>Feature sequence001 426 76 gene locus_tag LOCUS_00010 426 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1227 736 gene locus_tag LOCUS_00020 1227 736 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243734.1 protein_id gnl|my_center|LOCUS_00020 2020 1250 gene locus_tag LOCUS_00030 2020 1250 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970609.1 protein_id gnl|my_center|LOCUS_00030 2211 3188 gene locus_tag LOCUS_00040 2211 3188 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967262.1 protein_id gnl|my_center|LOCUS_00040 3185 4219 gene locus_tag LOCUS_00050 3185 4219 CDS product L-idonate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973553.1 protein_id gnl|my_center|LOCUS_00050 5080 4307 gene locus_tag LOCUS_00060 5080 4307 CDS product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387737.1 protein_id gnl|my_center|LOCUS_00060 5325 7286 gene locus_tag LOCUS_00070 gene ftsH 5325 7286 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143134.1 protein_id gnl|my_center|LOCUS_00070 7884 7585 gene locus_tag LOCUS_00080 7884 7585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 8120 9115 gene locus_tag LOCUS_00090 8120 9115 CDS product phosphotransferase enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974512.1 protein_id gnl|my_center|LOCUS_00090 >Feature sequence002 803 543 gene locus_tag LOCUS_00100 803 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 688 1377 gene locus_tag LOCUS_00110 688 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 1553 2614 gene locus_tag LOCUS_00120 1553 2614 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812137.1 protein_id gnl|my_center|LOCUS_00120 2611 3159 gene locus_tag LOCUS_00130 2611 3159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 3152 4537 gene locus_tag LOCUS_00140 3152 4537 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812141.1 protein_id gnl|my_center|LOCUS_00140 5644 4679 gene locus_tag LOCUS_00150 5644 4679 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387830.1 protein_id gnl|my_center|LOCUS_00150 5798 5995 gene locus_tag LOCUS_00160 5798 5995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 6002 8803 gene locus_tag LOCUS_00170 gene polA 6002 8803 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391261.1 protein_id gnl|my_center|LOCUS_00170 >Feature sequence003 2291 324 gene locus_tag LOCUS_00180 2291 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 3433 2342 gene locus_tag LOCUS_00190 gene pseI 3433 2342 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920708.1 protein_id gnl|my_center|LOCUS_00190 5037 3430 gene locus_tag LOCUS_00200 5037 3430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 5744 5037 gene locus_tag LOCUS_00210 gene pseF 5744 5037 CDS product pseudaminic acid cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867757.1 protein_id gnl|my_center|LOCUS_00210 6931 5741 gene locus_tag LOCUS_00220 gene pseC 6931 5741 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639919.1 protein_id gnl|my_center|LOCUS_00220 7929 6928 gene locus_tag LOCUS_00230 gene pseB 7929 6928 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073154.1 protein_id gnl|my_center|LOCUS_00230 8600 8049 gene locus_tag LOCUS_00240 8600 8049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 >Feature sequence004 459 1496 gene locus_tag LOCUS_00250 459 1496 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244179.1 protein_id gnl|my_center|LOCUS_00250 1925 2446 gene locus_tag LOCUS_00260 gene def 1925 2446 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391097.1 protein_id gnl|my_center|LOCUS_00260 2443 3375 gene locus_tag LOCUS_00270 gene fmt 2443 3375 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391098.1 protein_id gnl|my_center|LOