspermidine amidase/synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033690.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 gene gss CDS 112165..113220 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000475254.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS complement(113520..114932) product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190176.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 gene uxaC CDS complement(114944..116416) product fructuronate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437132.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS complement(116527..117711) product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815487.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 gene uxuA CDS 118116..119420 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784371.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS 119816..120694 product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137806.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS 120733..121656 product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540892.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS 122382..122867 product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000338756.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS 122870..123247 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS complement(123383..124867) product NAD-dependent phenylacetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286412.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS 125029..126330 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092814.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS 126345..126719 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704675.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS 126928..128427 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000475953.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS 128405..128962 product DUF3156 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100106.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS complement(129066..129749) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275352.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS 130261..131445 product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704668.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS 131514..133253 product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704667.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS complement(133301..134179) product itaconate degradation transcriptional regulator RipR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212067.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 gene ripR CDS 134271..135113 product itaconate degradation C-C-lyase RipC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212068.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 gene ripC CDS 135137..135664 product (R)-specific enoyl-CoA hydratase RipB/Ich inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212069.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 gene ripB CDS 135689..137014 product itaconate CoA-transferase RipA/Ict inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212070.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 gene ripA CDS 137025..137459 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208236.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 tRNA complement(137618..137693) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS complement(137799..138506) product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234466.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS 138940..141066 product ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839779.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 gene speC CDS complement(141128..142132) product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049802.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 note possible pseudo, frameshifted CDS complement(142090..142383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19320 note possible pseudo, frameshifted CDS complement(142600..143685) product membrane-bound lytic murein transglycosylase MltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976289.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 gene mltC CDS complement(143798..144073) product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091706.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS complement(144101..145153) product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148958.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 gene mutY CDS 145308..146027 product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786887.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 gene trmB CDS 146027..146353 product YggL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107559.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS 146403..147122 product DUF2884 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000984827.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS 147311..148357 product L-asparaginase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394189.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 gene ansB CDS 148490..149497 product DUF1202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000252198.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS complement(149588..150724) product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096530.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 gene hemW CDS complement(150717..151310) product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174773.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS complement(151318..151608) product DUF167 family protein YggU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277205.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 gene yggU CDS complement(151605..152171) product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094848.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS complement(152190..152894) product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997790.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS 152912..153892 product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055657.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS 154024..154710 product global regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098333.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS complement(154757..155173) product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285491.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 gene ruvX CDS complement(155173..155736) product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053167.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS complement(155952..156899) product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593242.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 gene gshB CDS complement(156919..157650) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001800534.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 gene rsmE CDS complement(157727..158434) product deoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286121.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 gene endA CDS complement(158530..158985) product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856775.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS complement(159106..160500) product galactose/proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113171.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 gene galP CDS 160455..160634 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS complement(160993..162147) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062140.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 gene metK CDS 162221..162502 product protein YqgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305310.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 gene yqgD CDS 163015..164913 product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278580.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 gene speA CDS 165058..165789 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758897.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS 165994..166743 product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438650.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS 167966..169438 product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640209.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS 169441..170457 product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853929.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS 170471..171478 product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214544.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS 171517..172011 product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209301.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS 172345..173160 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531321.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS 173365..174285 product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105550.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 gene speB CDS complement(174386..175144) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701830.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS 175420..177411 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098658.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 gene tkt CDS complement(177455..178111) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956919.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS complement(178105..178788) product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001520421.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 CDS complement(178770..179477) product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553271.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 CDS complement(179478..180056) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124001.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS complement(180082..180507) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218564.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS 180881..181927 product erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218338.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 gene epd CDS 181949..183112 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111274.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 gene pgk CDS 183214..184293 product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034386.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 gene fbaA CDS 184526..185386 product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389833.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS 185587..186222 product arginine exporter ArgO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626880.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 gene argO CDS 186316..187062 product oxidative stress defense protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669854.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS complement(187328..188221) product DNA-binding transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828344.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 gene argP CDS 188375..189034 product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189741.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 gene rpiA CDS 189250..190533 product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151621.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 gene serA CDS complement(190914..191462) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621084.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS complement(191756..192085) product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276011.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 gene zapA CDS 192252..192830 product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027229.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS 192856..194172 product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193684.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 gene pepP CDS 194169..195347 product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111142.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 gene ubiH CDS 195473..196675 product FAD-dependent 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192154.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 gene ubiI CDS 197130..198224 product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068738.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 gene gcvT CDS 198250..198639 product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295377.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 gene gcvH CDS 198802..201675 product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194962.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 gene gcvP sequence09 source 1..172562 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 564..2222 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989106.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS 2224..2910 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377415.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS complement(2932..3852) product ribonucleoside hydrolase RihC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127280.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 gene rihC CDS complement(3868..4110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19950 note possible pseudo, frameshifted CDS complement(4076..5071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516332.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 note possible pseudo, frameshifted CDS complement(5271..6221) product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166426.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 gene ispH CDS complement(6224..6673) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047269.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 gene fkpB CDS complement(6828..7328) product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042743.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 gene lspA CDS complement(7328..10198) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989105.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 gene ileS CDS complement(10207..11145) product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767311.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 gene ribF CDS 11474..11737 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518655.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 gene rpsT CDS 12193..13566 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989104.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS 13606..15645 product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116444.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS complement(15700..16599) product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062872.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 gene nhaR CDS complement(16661..17827) product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681337.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 gene nhaA CDS complement(17990..19705) product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094796.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS complement(19832..21079) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494928.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS complement(21104..22294) product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971151.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS complement(22393..23886) product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831876.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS 24480..25241 product outer membrane protein OmpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791535.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS 25349..26911 product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262866.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS complement(26957..28675) product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001035853.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS 29198..29638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS complement(29646..30650) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247397.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS 31012..31461 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250363.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS complement(31561..31848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839835.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS complement(31887..32732) product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291399.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS complement(32796..33431) product fimbrial chaperone BcfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135039.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 gene bcfG CDS complement(33493..34011) product fimbrial protein BcfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243237.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS complement(34027..34572) product fimbrial protein BcfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082042.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS complement(34573..35580) product fimbrial protein BcfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701249.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS complement(35581..38202) product fimbrial biogenesis usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123830139.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS complement(38207..38893) product fimbrial biogenesis chaperone BcfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742560.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 gene bcfB CDS complement(38994..39536) product fimbrial protein BcfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743355.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS complement(39966..40658) product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738610.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS complement(40951..43947) product chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704341.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS complement(44039..46138) product glycosyl hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235792.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS 46519..46962 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860681.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS 46979..47512 product glycoside hydrolase family 108 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068133.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS complement(47573..47917) product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026890.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS complement(48044..48991) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534904.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS complement(49272..50411) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119009.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 gene dnaJ CDS complement(50497..52413) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516126.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 gene dnaK CDS 52762..53166 product DUF2541 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258093.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS 53202..53915 product acidic protein MsyB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103477.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 gene msyB CDS 54065..54631 product acetate uptake transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528527.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 gene satP CDS complement(54688..55278) product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094677.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 gene mog CDS complement(55389..56342) product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130175.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 gene tal CDS 56611..58041 product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113816.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS 58120..58893 product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906171.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 gene yaaA CDS complement(58987..60273) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781103.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 gene thrC CDS complement(60277..61206) product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241685.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 gene thrB CDS complement(61208..63670) product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264731.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 gene thrA CDS complement(64031..64717) product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266768.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS 65353..66069 product two-component system response regulator ArcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194359.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 gene arcA CDS 67035..67706 product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811633.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS 68045..68590 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000482234.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS 68661..69344 product fimbrial biogenesis chaperone SthA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680527.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 gene sthA CDS 69519..71927 product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097475.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS 71945..72502 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056988.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS 72543..73628 product type 1 fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703282.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS complement(73686..75035) product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920380.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 gene creD CDS complement(75093..76517) product two-component system sensor histidine kinase CreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219536.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 gene creC CDS complement(76517..77206) product two-component system response regulator CreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187043.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 gene creB CDS complement(77219..77707) product protein CreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875811.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 gene creA CDS 77904..78773 product MDR efflux pump AcrAB transcriptional activator RobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371679.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 gene robA tRNA complement(79013..79106) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS 79268..79414 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS 79466..79981 product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001341279.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 gene yjjX CDS complement(80083..80409) product trp operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192005.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 gene trpR CDS complement(80467..82404) product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014343943.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 gene sltY CDS 82613..84280 product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046772.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 gene ettA CDS complement(84398..85630) product multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001532645.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 gene nadR CDS complement(85781..87163) product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029720.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 gene radA CDS complement(87247..88215) product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132983.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 gene serB CDS 88332..88976 product YtjB family periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090067.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS 89010..90026 product lipoate--protein ligase LplA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209755.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 gene lplA CDS complement(90031..91359) product type II toxin-antitoxin system HipA family toxin YjjJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293112.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 gene yjjJ CDS complement(91538..92257) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224864.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 gene deoD CDS complement(92467..93690) product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816454.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 gene deoB CDS complement(93742..95064) product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477838.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 gene deoA CDS complement(95188..95967) product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031624265.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 gene deoC CDS 96227..97777 product YjjI family glycine radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001111683.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS 98025..98612 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS complement(98645..99418) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119010.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS complement(99415..100488) product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531551.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS complement(100612..100773) product DUF1328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490276.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS complement(100902..101519) product molecular chaperone OsmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178963.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 gene osmY CDS complement(101921..103510) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175968.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 gene prfC CDS complement(103602..104282) product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978805.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 gene yjjG CDS complement(104301..104804) product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092432.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 gene rimI CDS complement(104692..105129) product DNA polymerase III subunit psi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203999.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS 105232..106260 product 16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272292.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 gene rsmC tRNA 106451..106537 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 tRNA 106565..106651 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 tRNA 106683..106769 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS complement(106801..107037) product DUF1435 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941878.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS 107438..108352 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211217.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS 108473..109261 product siderophore-iron reductase FhuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331545.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 gene fhuF CDS 109420..109878 product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058267.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS complement(109929..110552) product DNA-binding transcriptional activator BglJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431550.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 gene bglJ CDS complement(110564..111289) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936654.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS 112002..112778 product threonine/serine exporter ThrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989102.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS 112769..113242 product threonine/serine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511327.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS 113335..113874 product primosomal protein DnaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098578.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 gene dnaT CDS 113877..114614 product DNA replication protein DnaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799923.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 gene dnaC CDS 114672..115133 product DUF2501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090314.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS 115416..117707 product phosphatidylglycerol--membrane-oligosaccharide glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292715.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 gene opgB CDS complement(117841..118851) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236585662.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS complement(118869..119927) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016539.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS complement(119940..120788) product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002401797.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS complement(120766..121545) product PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357107.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS complement(121571..122032) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287114.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS complement(122047..122469) product PTS mannose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287112.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS complement(122571..125336) product sigma-54-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287111.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS complement(125659..127320) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919571.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 gene tsr CDS 127687..129837 product pyruvate/proton symporter BtsT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379928.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 gene btsT CDS 129932..130135 product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460616.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 CDS 130146..131102 product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187846.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 gene yjiA CDS complement(131177..131479) product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063142.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS complement(131466..131753) product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131963.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS 132191..134032 product nuclease-related domain-containing DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263035.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS 134475..134645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS 134645..135220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS 135651..136478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS complement(136510..136644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS 136763..137209 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS 137181..137648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS 137597..137935 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21160 note possible pseudo, frameshifted CDS 137999..139618 product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257681.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS 139608..140912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS 141007..144273 product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858356.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS 144437..145357 product DUF5655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554540.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS complement(145434..145598) product DUF1127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704272.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS complement(145803..147173) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095438.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS complement(147354..148307) product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749985.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS 148786..150027 product multidrug efflux MFS transporter MdtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188918.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 gene mdtM CDS 150114..151385 product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033044.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS 151605..152789 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233270.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS 153122..153304 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS 153662..154333 product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068750.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS 154330..154791 product YjiG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211979.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS 154804..155976 product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113054.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 gene iadA CDS 156095..157003 product hypochlorite stress DNA-binding transcriptional regulator HypT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383509.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 gene hypT CDS complement(157009..157743) product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683258.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS complement(157982..158428) product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907666.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS 159230..160243 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094618.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 gene trpS CDS complement(160244..160969) product Uxu operon transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841652.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 gene uxuR CDS 161514..162032 product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588705.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS complement(162049..162417) product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001796324.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS complement(162715..163626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000556762.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS 164640..164831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS 165074..165331 product YjhX family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054380.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS 165342..166967 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979786.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS 167527..168243 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000532938.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS complement(168723..169433) product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199879.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 note possible pseudo, internal stop codon CDS complement(169434..169598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21440 note possible pseudo, internal stop codon CDS complement(170067..170402) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21450 note possible pseudo, internal stop codon CDS 170466..170702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS complement(170686..170964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21470 note possible pseudo, frameshifted CDS complement(171227..172072) product YjiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490324.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS complement(172123..172308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21490 sequence10 source 1..171325 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1031..2032) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989202.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS complement(2034..3317) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001228890.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS complement(3403..4419) product CDP-paratose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000770936.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS complement(4416..5240) product CDP-paratose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697757.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS complement(5292..6605) product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126347.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 gene rfbH CDS complement(6632..7711) product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565909.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 gene rfbG CDS complement(7716..8489) product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648783.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 gene rfbF CDS complement(8505..9479) product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018226.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS complement(9485..10036) product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973711.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 gene rfbC CDS complement(10037..10921) product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857536.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 gene rfbA CDS complement(10963..11862) product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023656.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 gene rfbD CDS complement(11862..12947) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697846.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 gene rfbB CDS complement(13324..14217) product GalU regulator GalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981469.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 gene galF CDS complement(14395..15798) product colanic acid biosynthesis protein WcaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001111852.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 gene wcaM CDS complement(15809..17029) product colanic acid biosynthesis glycosyltransferase WcaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868505.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 gene wcaL CDS complement(17026..18306) product colanic acid biosynthesis pyruvyl transferase WcaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097868.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 gene wcaK CDS complement(18328..19806) product colanic acid undecaprenyl disphosphate flippase WzxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058696.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 gene wzxC CDS complement(19908..21302) product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183160.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 gene wcaJ CDS complement(21356..22726) product colanic acid biosynthesis phosphomannomutase CpsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164216.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 gene cpsG CDS complement(22837..24273) product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605946.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 gene cpsB CDS complement(24276..25499) product colanic acid biosynthesis fucosyltransferase WcaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699650.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 gene wcaI CDS complement(25496..25969) product GDP-mannose mannosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001688181.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS complement(25972..26937) product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041701.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS complement(26940..28061) product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048162.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 gene gmd CDS complement(28085..28639) product colanic acid biosynthesis acetyltransferase WcaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153597.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 gene wcaF CDS complement(28655..29401) product colanic acid biosynthesis glycosyltransferase WcaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480132.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 gene wcaE CDS complement(29414..30628) product colanic acid polymerase WcaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107842.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 gene wcaD CDS complement(30603..31820) product colanic acid biosynthesis glycosyltransferase WcaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023824.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 gene wcaC CDS complement(31817..32305) product colanic acid biosynthesis acetyltransferase WcaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888724.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 gene wcaB CDS complement(32308..33150) product colanic acid biosynthesis glycosyltransferase WcaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097880.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 gene wcaA CDS complement(33237..35396) product tyrosine-protein kinase Wzc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137223.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 gene wzc CDS complement(35393..35842) product low molecular weight protein-tyrosine-phosphatase Wzb inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000482225.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 gene wzb CDS complement(35848..36903) product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978074.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS 37662..39242 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454718.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS complement(39328..41184) product outer membrane assembly protein AsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252274.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 gene asmA CDS complement(41223..41804) product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234783.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 gene dcd CDS complement(41895..42536) product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132082.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 gene udk CDS 42867..45857 product MASE1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042960.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS complement(45825..46694) product DNA-3-methyladenine glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494720.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 gene alkA CDS 46828..48180 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469615.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 gene yegD CDS 48621..49862 product multidrug efflux RND transporter subunit MdtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678826.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 gene mdtA CDS 49862..52984 product multidrug efflux RND transporter permease subunit MdtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197813.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 gene mdtB CDS 52985..56065 product multidrug efflux RND transporter permease subunit MdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001210089.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 gene mdtC CDS 56062..57474 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134351.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS 57474..58877 product two-component system sensor histidine kinase BaeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870082.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 gene baeS CDS 58874..59596 product two-component system response regulator BaeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137847.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 gene baeR CDS complement(59985..60152) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS 60183..61067 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989040.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS 61067..61783 product DUF1266 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498586.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS 61794..63905 product DUF4034 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434232.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS 64021..65382 product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001517981.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 gene yegQ CDS complement(66021..66437) product CesT family type III secretion system chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287291.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS 67456..68355 product lipid kinase YegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273393.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 gene yegS CDS complement(68408..69460) product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000129590.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 gene fbaB CDS 69714..70985 product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858692.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS 70982..71986 product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642789.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 CDS 71983..72948 product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012656.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS complement(72922..73668) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434062.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS complement(73704..74504) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188955.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 gene thiD CDS complement(74491..75288) product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182157.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 gene thiM CDS complement(75387..75572) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS 75698..76012 product Ni(II)/Co(II) efflux transporter accessory subunit RcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837534.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 gene rcnB CDS complement(76056..77078) product putative fimbrial-like adhesin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702202.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS complement(77094..79580) product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000945390.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS complement(79609..80289) product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677183.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS complement(80351..80884) product fimbrial protein YehD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830686.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 gene yehD CDS complement(81163..81444) product YehE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760404.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS complement(81722..82831) product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005426.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 gene apbC CDS 82996..85029 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195338.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 gene metG CDS 85270..85728 product YehR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703137.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 CDS 85900..86430 product YehR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197951.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS complement(86487..87011) product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950413.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 CDS complement(87001..87720) product two-component system response regulator BtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598632.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 gene btsR CDS complement(87717..89402) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272839.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS 89625..90356 product HTH-type transcriptional regulator MlrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240415.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 gene mlrA CDS complement(90504..91235) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824854.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 CDS complement(91219..92166) product glycine betaine ABC transporter ATP binding protein YehX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569315.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 gene yehX CDS complement(92159..93328) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278105.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS complement(93332..94249) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155871.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS complement(94430..96727) product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871556.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 gene bglX CDS 96994..98724 product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095234.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 gene dld CDS complement(98783..99730) product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001319943.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 gene pbpG CDS complement(99896..100483) product Yip1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017057.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS 100642..101211 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000930540.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS complement(101260..102021) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169612.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS complement(102087..103451) product multidrug resistance outer membrane protein MdtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081453.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 gene mdtQ CDS 103714..103911 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22360 CDS complement(103982..104920) product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001802202.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 gene dusC CDS complement(105029..106222) product 3-hydroxybenzoate 6-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150113.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS complement(106237..106881) product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781184.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 gene maiA CDS complement(106890..107591) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170621.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS complement(107607..108644) product gentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289858.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 gene gtdA CDS complement(108656..110014) product aromatic acid/H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194222.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 CDS 110140..111048 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024658.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS 111180..111578 product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045719.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS 111575..112270 product CidB/LrgB family autolysis modulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000989296.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS 112424..113308 product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553529.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 gene cdd CDS 113485..114204 product outer membrane permeability protein SanA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920079.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 gene sanA CDS 114201..114446 product DUF2542 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605187.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS 114651..115892 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136400.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS 115886..117121 product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956072.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 gene preA CDS complement(117196..118206) product galactose/methyl galactoside ABC transporter permease MglC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275103.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 gene mglC CDS complement(118222..119742) product galactose/methyl galactoside ABC transporter ATP-binding protein MglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255032.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 gene mglA CDS complement(119876..120874) product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036947.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 gene mglB CDS complement(121373..122395) product HTH-type transcriptional regulator GalS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628627.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 gene galS CDS complement(122545..123687) product DUF418 domain-containing protein YeiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001765111.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 gene yeiB CDS complement(123702..124370) product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139611.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 gene folE CDS 124700..125557 product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425481.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 gene fghA CDS complement(125546..125935) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876815.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS complement(125940..127241) product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443204.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS 127524..128411 product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022911.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 gene serB CDS 128444..129766 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174929.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS complement(129810..131801) product catecholate siderophore receptor CirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488257.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 gene cirA CDS complement(132147..133616) product lysine-specific permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534995.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 gene lysP CDS complement(133806..134669) product DNA-binding transcriptional regulator YeiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548316.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 gene yieE CDS 134790..135839 product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137966.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 CDS 135918..136775 product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873905.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 gene nfo CDS complement(136840..138528) product PTS fructose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854408.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 gene fruA CDS complement(138545..139483) product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091249.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 gene fruK CDS complement(139483..140613) product fused PTS fructose transporter subunit IIA/HPr protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487294.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 gene fruB CDS 140982..142163 product sugar efflux transporter SetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551934.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 gene setB CDS complement(142227..142892) product GNVR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213885.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS 143983..144555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS 144768..145754 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169350.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS 145757..146503 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178088.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS 146917..147489 product bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241015.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 gene mepS CDS 147815..149371 product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957756.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS 149478..151283 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561746.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS 151293..152387 product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000501623.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS 152387..153412 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137761.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS 153414..155003 product microcin C ABC transporter ATP-binding protein YejF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203612.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 gene yejF CDS complement(155007..155351) product YejG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094639.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS complement(155742..156932) product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213351.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS complement(156960..157655) product 16S rRNA pseudouridine(516) synthase RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234836.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 gene rsuA CDS 157807..159567 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578121.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 CDS 159692..159976 product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494192.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 gene rplY CDS complement(160084..160704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033434.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS complement(160732..161739) product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050806.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 gene yejK CDS 161919..162146 product YejL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135904.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS 162178..163938 product LPS biosynthesis-modulating metalloenzyme YejM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256152.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 gene yejM tRNA 164012..164088 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 CDS complement(164399..164548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22900 note possible pseudo, frameshifted CDS complement(164709..166493) product SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115839.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 gene sspH2 CDS complement(167744..168028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22920 note possible pseudo, internal stop codon CDS complement(168071..168535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22930 note possible pseudo, internal stop codon CDS 168664..168852 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS 168839..169042 product virulence protein MsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001653202.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 CDS complement(169234..169791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS 170527..171174 product nitrate/nitrite response regulator protein NarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115500.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 gene narP sequence11 source 1..153373 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1166..2530 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000935.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS complement(2577..3068) product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138911.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS 3194..4105 product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705818.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 gene panE CDS 4068..4658 product protein deglycase YajL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275809.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 gene yajL CDS complement(4755..5564) product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079741.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS complement(5574..6677) product 2-aminoethylphosphonate--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203965.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 gene phnW CDS 6817..7536 product phosphonate utilization transcriptional regulator PhnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836268.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 gene phnR CDS 7734..8747 product 2-aminoethylphosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778002.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 gene phnS CDS 8753..9862 product 2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928794.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 gene phnT CDS 9865..10734 product 2-aminoethylphosphonate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052708.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 gene phnU CDS 10728..11525 product 2-aminoethylphosphonate ABC transport system, membrane component PhnV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000909802.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 gene phnV CDS complement(11569..13017) product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668658.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 gene thiI CDS 13227..13469 product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124944.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 gene xseB CDS 13470..14369 product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348078.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 gene ispA CDS 14393..16255 product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006791.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 gene dxs CDS 16312..17286 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199865.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS complement(17390..17905) product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154063.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 gene pgpA CDS complement(17883..18863) product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742107.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 gene thiL CDS complement(18942..19361) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801120.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 gene nusB CDS complement(19382..19852) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021372.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 gene ribE CDS complement(19941..21044) product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001150215.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 gene ribD CDS complement(21048..21497) product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543535.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 gene nrdR CDS 21649..22188 product DUF3251 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198480.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS 22488..23351 product nucleoside-specific channel-forming protein Tsx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000752021.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS complement(23980..24327) product HNH nuclease YajD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974818.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 gene yajD CDS complement(24497..25189) product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198318.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS complement(25215..25580) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793035.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS complement(25725..26696) product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046629.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 gene secF CDS complement(26707..28521) product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934811.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 gene secD CDS complement(28582..28914) product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007628.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 gene yajC CDS complement(28937..30064) product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667304.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 gene tgt CDS complement(30261..31325) product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266528.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 gene queA CDS 31419..32000 product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009858.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 gene acpH CDS 32210..32812 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244731.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS complement(32884..34701) product maltodextrin glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000930730.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 gene malZ CDS complement(34863..36293) product proline-specific permease ProY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445555.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 gene proY CDS complement(36308..37627) product branched-chain amino acid transporter carrier protein BrnQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149625.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 gene brnQ CDS complement(38036..39331) product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893648.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 gene phoR CDS complement(39401..40090) product phosphate response regulator transcription factor PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113921.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 gene phoB CDS 40305..41507 product exonuclease subunit SbcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221246.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 gene sbcD CDS 41504..44644 product exonuclease subunit SbcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001526312.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 gene sbcC CDS 44817..45989 product MFS transporter AraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326926.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 gene araJ CDS complement(46011..46919) product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219273.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 gene mak CDS 47033..47956 product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964305.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 gene rdgC CDS complement(47994..48278) product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941953.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 gene ppnP CDS complement(48349..49026) product AroM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276434.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS complement(49277..49468) product protein YaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143161.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 gene yaiA CDS complement(49495..50040) product shikimate kinase AroL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983569.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 gene aroL CDS complement(50225..50680) product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158137.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS 50820..51629 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412190.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 gene proC CDS complement(51644..52606) product diguanylate cyclase AdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484099.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 gene adrA CDS complement(52848..53168) product phosphate starvation-inducible protein PsiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705165.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 gene psiF CDS complement(53517..53777) product anti-adapter protein IraP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518423.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 gene iraP CDS complement(54074..55285) product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446769.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS complement(55454..56137) product extensin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480796.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS 56245..57339 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096588.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 gene ddlA CDS complement(57365..57580) product DUF2754 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239240.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 CDS 57848..58156 product YaiY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763139.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 CDS complement(58194..59288) product surface-exposed outer membrane lipoprotein YaiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271423.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 gene yaiW CDS complement(59303..60523) product peptide antibiotic transporter SbmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477016.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 gene sbmA CDS 60870..62027 product D-alanyl-D-alanine-carboxypeptidase/endopeptidase AmpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830774.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 gene ampH CDS complement(62072..62695) product hydrogen peroxide resistance inhibitor IprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950094.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 gene iprA CDS complement(62781..65795) product autotransporter adhesin EhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181238112.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 gene ehaB CDS 66308..67282 product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130724.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 gene hemB CDS complement(67386..69272) product propionate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010226.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 gene prpE CDS complement(69313..70764) product bifunctional 2-methylcitrate dehydratase/aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272709.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS complement(70802..71971) product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132750.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 gene prpC CDS complement(72094..72981) product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052221.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 gene prpB CDS 73247..74872 product propionate catabolism operon regulatory protein PrpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205290.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 gene prpR CDS complement(75008..75283) product DUF1471 family periplasmic protein YahO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848026.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 gene yahO CDS 75515..76147 product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433130.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS complement(76188..78278) product ferrioxamine B receptor FoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127727.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 gene foxA CDS complement(78442..79449) product ferrioxamine uptake transcriptional regulator FoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074609.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 gene foxR CDS complement(79784..80794) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151052.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 gene cydB CDS complement(80791..82194) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393706.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 CDS complement(82689..85661) product type III restriction-modification system endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689015.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 CDS complement(85671..87629) product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910350.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 CDS complement(87818..89071) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288510.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS complement(89363..89557) product gold resistance metallochaperone GolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159469.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 gene golB CDS complement(89635..90099) product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811033.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 gene cueR CDS complement(90096..92399) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931165.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS 92676..93902 product multidrug efflux RND transporter periplasmic adaptor subunit MexP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119548.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 gene mexP CDS 93899..97066 product multidrug efflux RND transporter permease subunit MexQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112892.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 gene mexQ CDS 97083..98540 product AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811956.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 gene adeC CDS complement(98610..98879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS complement(99027..99251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS complement(99262..99789) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610820.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS complement(100047..100571) product Ail/Lom family outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830239.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS complement(100972..101430) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545416.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS complement(101433..102176) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081360.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS complement(102276..103850) product cyclic diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868284.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS complement(104152..104652) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545416.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS complement(104625..105359) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005856.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS 106022..106558 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062036.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS 106620..107381 product fimbrial biogenesis chaperone StbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781490.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 gene stbB CDS 107365..109926 product fimbrial outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075318.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS 109931..111256 product fimbrial usher protein StbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899085.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 gene stbD CDS 111222..111980 product fimbrial biogenesis chaperone StbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247037.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 gene stbE CDS complement(112027..112425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS 113117..113389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS complement(113334..114299) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367267.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS complement(114333..115247) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256667.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS complement(115247..116125) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098684.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS complement(116140..116766) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972565.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 gene leuD CDS complement(116768..118189) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446523.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 gene leuC CDS complement(118321..119244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24030 CDS complement(119901..120200) product DUF1889 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369626.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS complement(120406..120774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24050 CDS 120841..121140 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169527.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 CDS complement(121065..121466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24070 CDS complement(121479..121748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24080 tRNA complement(121912..121987) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 CDS complement(122103..123350) product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893213.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 gene proA CDS complement(123362..124465) product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285275.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 gene proB CDS 124747..125799 product phosphoporin PhoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043666.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 gene phoE CDS complement(125850..126251) product sigma factor-binding protein Crl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174696.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 gene crl CDS complement(126309..127553) product esterase FrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189584.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 gene frsA CDS complement(127642..128100) product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292018.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 gene gpt CDS 128349..129797 product cytosol nonspecific dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292984.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 gene pepD CDS complement(129952..130566) product peptide chain release factor H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602086.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 gene prfH CDS complement(130563..131702) product RNA ligase RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528894.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS complement(131921..132976) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226198.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 gene dinB CDS 133226..133966 product peptidoglycan meso-diaminopimelic acid protein amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225658.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 gene dpaA CDS complement(133937..134704) product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333360.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS complement(134917..135495) product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284051.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 gene lpcA CDS 135735..138179 product acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973055.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 gene fadE CDS 138288..139055 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000015775.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 CDS 139365..139772 product Spy/CpxP family protein refolding chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000788200.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS 140103..140822 product adhesin/invasin protein PagN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787614.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 gene pagN CDS complement(141161..142105) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970302.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS complement(142923..143744) product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119384.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS complement(144152..144622) product AfaD family invasin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000266939.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 gene afaD CDS complement(144644..147037) product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669630.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS complement(147178..147891) product pili assembly chaperone SafB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691915.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 gene safB CDS complement(147999..148496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24310 CDS complement(149259..149537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24320 note possible pseudo, internal stop codon, frameshifted CDS complement(149750..149959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24330 note possible pseudo, frameshifted CDS 150147..150326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24340 CDS complement(150393..150746) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24350 CDS complement(150988..151407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24360 CDS complement(151452..151769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24370 CDS complement(152126..152266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24380 CDS complement(152327..152560) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24390 CDS 152895..153152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24400 sequence12 source 1..151950 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 655..810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24410 CDS 1101..1271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24420 CDS 1334..1933 product DUF1367 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940304.1 transl_table 11 codon_start 1 locus_tag LOCUS_24430 CDS 1933..2223 product DUF1364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228038.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 CDS 2220..2756 product DUF1133 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640158.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS 4927..5322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24460 CDS 5244..5432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24470 CDS 5422..5703 product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705707.1 transl_table 11 codon_start 1 locus_tag LOCUS_24480 CDS 5700..6245 product putative peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166765.1 transl_table 11 codon_start 1 locus_tag LOCUS_24490 CDS 6242..6451 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24500 CDS 7091..7429 product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159242.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 CDS complement(7479..7913) product universal stress protein UspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082296.1 transl_table 11 codon_start 1 locus_tag LOCUS_24520 gene uspF CDS 8127..8336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS complement(8395..11919) product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193255.1 transl_table 11 codon_start 1 locus_tag LOCUS_24540 gene nifJ CDS complement(12505..12915) product heat shock protein HslJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725242.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 gene hslJ CDS complement(13026..14015) product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762205.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 gene ldhA CDS 14255..16891 product YdbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677026.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 CDS 16891..17082 product YnbE family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784063.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 CDS 17105..17413 product YdbL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760346.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 CDS 17685..18005 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24600 CDS complement(18002..18607) product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048924.1 transl_table 11 codon_start 1 locus_tag LOCUS_24610 gene azoR CDS 18790..22710 product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001785213.1 transl_table 11 codon_start 1 locus_tag LOCUS_24620 gene hrpA CDS 22774..23574 product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098505.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS 23691..24221 product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005022464.1 transl_table 11 codon_start 1 locus_tag LOCUS_24640 gene cybB CDS complement(24492..25154) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239881.1 transl_table 11 codon_start 1 locus_tag LOCUS_24650 CDS complement(25618..26208) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24660 note possible pseudo, frameshifted CDS complement(26238..26741) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24670 note possible pseudo, internal stop codon, frameshifted CDS complement(27304..27984) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560165.1 transl_table 11 codon_start 1 locus_tag LOCUS_24680 CDS complement(27981..28712) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185897.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 CDS complement(28737..29369) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094452.1 transl_table 11 codon_start 1 locus_tag LOCUS_24700 CDS complement(29391..30152) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949382.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 CDS 31060..31404 product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281194.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS complement(31525..32751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24730 CDS 34946..35221 product metal/formaldehyde-sensitive transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096678.1 transl_table 11 codon_start 1 locus_tag LOCUS_24740 CDS 35253..36371 product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366371.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 CDS 36540..38165 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419375.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 CDS complement(38226..39149) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366376.1 transl_table 11 codon_start 1 locus_tag LOCUS_24770 CDS 39442..40785 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013762.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS 40834..42342 product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933982.1 transl_table 11 codon_start 1 locus_tag LOCUS_24790 CDS 42598..44217 product glucan biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081955.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 CDS 44422..44988 product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024312.1 transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS complement(45166..45885) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027219.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS complement(45976..47019) product L-idonate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197408.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 gene idnD CDS complement(47036..48397) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769658.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 CDS complement(48481..49248) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971598.1 transl_table 11 codon_start 1 locus_tag LOCUS_24850 CDS 49586..50839 product starvation-sensing protein RspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602314.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 gene rspA CDS complement(50980..51417) product cryptic aminoglycoside N-acetyltransferase AAC(6')-Iy/Iaa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354865.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 gene aac(6') CDS complement(51417..52214) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001670738.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS complement(52224..52856) product ribulose-phosphate 3 epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600614.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 CDS complement(52868..53305) product SgcA family PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606458.1 transl_table 11 codon_start 1 locus_tag LOCUS_24900 gene sgcA CDS complement(53437..54243) product BtpA family protein SgcQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118614.1 transl_table 11 codon_start 1 locus_tag LOCUS_24910 gene sgcQ CDS complement(54257..55570) product PTS sugar transporter subunit IIC SgcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460840.1 transl_table 11 codon_start 1 locus_tag LOCUS_24920 gene sgcC CDS complement(55581..55862) product PTS sugar transporter subunit IIB SgcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976132.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 gene sgcB CDS complement(55859..56977) product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144622.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 CDS 57194..57733 product 50S ribosomal protein L7/L12-serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229308.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 gene rimL CDS complement(57730..58710) product YdcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599089.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 gene ydcK CDS 58817..59830 product dicarboxylate transporter/tellurite-resistance protein TehA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000336113.1 transl_table 11 codon_start 1 locus_tag LOCUS_24970 gene tehA CDS 59817..60413 product tellurite resistance methyltransferase TehB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218282.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 gene tehB CDS 60569..61237 product DUF3313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259016.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 CDS complement(61291..62469) product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238501.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 CDS 62562..63098 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000369547.1 transl_table 11 codon_start 1 locus_tag LOCUS_25010 CDS 63177..65141 product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249757.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 CDS complement(65142..65375) product DUF2554 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956438.1 transl_table 11 codon_start 1 locus_tag LOCUS_25030 CDS complement(65646..66041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25040 CDS 67133..67531 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747901.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 CDS 68053..68823 product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237711.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 CDS 68959..70383 product GntR family transcriptional regulator YdcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760699.1 transl_table 11 codon_start 1 locus_tag LOCUS_25070 gene ycdR CDS 70498..71943 product aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158107.1 transl_table 11 codon_start 1 locus_tag LOCUS_25080 gene patD CDS complement(72560..74704) product virulence-associated effector SrfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165637.1 transl_table 11 codon_start 1 locus_tag LOCUS_25090 gene srfC CDS complement(74701..77694) product virulence factor SrfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000960825.1 transl_table 11 codon_start 1 locus_tag LOCUS_25100 CDS complement(77687..79012) product virulence-associated effector SrfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129948.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 gene srfA CDS 79236..79469 product YdcY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018716.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 CDS complement(79474..79923) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076571.1 transl_table 11 codon_start 1 locus_tag LOCUS_25130 CDS complement(79923..80438) product L-methionine sulfoximine/L-methionine sulfone acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155377.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 gene mddA CDS 80650..81687 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001682108.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 CDS 82021..82686 product colanic acid/biofilm transcriptional regulator McbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119592.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 gene mcbR CDS complement(82742..84760) product TonB-dependent receptor PqqU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692046.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 gene pqqU CDS 85126..86187 product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550638.1 transl_table 11 codon_start 1 locus_tag LOCUS_25180 CDS 86332..86553 product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732362.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 CDS complement(86630..88123) product L-asparagine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857112.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 gene ansP CDS 88636..89268 product type III secretion system effector SteA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147139.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 gene steA CDS 89551..90396 product N-hydroxyarylamine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200336.1 transl_table 11 codon_start 1 locus_tag LOCUS_25220 gene nhoA CDS complement(90432..91325) product PhzF family isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804298.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS complement(91431..92111) product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617102.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 gene narI CDS complement(92108..92803) product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166289.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 gene narW CDS complement(92803..94347) product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702603.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 gene narH CDS complement(94344..98084) product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000040363.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 CDS complement(98176..99414) product NarK family nitrate/nitrite MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198245.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 CDS complement(99779..100357) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121044.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 CDS 100475..101962 product methyl viologen efflux MFS transporter SmvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489748.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 gene smvA CDS complement(101987..102427) product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338748.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 CDS complement(102511..103599) product porin OmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096520.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 CDS 103682..103864 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS complement(104122..105003) product aromatic amino acid efflux DMT transporter YddG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198225.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 gene yddG CDS 105281..108328 product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602782.1 transl_table 11 codon_start 1 transl_except (pos:105866..105868,aa:Sec) note codon on position 196 is selenocysteine opal codon. locus_tag LOCUS_25350 gene fdnG CDS 108342..109226 product formate dehydrogenase N subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240581.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 gene fdnH CDS 109219..109875 product formate dehydrogenase-N subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045648.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 gene fdnI CDS complement(109966..110976) product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642447.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 gene adhP CDS complement(111258..112955) product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450511.1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 CDS complement(113132..113275) product stationary-phase-induced ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841559.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 gene sra CDS complement(113370..113585) product biofilm-dependent modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495700.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 gene bdm CDS 114098..114529 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152297.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 CDS 114879..115208 product acid-activated periplasmic chaperone HdeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032161.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 gene hdeB CDS 115351..116136 product OBAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698597.1 transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS 116265..118049 product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095550.1 transl_table 11 codon_start 1 locus_tag LOCUS_25450 gene treZ CDS 118046..120574 product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613170.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 gene treY CDS 120631..122706 product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096571.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 gene glgX CDS complement(122819..124021) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000336171.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 CDS complement(124034..125485) product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261868.1 transl_table 11 codon_start 1 locus_tag LOCUS_25490 gene nhaC CDS complement(125629..126609) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211038.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 CDS 126867..127148 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25510 CDS 127204..127506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25520 CDS complement(127437..127769) product DUF1493 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704508.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 CDS 128096..128263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS complement(128321..129394) product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954693.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 CDS complement(129587..130075) product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293639.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 CDS 130120..131628 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223342.1 transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS 131618..132859 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095727.1 transl_table 11 codon_start 1 locus_tag LOCUS_25580 CDS 133103..134485 product PhoPQ-activated pathogenicity-related family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476914.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 CDS 134662..135948 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824230.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 CDS 135923..136948 product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864933.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 CDS complement(137007..137678) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518759.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 CDS complement(137844..138932) product linear amide C-N hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976508.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 CDS 139474..140466 product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194451.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 CDS 140469..142271 product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089679.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS 142291..142965 product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924456.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 gene cybH CDS 142971..143579 product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852667.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 gene hybD CDS 143579..143878 product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334908.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 gene hypC CDS 143875..144285 product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155978.1 transl_table 11 codon_start 1 locus_tag LOCUS_25690 CDS 144303..145364 product hydrogenase expression/formation C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016742.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 CDS 145336..145524 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS 145538..146239 product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189412.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 CDS 146252..146593 product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544945.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 gene hypA CDS complement(146734..147852) product porin OmpN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837937.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 gene ompN CDS 148484..148681 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25750 CDS 148635..149111 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513115.1 transl_table 11 codon_start 1 locus_tag LOCUS_25760 CDS complement(149167..150081) product bestrophin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001670736.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 CDS complement(150336..150695) product DUF4186 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992456.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 CDS complement(150695..151621) product glutaminase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257409.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 gene glsB sequence13 source 1..149633 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 206..2086 product intimin-like inverse autotransporter SinH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002432009.1 transl_table 11 codon_start 1 locus_tag LOCUS_25800 gene sinH CDS 2144..3103 product SinI family autotransporter-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001149068.1 transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS 3241..8820 product DUF823 domain-containing adhesin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375801.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 CDS 8986..16293 product DUF823/DUF824 repeat adhesin RatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837143.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 gene ratB CDS 16996..22863 product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704642.1 transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS complement(23025..24374) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953156.1 transl_table 11 codon_start 1 locus_tag LOCUS_25850 gene xseA CDS 24535..26001 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944174.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 gene guaB CDS 26071..27648 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138293.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 gene guaA CDS 27871..28158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25880 CDS complement(28178..28492) product DUF1493 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365765.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 CDS complement(28479..28745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS 28816..29049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25910 note possible pseudo, frameshifted CDS complement(29201..29392) product YfgG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076001.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 CDS 29961..32018 product sensor domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000773655.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS complement(32054..33595) product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123330.1 transl_table 11 codon_start 1 locus_tag LOCUS_25940 gene ppx CDS complement(33600..35666) product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529558.1 transl_table 11 codon_start 1 locus_tag LOCUS_25950 gene ppk1 CDS complement(35855..36493) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028592.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 gene purN CDS complement(36493..37545) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001767330.1 transl_table 11 codon_start 1 locus_tag LOCUS_25970 gene purM CDS 37943..38569 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706208.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 gene upp CDS 38657..39946 product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198341.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 gene uraA CDS 40017..40742 product DnaA inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100388.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS complement(40769..41128) product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132650.1 transl_table 11 codon_start 1 locus_tag LOCUS_26010 gene arsC CDS complement(41168..42631) product beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489630.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 gene bepA CDS 42839..43906 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892056.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 CDS 44183..45370 product sugar diacid recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209535.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 CDS 45438..46706 product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200863.1 transl_table 11 codon_start 1 locus_tag LOCUS_26050 CDS 46712..47851 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706383.1 transl_table 11 codon_start 1 locus_tag LOCUS_26060 CDS complement(47898..48368) product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068686.1 transl_table 11 codon_start 1 locus_tag LOCUS_26070 gene bcp CDS complement(48368..48940) product glycine cleavage system transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001576288.1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS 49086..49964 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494019.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 gene dapA CDS 49981..51015 product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331881.1 transl_table 11 codon_start 1 locus_tag LOCUS_26100 gene bamC CDS 51190..51903 product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171630.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 CDS 52034..52897 product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267527.1 transl_table 11 codon_start 1 locus_tag LOCUS_26120 CDS 52913..54931 product tRNA cytosine(34) acetyltransferase TmcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279850.1 transl_table 11 codon_start 1 locus_tag LOCUS_26130 gene tmcA CDS complement(54958..55158) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26140 CDS complement(55186..56313) product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277830.1 transl_table 11 codon_start 1 locus_tag LOCUS_26150 gene dapE CDS complement(56317..56673) product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631925.1 transl_table 11 codon_start 1 locus_tag LOCUS_26160 CDS complement(57247..60360) product multidrug efflux RND transporter permease AcrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001263083.1 transl_table 11 codon_start 1 locus_tag LOCUS_26170 gene acrD CDS complement(60545..62245) product nitrate/nitrite two-component system sensor histidine kinase NarQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216820.1 transl_table 11 codon_start 1 locus_tag LOCUS_26180 gene narQ CDS 62431..64392 product formate-dependent uric acid utilization protein AegA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078843.1 transl_table 11 codon_start 1 locus_tag LOCUS_26190 gene aegA CDS complement(64841..66139) product penicillin binding protein PBP4B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673295.1 transl_table 11 codon_start 1 locus_tag LOCUS_26200 gene pbp4b CDS 66343..66918 product GDP-mannose pyrophosphatase NudK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084037.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 gene nudK CDS 67043..68086 product DUF1176 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270663.1 transl_table 11 codon_start 1 locus_tag LOCUS_26220 CDS 68214..68444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26230 CDS complement(68507..70507) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087345.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 gene tkt CDS complement(70527..71477) product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001072436.1 transl_table 11 codon_start 1 locus_tag LOCUS_26250 gene tal CDS 71749..74028 product NADP-dependent oxaloacetate-decarboxylating malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344299.1 transl_table 11 codon_start 1 locus_tag LOCUS_26260 gene maeB CDS 74445..74780 product ethanolamine utilization microcompartment protein EutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031444.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 gene eutS CDS 74793..75272 product ethanolamine utilization acetate kinase EutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000820751.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 gene eutP CDS 75250..75939 product ethanolamine utilization acetate kinase EutQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733871.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 gene eutQ CDS 75936..76739 product ethanolamine utilization cob(I)yrinic acid a,c-diamide adenosyltransferase EutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997668.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 gene eutT CDS 76736..77752 product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582913.1 transl_table 11 codon_start 1 locus_tag LOCUS_26310 gene pta CDS 77793..78083 product ethanolamine utilization microcompartment protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387713.1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 gene eutM CDS 78196..78483 product ethanolamine utilization microcompartment protein EutN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001522340.1 transl_table 11 codon_start 1 locus_tag LOCUS_26330 gene eutN CDS 78495..79898 product aldehyde dehydrogenase EutE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075647.1 transl_table 11 codon_start 1 locus_tag LOCUS_26340 CDS 79909..80748 product ethanolamine utilization protein EutJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929675.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 gene eutJ CDS 80738..81925 product ethanolamine utilization ethanol dehydrogenase EutG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147519.1 transl_table 11 codon_start 1 locus_tag LOCUS_26360 gene eutG CDS 82045..83271 product ethanolamine utilization protein EutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512341.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 gene eutH CDS 83268..84671 product ethanolamine ammonia-lyase reactivating factor EutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097523.1 transl_table 11 codon_start 1 locus_tag LOCUS_26380 gene eutA CDS 84683..86044 product ethanolamine ammonia-lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769994.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 gene eutB CDS 86063..86959 product ethanolamine ammonia-lyase subunit EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372351.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 gene eutC CDS 86969..87628 product ethanolamine utilization microcompartment protein EutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001111056.1 transl_table 11 codon_start 1 locus_tag LOCUS_26410 gene eutL CDS 87641..88135 product ethanolamine utilization microcompartment protein EutK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606260.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 gene eutK CDS 88183..89235 product HTH-type transcriptional regulator EutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753659.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 gene eutR CDS 89556..89702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26440 CDS complement(89684..90013) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26450 CDS complement(90034..90933) product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801336.1 transl_table 11 codon_start 1 locus_tag LOCUS_26460 gene hemF CDS complement(90936..91805) product N-acetylmuramoyl-L-alanine amidase AmiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102880.1 transl_table 11 codon_start 1 locus_tag LOCUS_26470 gene amiA CDS 92018..92443 product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406008.1 transl_table 11 codon_start 1 locus_tag LOCUS_26480 CDS 92430..92879 product DUF2919 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842927.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 CDS 92941..93516 product RpoE-regulated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838971.1 transl_table 11 codon_start 1 locus_tag LOCUS_26500 CDS 93611..94510 product porphyrinogen peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084583.1 transl_table 11 codon_start 1 locus_tag LOCUS_26510 gene yfeX CDS 94748..95539 product SDR family oxidoreductase UcpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517460.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 gene ucpA CDS 95697..96713 product thiosulfate/sulfate ABC transporter substrate-binding protein CysP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290267.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 gene cysP CDS 96713..97546 product sulfate/thiosulfate ABC transporter permease CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881746.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 gene cysT CDS 97546..98421 product sulfate/thiosulfate ABC transporter permease CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852703.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 gene cysW CDS 98411..99508 product sulfate/thiosulfate ABC transporter ATP-binding protein CysA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021072.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 gene cysA CDS 99576..100487 product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093881.1 transl_table 11 codon_start 1 locus_tag LOCUS_26570 gene cysM CDS 100739..101347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26580 CDS complement(101447..101812) product YfeK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710735.1 transl_table 11 codon_start 1 locus_tag LOCUS_26590 CDS complement(101889..102608) product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001263738.1 transl_table 11 codon_start 1 locus_tag LOCUS_26600 CDS complement(102623..103915) product transcriptional regulator PtsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565130.1 transl_table 11 codon_start 1 locus_tag LOCUS_26610 gene ptsJ CDS 103998..104864 product pyridoxine/pyridoxal/pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529606.1 transl_table 11 codon_start 1 locus_tag LOCUS_26620 gene pdxK CDS 104861..105100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844540.1 transl_table 11 codon_start 1 locus_tag LOCUS_26630 CDS complement(105264..105773) product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522253.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 gene crr CDS complement(105814..107541) product phosphoenolpyruvate-protein phosphotransferase PtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098199.1 transl_table 11 codon_start 1 locus_tag LOCUS_26650 gene ptsI CDS complement(107590..107847) product phosphocarrier protein Hpr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487600.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 gene ptsH CDS complement(108231..109202) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036904.1 transl_table 11 codon_start 1 locus_tag LOCUS_26670 gene cysK CDS complement(109366..110127) product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255008.1 transl_table 11 codon_start 1 locus_tag LOCUS_26680 gene cysZ CDS 110359..111345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26690 CDS 111417..113432 product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433258.1 transl_table 11 codon_start 1 locus_tag LOCUS_26700 gene ligA CDS 113425..113652 product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114688.1 transl_table 11 codon_start 1 locus_tag LOCUS_26710 CDS complement(113649..114647) product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765569.1 transl_table 11 codon_start 1 locus_tag LOCUS_26720 CDS 114737..115663 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109834.1 transl_table 11 codon_start 1 locus_tag LOCUS_26730 CDS complement(115725..116486) product outer membrane protein OmpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722932.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 CDS 116742..117575 product xanthosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119752.1 transl_table 11 codon_start 1 locus_tag LOCUS_26750 gene xapA CDS 117630..118886 product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513243.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 CDS 118945..119103 product DUF1427 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658727.1 transl_table 11 codon_start 1 locus_tag LOCUS_26770 CDS 119152..120039 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438886.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 tRNA complement(120203..120278) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 tRNA complement(120283..120358) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA complement(120400..120475) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 tRNA complement(120521..120596) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 CDS 120855..122270 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695623.1 transl_table 11 codon_start 1 locus_tag LOCUS_26790 gene gltX CDS complement(122324..122695) product putative DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826515.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 CDS complement(122718..123080) product putative DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472034.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 tRNA 123302..123377 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 tRNA 123420..123495 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 CDS 123671..125875 product sensor domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112949.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 CDS complement(125928..127130) product nucleoside permease NupC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000376341.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 gene nupC CDS 127473..128714 product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131734.1 transl_table 11 codon_start 1 locus_tag LOCUS_26840 CDS complement(128775..129101) product DUF2502 domain-containing protein YpeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490091.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 gene ypeC CDS complement(129215..130213) product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640297.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 gene mgrA CDS 130393..132045 product alpha-keto acid decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001180878.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 CDS complement(132065..133300) product ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468932.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 CDS 133504..134469 product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170371.1 transl_table 11 codon_start 1 locus_tag LOCUS_26890 gene glk CDS 135192..136430 product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785618.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 gene alaC CDS complement(136954..137874) product kdo(2)-lipid IV(A) palmitoleoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484431.1 transl_table 11 codon_start 1 locus_tag LOCUS_26910 gene lpxP CDS 138396..138638 product YfdY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639889.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 CDS complement(138913..140130) product phosphoglycerate transporter PgtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955756.1 transl_table 11 codon_start 1 locus_tag LOCUS_26930 gene pgtP CDS 140436..140696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26940 CDS 140710..141933 product phosphoglycerate transport regulator PgtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467983.1 transl_table 11 codon_start 1 locus_tag LOCUS_26950 gene pgtC CDS 141945..143936 product two-component system sensor histidine kinase PgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678500.1 transl_table 11 codon_start 1 locus_tag LOCUS_26960 gene pgtB CDS 143926..145173 product two-component system response regulator PgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000930841.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 gene pgtA CDS 145441..146379 product omptin family outer membrane protease PgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716015.1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 gene pgtE CDS 147271..147771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26990 CDS complement(147888..149198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27000 sequence14 source 1..146951 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 65..175 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 tRNA 193..268 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 rRNA 310..420 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 CDS complement(1207..1428) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825645.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 CDS 1558..1734 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27020 CDS complement(1666..4779) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703631.1 transl_table 11 codon_start 1 locus_tag LOCUS_27030 CDS complement(4791..5948) product multidrug efflux RND transporter periplasmic adaptor subunit AcrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160334.1 transl_table 11 codon_start 1 locus_tag LOCUS_27040 gene acrE CDS 6362..7024 product multidrug efflux transporter transcriptional repressor AcrS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129529.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 gene acrS CDS complement(7027..9126) product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098998.1 transl_table 11 codon_start 1 locus_tag LOCUS_27060 CDS complement(9277..9462) product DUF2556 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620015.1 transl_table 11 codon_start 1 locus_tag LOCUS_27070 CDS complement(9524..10408) product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642611.1 transl_table 11 codon_start 1 locus_tag LOCUS_27080 gene yhdJ CDS complement(10494..10790) product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462905.1 transl_table 11 codon_start 1 locus_tag LOCUS_27090 gene fis CDS complement(10816..11661) product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219664.1 transl_table 11 codon_start 1 locus_tag LOCUS_27100 gene dusB CDS complement(12442..13323) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145849.1 transl_table 11 codon_start 1 locus_tag LOCUS_27110 gene prmA CDS complement(13335..14786) product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001175744.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 gene panF CDS complement(14776..15018) product YhdT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340020.1 transl_table 11 codon_start 1 locus_tag LOCUS_27130 CDS complement(15127..16476) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884627.1 transl_table 11 codon_start 1 locus_tag LOCUS_27140 gene accC CDS complement(16487..16957) product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354626.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 gene accB CDS complement(17350..17949) product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241496.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 gene msrQ CDS complement(17950..18954) product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723876.1 transl_table 11 codon_start 1 locus_tag LOCUS_27170 gene msrP CDS complement(19067..20041) product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148246.1 transl_table 11 codon_start 1 locus_tag LOCUS_27180 CDS 20245..22185 product RNase E specificity factor CsrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241379.1 transl_table 11 codon_start 1 locus_tag LOCUS_27190 gene csrD CDS 22493..23536 product rod shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913396.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 gene mreB CDS 23601..24653 product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802540.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 gene mreC CDS 24653..25144 product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226619.1 transl_table 11 codon_start 1 locus_tag LOCUS_27220 gene mreD CDS 25153..25746 product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210300.1 transl_table 11 codon_start 1 locus_tag LOCUS_27230 CDS 25736..27205 product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123188.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 gene rng CDS 27316..31116 product AsmA2 domain-containing protein YhdP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253498.1 transl_table 11 codon_start 1 locus_tag LOCUS_27250 gene yhdP CDS 31261..32706 product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055936.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 gene tldD CDS complement(32829..33740) product HTH-type transcriptional activator AaeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440300.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 gene aaeR CDS 33940..34143 product p-hydroxybenzoic acid efflux pump operon protein AaeX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051840.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 gene aaeX CDS 34151..35083 product p-hydroxybenzoic acid efflux pump subunit AaeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855134.1 transl_table 11 codon_start 1 locus_tag LOCUS_27290 gene aaeA CDS 35089..37056 product p-hydroxybenzoic acid efflux pump subunit AaeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510909.1 transl_table 11 codon_start 1 locus_tag LOCUS_27300 gene aaeB CDS 37228..37500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103887.1 transl_table 11 codon_start 1 locus_tag LOCUS_27310 CDS complement(37560..37826) product DUF1471 family stress response protein YhcN-B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853277.1 transl_table 11 codon_start 1 locus_tag LOCUS_27320 gene yhcN-B CDS complement(37930..38193) product peroxide/acid stress response protein YhcN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695692.1 transl_table 11 codon_start 1 locus_tag LOCUS_27330 gene yhcN CDS complement(38558..39028) product transcriptional regulator ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257852.1 transl_table 11 codon_start 1 locus_tag LOCUS_27340 gene argR CDS 39443..40381 product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861588.1 transl_table 11 codon_start 1 locus_tag LOCUS_27350 gene mdh CDS 40501..41130 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723780.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 CDS 41117..41782 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171579.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 CDS 41993..43261 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433394.1 transl_table 11 codon_start 1 locus_tag LOCUS_27380 CDS 43294..44193 product L(+)-tartrate dehydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045349.1 transl_table 11 codon_start 1 locus_tag LOCUS_27390 gene ttdA CDS 44193..44810 product L(+)-tartrate dehydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162405.1 transl_table 11 codon_start 1 locus_tag LOCUS_27400 gene ttdB CDS 44967..45209 product oxaloacetate decarboxylase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180130.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 CDS 45225..46997 product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150450.1 transl_table 11 codon_start 1 locus_tag LOCUS_27420 gene oadA CDS 47010..48311 product oxalacetate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444843.1 transl_table 11 codon_start 1 locus_tag LOCUS_27430 CDS 48364..49062 product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600161.1 transl_table 11 codon_start 1 locus_tag LOCUS_27440 CDS complement(49096..50166) product outer membrane-stress sensor serine endopeptidase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497705.1 transl_table 11 codon_start 1 locus_tag LOCUS_27450 gene degS CDS complement(50259..51626) product serine endoprotease DegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716695.1 transl_table 11 codon_start 1 locus_tag LOCUS_27460 gene degQ CDS complement(51783..52181) product Z-ring associated protein ZapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481183.1 transl_table 11 codon_start 1 locus_tag LOCUS_27470 gene zapG CDS 52374..53498 product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191224.1 transl_table 11 codon_start 1 locus_tag LOCUS_27480 gene zapE CDS 53800..54228 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847559.1 transl_table 11 codon_start 1 locus_tag LOCUS_27490 gene rplM CDS 54244..54636 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829815.1 transl_table 11 codon_start 1 locus_tag LOCUS_27500 gene rpsI CDS 54794..55588 product DUF695 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505558.1 transl_table 11 codon_start 1 locus_tag LOCUS_27510 CDS 55851..56489 product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257300.1 transl_table 11 codon_start 1 locus_tag LOCUS_27520 gene sspA CDS 56495..56995 product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366112.1 transl_table 11 codon_start 1 locus_tag LOCUS_27530 gene sspB CDS 57113..57895 product transcriptional regulator NanR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382926.1 transl_table 11 codon_start 1 locus_tag LOCUS_27540 gene nanR CDS 58030..58923 product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029662.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 gene nanA CDS 59039..60529 product sialic acid transporter NanT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108071.1 transl_table 11 codon_start 1 locus_tag LOCUS_27560 gene nanT CDS 60576..61265 product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054239.1 transl_table 11 codon_start 1 locus_tag LOCUS_27570 CDS 61262..62137 product N-acetylmannosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208982.1 transl_table 11 codon_start 1 locus_tag LOCUS_27580 gene nanK CDS 62134..62601 product N-acetylneuraminate anomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979902.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 gene nanQ CDS complement(62683..63963) product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001180693.1 transl_table 11 codon_start 1 locus_tag LOCUS_27600 CDS complement(63950..65203) product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076275.1 transl_table 11 codon_start 1 locus_tag LOCUS_27610 gene codB CDS complement(65319..66422) product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184299.1 transl_table 11 codon_start 1 locus_tag LOCUS_27620 CDS complement(66629..68047) product glutamate synthase subunit GltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081705.1 transl_table 11 codon_start 1 locus_tag LOCUS_27630 gene gltD CDS complement(68057..72514) product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965014.1 transl_table 11 codon_start 1 locus_tag LOCUS_27640 gene gltB CDS 72395..72655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27650 CDS 73189..74118 product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176887.1 transl_table 11 codon_start 1 locus_tag LOCUS_27660 CDS 74212..76548 product aerobic respiration two-component sensor histidine kinase ArcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809818.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 gene arcB CDS 76775..77428 product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719819.1 transl_table 11 codon_start 1 locus_tag LOCUS_27680 gene elbB CDS 77425..78153 product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044653.1 transl_table 11 codon_start 1 locus_tag LOCUS_27690 gene mtgA CDS complement(78228..78860) product PhoP regulatory network protein YrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602196.1 transl_table 11 codon_start 1 locus_tag LOCUS_27700 gene yrbL CDS complement(79110..79382) product PTS phosphocarrier protein NPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216797.1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 gene npr CDS complement(79379..80233) product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000243746.1 transl_table 11 codon_start 1 locus_tag LOCUS_27720 gene rapZ CDS complement(80279..80770) product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609332.1 transl_table 11 codon_start 1 locus_tag LOCUS_27730 gene ptsN CDS complement(80888..81175) product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176588.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 gene hpf CDS complement(81198..82631) product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809012.1 transl_table 11 codon_start 1 locus_tag LOCUS_27750 gene rpoN CDS complement(82679..83404) product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224104.1 transl_table 11 codon_start 1 locus_tag LOCUS_27760 gene lptB CDS complement(83411..83965) product lipopolysaccharide ABC transporter substrate-binding protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669770.1 transl_table 11 codon_start 1 locus_tag LOCUS_27770 gene lptA CDS complement(83934..84509) product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047845.1 transl_table 11 codon_start 1 locus_tag LOCUS_27780 gene lptC CDS complement(84506..85072) product 3-deoxy-manno-octulosonate-8-phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030029.1 transl_table 11 codon_start 1 locus_tag LOCUS_27790 gene kdsC CDS complement(85093..86079) product arabinose-5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018616.1 transl_table 11 codon_start 1 locus_tag LOCUS_27800 gene kdsD CDS complement(86093..87070) product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922739.1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 CDS 87283..88095 product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531560.1 transl_table 11 codon_start 1 locus_tag LOCUS_27820 gene mlaF CDS 88103..88885 product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925786.1 transl_table 11 codon_start 1 locus_tag LOCUS_27830 gene mlaE CDS 88890..89441 product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193591.1 transl_table 11 codon_start 1 locus_tag LOCUS_27840 gene mlaD CDS 89460..90095 product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476475.1 transl_table 11 codon_start 1 locus_tag LOCUS_27850 gene mlaC CDS 90095..90391 product lipid asymmetry maintenance protein MlaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188843.1 transl_table 11 codon_start 1 locus_tag LOCUS_27860 gene mlaB CDS 90579..90833 product BolA family iron metabolism protein IbaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000900133.1 transl_table 11 codon_start 1 locus_tag LOCUS_27870 gene ibaG CDS 90887..92146 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357288.1 transl_table 11 codon_start 1 locus_tag LOCUS_27880 gene murA CDS complement(92205..92492) product DNA-binding transcriptional regulator SfsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444167.1 transl_table 11 codon_start 1 locus_tag LOCUS_27890 gene sfsB CDS complement(92724..93695) product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047354.1 transl_table 11 codon_start 1 locus_tag LOCUS_27900 gene ispB CDS 93953..94264 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271396.1 transl_table 11 codon_start 1 locus_tag LOCUS_27910 gene rplU CDS 94284..94541 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940593.1 transl_table 11 codon_start 1 locus_tag LOCUS_27920 gene rpmA CDS 94671..95636 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813052.1 transl_table 11 codon_start 1 locus_tag LOCUS_27930 CDS 95652..96824 product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673554.1 transl_table 11 codon_start 1 locus_tag LOCUS_27940 gene cgtA CDS complement(96955..98388) product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212675.1 transl_table 11 codon_start 1 locus_tag LOCUS_27950 gene dacB CDS 98636..99112 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148008.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 gene greA CDS complement(99268..99600) product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196654.1 transl_table 11 codon_start 1 locus_tag LOCUS_27970 gene yhbY CDS 99688..100314 product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145975.1 transl_table 11 codon_start 1 locus_tag LOCUS_27980 gene rlmE CDS 100409..102352 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107481.1 transl_table 11 codon_start 1 locus_tag LOCUS_27990 gene ftsH CDS 102457..103305 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764715.1 transl_table 11 codon_start 1 locus_tag LOCUS_28000 gene folP CDS 103298..104635 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071169.1 transl_table 11 codon_start 1 locus_tag LOCUS_28010 gene glmM CDS 104858..105190 product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272680.1 transl_table 11 codon_start 1 locus_tag LOCUS_28020 gene secG tRNA 105204..105290 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 CDS complement(105375..106334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28030 CDS complement(106492..107835) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207645.1 transl_table 11 codon_start 1 locus_tag LOCUS_28040 gene argG tRNA 108179..108255 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 CDS 108463..108915 product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024135124.1 transl_table 11 codon_start 1 locus_tag LOCUS_28050 gene rimP CDS 108943..110445 product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031036.1 transl_table 11 codon_start 1 locus_tag LOCUS_28060 gene nusA CDS 110470..113148 product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131175.1 transl_table 11 codon_start 1 locus_tag LOCUS_28070 gene infB CDS 113369..113770 product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040205.1 transl_table 11 codon_start 1 locus_tag LOCUS_28080 gene rbfA CDS 113770..114714 product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089682.1 transl_table 11 codon_start 1 locus_tag LOCUS_28090 gene truB CDS 114865..115134 product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059465.1 transl_table 11 codon_start 1 locus_tag LOCUS_28100 gene rpsO CDS 115346..117511 product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989243.1 transl_table 11 codon_start 1 locus_tag LOCUS_28110 gene pnp CDS 117744..118505 product lipoprotein NlpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802069.1 transl_table 11 codon_start 1 locus_tag LOCUS_28120 gene nlpI CDS 118684..120573 product ATP-dependent RNA helicase DeaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301504.1 transl_table 11 codon_start 1 locus_tag LOCUS_28130 gene deaD CDS 120727..121971 product tryptophan permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224390.1 transl_table 11 codon_start 1 locus_tag LOCUS_28140 gene mtr CDS complement(122032..122562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294022.1 transl_table 11 codon_start 1 locus_tag LOCUS_28150 CDS 122721..123440 product murein L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000532752.1 transl_table 11 codon_start 1 locus_tag LOCUS_28160 CDS complement(123418..124425) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130426.1 transl_table 11 codon_start 1 locus_tag LOCUS_28170 CDS complement(124603..125481) product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877709.1 transl_table 11 codon_start 1 locus_tag LOCUS_28180 CDS complement(125490..126485) product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421309.1 transl_table 11 codon_start 1 locus_tag LOCUS_28190 CDS 126702..127226 product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884720.1 transl_table 11 codon_start 1 locus_tag LOCUS_28200 CDS 127220..127723 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908562.1 transl_table 11 codon_start 1 locus_tag LOCUS_28210 CDS complement(127710..128027) product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928379.1 transl_table 11 codon_start 1 locus_tag LOCUS_28220 CDS 128065..128508 product YhbP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380404.1 transl_table 11 codon_start 1 locus_tag LOCUS_28230 CDS complement(128488..129006) product protein/nucleic acid deglycase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037599.1 transl_table 11 codon_start 1 locus_tag LOCUS_28240 gene yhbO CDS 129137..129772 product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001638995.1 transl_table 11 codon_start 1 locus_tag LOCUS_28250 CDS complement(129839..130414) product division/outer membrane stress-associated lipid-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643280.1 transl_table 11 codon_start 1 locus_tag LOCUS_28260 gene dolP CDS complement(130424..131014) product DnaA initiator-associating protein DiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893483.1 transl_table 11 codon_start 1 locus_tag LOCUS_28270 gene diaA CDS complement(131036..131431) product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057282.1 transl_table 11 codon_start 1 locus_tag LOCUS_28280 CDS complement(131389..133431) product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249248.1 transl_table 11 codon_start 1 locus_tag LOCUS_28290 CDS 133495..134358 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812294.1 transl_table 11 codon_start 1 locus_tag LOCUS_28300 gene rsmI CDS complement(134516..135289) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083899.1 transl_table 11 codon_start 1 locus_tag LOCUS_28310 CDS complement(135400..136443) product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844177.1 transl_table 11 codon_start 1 locus_tag LOCUS_28320 gene gatD CDS complement(136487..137860) product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490608.1 transl_table 11 codon_start 1 locus_tag LOCUS_28330 CDS complement(137864..138148) product PTS galactitol transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824293.1 transl_table 11 codon_start 1 locus_tag LOCUS_28340 gene gatB CDS complement(138179..138643) product PTS galactitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080443.1 transl_table 11 codon_start 1 locus_tag LOCUS_28350 gene gatA CDS complement(138658..139929) product tagatose-bisphosphate aldolase subunit GatZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853833.1 transl_table 11 codon_start 1 locus_tag LOCUS_28360 gene gatZ CDS complement(140049..140903) product tagatose bisphosphate family class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469985.1 transl_table 11 codon_start 1 locus_tag LOCUS_28370 CDS complement(141161..142732) product galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273719.1 transl_table 11 codon_start 1 locus_tag LOCUS_28380 gene garD CDS 143262..144032 product 2-dehydro-3-deoxyglucarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057715.1 transl_table 11 codon_start 1 locus_tag LOCUS_28390 gene garL CDS 144058..144948 product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178106.1 transl_table 11 codon_start 1 locus_tag LOCUS_28400 gene garR CDS 145046..146191 product glycerate 2-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706461.1 transl_table 11 codon_start 1 locus_tag LOCUS_28410 gene garK sequence15 source 1..115486 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 162..749 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032646.1 transl_table 11 codon_start 1 locus_tag LOCUS_28420 CDS 883..3528 product outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181237660.1 transl_table 11 codon_start 1 locus_tag LOCUS_28430 CDS 3541..4314 product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044464.1 transl_table 11 codon_start 1 locus_tag LOCUS_28440 CDS 4340..4840 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178263.1 transl_table 11 codon_start 1 locus_tag LOCUS_28450 CDS 4855..5325 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832400.1 transl_table 11 codon_start 1 locus_tag LOCUS_28460 CDS 5322..5858 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079652.1 transl_table 11 codon_start 1 locus_tag LOCUS_28470 CDS 5913..6944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28480 CDS complement(7294..9528) product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226841.1 transl_table 11 codon_start 1 locus_tag LOCUS_28490 gene relA CDS complement(9580..10875) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046844.1 transl_table 11 codon_start 1 locus_tag LOCUS_28500 gene rlmD CDS 10933..13689 product two-component sensor histidine kinase BarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186405.1 transl_table 11 codon_start 1 locus_tag LOCUS_28510 gene barA CDS complement(13733..14875) product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706477.1 transl_table 11 codon_start 1 locus_tag LOCUS_28520 CDS complement(14953..16293) product glucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107119.1 transl_table 11 codon_start 1 locus_tag LOCUS_28530 gene gudD CDS complement(16314..17654) product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211809.1 transl_table 11 codon_start 1 locus_tag LOCUS_28540 CDS complement(17651..19009) product galactarate/glucarate/glycerate transporter GudP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097011.1 transl_table 11 codon_start 1 locus_tag LOCUS_28550 gene gudP CDS 19089..19340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28560 CDS complement(19490..19939) product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807735.1 transl_table 11 codon_start 1 locus_tag LOCUS_28570 CDS complement(19958..20740) product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000890022.1 transl_table 11 codon_start 1 locus_tag LOCUS_28580 gene truC CDS complement(20740..21069) product YqcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207010.1 transl_table 11 codon_start 1 locus_tag LOCUS_28590 CDS complement(21681..22226) product SecY-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343990.1 transl_table 11 codon_start 1 locus_tag LOCUS_28600 gene syd CDS 22295..23143 product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100463.1 transl_table 11 codon_start 1 locus_tag LOCUS_28610 gene queF CDS 23256..24620 product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627966.1 transl_table 11 codon_start 1 locus_tag LOCUS_28620 gene ppnN CDS 25185..26474 product HAAAP family serine/threonine permease SdaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859030.1 transl_table 11 codon_start 1 locus_tag LOCUS_28630 gene sdaC CDS 26533..27900 product L-serine ammonia-lyase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626388.1 transl_table 11 codon_start 1 locus_tag LOCUS_28640 gene sdaB CDS 28070..28825 product flap endonuclease Xni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001532501.1 transl_table 11 codon_start 1 locus_tag LOCUS_28650 gene xni CDS complement(28917..30065) product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013573.1 transl_table 11 codon_start 1 locus_tag LOCUS_28660 gene fucO CDS complement(30082..30729) product L-fuculose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440828.1 transl_table 11 codon_start 1 locus_tag LOCUS_28670 gene fucA CDS 31285..32601 product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528619.1 transl_table 11 codon_start 1 locus_tag LOCUS_28680 gene fucP CDS 32633..34408 product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724126.1 transl_table 11 codon_start 1 locus_tag LOCUS_28690 gene fucI CDS 34509..35927 product L-fuculokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001763972.1 transl_table 11 codon_start 1 locus_tag LOCUS_28700 gene fucK CDS 35929..36351 product L-fucose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920848.1 transl_table 11 codon_start 1 locus_tag LOCUS_28710 gene fucU CDS 36409..37119 product L-fucose operon activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642330.1 transl_table 11 codon_start 1 locus_tag LOCUS_28720 gene fucR CDS complement(37178..38278) product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045494.1 transl_table 11 codon_start 1 locus_tag LOCUS_28730 gene rlmM CDS complement(38271..38672) product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203913.1 transl_table 11 codon_start 1 locus_tag LOCUS_28740 CDS complement(38685..39461) product glycine cleavage system transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044409.1 transl_table 11 codon_start 1 locus_tag LOCUS_28750 gene gcvA CDS complement(39949..40176) product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750393.1 transl_table 11 codon_start 1 locus_tag LOCUS_28760 CDS 40369..41574 product cysteine desulfurase CsdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991058.1 transl_table 11 codon_start 1 locus_tag LOCUS_28770 gene csdA CDS 41574..42017 product cysteine desulfurase sulfur acceptor subunit CsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184198.1 transl_table 11 codon_start 1 locus_tag LOCUS_28780 gene csdE CDS 42533..43204 product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014343890.1 transl_table 11 codon_start 1 locus_tag LOCUS_28790 gene rarD CDS complement(43256..44062) product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117742.1 transl_table 11 codon_start 1 locus_tag LOCUS_28800 gene tcdA CDS complement(44172..45269) product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678621.1 transl_table 11 codon_start 1 locus_tag LOCUS_28810 gene mltA tRNA 45477..45553 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 tRNA 45583..45659 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 CDS complement(45769..46965) product N-acetylmuramoyl-L-alanine amidase AmiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011916.1 transl_table 11 codon_start 1 locus_tag LOCUS_28820 gene amiC CDS 47255..48586 product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588970.1 transl_table 11 codon_start 1 locus_tag LOCUS_28830 gene argA CDS complement(48689..50524) product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155175.1 transl_table 11 codon_start 1 locus_tag LOCUS_28840 gene recD CDS complement(50521..54066) product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000533.1 transl_table 11 codon_start 1 locus_tag LOCUS_28850 gene recB CDS complement(54059..56947) product pitrilysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138262.1 transl_table 11 codon_start 1 locus_tag LOCUS_28860 gene ptrA CDS complement(57125..60496) product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000946820.1 transl_table 11 codon_start 1 locus_tag LOCUS_28870 gene recC CDS complement(60512..60832) product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019280.1 transl_table 11 codon_start 1 locus_tag LOCUS_28880 CDS complement(60817..61224) product DUF2509 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078536.1 transl_table 11 codon_start 1 locus_tag LOCUS_28890 CDS complement(61221..61784) product prepilin peptidase-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029148.1 transl_table 11 codon_start 1 locus_tag LOCUS_28900 CDS complement(61775..62245) product prepilin peptidase-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857051.1 transl_table 11 codon_start 1 locus_tag LOCUS_28910 CDS complement(62430..63224) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816222.1 transl_table 11 codon_start 1 locus_tag LOCUS_28920 gene thyA CDS complement(63231..64106) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204645.1 transl_table 11 codon_start 1 locus_tag LOCUS_28930 gene lgt CDS complement(64322..66568) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957883.1 transl_table 11 codon_start 1 locus_tag LOCUS_28940 gene ptsP CDS complement(66581..67111) product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000564481.1 transl_table 11 codon_start 1 locus_tag LOCUS_28950 gene rppH CDS 67794..68489 product DNA mismatch repair endonuclease MutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274935.1 transl_table 11 codon_start 1 locus_tag LOCUS_28960 gene mutH CDS 68671..69384 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895635.1 transl_table 11 codon_start 1 locus_tag LOCUS_28970 CDS 69554..69772 product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758664.1 transl_table 11 codon_start 1 locus_tag LOCUS_28980 CDS 69963..71003 product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558970.1 transl_table 11 codon_start 1 locus_tag LOCUS_28990 CDS complement(71090..72292) product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004684.1 transl_table 11 codon_start 1 locus_tag LOCUS_29000 gene lplT CDS complement(72285..74444) product bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896085.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 gene aas CDS 75037..76065 product HTH-type transcriptional regulator GalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201028.1 transl_table 11 codon_start 1 locus_tag LOCUS_29020 gene galR CDS 76076..77098 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968342.1 transl_table 11 codon_start 1 locus_tag LOCUS_29030 CDS complement(77108..78370) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056585.1 transl_table 11 codon_start 1 locus_tag LOCUS_29040 gene lysA CDS 78488..79423 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741798.1 transl_table 11 codon_start 1 locus_tag LOCUS_29050 CDS complement(79395..80102) product aspartate/glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848628.1 transl_table 11 codon_start 1 locus_tag LOCUS_29060 CDS complement(80215..81633) product arabinose-proton symporter AraE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253635.1 transl_table 11 codon_start 1 locus_tag LOCUS_29070 gene araE CDS complement(81987..82748) product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602495.1 transl_table 11 codon_start 1 locus_tag LOCUS_29080 gene kduD CDS complement(82805..83713) product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383270.1 transl_table 11 codon_start 1 locus_tag LOCUS_29090 gene kduI CDS complement(84072..85250) product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665983.1 transl_table 11 codon_start 1 locus_tag LOCUS_29100 CDS complement(85373..86236) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270764.1 transl_table 11 codon_start 1 locus_tag LOCUS_29110 CDS 86340..86795 product multidrug/biocide efflux PACE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597495.1 transl_table 11 codon_start 1 locus_tag LOCUS_29120 CDS 86937..88166 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036836.1 transl_table 11 codon_start 1 locus_tag LOCUS_29130 CDS complement(88197..88469) product Ni(II)/Co(II)-binding transcriptional repressor RcnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019953.1 transl_table 11 codon_start 1 locus_tag LOCUS_29140 gene rcnR CDS 88591..89427 product nickel/cobalt efflux protein RcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134629.1 transl_table 11 codon_start 1 locus_tag LOCUS_29150 gene rcnA CDS complement(89637..90395) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134788.1 transl_table 11 codon_start 1 locus_tag LOCUS_29160 CDS complement(90382..90894) product CaiF/GrlA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000336256.1 transl_table 11 codon_start 1 locus_tag LOCUS_29170 CDS complement(91038..92114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141334.1 transl_table 11 codon_start 1 locus_tag LOCUS_29180 CDS complement(92111..92854) product fimbrial biogenesis chaperone StdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798497.1 transl_table 11 codon_start 1 locus_tag LOCUS_29190 gene stdC CDS complement(92895..95378) product fimbrial outer membrane usher protein StdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705516.1 transl_table 11 codon_start 1 locus_tag LOCUS_29200 gene stdB CDS complement(95498..96079) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244646.1 transl_table 11 codon_start 1 locus_tag LOCUS_29210 CDS complement(96798..97430) product YfdX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835265.1 transl_table 11 codon_start 1 locus_tag LOCUS_29220 CDS complement(97477..98004) product STM3031 family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038500.1 transl_table 11 codon_start 1 locus_tag LOCUS_29230 CDS complement(98821..99219) product tRNA(fMet)-specific endonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911334.1 transl_table 11 codon_start 1 locus_tag LOCUS_29240 gene vapC CDS complement(99219..99470) product toxin-antitoxin system antitoxin VapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557549.1 transl_table 11 codon_start 1 locus_tag LOCUS_29250 gene vapB CDS 99645..99905 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29260 CDS 100191..100991 product DUF1460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989071.1 transl_table 11 codon_start 1 locus_tag LOCUS_29270 tRNA complement(101123..101196) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 CDS complement(101276..102034) product amidase activator ActS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518939.1 transl_table 11 codon_start 1 locus_tag LOCUS_29280 gene actS CDS 102299..102844 product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133998.1 transl_table 11 codon_start 1 locus_tag LOCUS_29290 gene idi CDS complement(102920..104437) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003338.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 gene lysS CDS complement(104447..105328) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989230.1 transl_table 11 codon_start 1 locus_tag LOCUS_29310 gene prfB note possible pseudo, frameshifted CDS complement(105650..107383) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813396.1 transl_table 11 codon_start 1 locus_tag LOCUS_29320 gene recJ CDS complement(107389..108102) product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745614.1 transl_table 11 codon_start 1 locus_tag LOCUS_29330 gene dsbC CDS complement(108126..109022) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434302.1 transl_table 11 codon_start 1 locus_tag LOCUS_29340 gene xerD CDS 109135..109656 product flavodoxin FldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055885.1 transl_table 11 codon_start 1 locus_tag LOCUS_29350 gene fldB CDS complement(109709..110122) product protein YgfX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244781.1 transl_table 11 codon_start 1 locus_tag LOCUS_29360 CDS complement(110103..110369) product FAD assembly factor SdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351186.1 transl_table 11 codon_start 1 locus_tag LOCUS_29370 gene sdhE CDS 110368..110604 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29380 CDS 110619..111599 product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000874170.1 transl_table 11 codon_start 1 locus_tag LOCUS_29390 gene ygfZ CDS complement(111715..112374) product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250289.1 transl_table 11 codon_start 1 locus_tag LOCUS_29400 CDS complement(112538..112849) product N(4)-acetylcytidine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182971.1 transl_table 11 codon_start 1 locus_tag LOCUS_29410 gene yqfB CDS 113022..114440 product 6-phospho-beta-glucosidase BglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230148.1 transl_table 11 codon_start 1 locus_tag LOCUS_29420 gene bglA CDS complement(114488..115381) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819369.1 transl_table 11 codon_start 1 locus_tag LOCUS_29430 sequence16 source 1..114526 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(75..956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29440 CDS 1322..1930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29450 CDS 2292..2789 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29460 CDS 3268..3519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212204.1 transl_table 11 codon_start 1 locus_tag LOCUS_29470 CDS complement(3591..4865) product integrase arm-type DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032666220.1 transl_table 11 codon_start 1 locus_tag LOCUS_29480 tRNA complement(5045..5120) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 tRNA complement(6015..6090) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 CDS complement(6191..6988) product DgsA anti-repressor MtfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598924.1 transl_table 11 codon_start 1 locus_tag LOCUS_29490 gene mtfA tRNA 7077..7166 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 CDS 8181..8999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29500 CDS 9461..10483 product IS110-like element IS1111A family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041952483.1 transl_table 11 codon_start 1 locus_tag LOCUS_29510 CDS complement(10656..10805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29520 tRNA complement(11678..11765) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 CDS 12001..12939 product glyoxylate/hydroxypyruvate reductase GhrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402555.1 transl_table 11 codon_start 1 locus_tag LOCUS_29530 gene ghrA CDS 13024..13761 product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283643.1 transl_table 11 codon_start 1 locus_tag LOCUS_29540 CDS 13785..14339 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001883.1 transl_table 11 codon_start 1 locus_tag LOCUS_29550 CDS 14440..14922 product DUF1097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337814.1 transl_table 11 codon_start 1 locus_tag LOCUS_29560 CDS complement(14961..15794) product curli production assembly/transport protein CsgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137620.1 transl_table 11 codon_start 1 locus_tag LOCUS_29570 gene csgG CDS complement(15821..16237) product curli production assembly/transport protein CsgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264073.1 transl_table 11 codon_start 1 locus_tag LOCUS_29580 gene csgF CDS complement(16264..16659) product curli production assembly/transport protein CsgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833307.1 transl_table 11 codon_start 1 locus_tag LOCUS_29590 gene csgE CDS complement(16664..17314) product biofilm master transcriptional regulator CsgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481516.1 transl_table 11 codon_start 1 locus_tag LOCUS_29600 gene csgD CDS 18042..18524 product curli minor subunit CsgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791653.1 transl_table 11 codon_start 1 locus_tag LOCUS_29610 gene csgB CDS 18566..19021 product curli major subunit CsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771416.1 transl_table 11 codon_start 1 locus_tag LOCUS_29620 gene csgA CDS 19083..19409 product curli assembly chaperone CsgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557254.1 transl_table 11 codon_start 1 locus_tag LOCUS_29630 gene csgC CDS 19540..19860 product type 1 fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111254.1 transl_table 11 codon_start 1 locus_tag LOCUS_29640 CDS 19947..20486 product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203944.1 transl_table 11 codon_start 1 locus_tag LOCUS_29650 gene ymdB CDS 20413..21909 product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976323.1 transl_table 11 codon_start 1 locus_tag LOCUS_29660 CDS complement(21926..23080) product glucans biosynthesis protein MdoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100054.1 transl_table 11 codon_start 1 locus_tag LOCUS_29670 gene mdoC CDS 23355..24887 product glucans biosynthesis protein MdoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001562609.1 transl_table 11 codon_start 1 locus_tag LOCUS_29680 gene mdoG CDS 24880..27423 product glucans biosynthesis glucosyltransferase MdoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044602.1 transl_table 11 codon_start 1 locus_tag LOCUS_29690 gene mdoH CDS 27497..27724 product YceK/YidQ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217832.1 transl_table 11 codon_start 1 locus_tag LOCUS_29700 CDS complement(27725..28099) product MysB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180050.1 transl_table 11 codon_start 1 locus_tag LOCUS_29710 CDS complement(28181..29395) product multidrug efflux MFS transporter MdtG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075040.1 transl_table 11 codon_start 1 locus_tag LOCUS_29720 gene mdtG CDS complement(29550..30470) product Kdo(2)-lipid IV(A) acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163974.1 transl_table 11 codon_start 1 locus_tag LOCUS_29730 CDS 30690..31742 product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144640.1 transl_table 11 codon_start 1 locus_tag LOCUS_29740 CDS complement(31794..32369) product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739886.1 transl_table 11 codon_start 1 locus_tag LOCUS_29750 CDS complement(32366..32938) product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011132.1 transl_table 11 codon_start 1 locus_tag LOCUS_29760 CDS complement(33355..34473) product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872781.1 transl_table 11 codon_start 1 locus_tag LOCUS_29770 gene solA CDS complement(34586..34840) product biofilm formation regulator BssS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414441.1 transl_table 11 codon_start 1 locus_tag LOCUS_29780 gene bssS CDS complement(35130..35375) product DNA damage-inducible protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217768.1 transl_table 11 codon_start 1 locus_tag LOCUS_29790 gene dinI CDS complement(35449..36495) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126592.1 transl_table 11 codon_start 1 locus_tag LOCUS_29800 gene pyrC CDS complement(36599..37159) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713057.1 transl_table 11 codon_start 1 locus_tag LOCUS_29810 CDS complement(37284..37931) product glutaredoxin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780893.1 transl_table 11 codon_start 1 locus_tag LOCUS_29820 gene grxB CDS complement(37995..39203) product multidrug efflux MFS transporter MdtH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092170.1 transl_table 11 codon_start 1 locus_tag LOCUS_29830 gene mdtH CDS 39440..40024 product ribosomal protein S5-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468201.1 transl_table 11 codon_start 1 locus_tag LOCUS_29840 gene rimJ CDS 40060..40707 product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873047.1 transl_table 11 codon_start 1 locus_tag LOCUS_29850 CDS 40709..41632 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259737.1 transl_table 11 codon_start 1 locus_tag LOCUS_29860 CDS 41897..43471 product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001155214.1 transl_table 11 codon_start 1 locus_tag LOCUS_29870 gene murJ CDS complement(43553..43975) product flagella biosynthesis chaperone FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197547.1 transl_table 11 codon_start 1 locus_tag LOCUS_29880 gene flgN CDS complement(43980..44273) product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020892.1 transl_table 11 codon_start 1 locus_tag LOCUS_29890 gene flgM CDS complement(44365..45024) product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194076.1 transl_table 11 codon_start 1 locus_tag LOCUS_29900 gene flgA CDS 45181..45597 product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887042.1 transl_table 11 codon_start 1 locus_tag LOCUS_29910 gene flgB CDS 45601..46005 product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196448.1 transl_table 11 codon_start 1 locus_tag LOCUS_29920 gene flgC CDS 46017..46715 product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020450.1 transl_table 11 codon_start 1 locus_tag LOCUS_29930 gene flgD CDS 46742..47953 product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010567.1 transl_table 11 codon_start 1 locus_tag LOCUS_29940 gene flgE CDS 47974..48729 product flagellar basal body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349284.1 transl_table 11 codon_start 1 locus_tag LOCUS_29950 CDS 48743..49525 product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625851.1 transl_table 11 codon_start 1 locus_tag LOCUS_29960 gene flgG CDS 49580..50278 product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174897.1 transl_table 11 codon_start 1 locus_tag LOCUS_29970 gene flgH CDS 50284..51387 product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518955.1 transl_table 11 codon_start 1 locus_tag LOCUS_29980 CDS 51387..52337 product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578683.1 transl_table 11 codon_start 1 locus_tag LOCUS_29990 gene flgJ CDS 52402..54063 product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096425.1 transl_table 11 codon_start 1 locus_tag LOCUS_30000 gene flgK CDS 54078..55031 product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223025.1 transl_table 11 codon_start 1 locus_tag LOCUS_30010 gene flgL CDS complement(55278..58484) product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827472.1 transl_table 11 codon_start 1 locus_tag LOCUS_30020 gene rne CDS 59016..60017 product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846324.1 transl_table 11 codon_start 1 locus_tag LOCUS_30030 gene rluC CDS 60155..60916 product DUF3053 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094974.1 transl_table 11 codon_start 1 locus_tag LOCUS_30040 CDS 61119..61343 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30050 CDS complement(61414..61998) product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137608.1 transl_table 11 codon_start 1 locus_tag LOCUS_30060 CDS 62196..62717 product 23S rRNA accumulation protein YceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174492.1 transl_table 11 codon_start 1 locus_tag LOCUS_30070 gene yceD CDS 62769..62942 product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290727.1 transl_table 11 codon_start 1 locus_tag LOCUS_30080 gene rpmF CDS 63076..64155 product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518286.1 transl_table 11 codon_start 1 locus_tag LOCUS_30090 gene plsX CDS 64235..65188 product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288151.1 transl_table 11 codon_start 1 locus_tag LOCUS_30100 gene fabH CDS 65204..66133 product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191346.1 transl_table 11 codon_start 1 locus_tag LOCUS_30110 gene fabD CDS 66146..66880 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007236.1 transl_table 11 codon_start 1 locus_tag LOCUS_30120 gene fabG CDS 67036..67272 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103754.1 transl_table 11 codon_start 1 locus_tag LOCUS_30130 gene acpP CDS 67358..68599 product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044667.1 transl_table 11 codon_start 1 locus_tag LOCUS_30140 gene fabF CDS 68723..69532 product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478660.1 transl_table 11 codon_start 1 locus_tag LOCUS_30150 gene pabC CDS 69535..70557 product cell division protein YceG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000736473.1 transl_table 11 codon_start 1 locus_tag LOCUS_30160 gene yceG CDS 70547..71188 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535399.1 transl_table 11 codon_start 1 locus_tag LOCUS_30170 gene tmk CDS 71185..72189 product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872450.1 transl_table 11 codon_start 1 locus_tag LOCUS_30180 gene holB CDS 72200..72997 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480274.1 transl_table 11 codon_start 1 locus_tag LOCUS_30190 CDS 73292..74725 product PTS glucose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000475735.1 transl_table 11 codon_start 1 locus_tag LOCUS_30200 gene ptsG CDS complement(74810..76984) product ferric-rhodotorulic acid/ferric-coprogen receptor FhuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953420.1 transl_table 11 codon_start 1 locus_tag LOCUS_30210 gene fhuE CDS 77326..77685 product purine nucleoside phosphoramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001532068.1 transl_table 11 codon_start 1 locus_tag LOCUS_30220 gene hinT CDS 77688..78062 product YcfL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589560.1 transl_table 11 codon_start 1 locus_tag LOCUS_30230 CDS 78076..78714 product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164360.1 transl_table 11 codon_start 1 locus_tag LOCUS_30240 gene lpoB CDS 78695..79519 product thiamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257320.1 transl_table 11 codon_start 1 locus_tag LOCUS_30250 gene thiK CDS 79530..80555 product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529339.1 transl_table 11 codon_start 1 locus_tag LOCUS_30260 gene nagZ CDS 80580..81122 product alpha/beta hydrolase YcfP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587943.1 transl_table 11 codon_start 1 locus_tag LOCUS_30270 gene ycfP CDS 81377..82681 product NADH-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211053.1 transl_table 11 codon_start 1 locus_tag LOCUS_30280 gene ndh CDS 82860..83399 product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043449.1 transl_table 11 codon_start 1 locus_tag LOCUS_30290 CDS complement(83473..84108) product TetR family copper-responsive transcriptional repressor ComR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205980.1 transl_table 11 codon_start 1 locus_tag LOCUS_30300 gene comR CDS 84350..84607 product multiple stress resistance protein BhsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800134.1 transl_table 11 codon_start 1 locus_tag LOCUS_30310 gene bhsA CDS complement(84704..85669) product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000482967.1 transl_table 11 codon_start 1 locus_tag LOCUS_30320 CDS complement(85817..89263) product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114340.1 transl_table 11 codon_start 1 locus_tag LOCUS_30330 gene mfd CDS 89601..90800 product lipoprotein-releasing ABC transporter permease subunit LolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272105.1 transl_table 11 codon_start 1 locus_tag LOCUS_30340 gene lolC CDS 90793..91494 product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033714.1 transl_table 11 codon_start 1 locus_tag LOCUS_30350 gene lolD CDS 91494..92738 product lipoprotein-releasing ABC transporter permease subunit LolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168092.1 transl_table 11 codon_start 1 locus_tag LOCUS_30360 gene lolE CDS 92767..93678 product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291327.1 transl_table 11 codon_start 1 locus_tag LOCUS_30370 gene nagK CDS 93697..94518 product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191856.1 transl_table 11 codon_start 1 locus_tag LOCUS_30380 gene cobB CDS complement(94600..95646) product spermidine/putrescine ABC transporter substrate-binding protein PotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759329.1 transl_table 11 codon_start 1 locus_tag LOCUS_30390 gene potD CDS complement(95671..96450) product spermidine/putrescine ABC transporter permease PotC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580299.1 transl_table 11 codon_start 1 locus_tag LOCUS_30400 gene potC CDS complement(96766..97776) product SPI-2 type III secretion system effector SifA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001682002.1 transl_table 11 codon_start 1 locus_tag LOCUS_30410 gene sifA CDS complement(98105..98968) product spermidine/putrescine ABC transporter permease PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799391.1 transl_table 11 codon_start 1 locus_tag LOCUS_30420 gene potB CDS complement(98952..100088) product spermidine/putrescine ABC transporter ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531581.1 transl_table 11 codon_start 1 locus_tag LOCUS_30430 gene potA CDS 100339..101568 product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359416.1 transl_table 11 codon_start 1 locus_tag LOCUS_30440 gene pepT CDS 101572..102906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902462.1 transl_table 11 codon_start 1 locus_tag LOCUS_30450 CDS complement(102946..104067) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456524.1 transl_table 11 codon_start 1 locus_tag LOCUS_30460 CDS complement(104148..105611) product two-component system sensor histidine kinase PhoQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031689.1 transl_table 11 codon_start 1 locus_tag LOCUS_30470 gene phoQ CDS complement(105611..106285) product two-component system response regulator PhoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986522.1 transl_table 11 codon_start 1 locus_tag LOCUS_30480 gene phoP CDS complement(106409..107779) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423756.1 transl_table 11 codon_start 1 locus_tag LOCUS_30490 gene purB CDS complement(107783..108430) product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024131182.1 transl_table 11 codon_start 1 locus_tag LOCUS_30500 gene hflD CDS complement(108511..109662) product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004540.1 transl_table 11 codon_start 1 locus_tag LOCUS_30510 gene mnmA CDS complement(109671..110132) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476064.1 transl_table 11 codon_start 1 locus_tag LOCUS_30520 CDS complement(110144..110473) product lysozyme inhibitor LprI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825956.1 transl_table 11 codon_start 1 locus_tag LOCUS_30530 CDS complement(110470..111009) product 23S rRNA pseudouridine(2457) synthase RluE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249410.1 transl_table 11 codon_start 1 locus_tag LOCUS_30540 gene rluE CDS 111307..112557 product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444506.1 transl_table 11 codon_start 1 locus_tag LOCUS_30550 gene icd CDS 113018..114142 product type III secretion system effector SopF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917281.1 transl_table 11 codon_start 1 locus_tag LOCUS_30560 gene sopF sequence17 source 1..97747 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..567 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001763397.1:glycosyltransferase family 1 protein locus_tag LOCUS_30570 CDS 568..1512 product O antigen biosynthesis rhamnosyltransferase RfbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705149.1 transl_table 11 codon_start 1 locus_tag LOCUS_30580 gene rfbN CDS 1513..2952 product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009019.1 transl_table 11 codon_start 1 locus_tag LOCUS_30590 CDS 2939..4372 product O-antigen biosynthesis phosphomannomutase RfbK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103638.1 transl_table 11 codon_start 1 locus_tag LOCUS_30600 gene rfbK CDS 4443..5873 product undecaprenyl-phosphate galactose phosphotransferase WbaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368710.1 transl_table 11 codon_start 1 locus_tag LOCUS_30610 CDS 6037..7443 product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043528.1 transl_table 11 codon_start 1 locus_tag LOCUS_30620 gene gndA CDS 7680..8846 product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704814.1 transl_table 11 codon_start 1 locus_tag LOCUS_30630 gene ugd CDS 8989..9972 product LPS O-antigen chain length determinant protein WzzB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215243.1 transl_table 11 codon_start 1 locus_tag LOCUS_30640 gene wzzB CDS complement(10051..10662) product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954855.1 transl_table 11 codon_start 1 locus_tag LOCUS_30650 gene hisIE CDS complement(10656..11432) product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880125.1 transl_table 11 codon_start 1 locus_tag LOCUS_30660 gene hisF CDS complement(11414..12151) product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586403.1 transl_table 11 codon_start 1 locus_tag LOCUS_30670 gene hisA CDS complement(12151..12741) product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103591.1 transl_table 11 codon_start 1 locus_tag LOCUS_30680 gene hisH CDS complement(12741..13808) product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080040.1 transl_table 11 codon_start 1 locus_tag LOCUS_30690 gene hisB CDS complement(13805..14884) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102709.1 transl_table 11 codon_start 1 locus_tag LOCUS_30700 gene hisC CDS complement(14881..16185) product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009629.1 transl_table 11 codon_start 1 locus_tag LOCUS_30710 gene hisD CDS complement(16288..17187) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886604.1 transl_table 11 codon_start 1 locus_tag LOCUS_30720 gene hisG CDS 17546..18370 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754712.1 transl_table 11 codon_start 1 locus_tag LOCUS_30730 CDS 18416..19330 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803316.1 transl_table 11 codon_start 1 locus_tag LOCUS_30740 CDS 19616..20974 product putrescine/proton symporter PlaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178807.1 transl_table 11 codon_start 1 locus_tag LOCUS_30750 gene plaP CDS complement(21110..22540) product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216700.1 transl_table 11 codon_start 1 locus_tag LOCUS_30760 gene sbcB CDS complement(22907..24232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30770 CDS 25875..28151 product thiosulfate reductase PhsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028230.1 transl_table 11 codon_start 1 locus_tag LOCUS_30780 gene phsA CDS 28166..28744 product thiosulfate reductase electron transport protein PhsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016236.1 transl_table 11 codon_start 1 locus_tag LOCUS_30790 gene phsB CDS 28741..29505 product thiosulfate reductase cytochrome B subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092553.1 transl_table 11 codon_start 1 locus_tag LOCUS_30800 CDS 29629..30801 product serine-type D-Ala-D-Ala carboxypeptidase DacD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296209.1 transl_table 11 codon_start 1 locus_tag LOCUS_30810 gene dacD CDS 30952..31419 product DNA gyrase inhibitor SbmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384326.1 transl_table 11 codon_start 1 locus_tag LOCUS_30820 gene sbmC CDS 31538..32596 product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200856.1 transl_table 11 codon_start 1 locus_tag LOCUS_30830 CDS 32841..33176 product DUF496 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450405.1 transl_table 11 codon_start 1 locus_tag LOCUS_30840 CDS complement(33210..34076) product L-threonine kinase PduX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201312.1 transl_table 11 codon_start 1 locus_tag LOCUS_30850 CDS complement(34170..35384) product propanediol utilization propionate kinase PduW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120652.1 transl_table 11 codon_start 1 locus_tag LOCUS_30860 gene pduW CDS complement(35369..35821) product propanediol utilization protein PduV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826280.1 transl_table 11 codon_start 1 locus_tag LOCUS_30870 gene pduV CDS complement(35826..36176) product propanediol utilization microcompartment protein PduU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000441103.1 transl_table 11 codon_start 1 locus_tag LOCUS_30880 gene pduU CDS complement(36176..36730) product propanediol utilization microcompartment protein PduT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075775.1 transl_table 11 codon_start 1 locus_tag LOCUS_30890 gene pduT CDS complement(36733..38088) product cobalamin reductase PduS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058762.1 transl_table 11 codon_start 1 locus_tag LOCUS_30900 gene pduS CDS complement(38085..39197) product 1-propanol dehydrogenase PduQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091449.1 transl_table 11 codon_start 1 locus_tag LOCUS_30910 gene pduQ CDS complement(39209..40603) product CoA-acylating propionaldehyde dehydrogenase PduP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097666.1 transl_table 11 codon_start 1 locus_tag LOCUS_30920 gene pduP CDS complement(40600..41610) product two-domain cob(I)yrinic acid a,c-diamide adenosyltransferase PduO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029486.1 transl_table 11 codon_start 1 locus_tag LOCUS_30930 gene pduO CDS complement(41620..41895) product propanediol utilization microcompartment protein PduN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549827.1 transl_table 11 codon_start 1 locus_tag LOCUS_30940 gene pduN CDS complement(41899..42390) product propanediol utilization microcompartment protein PduM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012961.1 transl_table 11 codon_start 1 locus_tag LOCUS_30950 gene pduM CDS complement(42387..43019) product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356724.1 transl_table 11 codon_start 1 locus_tag LOCUS_30960 CDS complement(43019..43480) product propanediol utilization microcompartment protein PduK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284376.1 transl_table 11 codon_start 1 locus_tag LOCUS_30970 gene pduK CDS complement(43505..43780) product propanediol utilization microcompartment protein PduJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057755.1 transl_table 11 codon_start 1 locus_tag LOCUS_30980 gene pduJ CDS complement(43799..44149) product propanediol dehydratase reactivase beta subunit PduH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377971.1 transl_table 11 codon_start 1 locus_tag LOCUS_30990 gene pduH CDS complement(44139..45971) product propanediol dehydratase reactivase alpha subunit PduG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268875.1 transl_table 11 codon_start 1 locus_tag LOCUS_31000 gene pduG CDS complement(45981..46502) product propanediol dehydratase small subunit PduE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090601.1 transl_table 11 codon_start 1 locus_tag LOCUS_31010 gene pduE CDS complement(46517..47191) product propanediol dehydratase medium subunit PduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405054.1 transl_table 11 codon_start 1 locus_tag LOCUS_31020 gene pduD CDS complement(47202..48866) product propanediol dehydratase large subunit PduC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256897.1 transl_table 11 codon_start 1 locus_tag LOCUS_31030 gene pduC CDS complement(48885..49697) product propanediol utilization microcompartment protein PduB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097484.1 transl_table 11 codon_start 1 locus_tag LOCUS_31040 gene pduB CDS complement(49694..49978) product propanediol utilization microcompartment protein PduA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183618.1 transl_table 11 codon_start 1 locus_tag LOCUS_31050 gene pduA CDS 50503..51297 product propanediol diffusion facilitator PduF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000027.1 transl_table 11 codon_start 1 locus_tag LOCUS_31060 gene pduF CDS 51513..52424 product regulatory protein PocR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622328.1 transl_table 11 codon_start 1 locus_tag LOCUS_31070 gene pocR CDS 53022..54401 product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741259.1 transl_table 11 codon_start 1 locus_tag LOCUS_31080 CDS 54398..55357 product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153666.1 transl_table 11 codon_start 1 locus_tag LOCUS_31090 gene cbiB CDS 55368..56000 product cobalt-precorrin-8 methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816687.1 transl_table 11 codon_start 1 locus_tag LOCUS_31100 CDS 56000..57139 product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292925.1 transl_table 11 codon_start 1 locus_tag LOCUS_31110 gene cbiD CDS 57133..57738 product cobalt-precorrin-7 (C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958833.1 transl_table 11 codon_start 1 locus_tag LOCUS_31120 CDS 57728..58306 product decarboxylating cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650991.1 transl_table 11 codon_start 1 locus_tag LOCUS_31130 CDS 58290..59063 product cobalt-precorrin-4 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004870.1 transl_table 11 codon_start 1 locus_tag LOCUS_31140 CDS 59125..60099 product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098913.1 transl_table 11 codon_start 1 locus_tag LOCUS_31150 gene cbiG CDS 60099..60824 product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953643.1 transl_table 11 codon_start 1 locus_tag LOCUS_31160 CDS 60836..61612 product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816684.1 transl_table 11 codon_start 1 locus_tag LOCUS_31170 CDS 61615..62409 product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168485.1 transl_table 11 codon_start 1 locus_tag LOCUS_31180 CDS 62406..63119 product cobalt-factor II C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013551.1 transl_table 11 codon_start 1 locus_tag LOCUS_31190 CDS 63116..63853 product cobalt ECF transporter S component CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816682.1 transl_table 11 codon_start 1 locus_tag LOCUS_31200 gene cbiM CDS 63855..64136 product energy-coupling factor ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753216.1 transl_table 11 codon_start 1 locus_tag LOCUS_31210 CDS 64120..64800 product energy-coupling factor ABC transporter transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147138.1 transl_table 11 codon_start 1 locus_tag LOCUS_31220 CDS 64809..65624 product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881535.1 transl_table 11 codon_start 1 locus_tag LOCUS_31230 CDS 65621..67141 product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189676.1 transl_table 11 codon_start 1 locus_tag LOCUS_31240 CDS 67138..67683 product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973185.1 transl_table 11 codon_start 1 locus_tag LOCUS_31250 gene cobU CDS 67680..68423 product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039987.1 transl_table 11 codon_start 1 locus_tag LOCUS_31260 gene cobS CDS 68450..69520 product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193966.1 transl_table 11 codon_start 1 locus_tag LOCUS_31270 gene cobT CDS 69598..70527 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252822.1 transl_table 11 codon_start 1 locus_tag LOCUS_31280 gene ldtA tRNA complement(70753..70828) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 CDS 70919..72445 product EmmdR/YeeO family multidrug/toxin efflux MATE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989199.1 transl_table 11 codon_start 1 locus_tag LOCUS_31290 tRNA 72586..72661 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 CDS 73158..73544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133086100.1 transl_table 11 codon_start 1 locus_tag LOCUS_31300 note possible pseudo, frameshifted CDS 73538..73864 product DUF1493 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886449.1 transl_table 11 codon_start 1 locus_tag LOCUS_31310 CDS 74060..75514 product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428186.1 transl_table 11 codon_start 1 locus_tag LOCUS_31320 CDS 75894..76079 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31330 CDS complement(76036..76209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31340 CDS complement(76419..78149) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645013.1 transl_table 11 codon_start 1 locus_tag LOCUS_31350 CDS complement(78206..80374) product SEL1-like repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211266.1 transl_table 11 codon_start 1 locus_tag LOCUS_31360 CDS complement(80717..81415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31370 CDS complement(81890..82414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31380 CDS 82957..83832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31390 CDS 83983..84201 product AlpA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071599.1 transl_table 11 codon_start 1 locus_tag LOCUS_31400 CDS 84283..84573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31410 CDS 84618..84914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31420 CDS 85160..86431 product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039059.1 transl_table 11 codon_start 1 locus_tag LOCUS_31430 CDS 86496..87044 product SLATT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039060.1 transl_table 11 codon_start 1 locus_tag LOCUS_31440 CDS complement(87460..87864) product H-NS family nucleoid-associated regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287388.1 transl_table 11 codon_start 1 locus_tag LOCUS_31450 CDS complement(88025..88504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31460 CDS complement(88590..89381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31470 CDS complement(89412..90146) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31480 CDS 91506..91775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31490 CDS 91824..92246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31500 CDS 92302..93264 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31510 CDS 93316..94926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31520 CDS complement(95004..95381) product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001417601.1 transl_table 11 codon_start 1 locus_tag LOCUS_31530 gene bamE CDS complement(95485..95886) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31540 CDS 96321..96851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31550 CDS 96862..97137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31560 sequence18 source 1..97011 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 201..656 product DUF4385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985648.1 transl_table 11 codon_start 1 locus_tag LOCUS_31570 CDS 760..2061 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807800.1 transl_table 11 codon_start 1 locus_tag LOCUS_31580 CDS complement(2058..2381) product YfiM family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264473.1 transl_table 11 codon_start 1 locus_tag LOCUS_31590 CDS complement(2426..3784) product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949286.1 transl_table 11 codon_start 1 locus_tag LOCUS_31600 gene pssA CDS complement(3896..6556) product protein lysine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082656.1 transl_table 11 codon_start 1 locus_tag LOCUS_31610 gene pat CDS complement(6610..7290) product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183640.1 transl_table 11 codon_start 1 locus_tag LOCUS_31620 gene tapT CDS complement(7363..7782) product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098738.1 transl_table 11 codon_start 1 locus_tag LOCUS_31630 gene trxC CDS 7986..9023 product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997368.1 transl_table 11 codon_start 1 locus_tag LOCUS_31640 CDS complement(9139..9828) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179978.1 transl_table 11 codon_start 1 locus_tag LOCUS_31650 gene ung CDS 10147..10530 product autonomous glycyl radical cofactor GrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627811.1 transl_table 11 codon_start 1 locus_tag LOCUS_31660 gene grcA CDS complement(10592..11179) product cysteine/O-acetylserine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188410.1 transl_table 11 codon_start 1 locus_tag LOCUS_31670 gene eamB CDS 11282..12181 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309673.1 transl_table 11 codon_start 1 locus_tag LOCUS_31680 CDS complement(12199..13533) product ATP-dependent RNA helicase SrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219176.1 transl_table 11 codon_start 1 locus_tag LOCUS_31690 gene srmB CDS 13663..14400 product tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083348.1 transl_table 11 codon_start 1 locus_tag LOCUS_31700 gene trmN CDS complement(14385..16007) product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000989173.1 transl_table 11 codon_start 1 locus_tag LOCUS_31710 gene nadB CDS 16433..17008 product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003307.1 transl_table 11 codon_start 1 locus_tag LOCUS_31720 gene rpoE CDS 17040..17690 product anti-sigma-E factor RseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168379.1 transl_table 11 codon_start 1 locus_tag LOCUS_31730 gene rseA CDS 17690..18646 product sigma-E factor regulatory protein RseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812023.1 transl_table 11 codon_start 1 locus_tag LOCUS_31740 gene rseB CDS 18643..19122 product SoxR-reducing system protein RseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589049.1 transl_table 11 codon_start 1 locus_tag LOCUS_31750 gene rseC CDS 19373..21172 product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790154.1 transl_table 11 codon_start 1 locus_tag LOCUS_31760 gene lepA CDS 21189..22163 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002559.1 transl_table 11 codon_start 1 locus_tag LOCUS_31770 gene lepB CDS 22503..23117 product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989216.1 transl_table 11 codon_start 1 locus_tag LOCUS_31780 gene rnc CDS 23114..24019 product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102231.1 transl_table 11 codon_start 1 locus_tag LOCUS_31790 gene era CDS 24031..24759 product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399380.1 transl_table 11 codon_start 1 locus_tag LOCUS_31800 gene recO CDS 24771..25502 product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818969.1 transl_table 11 codon_start 1 locus_tag LOCUS_31810 gene pdxJ CDS 25502..25882 product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986043.1 transl_table 11 codon_start 1 locus_tag LOCUS_31820 gene acpS CDS complement(25994..26254) product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196291.1 transl_table 11 codon_start 1 locus_tag LOCUS_31830 CDS complement(26292..27218) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001581956.1 transl_table 11 codon_start 1 locus_tag LOCUS_31840 CDS 27334..28530 product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276374.1 transl_table 11 codon_start 1 locus_tag LOCUS_31850 CDS 28552..29469 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684023.1 transl_table 11 codon_start 1 locus_tag LOCUS_31860 CDS complement(29508..30356) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000995694.1 transl_table 11 codon_start 1 locus_tag LOCUS_31870 CDS 30472..31365 product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048539.1 transl_table 11 codon_start 1 locus_tag LOCUS_31880 gene murQ CDS 31376..32737 product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361665.1 transl_table 11 codon_start 1 locus_tag LOCUS_31890 CDS 32741..33376 product phosphatidylglycerophosphatase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253562.1 transl_table 11 codon_start 1 locus_tag LOCUS_31900 gene yfhb CDS 33434..33952 product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001134566.1 transl_table 11 codon_start 1 locus_tag LOCUS_31910 gene tadA CDS complement(34003..35547) product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734212.1 transl_table 11 codon_start 1 locus_tag LOCUS_31920 gene mltF CDS 35803..39690 product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970035.1 transl_table 11 codon_start 1 locus_tag LOCUS_31930 gene purL CDS complement(40128..40307) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31940 CDS 40385..41770 product two component system sensor histidine kinase QseE/GlrK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001538042.1 transl_table 11 codon_start 1 locus_tag LOCUS_31950 gene qseE CDS 41850..42536 product two-component system QseEF-associated lipoprotein QseG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054242.1 transl_table 11 codon_start 1 locus_tag LOCUS_31960 gene qseG CDS 42533..43870 product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625590.1 transl_table 11 codon_start 1 locus_tag LOCUS_31970 gene glrR CDS 43947..44285 product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914032.1 transl_table 11 codon_start 1 locus_tag LOCUS_31980 gene glnB CDS complement(44334..45794) product dipeptide permease DtpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856790.1 transl_table 11 codon_start 1 locus_tag LOCUS_31990 gene dtpD CDS complement(45850..47994) product lysine decarboxylase CadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100652.1 transl_table 11 codon_start 1 locus_tag LOCUS_32000 gene cadA CDS complement(48077..49408) product cadaverine/lysine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100004.1 transl_table 11 codon_start 1 locus_tag LOCUS_32010 gene cadB CDS complement(49769..51313) product lysine decarboxylation/transport transcriptional activator CadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187128.1 transl_table 11 codon_start 1 locus_tag LOCUS_32020 gene cadC CDS complement(51495..52685) product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883143.1 transl_table 11 codon_start 1 locus_tag LOCUS_32030 gene hmpA CDS 53010..54263 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919178.1 transl_table 11 codon_start 1 locus_tag LOCUS_32040 CDS 54459..55598 product 3-phenylpropionate MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173729.1 transl_table 11 codon_start 1 locus_tag LOCUS_32050 CDS complement(55593..56870) product stationary phase inducible protein CsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982954.1 transl_table 11 codon_start 1 locus_tag LOCUS_32060 gene csiE CDS 56966..57634 product DUF1007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805721.1 transl_table 11 codon_start 1 locus_tag LOCUS_32070 CDS 57625..58611 product nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098297.1 transl_table 11 codon_start 1 locus_tag LOCUS_32080 CDS complement(58612..59625) product sulfite reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020685.1 transl_table 11 codon_start 1 locus_tag LOCUS_32090 gene asrC CDS complement(59636..60454) product anaerobic sulfite reductase subunit AsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017585.1 transl_table 11 codon_start 1 locus_tag LOCUS_32100 gene asrB CDS complement(60458..60694) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32110 note possible pseudo, frameshifted CDS complement(60678..61502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32120 note possible pseudo, frameshifted CDS complement(61684..62562) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174949.1 transl_table 11 codon_start 1 locus_tag LOCUS_32130 CDS complement(62707..63510) product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553464.1 transl_table 11 codon_start 1 locus_tag LOCUS_32140 gene suhB CDS 63629..64360 product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940032.1 transl_table 11 codon_start 1 locus_tag LOCUS_32150 gene trmJ CDS 64520..65014 product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241346.1 transl_table 11 codon_start 1 locus_tag LOCUS_32160 gene iscR CDS 65195..66409 product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775265.1 transl_table 11 codon_start 1 locus_tag LOCUS_32170 gene iscS CDS 66437..66823 product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331704.1 transl_table 11 codon_start 1 locus_tag LOCUS_32180 gene iscU CDS 66852..67175 product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028952.1 transl_table 11 codon_start 1 locus_tag LOCUS_32190 gene iscA CDS 67371..67886 product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384391.1 transl_table 11 codon_start 1 locus_tag LOCUS_32200 gene hscB CDS 67899..69749 product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196658.1 transl_table 11 codon_start 1 locus_tag LOCUS_32210 gene hscA CDS 69751..70086 product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124466.1 transl_table 11 codon_start 1 locus_tag LOCUS_32220 gene fdx CDS 70098..70298 product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523621.1 transl_table 11 codon_start 1 locus_tag LOCUS_32230 gene iscX CDS 70476..71759 product aminopeptidase PepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133543.1 transl_table 11 codon_start 1 locus_tag LOCUS_32240 gene pepB CDS 71860..72645 product enhanced serine sensitivity protein SseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612718.1 transl_table 11 codon_start 1 locus_tag LOCUS_32250 gene sseB CDS complement(73214..73882) product DUF5066 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355346.1 transl_table 11 codon_start 1 locus_tag LOCUS_32260 CDS complement(74128..74970) product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205251.1 transl_table 11 codon_start 1 locus_tag LOCUS_32270 gene sseA CDS 75179..80113 product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681887.1 transl_table 11 codon_start 1 locus_tag LOCUS_32280 CDS 80114..82429 product peptidoglycan glycosyltransferase PbpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014751.1 transl_table 11 codon_start 1 locus_tag LOCUS_32290 gene pbpC CDS 82864..84963 product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098283.1 transl_table 11 codon_start 1 locus_tag LOCUS_32300 CDS 84960..85589 product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077439.1 transl_table 11 codon_start 1 locus_tag LOCUS_32310 gene dmsB CDS 85582..86391 product dimethyl sulfoxide reductase anchor subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544883.1 transl_table 11 codon_start 1 locus_tag LOCUS_32320 CDS 86391..87254 product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247794.1 transl_table 11 codon_start 1 locus_tag LOCUS_32330 CDS 87375..87806 product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963846.1 transl_table 11 codon_start 1 locus_tag LOCUS_32340 gene ndk CDS 88013..89179 product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003206.1 transl_table 11 codon_start 1 locus_tag LOCUS_32350 CDS 89471..90475 product cytoskeleton protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090905.1 transl_table 11 codon_start 1 locus_tag LOCUS_32360 gene rodZ CDS 90502..91620 product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551816.1 transl_table 11 codon_start 1 locus_tag LOCUS_32370 gene ispG CDS 91731..93005 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107147.1 transl_table 11 codon_start 1 locus_tag LOCUS_32380 gene hisS CDS 93019..93639 product YfgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409190.1 transl_table 11 codon_start 1 locus_tag LOCUS_32390 CDS 93650..94828 product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177072.1 transl_table 11 codon_start 1 locus_tag LOCUS_32400 gene bamB CDS 94947..96419 product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249413.1 transl_table 11 codon_start 1 locus_tag LOCUS_32410 gene der CDS 96508..96729 product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402503.1 transl_table 11 codon_start 1 locus_tag LOCUS_32420 sequence19 source 1..96348 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..522 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000888541.1:cytochrome c biogenesis heme-transporting ATPase CcmA locus_tag LOCUS_32430 CDS 522..1178 product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269359.1 transl_table 11 codon_start 1 locus_tag LOCUS_32440 gene ccmB CDS 1221..1967 product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000266010.1 transl_table 11 codon_start 1 locus_tag LOCUS_32450 CDS 1964..2176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32460 CDS 2173..2652 product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053607.1 transl_table 11 codon_start 1 locus_tag LOCUS_32470 gene ccmE CDS 2649..4580 product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982516.1 transl_table 11 codon_start 1 locus_tag LOCUS_32480 CDS 4577..5134 product thiol:disulfide interchange protein DsbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828299.1 transl_table 11 codon_start 1 locus_tag LOCUS_32490 gene dsbE CDS 5131..6174 product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238304.1 transl_table 11 codon_start 1 locus_tag LOCUS_32500 CDS 6296..7522 product DUF3748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809957.1 transl_table 11 codon_start 1 locus_tag LOCUS_32510 CDS complement(7524..7784) product YceK/YidQ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012543411.1 transl_table 11 codon_start 1 locus_tag LOCUS_32520 CDS 8160..8579 product heat shock chaperone IbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001532742.1 transl_table 11 codon_start 1 locus_tag LOCUS_32530 gene ibpA CDS 8689..9117 product heat shock chaperone IbpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001766501.1 transl_table 11 codon_start 1 locus_tag LOCUS_32540 gene ibpB CDS 9306..10967 product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279784.1 transl_table 11 codon_start 1 locus_tag LOCUS_32550 CDS 11411..11758 product YidH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640235.1 transl_table 11 codon_start 1 locus_tag LOCUS_32560 CDS 11748..12110 product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113457.1 transl_table 11 codon_start 1 locus_tag LOCUS_32570 CDS 12107..12637 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147843.1 transl_table 11 codon_start 1 locus_tag LOCUS_32580 CDS complement(12719..14041) product D-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427787.1 transl_table 11 codon_start 1 locus_tag LOCUS_32590 gene dsdA CDS complement(14059..15396) product D-serine transporter DsdX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543313.1 transl_table 11 codon_start 1 locus_tag LOCUS_32600 gene dsdX CDS 15607..16545 product DNA-binding transcriptional regulator DsdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989264.1 transl_table 11 codon_start 1 locus_tag LOCUS_32610 gene dsdC CDS 16633..17694 product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238915.1 transl_table 11 codon_start 1 locus_tag LOCUS_32620 CDS complement(17621..18805) product multidrug efflux MFS transporter EmrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828742.1 transl_table 11 codon_start 1 locus_tag LOCUS_32630 gene emrD CDS complement(19008..19841) product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094802.1 transl_table 11 codon_start 1 locus_tag LOCUS_32640 CDS 20889..22577 product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168445.1 transl_table 11 codon_start 1 locus_tag LOCUS_32650 gene ilvB CDS 22581..22871 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171826.1 transl_table 11 codon_start 1 locus_tag LOCUS_32660 gene ilvN CDS complement(22873..23658) product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448638.1 transl_table 11 codon_start 1 locus_tag LOCUS_32670 CDS 23983..24903 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350272.1 transl_table 11 codon_start 1 locus_tag LOCUS_32680 gene rbsK CDS 24934..26250 product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998359.1 transl_table 11 codon_start 1 locus_tag LOCUS_32690 gene fucP CDS 26262..27275 product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213216.1 transl_table 11 codon_start 1 locus_tag LOCUS_32700 CDS 27429..28019 product transcriptional regulator UhpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633674.1 transl_table 11 codon_start 1 locus_tag LOCUS_32710 gene uhpA CDS 28019..29521 product signal transduction histidine-protein kinase/phosphatase UhpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091255.1 transl_table 11 codon_start 1 locus_tag LOCUS_32720 gene uhpB CDS 29531..30823 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948180.1 transl_table 11 codon_start 1 locus_tag LOCUS_32730 CDS 31001..32392 product hexose-6-phosphate:phosphate antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879212.1 transl_table 11 codon_start 1 locus_tag LOCUS_32740 gene uhpT CDS 32585..33037 product DUF1198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519640.1 transl_table 11 codon_start 1 locus_tag LOCUS_32750 CDS complement(33470..33793) product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274842.1 transl_table 11 codon_start 1 locus_tag LOCUS_32760 CDS complement(33777..34181) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001263506.1 transl_table 11 codon_start 1 locus_tag LOCUS_32770 CDS 34352..35545 product purine ribonucleoside efflux pump NepI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001004798.1 transl_table 11 codon_start 1 locus_tag LOCUS_32780 gene nepI CDS complement(35605..36987) product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270464.1 transl_table 11 codon_start 1 locus_tag LOCUS_32790 CDS complement(37093..37386) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824217.1 transl_table 11 codon_start 1 locus_tag LOCUS_32800 CDS 37583..40381 product transcriptional regulator DagR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063446280.1 transl_table 11 codon_start 1 locus_tag LOCUS_32810 gene dagR CDS 40600..41025 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214106.1 transl_table 11 codon_start 1 locus_tag LOCUS_32820 CDS 41036..41521 product PTS system mannose/fructose/N-acetylgalactosamine-transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284295.1 transl_table 11 codon_start 1 locus_tag LOCUS_32830 CDS 41667..42416 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380259.1 transl_table 11 codon_start 1 locus_tag LOCUS_32840 CDS 42416..43273 product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093404.1 transl_table 11 codon_start 1 locus_tag LOCUS_32850 CDS 43277..44386 product D-glucosaminate-6-phosphate ammonia lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188469.1 transl_table 11 codon_start 1 locus_tag LOCUS_32860 gene dgaE CDS 44373..45116 product 2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186142.1 transl_table 11 codon_start 1 locus_tag LOCUS_32870 CDS 45352..46293 product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749532.1 transl_table 11 codon_start 1 locus_tag LOCUS_32880 CDS complement(46336..47238) product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535970.1 transl_table 11 codon_start 1 locus_tag LOCUS_32890 CDS 47762..48445 product MgtC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392697.1 transl_table 11 codon_start 1 locus_tag LOCUS_32900 CDS 48665..51391 product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131278.1 transl_table 11 codon_start 1 locus_tag LOCUS_32910 gene mgtA CDS 51706..52185 product anti-virulence regulator CigR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705491.1 transl_table 11 codon_start 1 locus_tag LOCUS_32920 CDS complement(52353..53033) product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106461.1 transl_table 11 codon_start 1 locus_tag LOCUS_32930 CDS 53817..54674 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098484.1 transl_table 11 codon_start 1 locus_tag LOCUS_32940 CDS 54667..55149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001521985.1 transl_table 11 codon_start 1 locus_tag LOCUS_32950 CDS complement(55244..58111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32960 CDS complement(58186..58803) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000984810.1 transl_table 11 codon_start 1 locus_tag LOCUS_32970 CDS 59817..59990 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32980 CDS complement(60102..61139) product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703846.1 transl_table 11 codon_start 1 locus_tag LOCUS_32990 CDS complement(61326..61676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33000 note possible pseudo, internal stop codon CDS complement(61673..62173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33010 note possible pseudo, internal stop codon, frameshifted CDS complement(62170..62667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33020 CDS complement(62682..62858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33030 CDS 63536..63880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33040 tRNA complement(64197..64291) product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00560 CDS 64579..65961 product glycoside-pentoside-hexuronide family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834259.1 transl_table 11 codon_start 1 locus_tag LOCUS_33050 CDS 65973..68291 product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703001.1 transl_table 11 codon_start 1 locus_tag LOCUS_33060 gene yicI CDS complement(68394..70073) product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766661.1 transl_table 11 codon_start 1 locus_tag LOCUS_33070 CDS complement(70224..71615) product xanthine/proton symporter XanP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115428.1 transl_table 11 codon_start 1 locus_tag LOCUS_33080 gene xanP CDS 71843..73048 product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462252.1 transl_table 11 codon_start 1 locus_tag LOCUS_33090 gene gltS CDS complement(73084..75165) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016758.1 transl_table 11 codon_start 1 locus_tag LOCUS_33100 gene recG CDS complement(75171..75860) product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068431.1 transl_table 11 codon_start 1 locus_tag LOCUS_33110 gene trmH CDS complement(75865..77976) product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280498.1 transl_table 11 codon_start 1 locus_tag LOCUS_33120 gene spoT CDS complement(77995..78270) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135058.1 transl_table 11 codon_start 1 locus_tag LOCUS_33130 gene rpoZ CDS complement(78325..78948) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046966.1 transl_table 11 codon_start 1 locus_tag LOCUS_33140 gene gmk CDS 79205..80890 product NAD-dependent DNA ligase LigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309848.1 transl_table 11 codon_start 1 locus_tag LOCUS_33150 gene ligB CDS complement(80887..81504) product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924333.1 transl_table 11 codon_start 1 locus_tag LOCUS_33160 CDS complement(81755..82636) product HARLDQ motif MBL-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083230.1 transl_table 11 codon_start 1 locus_tag LOCUS_33170 CDS 82710..83612 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050861.1 transl_table 11 codon_start 1 locus_tag LOCUS_33180 CDS complement(83662..84525) product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621352.1 transl_table 11 codon_start 1 locus_tag LOCUS_33190 CDS 84651..85367 product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247078.1 transl_table 11 codon_start 1 locus_tag LOCUS_33200 gene rph CDS 85446..86087 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806169.1 transl_table 11 codon_start 1 locus_tag LOCUS_33210 gene pyrE CDS complement(86165..86761) product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818596.1 transl_table 11 codon_start 1 locus_tag LOCUS_33220 gene slmA CDS complement(86869..87327) product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717792.1 transl_table 11 codon_start 1 locus_tag LOCUS_33230 gene dut CDS complement(87305..88528) product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001541625.1 transl_table 11 codon_start 1 locus_tag LOCUS_33240 gene coaBC CDS 88701..89366 product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380129.1 transl_table 11 codon_start 1 locus_tag LOCUS_33250 gene radC CDS 89584..89820 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519051.1 transl_table 11 codon_start 1 locus_tag LOCUS_33260 gene rpmB CDS 89841..90008 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051798.1 transl_table 11 codon_start 1 locus_tag LOCUS_33270 gene rpmG CDS 90106..90915 product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114515.1 transl_table 11 codon_start 1 locus_tag LOCUS_33280 gene mutM CDS complement(90943..91422) product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171888.1 transl_table 11 codon_start 1 locus_tag LOCUS_33290 gene coaD CDS complement(91431..92708) product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891584.1 transl_table 11 codon_start 1 locus_tag LOCUS_33300 gene waaA CDS 93171..94187 product lipopolysaccharide core heptosyltransferase RfaQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001210932.1 transl_table 11 codon_start 1 locus_tag LOCUS_33310 gene rfaQ CDS 94184..95308 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261571.1 transl_table 11 codon_start 1 locus_tag LOCUS_33320 CDS 95301..96098 product lipopolysaccharide core heptose(I) kinase RfaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229818.1 transl_table 11 codon_start 1 locus_tag LOCUS_33330 gene rfaP sequence20 source 1..93612 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1182..2273) product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505850.1 transl_table 11 codon_start 1 locus_tag LOCUS_33340 gene ychF CDS complement(2390..2974) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985595.1 transl_table 11 codon_start 1 locus_tag LOCUS_33350 gene pth CDS 3250..3528 product stress-induced protein YchH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823885.1 transl_table 11 codon_start 1 locus_tag LOCUS_33360 gene ychH CDS complement(3573..5258) product C4-dicarboxylic acid transporter DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037188.1 transl_table 11 codon_start 1 locus_tag LOCUS_33370 gene dauA CDS complement(5383..6348) product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119392.1 transl_table 11 codon_start 1 locus_tag LOCUS_33380 gene prs CDS complement(6596..7447) product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988253.1 transl_table 11 codon_start 1 locus_tag LOCUS_33390 gene ispE CDS complement(7444..8067) product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174482.1 transl_table 11 codon_start 1 locus_tag LOCUS_33400 gene lolB CDS 8381..9637 product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173208.1 transl_table 11 codon_start 1 locus_tag LOCUS_33410 gene hemA CDS 9678..10760 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804703.1 transl_table 11 codon_start 1 locus_tag LOCUS_33420 gene prfA CDS 10760..11593 product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347320.1 transl_table 11 codon_start 1 locus_tag LOCUS_33430 gene prmC CDS 11590..11979 product invasion regulator SirB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150667.1 transl_table 11 codon_start 1 locus_tag LOCUS_33440 gene sirB2 CDS 11983..12792 product invasion regulator SirB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257065.1 transl_table 11 codon_start 1 locus_tag LOCUS_33450 gene sirB1 CDS 12830..13684 product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811046.1 transl_table 11 codon_start 1 locus_tag LOCUS_33460 gene kdsA CDS complement(13738..14838) product sodium-potassium/proton antiporter ChaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148419.1 transl_table 11 codon_start 1 locus_tag LOCUS_33470 gene chaA CDS 15105..15335 product putative cation transport regulator ChaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146392.1 transl_table 11 codon_start 1 locus_tag LOCUS_33480 gene chaB CDS complement(15415..15768) product DsrE/DsrF/TusD sulfur relay family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179794.1 transl_table 11 codon_start 1 locus_tag LOCUS_33490 CDS 15945..17369 product YchO/YchP family invasin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008985.1 transl_table 11 codon_start 1 locus_tag LOCUS_33500 CDS complement(17370..18020) product two-component system response regulator NarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064595.1 transl_table 11 codon_start 1 locus_tag LOCUS_33510 gene narL CDS complement(18013..19809) product nitrate/nitrite two-component system sensor histidine kinase NarX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476239.1 transl_table 11 codon_start 1 locus_tag LOCUS_33520 gene narX CDS 20150..21547 product nitrate transporter NarK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019848.1 transl_table 11 codon_start 1 locus_tag LOCUS_33530 gene narK CDS 21935..25678 product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032878.1 transl_table 11 codon_start 1 locus_tag LOCUS_33540 CDS 25675..27213 product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702629.1 transl_table 11 codon_start 1 locus_tag LOCUS_33550 gene narH CDS 27210..27920 product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571671.1 transl_table 11 codon_start 1 locus_tag LOCUS_33560 gene narJ CDS 27920..28597 product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545591.1 transl_table 11 codon_start 1 locus_tag LOCUS_33570 gene narI CDS 28839..30368 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212716.1 transl_table 11 codon_start 1 locus_tag LOCUS_33580 tRNA complement(30995..31079) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00570 tRNA complement(31290..31374) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00580 CDS complement(31715..32557) product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191159.1 transl_table 11 codon_start 1 locus_tag LOCUS_33590 gene purU CDS complement(32608..33066) product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001361954.1 transl_table 11 codon_start 1 locus_tag LOCUS_33600 CDS 33186..34082 product patatin-like phospholipase RssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230581.1 transl_table 11 codon_start 1 locus_tag LOCUS_33610 gene rssA CDS 34173..35186 product two-component system response regulator RssB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193432.1 transl_table 11 codon_start 1 locus_tag LOCUS_33620 gene rssB CDS 35389..36297 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729450.1 transl_table 11 codon_start 1 locus_tag LOCUS_33630 gene galU CDS complement(36429..36842) product DNA-binding transcriptional regulator H-NS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287383.1 transl_table 11 codon_start 1 locus_tag LOCUS_33640 gene hns CDS 37505..38122 product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068097.1 transl_table 11 codon_start 1 locus_tag LOCUS_33650 gene tdk CDS complement(38319..40997) product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301680.1 transl_table 11 codon_start 1 locus_tag LOCUS_33660 gene adhE CDS 41474..42121 product YchE family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615840.1 transl_table 11 codon_start 1 locus_tag LOCUS_33670 CDS 42885..44516 product oligopeptide ABC transporter substrate-binding protein OppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560668.1 transl_table 11 codon_start 1 locus_tag LOCUS_33680 gene oppA CDS 44638..45558 product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911094.1 transl_table 11 codon_start 1 locus_tag LOCUS_33690 gene oppB CDS 45573..46469 product oligopeptide ABC transporter permease OppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096272.1 transl_table 11 codon_start 1 locus_tag LOCUS_33700 gene oppC CDS 46481..47488 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058853.1 transl_table 11 codon_start 1 locus_tag LOCUS_33710 CDS 47485..48489 product murein tripeptide/oligopeptide ABC transporter ATP-binding protein OppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994698.1 transl_table 11 codon_start 1 locus_tag LOCUS_33720 gene oppF CDS 48537..49373 product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045367413.1 transl_table 11 codon_start 1 locus_tag LOCUS_33730 CDS complement(49421..49771) product HI1450 family dsDNA-mimic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069343.1 transl_table 11 codon_start 1 locus_tag LOCUS_33740 note possible pseudo, internal stop codon, frameshifted CDS complement(49784..51244) product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206886.1 transl_table 11 codon_start 1 locus_tag LOCUS_33750 gene cls CDS complement(51604..51900) product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000967605.1 transl_table 11 codon_start 1 locus_tag LOCUS_33760 CDS 52124..52852 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33770 CDS complement(52911..53312) product acyl-CoA thioester hydrolase YciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210317.1 transl_table 11 codon_start 1 locus_tag LOCUS_33780 gene yciA CDS complement(53473..54012) product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808682.1 transl_table 11 codon_start 1 locus_tag LOCUS_33790 CDS complement(54069..54812) product YciC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028506.1 transl_table 11 codon_start 1 locus_tag LOCUS_33800 CDS 55580..56218 product outer membrane protein OmpW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714798.1 transl_table 11 codon_start 1 locus_tag LOCUS_33810 gene ompW CDS complement(56300..57178) product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488351.1 transl_table 11 codon_start 1 locus_tag LOCUS_33820 CDS complement(57198..57704) product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109977.1 transl_table 11 codon_start 1 locus_tag LOCUS_33830 CDS complement(57778..58281) product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001022822.1 transl_table 11 codon_start 1 locus_tag LOCUS_33840 CDS complement(58371..58553) product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807657.1 transl_table 11 codon_start 1 locus_tag LOCUS_33850 CDS complement(59033..59839) product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443029.1 transl_table 11 codon_start 1 locus_tag LOCUS_33860 gene trpA CDS complement(59839..61032) product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209485.1 transl_table 11 codon_start 1 locus_tag LOCUS_33870 gene trpB CDS complement(61042..62400) product bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195287.1 transl_table 11 codon_start 1 locus_tag LOCUS_33880 gene trpCF CDS complement(62404..63999) product bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763483.1 transl_table 11 codon_start 1 locus_tag LOCUS_33890 gene trpD CDS complement(63999..65561) product anthranilate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194375.1 transl_table 11 codon_start 1 locus_tag LOCUS_33900 CDS 65822..66703 product RNase AM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000500433.1 transl_table 11 codon_start 1 locus_tag LOCUS_33910 gene rnm CDS 66711..67331 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077250.1 transl_table 11 codon_start 1 locus_tag LOCUS_33920 CDS 67432..68307 product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291232.1 transl_table 11 codon_start 1 locus_tag LOCUS_33930 gene rluB CDS complement(68394..68984) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278854.1 transl_table 11 codon_start 1 locus_tag LOCUS_33940 gene cobO CDS complement(68981..69742) product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559310.1 transl_table 11 codon_start 1 locus_tag LOCUS_33950 CDS 69980..71026 product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422082.1 transl_table 11 codon_start 1 locus_tag LOCUS_33960 gene sohB CDS complement(71068..71319) product YciN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548616.1 transl_table 11 codon_start 1 locus_tag LOCUS_33970 CDS 71722..74319 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513593.1 transl_table 11 codon_start 1 locus_tag LOCUS_33980 gene topA CDS 74730..75704 product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776231.1 transl_table 11 codon_start 1 locus_tag LOCUS_33990 gene cysB CDS 75997..76125 product YmiA family putative membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295577.1 transl_table 11 codon_start 1 locus_tag LOCUS_34000 CDS 76681..79356 product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099459.1 transl_table 11 codon_start 1 locus_tag LOCUS_34010 gene acnA CDS complement(79412..80002) product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176284.1 transl_table 11 codon_start 1 locus_tag LOCUS_34020 gene ribA CDS 80198..80962 product phosphatidylglycerophosphatase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948651.1 transl_table 11 codon_start 1 locus_tag LOCUS_34030 gene pgpB CDS 81112..81420 product LapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876301.1 transl_table 11 codon_start 1 locus_tag LOCUS_34040 CDS 81427..82596 product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891378.1 transl_table 11 codon_start 1 locus_tag LOCUS_34050 gene lapB CDS 82787..83524 product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001763993.1 transl_table 11 codon_start 1 locus_tag LOCUS_34060 gene pyrF CDS 83524..83850 product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285199.1 transl_table 11 codon_start 1 locus_tag LOCUS_34070 gene yciH CDS complement(83970..84188) product osmotically-inducible lipoprotein OsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480930.1 transl_table 11 codon_start 1 locus_tag LOCUS_34080 gene osmB CDS complement(84447..85199) product DNA-binding transcriptional regulator YciT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088593.1 transl_table 11 codon_start 1 locus_tag LOCUS_34090 CDS complement(85286..85465) product protein YciZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069350.1 transl_table 11 codon_start 1 locus_tag LOCUS_34100 gene yciZ CDS complement(85587..87578) product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989147.1 transl_table 11 codon_start 1 locus_tag LOCUS_34110 gene pdeR CDS complement(87831..89765) product exoribonuclease II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000485046.1 transl_table 11 codon_start 1 locus_tag LOCUS_34120 CDS complement(89854..90987) product CMD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298115.1 transl_table 11 codon_start 1 locus_tag LOCUS_34130 CDS complement(91187..91975) product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506501.1 transl_table 11 codon_start 1 locus_tag LOCUS_34140 gene fabI sequence21 source 1..92062 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(92..943) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201804.1 transl_table 11 codon_start 1 locus_tag LOCUS_34150 gene murI CDS complement(888..2732) product TonB-dependent vitamin B12 receptor BtuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000591414.1 transl_table 11 codon_start 1 locus_tag LOCUS_34160 gene btuB CDS 3106..4206 product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186987.1 transl_table 11 codon_start 1 locus_tag LOCUS_34170 gene trmA CDS complement(4253..4612) product YijD family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813838.1 transl_table 11 codon_start 1 locus_tag LOCUS_34180 CDS complement(4628..5263) product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001537960.1 transl_table 11 codon_start 1 locus_tag LOCUS_34190 gene fabR CDS 5528..6862 product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120789.1 transl_table 11 codon_start 1 locus_tag LOCUS_34200 gene sthA CDS complement(6845..7762) product DNA-binding transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025919.1 transl_table 11 codon_start 1 locus_tag LOCUS_34210 gene oxyR CDS complement(8046..9422) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230038.1 transl_table 11 codon_start 1 locus_tag LOCUS_34220 gene argH CDS complement(9540..10313) product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001575262.1 transl_table 11 codon_start 1 locus_tag LOCUS_34230 gene argB CDS complement(10324..11328) product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935332.1 transl_table 11 codon_start 1 locus_tag LOCUS_34240 gene argC CDS complement(11519..11719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34250 CDS 11639..12568 product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800207.1 transl_table 11 codon_start 1 locus_tag LOCUS_34260 gene argE CDS 12937..15588 product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005544.1 transl_table 11 codon_start 1 locus_tag LOCUS_34270 gene ppc CDS 15799..17532 product phosphoethanolamine transferase CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192092.1 transl_table 11 codon_start 1 locus_tag LOCUS_34280 CDS 17693..18544 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000274601.1 transl_table 11 codon_start 1 locus_tag LOCUS_34290 CDS complement(18531..18884) product PTS fructose-like transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323848.1 transl_table 11 codon_start 1 locus_tag LOCUS_34300 CDS complement(18886..19764) product [formate-C-acetyltransferase]-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204105.1 transl_table 11 codon_start 1 locus_tag LOCUS_34310 CDS complement(19730..22027) product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184831.1 transl_table 11 codon_start 1 locus_tag LOCUS_34320 CDS complement(22126..22446) product PTS fructose-like transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161259.1 transl_table 11 codon_start 1 locus_tag LOCUS_34330 CDS complement(22461..23540) product PTS fructose transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001004469.1 transl_table 11 codon_start 1 locus_tag LOCUS_34340 CDS 23849..26350 product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174077.1 transl_table 11 codon_start 1 locus_tag LOCUS_34350 gene ptsP CDS 26361..27023 product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424865.1 transl_table 11 codon_start 1 locus_tag LOCUS_34360 gene fsa CDS 27035..28138 product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000374033.1 transl_table 11 codon_start 1 locus_tag LOCUS_34370 CDS 28397..29020 product DUF1287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647891.1 transl_table 11 codon_start 1 locus_tag LOCUS_34380 CDS complement(29078..31258) product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108110.1 transl_table 11 codon_start 1 locus_tag LOCUS_34390 gene katG CDS complement(31423..32313) product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007509.1 transl_table 11 codon_start 1 locus_tag LOCUS_34400 gene metF CDS 32592..34073 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090459.1 transl_table 11 codon_start 1 locus_tag LOCUS_34410 CDS complement(34018..35124) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976816.1 transl_table 11 codon_start 1 locus_tag LOCUS_34420 gene alr CDS complement(35121..36359) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087881318.1 transl_table 11 codon_start 1 locus_tag LOCUS_34430 CDS complement(36624..38180) product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865256.1 transl_table 11 codon_start 1 locus_tag LOCUS_34440 CDS 38316..39440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001134817.1 transl_table 11 codon_start 1 locus_tag LOCUS_34450 CDS 40467..40673 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34460 CDS 40676..41533 product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369769.1 transl_table 11 codon_start 1 locus_tag LOCUS_34470 CDS complement(41649..44081) product bifunctional aspartate kinase/homoserine dehydrogenase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110811.1 transl_table 11 codon_start 1 locus_tag LOCUS_34480 gene metL CDS complement(44084..45244) product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197208.1 transl_table 11 codon_start 1 locus_tag LOCUS_34490 gene metB CDS 45509..45826 product met regulon transcriptional regulator MetJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852811.1 transl_table 11 codon_start 1 locus_tag LOCUS_34500 gene metJ CDS 46424..48073 product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669894.1 transl_table 11 codon_start 1 locus_tag LOCUS_34510 CDS 48274..48936 product TIGR02117 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792797.1 transl_table 11 codon_start 1 locus_tag LOCUS_34520 CDS complement(48981..49193) product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715284.1 transl_table 11 codon_start 1 locus_tag LOCUS_34530 gene rpmE CDS 49397..51595 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109394.1 transl_table 11 codon_start 1 locus_tag LOCUS_34540 gene priA CDS 51750..52775 product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841337.1 transl_table 11 codon_start 1 locus_tag LOCUS_34550 gene cytR CDS 52962..53843 product cell division protein FtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068798.1 transl_table 11 codon_start 1 locus_tag LOCUS_34560 gene ftsN CDS 53935..54465 product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208240.1 transl_table 11 codon_start 1 locus_tag LOCUS_34570 gene hslV CDS 54475..55806 product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293355.1 transl_table 11 codon_start 1 locus_tag LOCUS_34580 gene hslU CDS 55873..56802 product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139635.1 transl_table 11 codon_start 1 locus_tag LOCUS_34590 gene menA CDS 56895..57380 product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872918.1 transl_table 11 codon_start 1 locus_tag LOCUS_34600 gene rraA CDS complement(57602..57841) product septal ring assembly protein ZapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051368.1 transl_table 11 codon_start 1 locus_tag LOCUS_34610 gene zapB CDS 58240..59085 product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084284.1 transl_table 11 codon_start 1 locus_tag LOCUS_34620 CDS 59106..60614 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137244.1 transl_table 11 codon_start 1 locus_tag LOCUS_34630 gene glpK CDS 60726..61736 product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250625.1 transl_table 11 codon_start 1 locus_tag LOCUS_34640 gene glpX CDS 61833..62579 product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796307.1 transl_table 11 codon_start 1 locus_tag LOCUS_34650 gene fpr CDS complement(62685..63113) product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155237.1 transl_table 11 codon_start 1 locus_tag LOCUS_34660 CDS 63214..63810 product YiiQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802241.1 transl_table 11 codon_start 1 locus_tag LOCUS_34670 CDS 63923..64690 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216342.1 transl_table 11 codon_start 1 locus_tag LOCUS_34680 gene tpiA CDS complement(64782..65546) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088043.1 transl_table 11 codon_start 1 locus_tag LOCUS_34690 CDS complement(65556..65849) product (4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001543603.1 transl_table 11 codon_start 1 locus_tag LOCUS_34700 gene lsrG CDS complement(65928..66803) product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774152.1 transl_table 11 codon_start 1 locus_tag LOCUS_34710 gene lsrF CDS complement(66832..67854) product autoinducer 2 ABC transporter substrate-binding protein LsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090739.1 transl_table 11 codon_start 1 locus_tag LOCUS_34720 gene lsrB CDS complement(67883..68884) product autoinducer 2 ABC transporter permease LsrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981826.1 transl_table 11 codon_start 1 locus_tag LOCUS_34730 gene lsrD CDS complement(68881..69924) product autoinducer 2 ABC transporter permease LsrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911130.1 transl_table 11 codon_start 1 locus_tag LOCUS_34740 gene lsrC CDS complement(69918..71453) product autoinducer 2 ABC transporter ATP-binding protein LsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167253.1 transl_table 11 codon_start 1 locus_tag LOCUS_34750 gene lsrA CDS 71710..72669 product transcriptional regulator LsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283049.1 transl_table 11 codon_start 1 locus_tag LOCUS_34760 gene lsrR CDS 72798..74348 product autoinducer-2 kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113082.1 transl_table 11 codon_start 1 locus_tag LOCUS_34770 gene lsrK CDS 74362..74712 product dimethylsulfonioproprionate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000909989.1 transl_table 11 codon_start 1 locus_tag LOCUS_34780 CDS complement(74949..75119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34790 CDS complement(75217..75948) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001764005.1 transl_table 11 codon_start 1 locus_tag LOCUS_34800 CDS complement(76002..77042) product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557877.1 transl_table 11 codon_start 1 locus_tag LOCUS_34810 CDS complement(77052..78011) product aminoimidazole riboside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646490.1 transl_table 11 codon_start 1 locus_tag LOCUS_34820 CDS complement(78022..79356) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095593.1 transl_table 11 codon_start 1 locus_tag LOCUS_34830 CDS complement(79620..80375) product CDP-diacylglycerol diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750765.1 transl_table 11 codon_start 1 locus_tag LOCUS_34840 CDS complement(80476..81465) product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758715.1 transl_table 11 codon_start 1 locus_tag LOCUS_34850 CDS complement(81669..82631) product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000591793.1 transl_table 11 codon_start 1 locus_tag LOCUS_34860 gene pfkA CDS complement(82816..83718) product CDF family cation-efflux transporter FieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077323.1 transl_table 11 codon_start 1 locus_tag LOCUS_34870 gene fieF CDS complement(83866..84366) product cell-envelope stress modulator CpxP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233466.1 transl_table 11 codon_start 1 locus_tag LOCUS_34880 gene cpxP CDS 84517..85215 product envelope stress response regulator transcription factor CpxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033727.1 transl_table 11 codon_start 1 locus_tag LOCUS_34890 gene cpxR CDS 85212..86585 product envelope stress sensor histidine kinase CpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580402.1 transl_table 11 codon_start 1 locus_tag LOCUS_34900 gene cpxA CDS complement(86633..86836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34910 CDS complement(86957..87352) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133445.1 transl_table 11 codon_start 1 locus_tag LOCUS_34920 CDS complement(87364..88053) product 6-hydroxyaminopurine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014343930.1 transl_table 11 codon_start 1 locus_tag LOCUS_34930 gene yiiM CDS complement(88123..88743) product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122632.1 transl_table 11 codon_start 1 locus_tag LOCUS_34940 gene sodA CDS 89073..89888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34950 CDS 89794..90963 product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566798.1 transl_table 11 codon_start 1 locus_tag LOCUS_34960 CDS complement(91121..91792) product oligogalacturonate-specific porin KdgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378721.1 transl_table 11 codon_start 1 locus_tag LOCUS_34970 sequence22 source 1..89032 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(21..566) product menaquinone-dependent protoporphyrinogen IX dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853982.1 transl_table 11 codon_start 1 locus_tag LOCUS_34980 gene hemG CDS complement(578..2029) product Trk system potassium transporter TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545686.1 transl_table 11 codon_start 1 locus_tag LOCUS_34990 gene trkH CDS complement(2068..2682) product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378910.1 transl_table 11 codon_start 1 locus_tag LOCUS_35000 CDS complement(2682..4013) product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444529.1 transl_table 11 codon_start 1 locus_tag LOCUS_35010 gene pepQ CDS 4203..6392 product fatty acid oxidation complex subunit alpha FadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966004.1 transl_table 11 codon_start 1 locus_tag LOCUS_35020 gene fadB CDS 6402..7565 product acetyl-CoA C-acyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438778.1 transl_table 11 codon_start 1 locus_tag LOCUS_35030 gene fadA CDS complement(7762..9585) product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669894.1 transl_table 11 codon_start 1 locus_tag LOCUS_35040 CDS complement(9839..10540) product NAD(P)H-flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209828.1 transl_table 11 codon_start 1 locus_tag LOCUS_35050 gene fre CDS complement(10626..12104) product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339760.1 transl_table 11 codon_start 1 locus_tag LOCUS_35060 gene ubiD CDS 12290..12778 product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192407.1 transl_table 11 codon_start 1 locus_tag LOCUS_35070 gene rfaH CDS complement(12786..13580) product 3'-5' ssDNA/RNA exonuclease TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459642.1 transl_table 11 codon_start 1 locus_tag LOCUS_35080 gene tatD CDS complement(13610..14389) product Sec-independent protein translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257554.1 transl_table 11 codon_start 1 locus_tag LOCUS_35090 gene tatC CDS complement(14392..14940) product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459611.1 transl_table 11 codon_start 1 locus_tag LOCUS_35100 gene tatB CDS complement(14944..15198) product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000508972.1 transl_table 11 codon_start 1 locus_tag LOCUS_35110 gene tatA CDS complement(15404..17044) product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187559.1 transl_table 11 codon_start 1 locus_tag LOCUS_35120 gene ubiB CDS complement(17041..17646) product ubiquinone biosynthesis protein UbiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116094.1 transl_table 11 codon_start 1 locus_tag LOCUS_35130 gene ubiJ CDS complement(17656..18411) product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229009.1 transl_table 11 codon_start 1 locus_tag LOCUS_35140 gene ubiE CDS complement(18507..19937) product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355562.1 transl_table 11 codon_start 1 locus_tag LOCUS_35150 gene rmuC CDS complement(20077..20838) product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045169.1 transl_table 11 codon_start 1 locus_tag LOCUS_35160 gene udp CDS 21220..21909 product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213961.1 transl_table 11 codon_start 1 locus_tag LOCUS_35170 CDS complement(21989..23284) product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017936.1 transl_table 11 codon_start 1 locus_tag LOCUS_35180 CDS complement(23676..25940) product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154198.1 transl_table 11 codon_start 1 locus_tag LOCUS_35190 gene metE CDS 26189..27142 product HTH-type transcriptional regulator MetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569786.1 transl_table 11 codon_start 1 locus_tag LOCUS_35200 gene metR CDS complement(27030..27929) product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196257.1 transl_table 11 codon_start 1 locus_tag LOCUS_35210 CDS complement(28010..28810) product sugar/pyridoxal phosphate phosphatase YigL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285338.1 transl_table 11 codon_start 1 locus_tag LOCUS_35220 gene yigL CDS complement(28826..29842) product lysophospholipase L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487681.1 transl_table 11 codon_start 1 locus_tag LOCUS_35230 gene pldB CDS 29953..30573 product homoserine/homoserine lactone efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000142520.1 transl_table 11 codon_start 1 locus_tag LOCUS_35240 gene rhtB CDS complement(30613..31116) product threonine export protein RhtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928814.1 transl_table 11 codon_start 1 locus_tag LOCUS_35250 gene rhtC CDS complement(31297..33144) product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001533487.1 transl_table 11 codon_start 1 locus_tag LOCUS_35260 gene recQ CDS complement(33210..34079) product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201692.1 transl_table 11 codon_start 1 locus_tag LOCUS_35270 gene pldA CDS 34244..34711 product acyl-CoA thioesterase YigI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277136.1 transl_table 11 codon_start 1 locus_tag LOCUS_35280 gene yigI CDS 34755..35642 product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339085.1 transl_table 11 codon_start 1 locus_tag LOCUS_35290 gene rarD CDS complement(35682..35978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000526434.1 transl_table 11 codon_start 1 locus_tag LOCUS_35300 CDS 36060..36533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35310 CDS complement(36581..37531) product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947139.1 transl_table 11 codon_start 1 locus_tag LOCUS_35320 gene corA CDS complement(38003..40165) product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383444.1 transl_table 11 codon_start 1 locus_tag LOCUS_35330 gene uvrD CDS complement(40301..41017) product 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213563.1 transl_table 11 codon_start 1 locus_tag LOCUS_35340 gene yigB CDS complement(41017..41919) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141123.1 transl_table 11 codon_start 1 locus_tag LOCUS_35350 gene xerC CDS complement(41916..42623) product DUF484 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812770.1 transl_table 11 codon_start 1 locus_tag LOCUS_35360 CDS complement(42620..43444) product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160671.1 transl_table 11 codon_start 1 locus_tag LOCUS_35370 gene dapF CDS complement(43481..43684) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799903.1 transl_table 11 codon_start 1 locus_tag LOCUS_35380 CDS 44160..44393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35390 note possible pseudo, internal stop codon CDS 44390..44770 product DUF3021 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125556.1 transl_table 11 codon_start 1 locus_tag LOCUS_35400 CDS 44840..45160 product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999925.1 transl_table 11 codon_start 1 locus_tag LOCUS_35410 gene cyaY CDS complement(45238..47784) product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281718.1 transl_table 11 codon_start 1 locus_tag LOCUS_35420 gene cyaA CDS 48242..49102 product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001521319.1 transl_table 11 codon_start 1 locus_tag LOCUS_35430 gene hemC CDS 49099..49839 product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025500.1 transl_table 11 codon_start 1 locus_tag LOCUS_35440 gene hemD CDS 49861..51030 product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138976.1 transl_table 11 codon_start 1 locus_tag LOCUS_35450 gene hemX CDS 51030..52229 product protoheme IX biogenesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979262.1 transl_table 11 codon_start 1 locus_tag LOCUS_35460 gene hemY tRNA complement(52811..52887) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00590 tRNA complement(52930..53016) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00600 tRNA complement(53037..53112) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00610 tRNA complement(53167..53243) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00620 CDS complement(53346..54731) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818378.1 transl_table 11 codon_start 1 locus_tag LOCUS_35470 CDS complement(54938..55678) product lipopolysaccharide N-acetylmannosaminouronosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183613.1 transl_table 11 codon_start 1 locus_tag LOCUS_35480 gene wecG CDS complement(55675..57033) product ECA oligosaccharide polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055604.1 transl_table 11 codon_start 1 locus_tag LOCUS_35490 gene wzyE CDS complement(57030..58109) product TDP-N-acetylfucosamine:lipid II N-acetylfucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217177.1 transl_table 11 codon_start 1 locus_tag LOCUS_35500 CDS complement(58106..59356) product lipid III flippase WzxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050302.1 transl_table 11 codon_start 1 locus_tag LOCUS_35510 gene wzxE CDS complement(59358..60488) product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612080.1 transl_table 11 codon_start 1 locus_tag LOCUS_35520 gene rffA CDS complement(60493..61170) product dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012539915.1 transl_table 11 codon_start 1 locus_tag LOCUS_35530 gene rffC CDS complement(61148..61372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35540 CDS complement(61405..62472) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822139.1 transl_table 11 codon_start 1 locus_tag LOCUS_35550 gene rffG CDS complement(62472..63734) product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011236.1 transl_table 11 codon_start 1 locus_tag LOCUS_35560 gene wecC CDS complement(63731..64861) product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866686.1 transl_table 11 codon_start 1 locus_tag LOCUS_35570 gene wecB CDS complement(64917..65963) product ECA polysaccharide chain length modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193415.1 transl_table 11 codon_start 1 locus_tag LOCUS_35580 gene wzzE CDS complement(65975..66814) product UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771938.1 transl_table 11 codon_start 1 locus_tag LOCUS_35590 gene wecA CDS complement(67308..68567) product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054532.1 transl_table 11 codon_start 1 locus_tag LOCUS_35600 gene rho CDS complement(68986..69315) product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305383.1 transl_table 11 codon_start 1 locus_tag LOCUS_35610 gene trxA CDS 69459..70724 product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047525.1 transl_table 11 codon_start 1 locus_tag LOCUS_35620 gene rhlB CDS 70861..72342 product guanosine-5'-triphosphate,3'-diphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089447.1 transl_table 11 codon_start 1 locus_tag LOCUS_35630 gene gppA CDS complement(72382..74406) product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238841.1 transl_table 11 codon_start 1 locus_tag LOCUS_35640 gene rep CDS 74944..75225 product peptidylprolyl isomerase PpiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096806.1 transl_table 11 codon_start 1 locus_tag LOCUS_35650 gene ppiC CDS complement(75317..76792) product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024943.1 transl_table 11 codon_start 1 locus_tag LOCUS_35660 gene ilvC CDS 76957..77844 product HTH-type transcriptional activator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365798.1 transl_table 11 codon_start 1 locus_tag LOCUS_35670 gene ilvY CDS complement(77847..78188) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560819.1 transl_table 11 codon_start 1 locus_tag LOCUS_35680 CDS complement(78185..78547) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001779357.1 transl_table 11 codon_start 1 locus_tag LOCUS_35690 CDS 78537..78716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35700 CDS complement(78785..80329) product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989250.1 transl_table 11 codon_start 1 locus_tag LOCUS_35710 gene ilvA CDS complement(80332..82182) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127449.1 transl_table 11 codon_start 1 locus_tag LOCUS_35720 gene ilvD CDS complement(82342..83271) product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208528.1 transl_table 11 codon_start 1 locus_tag LOCUS_35730 gene ilvE CDS complement(83289..83552) product acetolactate synthase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001576447.1 transl_table 11 codon_start 1 locus_tag LOCUS_35740 gene ilvM CDS complement(83549..85195) product acetolactate synthase 2 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012560.1 transl_table 11 codon_start 1 locus_tag LOCUS_35750 gene ilvG CDS 85785..87305 product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058995.1 transl_table 11 codon_start 1 locus_tag LOCUS_35760 CDS complement(87330..87668) product macrodomain Ori organization protein MaoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840996.1 transl_table 11 codon_start 1 locus_tag LOCUS_35770 gene maoP CDS 87787..88623 product HTH-type transcriptional regulator HdfR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001541181.1 transl_table 11 codon_start 1 locus_tag LOCUS_35780 gene hdfR tRNA complement(88726..88801) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00630 tRNA complement(88810..88886) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00640 sequence23 source 1..84076 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(654..2111) product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156669.1 transl_table 11 codon_start 1 locus_tag LOCUS_35790 gene nuoN CDS complement(2118..3647) product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926422.1 transl_table 11 codon_start 1 locus_tag LOCUS_35800 gene nuoM CDS complement(3961..5802) product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056574.1 transl_table 11 codon_start 1 locus_tag LOCUS_35810 gene nuoL CDS complement(5799..6101) product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612687.1 transl_table 11 codon_start 1 locus_tag LOCUS_35820 gene nuoK CDS complement(6098..6652) product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393522.1 transl_table 11 codon_start 1 locus_tag LOCUS_35830 gene nuoJ CDS complement(6663..7205) product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172747.1 transl_table 11 codon_start 1 locus_tag LOCUS_35840 gene nuoI CDS complement(7220..8197) product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118517.1 transl_table 11 codon_start 1 locus_tag LOCUS_35850 gene nuoH CDS complement(8194..10920) product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518099.1 transl_table 11 codon_start 1 locus_tag LOCUS_35860 gene nuoG CDS complement(10951..12288) product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800046.1 transl_table 11 codon_start 1 locus_tag LOCUS_35870 gene nuoF CDS complement(12285..12785) product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545038.1 transl_table 11 codon_start 1 locus_tag LOCUS_35880 gene nuoE CDS complement(12788..14590) product NADH-quinone oxidoreductase subunit C/D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247855.1 transl_table 11 codon_start 1 locus_tag LOCUS_35890 gene nuoC CDS complement(14677..15339) product NADH-quinone oxidoreductase subunit NuoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386728.1 transl_table 11 codon_start 1 locus_tag LOCUS_35900 gene nuoB CDS complement(15355..15798) product NADH-quinone oxidoreductase subunit NuoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062993.1 transl_table 11 codon_start 1 locus_tag LOCUS_35910 gene nuoA CDS complement(16425..17363) product transcriptional regulator LrhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606282.1 transl_table 11 codon_start 1 locus_tag LOCUS_35920 gene lrhA CDS 18295..19509 product alanine transaminase AlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074540.1 transl_table 11 codon_start 1 locus_tag LOCUS_35930 gene alaA CDS 19603..20202 product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813878.1 transl_table 11 codon_start 1 locus_tag LOCUS_35940 gene yfbR CDS complement(20308..22134) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012871.1 transl_table 11 codon_start 1 locus_tag LOCUS_35950 CDS complement(22211..22870) product sugar phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013205.1 transl_table 11 codon_start 1 locus_tag LOCUS_35960 CDS complement(22881..23375) product YfbU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426135.1 transl_table 11 codon_start 1 locus_tag LOCUS_35970 CDS complement(23458..23835) product terminus macrodomain insulation protein YfbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106616.1 transl_table 11 codon_start 1 locus_tag LOCUS_35980 gene yfbV CDS 24253..25455 product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095689.1 transl_table 11 codon_start 1 locus_tag LOCUS_35990 gene ackA CDS 25532..27676 product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086690.1 transl_table 11 codon_start 1 locus_tag LOCUS_36000 gene pta CDS 27936..29414 product putative basic amino acid antiporter YfcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117932.1 transl_table 11 codon_start 1 locus_tag LOCUS_36010 gene yfcC CDS complement(29463..30416) product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098117.1 transl_table 11 codon_start 1 locus_tag LOCUS_36020 CDS complement(30409..31239) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103260.1 transl_table 11 codon_start 1 locus_tag LOCUS_36030 CDS complement(31236..32627) product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001681684.1 transl_table 11 codon_start 1 locus_tag LOCUS_36040 CDS complement(32648..32920) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699818.1 transl_table 11 codon_start 1 locus_tag LOCUS_36050 CDS complement(33001..33444) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901818.1 transl_table 11 codon_start 1 locus_tag LOCUS_36060 CDS 33697..34716 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026954.1 transl_table 11 codon_start 1 locus_tag LOCUS_36070 CDS complement(34722..35276) product NUDIX hydrolase YfcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230215.1 transl_table 11 codon_start 1 locus_tag LOCUS_36080 gene yfcD CDS complement(35333..35884) product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772458.1 transl_table 11 codon_start 1 locus_tag LOCUS_36090 gene yfcE CDS complement(35940..36584) product glutathione transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043013.1 transl_table 11 codon_start 1 locus_tag LOCUS_36100 gene yfcF CDS 36727..37374 product GSH-dependent disulfide bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566559.1 transl_table 11 codon_start 1 locus_tag LOCUS_36110 gene yfcG CDS 37500..38393 product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166265.1 transl_table 11 codon_start 1 locus_tag LOCUS_36120 CDS complement(38445..39221) product histidine ABC transporter ATP-binding protein HisP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986775.1 transl_table 11 codon_start 1 locus_tag LOCUS_36130 gene hisP CDS complement(39232..39939) product histidine ABC transporter permease HisM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569771.1 transl_table 11 codon_start 1 locus_tag LOCUS_36140 gene hisM CDS complement(39936..40622) product histidine ABC transporter permease HisQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965498.1 transl_table 11 codon_start 1 locus_tag LOCUS_36150 CDS complement(40805..41587) product histidine ABC transporter substrate-binding protein HisJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000731871.1 transl_table 11 codon_start 1 locus_tag LOCUS_36160 gene hisJ CDS complement(41825..42607) product lysine/arginine/ornithine ABC transporter substrate-binding protein ArgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754418.1 transl_table 11 codon_start 1 locus_tag LOCUS_36170 gene argT CDS complement(42896..43465) product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825682.1 transl_table 11 codon_start 1 locus_tag LOCUS_36180 CDS complement(43492..44898) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380357.1 transl_table 11 codon_start 1 locus_tag LOCUS_36190 CDS complement(44962..46065) product alanine/ornithine racemase family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281913.1 transl_table 11 codon_start 1 locus_tag LOCUS_36200 CDS complement(46067..47488) product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072509.1 transl_table 11 codon_start 1 locus_tag LOCUS_36210 CDS complement(47579..48976) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132306.1 transl_table 11 codon_start 1 locus_tag LOCUS_36220 CDS 49187..50614 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168932.1 transl_table 11 codon_start 1 locus_tag LOCUS_36230 CDS complement(50650..52167) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334231.1 transl_table 11 codon_start 1 locus_tag LOCUS_36240 gene purF CDS complement(52205..52693) product colicin V production protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262102.1 transl_table 11 codon_start 1 locus_tag LOCUS_36250 gene cvpA CDS complement(53004..53678) product cell division protein DedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157040.1 transl_table 11 codon_start 1 locus_tag LOCUS_36260 gene dedD CDS complement(53668..54936) product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792271.1 transl_table 11 codon_start 1 locus_tag LOCUS_36270 gene folC CDS complement(55004..55918) product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118383.1 transl_table 11 codon_start 1 locus_tag LOCUS_36280 gene accD CDS complement(56068..56727) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364318.1 transl_table 11 codon_start 1 locus_tag LOCUS_36290 CDS complement(56776..57588) product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016631.1 transl_table 11 codon_start 1 locus_tag LOCUS_36300 gene truA CDS complement(57588..58601) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289141.1 transl_table 11 codon_start 1 locus_tag LOCUS_36310 CDS complement(58669..59805) product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699178.1 transl_table 11 codon_start 1 locus_tag LOCUS_36320 gene pdxB CDS 59909..60910 product flagella biosynthesis regulator Flk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553395.1 transl_table 11 codon_start 1 locus_tag LOCUS_36330 gene flk CDS complement(60907..62082) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127714.1 transl_table 11 codon_start 1 locus_tag LOCUS_36340 CDS complement(62262..62636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051260.1 transl_table 11 codon_start 1 locus_tag LOCUS_36350 CDS 62809..63057 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433427.1 transl_table 11 codon_start 1 locus_tag LOCUS_36360 CDS 63226..63594 product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118257.1 transl_table 11 codon_start 1 locus_tag LOCUS_36370 CDS 63594..64112 product YbjP/YqhG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847532.1 transl_table 11 codon_start 1 locus_tag LOCUS_36380 CDS complement(64933..66147) product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817161.1 transl_table 11 codon_start 1 locus_tag LOCUS_36390 gene fabB CDS 66307..68307 product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816082.1 transl_table 11 codon_start 1 locus_tag LOCUS_36400 gene mnmC CDS complement(68359..68634) product YfcL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559749.1 transl_table 11 codon_start 1 locus_tag LOCUS_36410 CDS complement(68667..69215) product elongation factor P hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089233.1 transl_table 11 codon_start 1 locus_tag LOCUS_36420 gene epmC CDS complement(69215..70024) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368599.1 transl_table 11 codon_start 1 locus_tag LOCUS_36430 CDS complement(70024..70848) product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750429.1 transl_table 11 codon_start 1 locus_tag LOCUS_36440 gene mepA CDS complement(70852..71937) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918475.1 transl_table 11 codon_start 1 locus_tag LOCUS_36450 gene aroC CDS complement(71973..72905) product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001542329.1 transl_table 11 codon_start 1 locus_tag LOCUS_36460 gene prmB CDS 73071..73622 product endonuclease SmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730794.1 transl_table 11 codon_start 1 locus_tag LOCUS_36470 gene smrB CDS complement(73722..74207) product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195808.1 transl_table 11 codon_start 1 locus_tag LOCUS_36480 gene sixA CDS complement(74416..76563) product fatty acid oxidation complex subunit alpha FadJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214156.1 transl_table 11 codon_start 1 locus_tag LOCUS_36490 gene fadJ CDS complement(76563..77873) product acetyl-CoA C-acyltransferase FadI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248124.1 transl_table 11 codon_start 1 locus_tag LOCUS_36500 gene fadI CDS complement(78051..78335) product YfcZ/YiiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030904.1 transl_table 11 codon_start 1 locus_tag LOCUS_36510 CDS 78700..80013 product long-chain fatty acid transporter FadL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001766332.1 transl_table 11 codon_start 1 locus_tag LOCUS_36520 gene fadL CDS complement(80074..80829) product phospholipid-binding lipoprotein MlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776787.1 transl_table 11 codon_start 1 locus_tag LOCUS_36530 gene mlaA CDS 81118..82059 product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377769.1 transl_table 11 codon_start 1 locus_tag LOCUS_36540 tRNA 82135..82209 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00650 CDS 83540..83914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36550 sequence24 source 1..75062 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 135..587 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36560 CDS 1112..1321 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36570 CDS 1502..2620 product hydrogenase 1 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058323.1 transl_table 11 codon_start 1 locus_tag LOCUS_36580 gene hyaA CDS 2617..4410 product Ni/Fe-hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070982.1 transl_table 11 codon_start 1 locus_tag LOCUS_36590 gene hyaB CDS 4429..5160 product Ni/Fe-hydrogenase b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147028.1 transl_table 11 codon_start 1 locus_tag LOCUS_36600 gene hyaC CDS 5157..5753 product hydrogenase 1 maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993803.1 transl_table 11 codon_start 1 locus_tag LOCUS_36610 CDS 5743..6147 product hydrogenase-1 operon protein HyaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262577.1 transl_table 11 codon_start 1 locus_tag LOCUS_36620 gene hyaE CDS 6144..6992 product hydrogenase expression/formation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063377.1 transl_table 11 codon_start 1 locus_tag LOCUS_36630 CDS 7067..8611 product cytochrome bd-II oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000263597.1 transl_table 11 codon_start 1 locus_tag LOCUS_36640 gene appC CDS 8623..9759 product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888121.1 transl_table 11 codon_start 1 locus_tag LOCUS_36650 gene appB CDS 10256..11530 product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366353.1 transl_table 11 codon_start 1 locus_tag LOCUS_36660 CDS 11744..13456 product alpha,alpha-trehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841738.1 transl_table 11 codon_start 1 locus_tag LOCUS_36670 gene treA CDS complement(13519..13773) product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511323.1 transl_table 11 codon_start 1 locus_tag LOCUS_36680 CDS 13942..14676 product flagellar brake protein YcgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017410.1 transl_table 11 codon_start 1 locus_tag LOCUS_36690 gene ycgR CDS complement(14690..15193) product membrane-bound lytic murein transglycosylase EmtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776974.1 transl_table 11 codon_start 1 locus_tag LOCUS_36700 gene emtA CDS 15472..16386 product muramoyltetrapeptide carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051613.1 transl_table 11 codon_start 1 locus_tag LOCUS_36710 gene ldcA CDS 16483..18216 product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000338376.1 transl_table 11 codon_start 1 locus_tag LOCUS_36720 CDS complement(18279..19349) product catabolic alanine racemase DadX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197904.1 transl_table 11 codon_start 1 locus_tag LOCUS_36730 gene dadX CDS complement(19363..20661) product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266934.1 transl_table 11 codon_start 1 locus_tag LOCUS_36740 CDS 20984..22516 product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240763.1 transl_table 11 codon_start 1 locus_tag LOCUS_36750 CDS complement(22563..23282) product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234821.1 transl_table 11 codon_start 1 locus_tag LOCUS_36760 gene fadR CDS 23502..25046 product Na(+)/H(+) antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406446.1 transl_table 11 codon_start 1 locus_tag LOCUS_36770 gene nhaB CDS 25188..25718 product disulfide bond formation protein DsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943475.1 transl_table 11 codon_start 1 locus_tag LOCUS_36780 gene dsbB CDS 25827..26168 product DUF1971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018971.1 transl_table 11 codon_start 1 locus_tag LOCUS_36790 CDS complement(26240..26413) product addiction module toxin, GnsA/GnsB family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083582.1 transl_table 11 codon_start 1 locus_tag LOCUS_36800 CDS complement(26605..26742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36810 CDS complement(27094..27555) product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785857.1 transl_table 11 codon_start 1 locus_tag LOCUS_36820 CDS complement(27633..28292) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519895.1 transl_table 11 codon_start 1 locus_tag LOCUS_36830 CDS complement(28342..28635) product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250286.1 transl_table 11 codon_start 1 locus_tag LOCUS_36840 CDS 28761..29468 product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072527.1 transl_table 11 codon_start 1 locus_tag LOCUS_36850 gene minC CDS 29492..30304 product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101048.1 transl_table 11 codon_start 1 locus_tag LOCUS_36860 gene minD CDS 30308..30574 product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185666.1 transl_table 11 codon_start 1 locus_tag LOCUS_36870 gene minE CDS complement(30696..31823) product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109129.1 transl_table 11 codon_start 1 locus_tag LOCUS_36880 gene rnd CDS complement(31896..33581) product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758418.1 transl_table 11 codon_start 1 locus_tag LOCUS_36890 gene fadD CDS complement(33786..34367) product Slp family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290594.1 transl_table 11 codon_start 1 locus_tag LOCUS_36900 CDS complement(34439..35134) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221014.1 transl_table 11 codon_start 1 locus_tag LOCUS_36910 gene tsaB CDS complement(35192..37102) product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128807.1 transl_table 11 codon_start 1 locus_tag LOCUS_36920 CDS 37233..37577 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029549.1 transl_table 11 codon_start 1 locus_tag LOCUS_36930 CDS complement(37583..37762) product YoaH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457328.1 transl_table 11 codon_start 1 locus_tag LOCUS_36940 CDS 37843..39207 product aminodeoxychorismate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978456.1 transl_table 11 codon_start 1 locus_tag LOCUS_36950 gene pabB CDS 39211..39789 product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381544.1 transl_table 11 codon_start 1 locus_tag LOCUS_36960 CDS 40053..41417 product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624274.1 transl_table 11 codon_start 1 locus_tag LOCUS_36970 gene sdaA CDS complement(41675..41836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36980 CDS 41774..43156 product cyclic diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192512.1 transl_table 11 codon_start 1 locus_tag LOCUS_36990 CDS complement(43178..44737) product CNNM family cation transport protein YoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421821.1 transl_table 11 codon_start 1 locus_tag LOCUS_37000 gene yoaE CDS 45210..46178 product PTS mannose transporter subunit IIAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150523.1 transl_table 11 codon_start 1 locus_tag LOCUS_37010 gene manX CDS 46231..47031 product PTS mannose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406918.1 transl_table 11 codon_start 1 locus_tag LOCUS_37020 gene manY CDS 47044..47895 product PTS mannose transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518647.1 transl_table 11 codon_start 1 locus_tag LOCUS_37030 CDS 47954..48412 product DUF986 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156273.1 transl_table 11 codon_start 1 locus_tag LOCUS_37040 CDS 48822..49388 product manganese efflux pump MntP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518359.1 transl_table 11 codon_start 1 locus_tag LOCUS_37050 gene mntP CDS complement(49385..50194) product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010934.1 transl_table 11 codon_start 1 locus_tag LOCUS_37060 gene rlmA CDS complement(50260..52005) product peptidoglycan glycosyltransferase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730322.1 transl_table 11 codon_start 1 locus_tag LOCUS_37070 gene ftsI CDS complement(52225..52434) product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062678.1 transl_table 11 codon_start 1 locus_tag LOCUS_37080 gene cspE CDS complement(53239..53472) product YebO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000660.1 transl_table 11 codon_start 1 locus_tag LOCUS_37090 CDS 53898..54137 product invasion protein YobH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236782.1 transl_table 11 codon_start 1 locus_tag LOCUS_37100 gene yobH CDS complement(54349..55140) product DNA-binding transcriptional regulator KdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262197.1 transl_table 11 codon_start 1 locus_tag LOCUS_37110 gene kdgR CDS complement(55303..55506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37120 CDS 55394..56689 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296135.1 transl_table 11 codon_start 1 locus_tag LOCUS_37130 CDS complement(56737..57618) product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000984498.1 transl_table 11 codon_start 1 locus_tag LOCUS_37140 gene htpX CDS complement(57812..59860) product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091235.1 transl_table 11 codon_start 1 locus_tag LOCUS_37150 gene prc CDS complement(59880..60566) product RNA chaperone ProQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431401.1 transl_table 11 codon_start 1 locus_tag LOCUS_37160 gene proQ CDS complement(60664..61161) product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145727.1 transl_table 11 codon_start 1 locus_tag LOCUS_37170 CDS 61290..62573 product membrane integrity lipid transport subunit YebS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207300.1 transl_table 11 codon_start 1 locus_tag LOCUS_37180 gene yebS CDS 62542..65175 product PqiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551143.1 transl_table 11 codon_start 1 locus_tag LOCUS_37190 CDS 65151..66692 product 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989184.1 transl_table 11 codon_start 1 locus_tag LOCUS_37200 gene rsmF CDS 66807..67046 product YebV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978523.1 transl_table 11 codon_start 1 locus_tag LOCUS_37210 CDS 67157..67348 product DUF1482 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457838.1 transl_table 11 codon_start 1 locus_tag LOCUS_37220 CDS complement(67367..68014) product protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986169.1 transl_table 11 codon_start 1 locus_tag LOCUS_37230 gene pphA CDS complement(68035..68268) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37240 CDS complement(68241..68405) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37250 CDS complement(68690..69412) product SPI-1 type III secretion system guanine nucleotide exchange factor SopE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161708.1 transl_table 11 codon_start 1 locus_tag LOCUS_37260 gene sopE CDS 70096..70491 product DUF1398 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422884.1 transl_table 11 codon_start 1 locus_tag LOCUS_37270 CDS 70821..71297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030950.1 transl_table 11 codon_start 1 locus_tag LOCUS_37280 CDS complement(71670..72089) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354403.1 transl_table 11 codon_start 1 locus_tag LOCUS_37290 CDS complement(72221..72415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37300 CDS 72797..72976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37310 CDS complement(73230..74390) product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209743.1 transl_table 11 codon_start 1 locus_tag LOCUS_37320 sequence25 source 1..74012 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(202..1794) product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961480.1 transl_table 11 codon_start 1 locus_tag LOCUS_37330 CDS 2013..2933 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056404.1 transl_table 11 codon_start 1 locus_tag LOCUS_37340 gene ldtB CDS complement(2977..4089) product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046516.1 transl_table 11 codon_start 1 locus_tag LOCUS_37350 CDS complement(4086..4559) product manganese-binding transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533542.1 transl_table 11 codon_start 1 locus_tag LOCUS_37360 gene mntR CDS 4745..4873 product manganase accumulation protein MntS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001761.1 transl_table 11 codon_start 1 locus_tag LOCUS_37370 gene mntS CDS 5138..6718 product phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089326.1 transl_table 11 codon_start 1 locus_tag LOCUS_37380 CDS complement(6780..7295) product outer membrane protein OmpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716763.1 transl_table 11 codon_start 1 locus_tag LOCUS_37390 gene ompX CDS 7648..8535 product threonine/homoserine exporter RhtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119558.1 transl_table 11 codon_start 1 locus_tag LOCUS_37400 gene rhtA CDS 8838..9341 product DNA starvation/stationary phase protection protein Dps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100805.1 transl_table 11 codon_start 1 locus_tag LOCUS_37410 gene dps CDS 9818..10564 product glutamine ABC transporter substrate-binding protein GlnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838671.1 transl_table 11 codon_start 1 locus_tag LOCUS_37420 gene glnH CDS 10708..11367 product glutamine ABC transporter permease GlnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159076.1 transl_table 11 codon_start 1 locus_tag LOCUS_37430 gene glnP CDS 11364..12086 product glutamine ABC transporter ATP-binding protein GlnQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569093.1 transl_table 11 codon_start 1 locus_tag LOCUS_37440 gene glnQ CDS 12205..14421 product mechanosensitive channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267712.1 transl_table 11 codon_start 1 locus_tag LOCUS_37450 gene ybiO CDS complement(14418..15344) product 23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305954.1 transl_table 11 codon_start 1 locus_tag LOCUS_37460 gene rlmF CDS 15549..15815 product DksA/TraR family C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146332.1 transl_table 11 codon_start 1 locus_tag LOCUS_37470 CDS 16100..16360 product DUF1471 family protein YbiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000849089.1 transl_table 11 codon_start 1 locus_tag LOCUS_37480 gene ybiJ CDS complement(16516..17490) product DNA-binding protein YbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386513.1 transl_table 11 codon_start 1 locus_tag LOCUS_37490 gene ybiB CDS complement(17520..19664) product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704815.1 transl_table 11 codon_start 1 locus_tag LOCUS_37500 gene dinG CDS complement(19872..21233) product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007058.1 transl_table 11 codon_start 1 locus_tag LOCUS_37510 gene rhlE CDS 21460..22137 product transcriptional regulator CecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025256.1 transl_table 11 codon_start 1 locus_tag LOCUS_37520 gene cecR CDS 22137..23132 product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743445.1 transl_table 11 codon_start 1 locus_tag LOCUS_37530 gene hlyD CDS 23125..24861 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287626.1 transl_table 11 codon_start 1 locus_tag LOCUS_37540 CDS 24854..25984 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045765.1 transl_table 11 codon_start 1 locus_tag LOCUS_37550 CDS 26100..27206 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469048.1 transl_table 11 codon_start 1 locus_tag LOCUS_37560 CDS complement(27168..27578) product YbhQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871970.1 transl_table 11 codon_start 1 locus_tag LOCUS_37570 CDS 27711..28469 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192041.1 transl_table 11 codon_start 1 locus_tag LOCUS_37580 CDS 28466..29707 product cardiolipin synthase ClsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649638.1 transl_table 11 codon_start 1 locus_tag LOCUS_37590 gene clsB CDS 29707..30669 product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129824.1 transl_table 11 codon_start 1 locus_tag LOCUS_37600 CDS complement(30672..31232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37610 CDS complement(31240..31830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37620 CDS complement(31872..32393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37630 CDS complement(32724..33428) product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367602.1 transl_table 11 codon_start 1 locus_tag LOCUS_37640 CDS complement(33476..33928) product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545202.1 transl_table 11 codon_start 1 locus_tag LOCUS_37650 gene moaE CDS complement(33930..34175) product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001575835.1 transl_table 11 codon_start 1 locus_tag LOCUS_37660 gene moaD CDS complement(34168..34653) product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080893.1 transl_table 11 codon_start 1 locus_tag LOCUS_37670 gene moaC CDS complement(34656..35168) product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084604.1 transl_table 11 codon_start 1 locus_tag LOCUS_37680 gene moaB CDS complement(35190..36212) product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168180.1 transl_table 11 codon_start 1 locus_tag LOCUS_37690 gene moaA CDS 36576..37484 product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246034.1 transl_table 11 codon_start 1 locus_tag LOCUS_37700 gene yvcK CDS complement(37576..38160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37710 note possible pseudo, frameshifted CDS complement(38250..38906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37720 note possible pseudo, internal stop codon, frameshifted CDS complement(38994..39830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37730 note possible pseudo, internal stop codon, frameshifted CDS complement(40320..42341) product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042501.1 transl_table 11 codon_start 1 locus_tag LOCUS_37740 gene uvrB CDS complement(42992..43678) product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167219.1 transl_table 11 codon_start 1 locus_tag LOCUS_37750 gene bioD CDS complement(43671..44426) product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079913.1 transl_table 11 codon_start 1 locus_tag LOCUS_37760 gene bioC CDS complement(44410..45567) product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118943.1 transl_table 11 codon_start 1 locus_tag LOCUS_37770 gene bioF CDS complement(45564..46604) product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090724.1 transl_table 11 codon_start 1 locus_tag LOCUS_37780 gene bioB CDS 46691..47980 product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205503.1 transl_table 11 codon_start 1 locus_tag LOCUS_37790 gene bioA CDS 48038..48514 product kinase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767403.1 transl_table 11 codon_start 1 locus_tag LOCUS_37800 CDS complement(48599..50119) product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095232.1 transl_table 11 codon_start 1 locus_tag LOCUS_37810 gene hutH CDS complement(50121..51806) product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115205.1 transl_table 11 codon_start 1 locus_tag LOCUS_37820 gene hutU CDS complement(52003..52728) product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287410.1 transl_table 11 codon_start 1 locus_tag LOCUS_37830 CDS complement(52773..53714) product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195673.1 transl_table 11 codon_start 1 locus_tag LOCUS_37840 gene hutG CDS complement(53711..54880) product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249497.1 transl_table 11 codon_start 1 locus_tag LOCUS_37850 gene hutI CDS 55172..56455 product putative acyl-CoA thioester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094768.1 transl_table 11 codon_start 1 locus_tag LOCUS_37860 CDS complement(56599..57594) product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815470.1 transl_table 11 codon_start 1 locus_tag LOCUS_37870 gene pgl CDS 57716..58576 product pyridoxal phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989132.1 transl_table 11 codon_start 1 locus_tag LOCUS_37880 CDS complement(58577..59635) product molybdenum ABC transporter ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891721.1 transl_table 11 codon_start 1 locus_tag LOCUS_37890 gene modC CDS complement(59638..60327) product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604026.1 transl_table 11 codon_start 1 locus_tag LOCUS_37900 gene modB CDS complement(60327..61100) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951413.1 transl_table 11 codon_start 1 locus_tag LOCUS_37910 gene modA CDS complement(61267..61416) product AcrZ family multidrug efflux pump-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045380498.1 transl_table 11 codon_start 1 locus_tag LOCUS_37920 CDS 61545..62333 product molybdenum-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147416.1 transl_table 11 codon_start 1 locus_tag LOCUS_37930 gene modE CDS 62401..63876 product molybdate ABC transporter ATP-binding protein ModF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096923.1 transl_table 11 codon_start 1 locus_tag LOCUS_37940 gene modF CDS 64047..64955 product DUF2167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885529.1 transl_table 11 codon_start 1 locus_tag LOCUS_37950 CDS 65178..66194 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001265456.1 transl_table 11 codon_start 1 locus_tag LOCUS_37960 gene galE CDS 66205..67251 product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187468.1 transl_table 11 codon_start 1 locus_tag LOCUS_37970 gene galT CDS 67254..68402 product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049364.1 transl_table 11 codon_start 1 locus_tag LOCUS_37980 gene galK CDS 68396..69436 product galactose-1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931431.1 transl_table 11 codon_start 1 locus_tag LOCUS_37990 gene galM CDS 69660..70412 product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301554.1 transl_table 11 codon_start 1 locus_tag LOCUS_38000 gene gpmA CDS complement(70503..71279) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253471.1 transl_table 11 codon_start 1 locus_tag LOCUS_38010 CDS complement(71279..72262) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128344.1 transl_table 11 codon_start 1 locus_tag LOCUS_38020 CDS complement(72738..73436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703615.1 transl_table 11 codon_start 1 locus_tag LOCUS_38030 sequence26 source 1..69931 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 97..1887 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244800.1 transl_table 11 codon_start 1 locus_tag LOCUS_38040 CDS complement(1928..2929) product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368546.1 transl_table 11 codon_start 1 locus_tag LOCUS_38050 CDS complement(2995..3921) product ribonuclease BN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000419093.1 transl_table 11 codon_start 1 locus_tag LOCUS_38060 gene rbn CDS 3973..4434 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568155.1 transl_table 11 codon_start 1 locus_tag LOCUS_38070 CDS 4489..4794 product stress response protein ElaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242981.1 transl_table 11 codon_start 1 locus_tag LOCUS_38080 gene elaB CDS 4895..6190 product isochorismate synthase MenF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000555672.1 transl_table 11 codon_start 1 locus_tag LOCUS_38090 gene menF CDS 6276..7946 product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116387.1 transl_table 11 codon_start 1 locus_tag LOCUS_38100 gene menD CDS 7943..8701 product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979148.1 transl_table 11 codon_start 1 locus_tag LOCUS_38110 gene menH CDS 8716..9573 product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640013.1 transl_table 11 codon_start 1 locus_tag LOCUS_38120 gene menB CDS 9573..10535 product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255562.1 transl_table 11 codon_start 1 locus_tag LOCUS_38130 gene menC CDS 10532..11899 product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144672.1 transl_table 11 codon_start 1 locus_tag LOCUS_38140 gene menE CDS 11997..12254 product signal transduction protein PmrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455131.1 transl_table 11 codon_start 1 locus_tag LOCUS_38150 gene pmrD CDS complement(12249..12626) product 4-amino-4-deoxy-L-arabinose-phosphoundecaprenol flippase subunit ArnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538693.1 transl_table 11 codon_start 1 locus_tag LOCUS_38160 gene arnF CDS complement(12626..12961) product 4-amino-4-deoxy-L-arabinose-phosphoundecaprenol flippase subunit ArnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579483.1 transl_table 11 codon_start 1 locus_tag LOCUS_38170 gene arnE CDS complement(12958..14604) product lipid IV(A) 4-amino-4-deoxy-L-arabinosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024131156.1 transl_table 11 codon_start 1 locus_tag LOCUS_38180 gene arnT CDS complement(14601..15500) product 4-deoxy-4-formamido-L-arabinose-phosphoundecaprenol deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169759.1 transl_table 11 codon_start 1 locus_tag LOCUS_38190 gene arnD CDS complement(15497..17479) product bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648774.1 transl_table 11 codon_start 1 locus_tag LOCUS_38200 gene arnA CDS complement(17476..18459) product undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000458894.1 transl_table 11 codon_start 1 locus_tag LOCUS_38210 gene arnC CDS complement(18462..19601) product UDP-4-amino-4-deoxy-L-arabinose aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279286.1 transl_table 11 codon_start 1 locus_tag LOCUS_38220 gene arnB CDS 19900..20505 product lipopolysaccharide core heptose(II)-phosphate phosphatase PmrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879245.1 transl_table 11 codon_start 1 locus_tag LOCUS_38230 gene pmrG CDS complement(20550..20975) product nucleoside triphosphatase NudI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249902.1 transl_table 11 codon_start 1 locus_tag LOCUS_38240 gene nudI CDS 21122..21796 product YfaZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001574701.1 transl_table 11 codon_start 1 locus_tag LOCUS_38250 CDS 21911..23107 product nicotinamide mononucleotide deamidase-related protein YfaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935685.1 transl_table 11 codon_start 1 locus_tag LOCUS_38260 CDS 23357..24139 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894172.1 transl_table 11 codon_start 1 locus_tag LOCUS_38270 CDS 24153..25358 product L-rhamnonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427822.1 transl_table 11 codon_start 1 locus_tag LOCUS_38280 gene rhmD CDS 25414..26703 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028931.1 transl_table 11 codon_start 1 locus_tag LOCUS_38290 CDS 26729..27532 product 2-keto-3-deoxy-L-rhamnonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992948.1 transl_table 11 codon_start 1 locus_tag LOCUS_38300 gene yfaU CDS 27538..27714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38310 CDS complement(27801..28823) product SPI-2 type III secretion system effector deubiquitinase SseL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017745.1 transl_table 11 codon_start 1 locus_tag LOCUS_38320 gene sseL CDS complement(29249..30439) product anaerobic glycerol-3-phosphate dehydrogenase subunit GlpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285727.1 transl_table 11 codon_start 1 locus_tag LOCUS_38330 gene glpC CDS complement(30436..31695) product glycerol-3-phosphate dehydrogenase subunit GlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667159.1 transl_table 11 codon_start 1 locus_tag LOCUS_38340 gene glpB CDS complement(31772..33313) product anaerobic glycerol-3-phosphate dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857213.1 transl_table 11 codon_start 1 locus_tag LOCUS_38350 gene glpA CDS 33586..34944 product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948703.1 transl_table 11 codon_start 1 locus_tag LOCUS_38360 gene glpT CDS 34949..36019 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858949.1 transl_table 11 codon_start 1 locus_tag LOCUS_38370 gene glpQ CDS complement(36135..37013) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176728.1 transl_table 11 codon_start 1 locus_tag LOCUS_38380 CDS 37175..38365 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660244.1 transl_table 11 codon_start 1 locus_tag LOCUS_38390 CDS complement(38367..38621) product ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533921.1 transl_table 11 codon_start 1 locus_tag LOCUS_38400 gene yfaE CDS complement(38621..39751) product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000332020.1 transl_table 11 codon_start 1 locus_tag LOCUS_38410 gene nrdB CDS complement(39864..42149) product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076502.1 transl_table 11 codon_start 1 locus_tag LOCUS_38420 gene nrdA CDS complement(42505..43233) product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091011.1 transl_table 11 codon_start 1 locus_tag LOCUS_38430 CDS complement(43316..44011) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944714.1 transl_table 11 codon_start 1 locus_tag LOCUS_38440 CDS 44250..45575 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098092.1 transl_table 11 codon_start 1 locus_tag LOCUS_38450 CDS 45590..46792 product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705579.1 transl_table 11 codon_start 1 locus_tag LOCUS_38460 CDS 47202..49838 product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281282.1 transl_table 11 codon_start 1 locus_tag LOCUS_38470 gene gyrA CDS 49956..52802 product two-component system sensor histidine kinase RcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876074.1 transl_table 11 codon_start 1 locus_tag LOCUS_38480 gene rcsC CDS complement(52905..53555) product response regulator transcription factor RcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061910.1 transl_table 11 codon_start 1 locus_tag LOCUS_38490 gene rcsB CDS complement(53572..56241) product phosphotransferase RcsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083209.1 transl_table 11 codon_start 1 locus_tag LOCUS_38500 gene rcsD CDS 56969..58105 product porin OmpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865526.1 transl_table 11 codon_start 1 locus_tag LOCUS_38510 CDS 58220..59272 product FAD:protein FMN transferase ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784304.1 transl_table 11 codon_start 1 locus_tag LOCUS_38520 gene apbE CDS 59356..60414 product bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000975974.1 transl_table 11 codon_start 1 locus_tag LOCUS_38530 gene ada CDS 60417..61067 product DNA oxidative demethylase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884984.1 transl_table 11 codon_start 1 locus_tag LOCUS_38540 gene alkB CDS 61141..62784 product multidrug ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421580.1 transl_table 11 codon_start 1 locus_tag LOCUS_38550 CDS complement(62967..63473) product serine protease inhibitor ecotin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001764187.1 transl_table 11 codon_start 1 locus_tag LOCUS_38560 gene eco CDS 64356..64619 product chaperone NapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260058.1 transl_table 11 codon_start 1 locus_tag LOCUS_38570 gene napD CDS 64616..67102 product nitrate reductase catalytic subunit NapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778090.1 transl_table 11 codon_start 1 locus_tag LOCUS_38580 gene napA CDS 67109..67804 product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091679.1 transl_table 11 codon_start 1 locus_tag LOCUS_38590 gene napG CDS 67791..68660 product quinol dehydrogenase ferredoxin subunit NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013528.1 transl_table 11 codon_start 1 locus_tag LOCUS_38600 gene napH CDS 68755..69225 product nitrate reductase cytochrome c-type subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835182.1 transl_table 11 codon_start 1 locus_tag LOCUS_38610 gene napB CDS 69235..69837 product cytochrome c-type protein NapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431773.1 transl_table 11 codon_start 1 locus_tag LOCUS_38620 gene napC sequence27 source 1..67118 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..834 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000106933.1:TMAO reductase system sensor histidine kinase/response regulator TorS locus_tag LOCUS_38630 CDS complement(860..2152) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032706561.1 transl_table 11 codon_start 1 locus_tag LOCUS_38640 CDS complement(2282..3430) product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703894.1 transl_table 11 codon_start 1 locus_tag LOCUS_38650 gene dgoD CDS complement(3427..4044) product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703895.1 transl_table 11 codon_start 1 locus_tag LOCUS_38660 CDS complement(4028..4906) product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703896.1 transl_table 11 codon_start 1 locus_tag LOCUS_38670 CDS complement(4903..5592) product D-galactonate utilization transcriptional regulator DgoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369039.1 transl_table 11 codon_start 1 locus_tag LOCUS_38680 gene dgoR CDS complement(5853..6698) product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985571.1 transl_table 11 codon_start 1 locus_tag LOCUS_38690 gene yidA CDS 7003..8265 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061243.1 transl_table 11 codon_start 1 locus_tag LOCUS_38700 CDS 8279..9472 product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000975831.1 transl_table 11 codon_start 1 locus_tag LOCUS_38710 CDS 9587..10483 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054598.1 transl_table 11 codon_start 1 locus_tag LOCUS_38720 CDS complement(10502..12916) product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072047.1 transl_table 11 codon_start 1 locus_tag LOCUS_38730 gene gyrB CDS complement(12945..14018) product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059373.1 transl_table 11 codon_start 1 locus_tag LOCUS_38740 gene recF CDS complement(14166..15266) product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673474.1 transl_table 11 codon_start 1 locus_tag LOCUS_38750 gene dnaN CDS complement(15271..16602) product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059095.1 transl_table 11 codon_start 1 locus_tag LOCUS_38760 gene dnaA CDS 17522..17848 product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239725.1 transl_table 11 codon_start 1 locus_tag LOCUS_38770 gene rnpA CDS 18072..19718 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378272.1 transl_table 11 codon_start 1 locus_tag LOCUS_38780 gene yidC CDS complement(19602..19808) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38790 CDS 19860..21224 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019075.1 transl_table 11 codon_start 1 locus_tag LOCUS_38800 gene mnmE CDS 21407..22594 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819608.1 transl_table 11 codon_start 1 locus_tag LOCUS_38810 CDS 22563..23522 product HTH-type transcriptional regulator YidZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749373.1 transl_table 11 codon_start 1 locus_tag LOCUS_38820 gene yidZ CDS 23680..24435 product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190678.1 transl_table 11 codon_start 1 locus_tag LOCUS_38830 CDS 24453..25019 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013212.1 transl_table 11 codon_start 1 locus_tag LOCUS_38840 CDS complement(25064..26401) product adenine permease AdeP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001214973.1 transl_table 11 codon_start 1 locus_tag LOCUS_38850 gene adeP CDS 26570..27235 product 6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078084.1 transl_table 11 codon_start 1 locus_tag LOCUS_38860 gene yieH CDS complement(27330..28055) product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377800.1 transl_table 11 codon_start 1 locus_tag LOCUS_38870 gene phoU CDS complement(28070..28837) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063118.1 transl_table 11 codon_start 1 locus_tag LOCUS_38880 gene pstB CDS complement(28930..29820) product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212190.1 transl_table 11 codon_start 1 locus_tag LOCUS_38890 gene pstA CDS complement(29820..30779) product phosphate ABC transporter permease PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741630.1 transl_table 11 codon_start 1 locus_tag LOCUS_38900 gene pstC CDS complement(30915..31955) product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867129.1 transl_table 11 codon_start 1 locus_tag LOCUS_38910 gene pstS CDS complement(32121..33494) product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162538.1 transl_table 11 codon_start 1 locus_tag LOCUS_38920 CDS complement(33543..34361) product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166706.1 transl_table 11 codon_start 1 locus_tag LOCUS_38930 CDS 34423..36213 product SgrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235491.1 transl_table 11 codon_start 1 locus_tag LOCUS_38940 CDS complement(36364..38193) product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334049.1 transl_table 11 codon_start 1 locus_tag LOCUS_38950 gene glmS CDS complement(38382..39752) product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934853.1 transl_table 11 codon_start 1 locus_tag LOCUS_38960 gene glmU CDS complement(40072..40770) product Bax inhibitor-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009901.1 transl_table 11 codon_start 1 locus_tag LOCUS_38970 CDS complement(41000..41419) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251971.1 transl_table 11 codon_start 1 locus_tag LOCUS_38980 CDS complement(41440..42822) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190499.1 transl_table 11 codon_start 1 locus_tag LOCUS_38990 gene atpD CDS complement(42849..43712) product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896504.1 transl_table 11 codon_start 1 locus_tag LOCUS_39000 gene atpG CDS complement(43763..45304) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176751.1 transl_table 11 codon_start 1 locus_tag LOCUS_39010 gene atpA CDS complement(45317..45850) product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288957.1 transl_table 11 codon_start 1 locus_tag LOCUS_39020 gene atpH CDS complement(45865..46335) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052212.1 transl_table 11 codon_start 1 locus_tag LOCUS_39030 gene atpF CDS complement(46395..46634) product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429386.1 transl_table 11 codon_start 1 locus_tag LOCUS_39040 gene atpE CDS complement(46681..47496) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135632.1 transl_table 11 codon_start 1 locus_tag LOCUS_39050 gene atpB CDS complement(47505..47885) product F0F1 ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145371.1 transl_table 11 codon_start 1 locus_tag LOCUS_39060 gene atpI CDS complement(48501..49130) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519938.1 transl_table 11 codon_start 1 locus_tag LOCUS_39070 gene rsmG CDS complement(49227..51116) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499882.1 transl_table 11 codon_start 1 locus_tag LOCUS_39080 gene mnmG CDS complement(51495..51938) product FMN-binding protein MioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763722.1 transl_table 11 codon_start 1 locus_tag LOCUS_39090 gene mioC CDS complement(52028..52486) product transcriptional regulator AsnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433016.1 transl_table 11 codon_start 1 locus_tag LOCUS_39100 gene asnC CDS 52637..53629 product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845119.1 transl_table 11 codon_start 1 locus_tag LOCUS_39110 gene asnA CDS complement(53634..55085) product ATPase RavA stimulator ViaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956591.1 transl_table 11 codon_start 1 locus_tag LOCUS_39120 gene viaA CDS complement(55079..56575) product ATPase RavA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940993.1 transl_table 11 codon_start 1 locus_tag LOCUS_39130 gene ravA CDS 56923..58791 product low affinity potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102337.1 transl_table 11 codon_start 1 locus_tag LOCUS_39140 gene kup CDS 59008..59427 product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715950.1 transl_table 11 codon_start 1 locus_tag LOCUS_39150 gene rbsD CDS 59390..60940 product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339360.1 transl_table 11 codon_start 1 locus_tag LOCUS_39160 gene rbsA CDS 60946..61911 product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211345.1 transl_table 11 codon_start 1 locus_tag LOCUS_39170 gene rbsC CDS 61936..62826 product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056260.1 transl_table 11 codon_start 1 locus_tag LOCUS_39180 gene rbsB CDS 62959..63888 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844732.1 transl_table 11 codon_start 1 locus_tag LOCUS_39190 gene rbsK CDS 63892..64890 product ribose operon transcriptional repressor RbsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224487.1 transl_table 11 codon_start 1 locus_tag LOCUS_39200 gene rbsR CDS complement(64856..66046) product multidrug transporter subunit MdtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099391.1 transl_table 11 codon_start 1 locus_tag LOCUS_39210 gene mdtD note possible pseudo, frameshifted CDS complement(66034..66279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39220 note possible pseudo, frameshifted CDS complement(66291..66995) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131144.1 transl_table 11 codon_start 1 locus_tag LOCUS_39230 sequence28 source 1..60849 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(294..824) product molybdopterin-guanine dinucleotide biosynthesis protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989262.1 transl_table 11 codon_start 1 locus_tag LOCUS_39240 gene mobB CDS complement(806..1390) product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046874.1 transl_table 11 codon_start 1 locus_tag LOCUS_39250 gene mobA CDS 1460..1729 product YihD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649858.1 transl_table 11 codon_start 1 locus_tag LOCUS_39260 CDS 1806..2792 product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999265.1 transl_table 11 codon_start 1 locus_tag LOCUS_39270 CDS 2809..3432 product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725369.1 transl_table 11 codon_start 1 locus_tag LOCUS_39280 gene dsbA CDS complement(3445..4194) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196902.1 transl_table 11 codon_start 1 locus_tag LOCUS_39290 CDS 4741..7527 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249956.1 transl_table 11 codon_start 1 locus_tag LOCUS_39300 gene polA CDS complement(7862..8494) product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183327.1 transl_table 11 codon_start 1 locus_tag LOCUS_39310 gene yihA CDS 8761..8958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39320 CDS 9077..9592 product Der GTPase-activating protein YihI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743292.1 transl_table 11 codon_start 1 locus_tag LOCUS_39330 gene yihI CDS 9781..11154 product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003520.1 transl_table 11 codon_start 1 locus_tag LOCUS_39340 gene hemN CDS complement(11467..12876) product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188774.1 transl_table 11 codon_start 1 locus_tag LOCUS_39350 gene glnG CDS complement(12885..13934) product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146194.1 transl_table 11 codon_start 1 locus_tag LOCUS_39360 gene glnL CDS complement(14209..15618) product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271699.1 transl_table 11 codon_start 1 locus_tag LOCUS_39370 gene glnA CDS 15994..17817 product ribosome-dependent GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572064.1 transl_table 11 codon_start 1 locus_tag LOCUS_39380 gene typA CDS complement(17872..18606) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270591.1 transl_table 11 codon_start 1 locus_tag LOCUS_39390 CDS complement(18591..19469) product STM4011 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001681897.1 transl_table 11 codon_start 1 locus_tag LOCUS_39400 CDS complement(19466..20707) product STM4012 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058547.1 transl_table 11 codon_start 1 locus_tag LOCUS_39410 CDS complement(20709..21584) product STM4013/SEN3800 family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282797.1 transl_table 11 codon_start 1 locus_tag LOCUS_39420 CDS complement(21577..22563) product STM4014 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631310.1 transl_table 11 codon_start 1 locus_tag LOCUS_39430 CDS complement(22615..23463) product STM4015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042080.1 transl_table 11 codon_start 1 locus_tag LOCUS_39440 CDS complement(23620..24312) product porin OmpL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838825.1 transl_table 11 codon_start 1 locus_tag LOCUS_39450 gene ompL CDS complement(24380..24958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39460 note possible pseudo, frameshifted CDS complement(24943..25800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39470 note possible pseudo, frameshifted CDS complement(25846..27228) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084241.1 transl_table 11 codon_start 1 locus_tag LOCUS_39480 CDS complement(27274..29310) product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087028.1 transl_table 11 codon_start 1 locus_tag LOCUS_39490 CDS complement(29354..30196) product aldose-1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005052848.1 transl_table 11 codon_start 1 locus_tag LOCUS_39500 CDS complement(30215..31456) product sulfoquinovose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870897.1 transl_table 11 codon_start 1 locus_tag LOCUS_39510 gene yihS CDS complement(31472..32350) product sulfofructosephosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067413.1 transl_table 11 codon_start 1 locus_tag LOCUS_39520 gene yihT CDS complement(32373..33269) product sulfolactaldehyde 3-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268240.1 transl_table 11 codon_start 1 locus_tag LOCUS_39530 gene yihU CDS 33434..34330 product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001520529.1 transl_table 11 codon_start 1 locus_tag LOCUS_39540 CDS 34358..35167 product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059689.1 transl_table 11 codon_start 1 locus_tag LOCUS_39550 CDS 35358..35957 product glucose-1-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965695.1 transl_table 11 codon_start 1 locus_tag LOCUS_39560 gene yihX CDS 35951..36823 product virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921423.1 transl_table 11 codon_start 1 locus_tag LOCUS_39570 CDS 36820..37257 product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560975.1 transl_table 11 codon_start 1 locus_tag LOCUS_39580 gene dtd CDS 37302..38243 product fatty acid biosynthesis protein FabY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080770.1 transl_table 11 codon_start 1 locus_tag LOCUS_39590 gene fabY CDS complement(38258..38686) product type II toxin-antitoxin system HigA family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259009.1 transl_table 11 codon_start 1 locus_tag LOCUS_39600 CDS complement(38701..39012) product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558160.1 transl_table 11 codon_start 1 locus_tag LOCUS_39610 CDS complement(39098..40027) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162859.1 transl_table 11 codon_start 1 locus_tag LOCUS_39620 CDS 40245..40556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099360.1 transl_table 11 codon_start 1 locus_tag LOCUS_39630 CDS 40557..40847 product NadS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356397.1 transl_table 11 codon_start 1 locus_tag LOCUS_39640 gene nadS CDS complement(40894..41823) product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027727.1 transl_table 11 codon_start 1 locus_tag LOCUS_39650 gene fdhE CDS complement(41820..42455) product formate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829025.1 transl_table 11 codon_start 1 locus_tag LOCUS_39660 gene fdoI CDS complement(42452..43354) product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331359.1 transl_table 11 codon_start 1 locus_tag LOCUS_39670 gene fdxH CDS complement(43367..46417) product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989259.1 transl_table 11 codon_start 1 transl_except (pos:45830..45832,aa:Sec) note codon on position 196 is selenocysteine opal codon. locus_tag LOCUS_39680 gene fdnG CDS 46645..47448 product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059746.1 transl_table 11 codon_start 1 locus_tag LOCUS_39690 gene fdhD CDS complement(47716..48180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39700 note possible pseudo, frameshifted CDS complement(48137..48736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39710 note possible pseudo, frameshifted CDS 48919..50019 product YiiG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828045.1 transl_table 11 codon_start 1 locus_tag LOCUS_39720 CDS complement(50375..50698) product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368956.1 transl_table 11 codon_start 1 locus_tag LOCUS_39730 CDS complement(50698..51357) product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683586.1 transl_table 11 codon_start 1 locus_tag LOCUS_39740 CDS 51458..52006 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989088.1 transl_table 11 codon_start 1 locus_tag LOCUS_39750 CDS complement(52095..52409) product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619478.1 transl_table 11 codon_start 1 locus_tag LOCUS_39760 gene rhaM CDS complement(52406..53554) product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009255.1 transl_table 11 codon_start 1 locus_tag LOCUS_39770 gene fucO CDS complement(53681..54508) product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179732.1 transl_table 11 codon_start 1 locus_tag LOCUS_39780 gene rhaD CDS complement(54651..55910) product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211475.1 transl_table 11 codon_start 1 locus_tag LOCUS_39790 CDS complement(55907..57376) product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000143961.1 transl_table 11 codon_start 1 locus_tag LOCUS_39800 gene rhaB CDS 57664..58500 product HTH-type transcriptional activator RhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217112.1 transl_table 11 codon_start 1 locus_tag LOCUS_39810 gene rhaS CDS 58653..59501 product HTH-type transcriptional activator RhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013291.1 transl_table 11 codon_start 1 locus_tag LOCUS_39820 gene rhaR CDS complement(59498..60532) product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063537.1 transl_table 11 codon_start 1 locus_tag LOCUS_39830 gene rhaT sequence29 source 1..51163 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1065..1937 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366540.1 transl_table 11 codon_start 1 locus_tag LOCUS_39840 CDS 2053..3243 product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154617.1 transl_table 11 codon_start 1 locus_tag LOCUS_39850 CDS complement(3290..3955) product MarC family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968968.1 transl_table 11 codon_start 1 locus_tag LOCUS_39860 CDS 4214..4648 product multiple antibiotic resistance transcriptional regulator MarR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843434.1 transl_table 11 codon_start 1 locus_tag LOCUS_39870 gene marR CDS 4668..5051 product MDR efflux pump AcrAB transcriptional activator MarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091194.1 transl_table 11 codon_start 1 locus_tag LOCUS_39880 gene marA CDS 5086..5295 product multiple antibiotic resistance protein MarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783049.1 transl_table 11 codon_start 1 locus_tag LOCUS_39890 gene marB CDS complement(5414..6316) product O-acetylserine/cysteine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987753.1 transl_table 11 codon_start 1 locus_tag LOCUS_39900 gene eamA CDS 6544..7731 product efflux MFS transporter YdeE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068053.1 transl_table 11 codon_start 1 locus_tag LOCUS_39910 gene ydeE CDS complement(8422..8814) product YdeI family stress tolerance OB fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776348.1 transl_table 11 codon_start 1 locus_tag LOCUS_39920 CDS 9242..9769 product 2-oxo-tetronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235351.1 transl_table 11 codon_start 1 locus_tag LOCUS_39930 CDS complement(9905..10087) product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807642.1 transl_table 11 codon_start 1 locus_tag LOCUS_39940 CDS complement(10431..12473) product peptidyl-dipeptidase Dcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106277.1 transl_table 11 codon_start 1 locus_tag LOCUS_39950 gene dcp CDS 12612..13358 product bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636564.1 transl_table 11 codon_start 1 locus_tag LOCUS_39960 gene ydfG CDS 13488..14174 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215563.1 transl_table 11 codon_start 1 locus_tag LOCUS_39970 CDS 14356..14559 product putative selenium delivery protein YdfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000989267.1 transl_table 11 codon_start 1 locus_tag LOCUS_39980 gene ydfZ CDS complement(14626..16092) product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181244.1 transl_table 11 codon_start 1 locus_tag LOCUS_39990 CDS complement(16236..17615) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192118.1 transl_table 11 codon_start 1 locus_tag LOCUS_40000 CDS complement(17669..18688) product Zn-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096790.1 transl_table 11 codon_start 1 locus_tag LOCUS_40010 CDS complement(18699..19913) product starvation-sensing protein RspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706283.1 transl_table 11 codon_start 1 locus_tag LOCUS_40020 gene rspA CDS complement(20035..20361) product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921383.1 transl_table 11 codon_start 1 locus_tag LOCUS_40030 CDS 20513..20854 product DUF1283 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066440.1 transl_table 11 codon_start 1 locus_tag LOCUS_40040 CDS 20890..21450 product spermidine N1-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199998.1 transl_table 11 codon_start 1 locus_tag LOCUS_40050 gene speG CDS complement(21491..22168) product YnfC family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743128.1 transl_table 11 codon_start 1 locus_tag LOCUS_40060 CDS 22308..22613 product DUF1161 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059218804.1 transl_table 11 codon_start 1 locus_tag LOCUS_40070 CDS 22770..25208 product DmsA/YnfE/YnfF family dimethyl sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117601.1 transl_table 11 codon_start 1 locus_tag LOCUS_40080 CDS 25307..27742 product DmsA/YnfE/YnfF family dimethyl sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705268.1 transl_table 11 codon_start 1 locus_tag LOCUS_40090 CDS 27753..28370 product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213069.1 transl_table 11 codon_start 1 locus_tag LOCUS_40100 gene dmsB CDS 28372..29229 product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534718.1 transl_table 11 codon_start 1 locus_tag LOCUS_40110 CDS 29272..29886 product Tat proofreading chaperone DmsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206559.1 transl_table 11 codon_start 1 locus_tag LOCUS_40120 gene dmsD CDS 30191..30901 product osmoprotectant ABC transporter permease OsmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547814.1 transl_table 11 codon_start 1 locus_tag LOCUS_40130 gene osmY CDS 30930..31832 product osmoprotectant ABC transporter substrate-binding protein OsmX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211196.1 transl_table 11 codon_start 1 locus_tag LOCUS_40140 gene osmX CDS 31842..32489 product osmoprotectant ABC transporter permease OsmW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379676.1 transl_table 11 codon_start 1 locus_tag LOCUS_40150 gene osmW CDS 32489..33637 product osmoprotectant ABC transporter ATP-binding protein OsmV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593089.1 transl_table 11 codon_start 1 locus_tag LOCUS_40160 gene osmV CDS 33773..35062 product voltage-gated ClC-type chloride channel ClcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000554911.1 transl_table 11 codon_start 1 locus_tag LOCUS_40170 gene clcB CDS complement(35018..35713) product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919236.1 transl_table 11 codon_start 1 locus_tag LOCUS_40180 gene bioD CDS complement(35839..37059) product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225096.1 transl_table 11 codon_start 1 locus_tag LOCUS_40190 CDS complement(37187..38086) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019571.1 transl_table 11 codon_start 1 locus_tag LOCUS_40200 CDS complement(38370..38564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40210 CDS 38563..39459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40220 CDS 39854..40102 product acid resistance repetitive basic protein Asr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001766314.1 transl_table 11 codon_start 1 locus_tag LOCUS_40230 gene asr CDS 40371..41192 product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549642.1 transl_table 11 codon_start 1 locus_tag LOCUS_40240 CDS complement(41232..41561) product multidrug/spermidine efflux SMR transporter subunit MdtI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183821.1 transl_table 11 codon_start 1 locus_tag LOCUS_40250 gene mdtI CDS complement(41548..41910) product multidrug/spermidine efflux SMR transporter subunit MdtJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000500278.1 transl_table 11 codon_start 1 locus_tag LOCUS_40260 gene mdtJ CDS 42328..43362 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118268.1 transl_table 11 codon_start 1 locus_tag LOCUS_40270 CDS complement(43537..44925) product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014056.1 transl_table 11 codon_start 1 locus_tag LOCUS_40280 gene pntB CDS complement(44936..46465) product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219360.1 transl_table 11 codon_start 1 locus_tag LOCUS_40290 gene pntA CDS 46992..47936 product DUF1471 family protein YdgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769298.1 transl_table 11 codon_start 1 locus_tag LOCUS_40300 gene ydgH CDS 48235..49617 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412353.1 transl_table 11 codon_start 1 locus_tag LOCUS_40310 CDS complement(49679..50014) product GlpM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524877.1 transl_table 11 codon_start 1 locus_tag LOCUS_40320 CDS 50141..50872 product two-component system response regulator RstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080045.1 transl_table 11 codon_start 1 locus_tag LOCUS_40330 gene rstA sequence30 source 1..48800 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 659..1213 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40340 CDS complement(1375..1665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40350 CDS 1977..2444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40360 CDS 2820..2984 product YdaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169151.1 transl_table 11 codon_start 1 locus_tag LOCUS_40370 CDS 2977..3102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40380 CDS complement(3092..3613) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40390 CDS 4051..4272 product killing protein KilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560226.1 transl_table 11 codon_start 1 locus_tag LOCUS_40400 gene kilR CDS 4357..4674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40410 CDS 4702..5319 product exodeoxyribonuclease VIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105118.1 transl_table 11 codon_start 1 locus_tag LOCUS_40420 CDS 5312..5584 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40430 CDS 5636..6571 product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156215.1 transl_table 11 codon_start 1 locus_tag LOCUS_40440 gene ttcA CDS complement(6615..7988) product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096453.1 transl_table 11 codon_start 1 locus_tag LOCUS_40450 gene dbpA CDS complement(8475..9458) product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387372.1 transl_table 11 codon_start 1 locus_tag LOCUS_40460 gene zntB CDS complement(9604..10599) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000945629.1 transl_table 11 codon_start 1 locus_tag LOCUS_40470 CDS complement(11169..11732) product DNA endonuclease SmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046807.1 transl_table 11 codon_start 1 locus_tag LOCUS_40480 gene smrA CDS 11990..12505 product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000945036.1 transl_table 11 codon_start 1 locus_tag LOCUS_40490 gene ogt CDS 12701..13453 product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611917.1 transl_table 11 codon_start 1 locus_tag LOCUS_40500 gene fnr CDS 13604..14551 product universal stress protein UspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262143.1 transl_table 11 codon_start 1 locus_tag LOCUS_40510 gene uspE CDS complement(14606..14860) product DUF2534 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605645.1 transl_table 11 codon_start 1 locus_tag LOCUS_40520 CDS 15099..16130 product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493669.1 transl_table 11 codon_start 1 locus_tag LOCUS_40530 CDS complement(16212..16814) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163369.1 transl_table 11 codon_start 1 locus_tag LOCUS_40540 CDS 16858..17544 product B3/4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097260.1 transl_table 11 codon_start 1 locus_tag LOCUS_40550 CDS 17572..17910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051816.1 transl_table 11 codon_start 1 locus_tag LOCUS_40560 CDS complement(18017..18535) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062616.1 transl_table 11 codon_start 1 locus_tag LOCUS_40570 CDS complement(18673..19398) product two-partner-like secretion system exoprotein ZirS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242932.1 transl_table 11 codon_start 1 locus_tag LOCUS_40580 gene zirS CDS complement(19524..21506) product two-partner secretion translocator ZirT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000232040.1 transl_table 11 codon_start 1 locus_tag LOCUS_40590 gene zirT CDS complement(21581..22339) product two-partner-like secretion system exoprotein ZirU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273672.1 transl_table 11 codon_start 1 locus_tag LOCUS_40600 gene zirU CDS 22723..23577 product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989022.1 transl_table 11 codon_start 1 locus_tag LOCUS_40610 CDS 24461..25078 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40620 CDS complement(25292..25528) product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168017.1 transl_table 11 codon_start 1 locus_tag LOCUS_40630 CDS complement(25657..26247) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208481.1 transl_table 11 codon_start 1 locus_tag LOCUS_40640 CDS 26325..27038 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979081.1 transl_table 11 codon_start 1 locus_tag LOCUS_40650 gene bdcA CDS complement(27129..27965) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456775.1 transl_table 11 codon_start 1 locus_tag LOCUS_40660 CDS complement(28274..29179) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359197.1 transl_table 11 codon_start 1 locus_tag LOCUS_40670 CDS 29298..30227 product aromatic alcohol reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814344.1 transl_table 11 codon_start 1 locus_tag LOCUS_40680 CDS complement(30324..31937) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216556.1 transl_table 11 codon_start 1 locus_tag LOCUS_40690 CDS 32127..32855 product murein tripeptide amidase MpaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219125.1 transl_table 11 codon_start 1 locus_tag LOCUS_40700 gene mpaA CDS complement(32830..33795) product L-Ala-D/L-Glu epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258077.1 transl_table 11 codon_start 1 locus_tag LOCUS_40710 gene ycjG CDS 33911..34417 product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084375.1 transl_table 11 codon_start 1 locus_tag LOCUS_40720 gene tpx CDS complement(34507..36048) product transcriptional regulator TyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235493.1 transl_table 11 codon_start 1 locus_tag LOCUS_40730 gene tyrR CDS complement(36196..37257) product YcjF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294457.1 transl_table 11 codon_start 1 locus_tag LOCUS_40740 CDS complement(37254..38651) product YcjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825858.1 transl_table 11 codon_start 1 locus_tag LOCUS_40750 CDS complement(38800..39114) product thiosulfate sulfurtransferase PspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913432.1 transl_table 11 codon_start 1 locus_tag LOCUS_40760 gene pspE CDS complement(39190..39408) product phage shock protein PspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097607.1 transl_table 11 codon_start 1 locus_tag LOCUS_40770 gene pspD CDS complement(39431..39790) product envelope stress response membrane protein PspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014347.1 transl_table 11 codon_start 1 locus_tag LOCUS_40780 gene pspC CDS complement(39790..40014) product envelope stress response membrane protein PspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274953.1 transl_table 11 codon_start 1 locus_tag LOCUS_40790 gene pspB CDS complement(40074..40742) product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511000.1 transl_table 11 codon_start 1 locus_tag LOCUS_40800 gene pspA CDS 40913..41893 product phage shock protein operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001764157.1 transl_table 11 codon_start 1 locus_tag LOCUS_40810 gene pspF CDS 42005..43654 product peptide ABC transporter substrate-binding protein SapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241626.1 transl_table 11 codon_start 1 locus_tag LOCUS_40820 gene sapA CDS 43651..44616 product peptide ABC transporter permease SapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583298.1 transl_table 11 codon_start 1 locus_tag LOCUS_40830 gene sapB CDS 44603..45493 product peptide ABC transporter permease SapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146150.1 transl_table 11 codon_start 1 locus_tag LOCUS_40840 gene sapC CDS 45493..46485 product peptide ABC transporter ATP-binding protein SapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128869.1 transl_table 11 codon_start 1 locus_tag LOCUS_40850 gene sapD CDS 46487..47293 product peptide ABC transporter ATP-binding protein SapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230463.1 transl_table 11 codon_start 1 locus_tag LOCUS_40860 gene sapF CDS complement(47309..48016) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268399.1 transl_table 11 codon_start 1 locus_tag LOCUS_40870 sequence31 source 1..44754 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 607..1077 product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000243713.1 transl_table 11 codon_start 1 locus_tag LOCUS_40880 CDS complement(1600..1833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40890 note possible pseudo, internal stop codon, frameshifted CDS complement(1937..2206) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40900 note possible pseudo, internal stop codon, frameshifted CDS complement(2309..2467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40910 CDS complement(2716..3315) product plasmid SOS inhibition protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087158.1 transl_table 11 codon_start 1 locus_tag LOCUS_40920 CDS complement(3309..3473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40930 CDS complement(3516..5267) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145488.1 transl_table 11 codon_start 1 locus_tag LOCUS_40940 CDS 5538..5960 product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109071.1 transl_table 11 codon_start 1 locus_tag LOCUS_40950 gene umuD CDS 5960..7234 product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457555.1 transl_table 11 codon_start 1 locus_tag LOCUS_40960 CDS complement(7316..8290) product ParB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431558.1 transl_table 11 codon_start 1 locus_tag LOCUS_40970 CDS complement(8290..9495) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200287.1 transl_table 11 codon_start 1 locus_tag LOCUS_40980 CDS 9910..10851 product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215065.1 transl_table 11 codon_start 1 locus_tag LOCUS_40990 CDS complement(10848..11453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41000 CDS complement(11510..11845) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41010 CDS complement(12029..12445) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41020 CDS complement(12531..13646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41030 CDS 13904..14392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416123.1 transl_table 11 codon_start 1 locus_tag LOCUS_41040 CDS 15047..15787 product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817006.1 transl_table 11 codon_start 1 locus_tag LOCUS_41050 CDS 16132..16554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41060 CDS 16874..18202 product IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119264.1 transl_table 11 codon_start 1 locus_tag LOCUS_41070 CDS 18192..19160 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122320241.1 transl_table 11 codon_start 1 locus_tag LOCUS_41080 CDS complement(19349..20386) product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025381298.1 transl_table 11 codon_start 1 locus_tag LOCUS_41090 CDS 20994..21887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41100 CDS 22061..22225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41110 note possible pseudo, frameshifted CDS 22399..23166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41120 CDS 23129..23296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41130 CDS 23348..25123 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41140 CDS 25404..26129 product type III secretion system effector phosphothreonine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001121867.1 transl_table 11 codon_start 1 locus_tag LOCUS_41150 CDS 26391..27041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41160 CDS complement(27168..27527) product IS200/IS605-like element ISEc46 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064873.1 transl_table 11 codon_start 1 locus_tag LOCUS_41170 gene tnpA CDS 27650..28000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41180 note possible pseudo, frameshifted CDS complement(28067..28627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41190 CDS 28783..29070 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41200 CDS complement(29150..29437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41210 CDS complement(29347..29832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41220 CDS complement(29826..30314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41230 CDS complement(30339..31052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41240 CDS complement(31061..31843) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013214009.1 transl_table 11 codon_start 1 locus_tag LOCUS_41250 CDS complement(31878..32399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41260 CDS complement(32396..32686) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41270 CDS complement(32688..32993) product type II toxin-antitoxin system toxin CcdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159868.1 transl_table 11 codon_start 1 locus_tag LOCUS_41280 gene ccdB CDS complement(32995..33213) product type II toxin-antitoxin system antitoxin CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813638.1 transl_table 11 codon_start 1 locus_tag LOCUS_41290 gene ccdA CDS complement(34544..34759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41300 CDS 34894..35082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41310 CDS 35683..36672 product RepB family plasmid replication initiator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361615.1 transl_table 11 codon_start 1 locus_tag LOCUS_41320 CDS complement(37213..37599) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41330 CDS 38306..38608 product adhesin biosynthesis transcription regulatory family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000930062.1 transl_table 11 codon_start 1 locus_tag LOCUS_41340 CDS 38883..39407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41350 CDS 39634..42042 product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103899.1 transl_table 11 codon_start 1 locus_tag LOCUS_41360 CDS 42035..42727 product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094863.1 transl_table 11 codon_start 1 locus_tag LOCUS_41370 CDS 42724..43302 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41380 CDS 43485..44339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41390 sequence32 source 1..36101 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 75..1265 product maltose/maltodextrin ABC transporter substrate-binding protein MalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695415.1 transl_table 11 codon_start 1 locus_tag LOCUS_41400 gene malE CDS 1397..2941 product maltose ABC transporter permease MalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382568.1 transl_table 11 codon_start 1 locus_tag LOCUS_41410 gene malF CDS 2956..3846 product maltose ABC transporter permease MalG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252081.1 transl_table 11 codon_start 1 locus_tag LOCUS_41420 gene malG CDS complement(4012..4422) product phosphate-starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982749.1 transl_table 11 codon_start 1 locus_tag LOCUS_41430 gene psiE CDS complement(4565..6661) product YjbH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750797.1 transl_table 11 codon_start 1 locus_tag LOCUS_41440 CDS complement(6661..7398) product capsule biosynthesis GfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977977.1 transl_table 11 codon_start 1 locus_tag LOCUS_41450 CDS complement(7395..8033) product YjbF family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824800.1 transl_table 11 codon_start 1 locus_tag LOCUS_41460 CDS complement(8097..8342) product exopolysaccharide production protein YjbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976742.1 transl_table 11 codon_start 1 locus_tag LOCUS_41470 gene yjbE CDS complement(8783..10432) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790033.1 transl_table 11 codon_start 1 locus_tag LOCUS_41480 gene pgi CDS 10820..12169 product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136394.1 transl_table 11 codon_start 1 locus_tag LOCUS_41490 gene lysC CDS complement(12300..12647) product Mor transcription activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619864.1 transl_table 11 codon_start 1 locus_tag LOCUS_41500 CDS 13097..13513 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41510 note possible pseudo, frameshifted CDS 14092..14820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41520 CDS 15249..16838 product PTS sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099738.1 transl_table 11 codon_start 1 locus_tag LOCUS_41530 CDS 16862..17701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472332.1 transl_table 11 codon_start 1 locus_tag LOCUS_41540 CDS 17718..18581 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924650.1 transl_table 11 codon_start 1 locus_tag LOCUS_41550 CDS 18568..19326 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068169.1 transl_table 11 codon_start 1 locus_tag LOCUS_41560 CDS 19362..19661 product DUF3811 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207628.1 transl_table 11 codon_start 1 locus_tag LOCUS_41570 CDS complement(19658..20527) product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954615.1 transl_table 11 codon_start 1 locus_tag LOCUS_41580 gene rluF CDS complement(20574..21113) product DUF2058 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096724.1 transl_table 11 codon_start 1 locus_tag LOCUS_41590 CDS 21423..22025 product dipeptidase PepE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421788.1 transl_table 11 codon_start 1 locus_tag LOCUS_41600 gene pepE note possible pseudo, internal stop codon, frameshifted CDS complement(22085..23716) product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956807.1 transl_table 11 codon_start 1 locus_tag LOCUS_41610 CDS complement(23983..27666) product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095965.1 transl_table 11 codon_start 1 locus_tag LOCUS_41620 gene metH CDS 27970..28794 product glyoxylate bypass operon transcriptional repressor IclR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226433.1 transl_table 11 codon_start 1 locus_tag LOCUS_41630 gene iclR CDS 28778..29212 product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001412115.1 transl_table 11 codon_start 1 locus_tag LOCUS_41640 CDS complement(29176..30927) product bifunctional isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137261.1 transl_table 11 codon_start 1 locus_tag LOCUS_41650 gene aceK CDS complement(31029..32333) product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857886.1 transl_table 11 codon_start 1 locus_tag LOCUS_41660 gene aceA CDS complement(32365..33969) product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069369.1 transl_table 11 codon_start 1 locus_tag LOCUS_41670 gene aceB CDS complement(34235..35164) product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122765.1 transl_table 11 codon_start 1 locus_tag LOCUS_41680 gene metA CDS 35321..35758 product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973251.1 transl_table 11 codon_start 1 locus_tag LOCUS_41690 rRNA complement(35927..36037) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 sequence33 source 1..30492 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(542..2656) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124693.1 transl_table 11 codon_start 1 locus_tag LOCUS_41700 gene fusA CDS complement(2753..3223) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138043.1 transl_table 11 codon_start 1 locus_tag LOCUS_41710 gene rpsG CDS complement(3319..3693) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246815.1 transl_table 11 codon_start 1 locus_tag LOCUS_41720 gene rpsL CDS complement(3819..4106) product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903398.1 transl_table 11 codon_start 1 locus_tag LOCUS_41730 gene tusB CDS complement(4114..4470) product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000820707.1 transl_table 11 codon_start 1 locus_tag LOCUS_41740 gene tusC CDS complement(4470..4856) product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268013.1 transl_table 11 codon_start 1 locus_tag LOCUS_41750 gene tusD CDS complement(4856..5578) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091471.1 transl_table 11 codon_start 1 locus_tag LOCUS_41760 CDS complement(5854..6672) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838232.1 transl_table 11 codon_start 1 locus_tag LOCUS_41770 gene fkpA CDS 6892..7110 product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001152702.1 transl_table 11 codon_start 1 locus_tag LOCUS_41780 CDS complement(7299..7889) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861345.1 transl_table 11 codon_start 1 locus_tag LOCUS_41790 gene slyD CDS complement(7984..8184) product YheV family putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007735.1 transl_table 11 codon_start 1 locus_tag LOCUS_41800 CDS complement(8194..9999) product glutathione-regulated potassium-efflux system protein KefB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000398137.1 transl_table 11 codon_start 1 locus_tag LOCUS_41810 gene kefB CDS complement(9999..10550) product glutathione-regulated potassium-efflux system ancillary protein KefG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081820.1 transl_table 11 codon_start 1 locus_tag LOCUS_41820 gene kefG CDS 10816..12723 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634756.1 transl_table 11 codon_start 1 locus_tag LOCUS_41830 CDS 12886..13107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41840 CDS complement(13109..13420) product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047690.1 transl_table 11 codon_start 1 locus_tag LOCUS_41850 CDS 13663..14685 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057395.1 transl_table 11 codon_start 1 locus_tag LOCUS_41860 CDS 14682..14900 product YheU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586568.1 transl_table 11 codon_start 1 locus_tag LOCUS_41870 CDS 14951..15820 product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274690.1 transl_table 11 codon_start 1 locus_tag LOCUS_41880 CDS complement(15916..16320) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148917.1 transl_table 11 codon_start 1 locus_tag LOCUS_41890 CDS 16628..17260 product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242758.1 transl_table 11 codon_start 1 locus_tag LOCUS_41900 gene crp CDS 17366..19396 product YccS/YhfK family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012135464.1 transl_table 11 codon_start 1 locus_tag LOCUS_41910 CDS complement(19439..20656) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190017.1 transl_table 11 codon_start 1 locus_tag LOCUS_41920 CDS complement(20742..21305) product aminodeoxychorismate synthase component 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601879.1 transl_table 11 codon_start 1 locus_tag LOCUS_41930 gene pabA CDS complement(21337..21939) product putative adenosine monophosphate-protein transferase Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280679.1 transl_table 11 codon_start 1 locus_tag LOCUS_41940 CDS complement(21929..22201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41950 CDS complement(22205..22777) product peptidylprolyl isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920482.1 transl_table 11 codon_start 1 locus_tag LOCUS_41960 gene ppiA CDS 23054..24235 product MFS transporter TsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185273.1 transl_table 11 codon_start 1 locus_tag LOCUS_41970 gene tsgA CDS complement(24369..24641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41980 CDS 24534..27041 product NADPH-nitrite reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049259.1 transl_table 11 codon_start 1 locus_tag LOCUS_41990 gene nirB CDS 27038..27364 product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084814.1 transl_table 11 codon_start 1 locus_tag LOCUS_42000 gene nirD CDS 27560..28369 product nitrite transporter NirC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493575.1 transl_table 11 codon_start 1 locus_tag LOCUS_42010 gene nirC CDS 28381..29754 product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349908.1 transl_table 11 codon_start 1 locus_tag LOCUS_42020 gene cysG sequence34 source 1..29979 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(654..3338) product two-component system sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997481.1 transl_table 11 codon_start 1 locus_tag LOCUS_42030 gene kdpD CDS complement(3335..3919) product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014341418.1 transl_table 11 codon_start 1 locus_tag LOCUS_42040 gene kdpC CDS complement(3928..5976) product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087964.1 transl_table 11 codon_start 1 locus_tag LOCUS_42050 gene kdpB CDS complement(5997..7676) product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730077.1 transl_table 11 codon_start 1 locus_tag LOCUS_42060 gene kdpA CDS 8102..8308 product YbfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401435.1 transl_table 11 codon_start 1 locus_tag LOCUS_42070 CDS 8420..9841 product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142014.1 transl_table 11 codon_start 1 locus_tag LOCUS_42080 gene phrB CDS complement(9880..11361) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041123.1 transl_table 11 codon_start 1 locus_tag LOCUS_42090 CDS 11690..12433 product radiation resistance protein YbgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798844.1 transl_table 11 codon_start 1 locus_tag LOCUS_42100 gene ybgI CDS 12449..13105 product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188364.1 transl_table 11 codon_start 1 locus_tag LOCUS_42110 gene pxpB CDS 13099..14031 product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932048.1 transl_table 11 codon_start 1 locus_tag LOCUS_42120 CDS 14021..14755 product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017910.1 transl_table 11 codon_start 1 locus_tag LOCUS_42130 gene pxpA CDS 14877..15668 product endonuclease VIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113965.1 transl_table 11 codon_start 1 locus_tag LOCUS_42140 gene nei CDS complement(15723..16769) product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122050.1 transl_table 11 codon_start 1 locus_tag LOCUS_42150 CDS complement(16906..18189) product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785816.1 transl_table 11 codon_start 1 locus_tag LOCUS_42160 CDS 18290..18535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42170 note possible pseudo, frameshifted CDS 18929..19333 product succinate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001539490.1 transl_table 11 codon_start 1 locus_tag LOCUS_42180 gene sdhC CDS 19327..19674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42190 CDS 19674..21440 product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775523.1 transl_table 11 codon_start 1 locus_tag LOCUS_42200 gene sdhA CDS 21454..22173 product succinate dehydrogenase iron-sulfur subunit SdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976880.1 transl_table 11 codon_start 1 locus_tag LOCUS_42210 gene sdhB CDS 22697..25498 product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181500.1 transl_table 11 codon_start 1 locus_tag LOCUS_42220 gene sucA CDS 25513..26721 product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099858.1 transl_table 11 codon_start 1 locus_tag LOCUS_42230 gene odhB CDS 26863..28029 product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048590.1 transl_table 11 codon_start 1 locus_tag LOCUS_42240 gene sucC CDS 28029..28898 product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367669.1 transl_table 11 codon_start 1 locus_tag LOCUS_42250 gene sucD sequence35 source 1..26371 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(61..213) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42260 CDS 327..881 product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285635.1 transl_table 11 codon_start 1 locus_tag LOCUS_42270 CDS complement(857..1114) product DUF1488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070570.1 transl_table 11 codon_start 1 locus_tag LOCUS_42280 CDS complement(1111..1932) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388662.1 transl_table 11 codon_start 1 locus_tag LOCUS_42290 gene aroE CDS complement(1934..2506) product L-threonylcarbamoyladenylate synthase type 1 TsaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063622.1 transl_table 11 codon_start 1 locus_tag LOCUS_42300 gene tsaC CDS complement(2511..3053) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129710.1 transl_table 11 codon_start 1 locus_tag LOCUS_42310 CDS complement(3080..3553) product DUF494 family protein Smg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460663.1 transl_table 11 codon_start 1 locus_tag LOCUS_42320 gene smg CDS complement(3525..4649) product DNA-protecting protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124521.1 transl_table 11 codon_start 1 locus_tag LOCUS_42330 gene dprA CDS 4781..5290 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114992.1 transl_table 11 codon_start 1 locus_tag LOCUS_42340 gene def CDS 5306..6253 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285161.1 transl_table 11 codon_start 1 locus_tag LOCUS_42350 gene fmt CDS 6305..7594 product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744595.1 transl_table 11 codon_start 1 locus_tag LOCUS_42360 gene rsmB CDS 7616..8992 product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691374.1 transl_table 11 codon_start 1 locus_tag LOCUS_42370 gene trkA CDS 9134..9547 product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008119.1 transl_table 11 codon_start 1 locus_tag LOCUS_42380 gene mscL CDS complement(9483..9752) product alternative ribosome-rescue factor ArfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092695.1 transl_table 11 codon_start 1 locus_tag LOCUS_42390 gene arfA CDS complement(9810..10235) product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285589.1 transl_table 11 codon_start 1 locus_tag LOCUS_42400 gene zntR CDS complement(10246..10614) product DUF1992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000266513.1 transl_table 11 codon_start 1 locus_tag LOCUS_42410 CDS complement(10722..11105) product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216370.1 transl_table 11 codon_start 1 locus_tag LOCUS_42420 gene rplQ CDS complement(11146..12135) product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162094.1 transl_table 11 codon_start 1 locus_tag LOCUS_42430 gene rpoA CDS complement(12161..12781) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135224.1 transl_table 11 codon_start 1 locus_tag LOCUS_42440 gene rpsD CDS complement(12815..13204) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029684.1 transl_table 11 codon_start 1 locus_tag LOCUS_42450 gene rpsK CDS complement(13221..13577) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090779.1 transl_table 11 codon_start 1 locus_tag LOCUS_42460 gene rpsM CDS complement(13872..15203) product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118861.1 transl_table 11 codon_start 1 locus_tag LOCUS_42470 gene secY CDS complement(15211..15645) product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238917.1 transl_table 11 codon_start 1 locus_tag LOCUS_42480 gene rplO CDS complement(15649..15828) product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140434.1 transl_table 11 codon_start 1 locus_tag LOCUS_42490 gene rpmD CDS complement(15832..16335) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940121.1 transl_table 11 codon_start 1 locus_tag LOCUS_42500 gene rpsE CDS complement(16350..16703) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358956.1 transl_table 11 codon_start 1 locus_tag LOCUS_42510 gene rplR CDS complement(16713..17246) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091939.1 transl_table 11 codon_start 1 locus_tag LOCUS_42520 gene rplF CDS complement(17259..17651) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062611.1 transl_table 11 codon_start 1 locus_tag LOCUS_42530 gene rpsH CDS complement(17685..17990) product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118932.1 transl_table 11 codon_start 1 locus_tag LOCUS_42540 gene rpsN CDS complement(18005..18544) product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096206.1 transl_table 11 codon_start 1 locus_tag LOCUS_42550 gene rplE CDS complement(18559..18873) product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729185.1 transl_table 11 codon_start 1 locus_tag LOCUS_42560 gene rplX CDS complement(18884..19255) product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613954.1 transl_table 11 codon_start 1 locus_tag LOCUS_42570 gene rplN CDS complement(19419..19673) product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130101.1 transl_table 11 codon_start 1 locus_tag LOCUS_42580 gene rpsQ CDS complement(19673..19864) product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644742.1 transl_table 11 codon_start 1 locus_tag LOCUS_42590 gene rpmC CDS complement(19864..20274) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941208.1 transl_table 11 codon_start 1 locus_tag LOCUS_42600 gene rplP CDS complement(20287..20988) product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529945.1 transl_table 11 codon_start 1 locus_tag LOCUS_42610 gene rpsC CDS complement(21006..21338) product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447529.1 transl_table 11 codon_start 1 locus_tag LOCUS_42620 gene rplV CDS complement(21353..21631) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138115.1 transl_table 11 codon_start 1 locus_tag LOCUS_42630 gene rpsS CDS complement(21648..22469) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301869.1 transl_table 11 codon_start 1 locus_tag LOCUS_42640 gene rplB CDS complement(22487..22789) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617546.1 transl_table 11 codon_start 1 locus_tag LOCUS_42650 gene rplW CDS complement(22786..23391) product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424395.1 transl_table 11 codon_start 1 locus_tag LOCUS_42660 gene rplD CDS complement(23402..24031) product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579838.1 transl_table 11 codon_start 1 locus_tag LOCUS_42670 gene rplC CDS complement(24064..24375) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181005.1 transl_table 11 codon_start 1 locus_tag LOCUS_42680 gene rpsJ CDS 24755..25222 product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495849.1 transl_table 11 codon_start 1 locus_tag LOCUS_42690 CDS complement(25219..25695) product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675528.1 transl_table 11 codon_start 1 locus_tag LOCUS_42700 gene bfr CDS complement(25768..25962) product bacterioferritin-associated ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000289082.1 transl_table 11 codon_start 1 locus_tag LOCUS_42710 gene bfd CDS 25897..26055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42720 sequence36 source 1..19944 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 470..2059 product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187502.1 transl_table 11 codon_start 1 locus_tag LOCUS_42730 gene purH CDS 2071..3360 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866776.1 transl_table 11 codon_start 1 locus_tag LOCUS_42740 gene purD CDS complement(3357..4682) product sigma-54-dependent response regulator transcription factor ZraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617932.1 transl_table 11 codon_start 1 locus_tag LOCUS_42750 gene zraR CDS complement(4688..6085) product two-component system sensor histidine kinase ZraS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001772857.1 transl_table 11 codon_start 1 locus_tag LOCUS_42760 gene zraS CDS 6339..6794 product zinc resistance sensor/chaperone ZraP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828133.1 transl_table 11 codon_start 1 locus_tag LOCUS_42770 gene zraP CDS complement(6836..7528) product DUF1481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083923.1 transl_table 11 codon_start 1 locus_tag LOCUS_42780 CDS complement(7540..7812) product DNA-binding protein HU-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044509.1 transl_table 11 codon_start 1 locus_tag LOCUS_42790 gene hupA CDS complement(7999..8589) product YjaG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940092.1 transl_table 11 codon_start 1 locus_tag LOCUS_42800 CDS complement(8631..9302) product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362359.1 transl_table 11 codon_start 1 locus_tag LOCUS_42810 gene nfi CDS complement(9312..10376) product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137619.1 transl_table 11 codon_start 1 locus_tag LOCUS_42820 gene hemE CDS complement(10417..11190) product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373954.1 transl_table 11 codon_start 1 locus_tag LOCUS_42830 gene nudC CDS 11283..11771 product sigma D regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934311.1 transl_table 11 codon_start 1 locus_tag LOCUS_42840 gene rsd CDS 12135..14030 product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108425.1 transl_table 11 codon_start 1 locus_tag LOCUS_42850 gene thiC CDS 14030..14665 product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284626.1 transl_table 11 codon_start 1 locus_tag LOCUS_42860 gene thiE CDS 14658..15416 product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999774.1 transl_table 11 codon_start 1 locus_tag LOCUS_42870 CDS 15397..15597 product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035896383.1 transl_table 11 codon_start 1 locus_tag LOCUS_42880 gene thiS CDS 15599..16369 product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944065.1 transl_table 11 codon_start 1 locus_tag LOCUS_42890 gene thiG CDS 16366..17499 product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643282.1 transl_table 11 codon_start 1 locus_tag LOCUS_42900 gene thiH CDS complement(17650..17838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42910 CDS complement(18161..19189) product type III secretion system effector arginine glycosyltransferase NleB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953022.1 transl_table 11 codon_start 1 locus_tag LOCUS_42920 gene nleB CDS 19479..19616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42930 CDS 19570..19914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42940 sequence37 source 1..17891 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 357..1925 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884372.1 transl_table 11 codon_start 1 locus_tag LOCUS_42950 gene cydA CDS 1941..3080 product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568258.1 transl_table 11 codon_start 1 locus_tag LOCUS_42960 gene cydB CDS 3208..3501 product cyd operon protein YbgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875303.1 transl_table 11 codon_start 1 locus_tag LOCUS_42970 gene ybgE CDS 3730..4134 product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046241.1 transl_table 11 codon_start 1 locus_tag LOCUS_42980 gene ybgC CDS 4131..4823 product Tol-Pal system protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131318.1 transl_table 11 codon_start 1 locus_tag LOCUS_42990 gene tolQ CDS 4827..5255 product colicin uptake protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124676.1 transl_table 11 codon_start 1 locus_tag LOCUS_43000 gene tolR CDS 5320..6498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43010 CDS 6622..7914 product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989131.1 transl_table 11 codon_start 1 locus_tag LOCUS_43020 gene tolB CDS 7949..8473 product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176621.1 transl_table 11 codon_start 1 locus_tag LOCUS_43030 gene pal CDS 8483..9271 product cell division protein CpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097547.1 transl_table 11 codon_start 1 locus_tag LOCUS_43040 gene cpoB tRNA 9436..9511 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00660 tRNA 9648..9723 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00670 tRNA 9727..9802 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00680 tRNA 9942..10017 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00690 tRNA 10152..10227 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00700 CDS 10832..11875 product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115355.1 transl_table 11 codon_start 1 locus_tag LOCUS_43050 gene nadA CDS 11900..12619 product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345378.1 transl_table 11 codon_start 1 locus_tag LOCUS_43060 gene pnuC CDS complement(12616..13554) product CDF family zinc transporter ZitB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951257.1 transl_table 11 codon_start 1 locus_tag LOCUS_43070 gene zitB CDS complement(13665..14051) product YbgS-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784380.1 transl_table 11 codon_start 1 locus_tag LOCUS_43080 CDS 14371..15423 product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109233.1 transl_table 11 codon_start 1 locus_tag LOCUS_43090 gene aroG CDS complement(15517..16062) product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881093.1 transl_table 11 codon_start 1 locus_tag LOCUS_43100 CDS complement(16077..16922) product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816933.1 transl_table 11 codon_start 1 locus_tag LOCUS_43110 sequence38 source 1..17226 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 184..260 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00710 CDS 425..1228 product 2,5-didehydrogluconate reductase DkgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154870.1 transl_table 11 codon_start 1 locus_tag LOCUS_43120 gene dkgB CDS complement(1249..2163) product DNA-binding transcriptional regulator YafC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648539.1 transl_table 11 codon_start 1 locus_tag LOCUS_43130 gene yafC CDS 2268..3443 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127546.1 transl_table 11 codon_start 1 locus_tag LOCUS_43140 CDS 3575..4375 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230964.1 transl_table 11 codon_start 1 locus_tag LOCUS_43150 CDS 4453..5223 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207227.1 transl_table 11 codon_start 1 locus_tag LOCUS_43160 CDS complement(5279..6499) product murein transglycosylase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644706.1 transl_table 11 codon_start 1 locus_tag LOCUS_43170 gene mltD CDS complement(6718..7473) product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052766.1 transl_table 11 codon_start 1 locus_tag LOCUS_43180 gene gloB CDS 7508..8230 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801233.1 transl_table 11 codon_start 1 locus_tag LOCUS_43190 CDS complement(8227..8694) product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917872.1 transl_table 11 codon_start 1 locus_tag LOCUS_43200 gene rnhA CDS 8749..9489 product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001670675.1 transl_table 11 codon_start 1 locus_tag LOCUS_43210 gene dnaQ tRNA 9623..9699 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00720 CDS complement(10022..11077) product type VI secretion system ImpA family N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402248.1 transl_table 11 codon_start 1 locus_tag LOCUS_43220 CDS complement(11088..11831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43230 CDS 11888..12160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43240 CDS 12187..12705 product DUF2778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808301.1 transl_table 11 codon_start 1 locus_tag LOCUS_43250 CDS 13102..13743 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43260 CDS 13665..16982 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43270 sequence39 source 1..13587 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 255..440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43280 CDS 491..1336 product YjiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490324.1 transl_table 11 codon_start 1 locus_tag LOCUS_43290 CDS 1426..1983 product virulence membrane protein PagC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789474.1 transl_table 11 codon_start 1 locus_tag LOCUS_43300 gene pagC CDS complement(3092..3271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43310 CDS complement(4169..5050) product incFII family plasmid replication initiator RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213292.1 transl_table 11 codon_start 1 locus_tag LOCUS_43320 gene repA CDS complement(5113..5280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43330 CDS complement(5358..5603) product replication regulatory protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229817.1 transl_table 11 codon_start 1 locus_tag LOCUS_43340 gene repA CDS complement(5803..5982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43350 note possible pseudo, frameshifted CDS complement(5999..6283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43360 note possible pseudo, frameshifted CDS complement(6405..6857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43370 CDS complement(6974..7396) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43380 CDS complement(7658..7990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43390 note possible pseudo, frameshifted CDS complement(7987..8202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43400 CDS complement(8189..8791) product conjugal transfer pilus-stabilizing protein TraP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002787.1 transl_table 11 codon_start 1 locus_tag LOCUS_43410 gene traP CDS complement(8775..10196) product F-type conjugal transfer pilus assembly protein TraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146665.1 transl_table 11 codon_start 1 locus_tag LOCUS_43420 gene traB CDS complement(10196..10936) product type-F conjugative transfer system secretin TraK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230787.1 transl_table 11 codon_start 1 locus_tag LOCUS_43430 gene traK CDS complement(10923..11489) product type IV conjugative transfer system protein TraE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399792.1 transl_table 11 codon_start 1 locus_tag LOCUS_43440 gene traE CDS complement(11511..11822) product type IV conjugative transfer system protein TraL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012100.1 transl_table 11 codon_start 1 locus_tag LOCUS_43450 gene traL CDS complement(11837..12199) product type IV conjugative transfer system pilin TraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994779.1 transl_table 11 codon_start 1 locus_tag LOCUS_43460 gene traA CDS complement(12241..12468) product conjugal transfer relaxosome protein TraY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254388.1 transl_table 11 codon_start 1 locus_tag LOCUS_43470 gene traY CDS complement(12562..12933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43480 note possible pseudo, frameshifted CDS complement(12936..13247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43490 note possible pseudo, frameshifted sequence40 source 1..12882 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 455..838 product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275691.1 transl_table 11 codon_start 1 locus_tag LOCUS_43500 gene secE CDS 840..1385 product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287521.1 transl_table 11 codon_start 1 locus_tag LOCUS_43510 gene nusG CDS 1543..1971 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085926.1 transl_table 11 codon_start 1 locus_tag LOCUS_43520 gene rplK CDS 1975..2679 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096676.1 transl_table 11 codon_start 1 locus_tag LOCUS_43530 gene rplA CDS 3095..3592 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207203.1 transl_table 11 codon_start 1 locus_tag LOCUS_43540 gene rplJ CDS 3659..4024 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028882.1 transl_table 11 codon_start 1 locus_tag LOCUS_43550 gene rplL CDS 4342..8370 product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000263103.1 transl_table 11 codon_start 1 locus_tag LOCUS_43560 gene rpoB CDS 8447..12670 product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653965.1 transl_table 11 codon_start 1 locus_tag LOCUS_43570 gene rpoC sequence41 source 1..9813 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(80..1480) product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724476.1 transl_table 11 codon_start 1 locus_tag LOCUS_43580 CDS complement(1670..2302) product molecular chaperone TorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595416.1 transl_table 11 codon_start 1 locus_tag LOCUS_43590 gene torD CDS complement(2295..4847) product trimethylamine-N-oxide reductase TorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790669.1 transl_table 11 codon_start 1 locus_tag LOCUS_43600 gene torA CDS complement(4837..6021) product pentaheme c-type cytochrome TorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230242.1 transl_table 11 codon_start 1 locus_tag LOCUS_43610 gene torC CDS 6151..6843 product two-component system response regulator TorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120125.1 transl_table 11 codon_start 1 locus_tag LOCUS_43620 gene torR CDS complement(6816..7856) product TMAO reductase system periplasmic protein TorT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259560.1 transl_table 11 codon_start 1 locus_tag LOCUS_43630 gene torT sequence42 source 1..5304 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1179..2447 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703620.1 transl_table 11 codon_start 1 locus_tag LOCUS_43640 CDS 2497..2745 product oxaloacetate decarboxylase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703617.1 transl_table 11 codon_start 1 locus_tag LOCUS_43650 CDS 2761..4530 product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150450.1 transl_table 11 codon_start 1 locus_tag LOCUS_43660 gene oadA sequence43 source 1..4573 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 173..1201 product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149790.1 transl_table 11 codon_start 1 locus_tag LOCUS_43670 gene murB CDS 1198..2160 product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655746.1 transl_table 11 codon_start 1 locus_tag LOCUS_43680 gene birA CDS complement(2195..3121) product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023068.1 transl_table 11 codon_start 1 locus_tag LOCUS_43690 gene coaA tRNA 3547..3622 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00730 tRNA 3631..3715 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00740 tRNA 3832..3906 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00750 tRNA 3913..3988 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00760 sequence44 source 1..3674 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(28..474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43700 CDS complement(471..2915) product SEF14/SEF18 fimbria usher protein SefC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753917.1 transl_table 11 codon_start 1 locus_tag LOCUS_43710 gene sefC CDS complement(2932..3672) product SEF14/SEF18 fimbria chaperone SefB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001772663.1 transl_table 11 codon_start 1 locus_tag LOCUS_43720 gene sefB sequence45 source 1..3210 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(380..1900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43730 CDS 2537..2842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43740 sequence46 source 1..2750 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 561..2399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43750 sequence47 source 1..1417 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence48 source 1..1232 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 191..310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43760 sequence49 source 1..944 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(453..596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43770 CDS complement(575..925) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135400.1 transl_table 11 codon_start 1 locus_tag LOCUS_43780 sequence50 source 1..611 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence51 source 1..482 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence52 source 1..446 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@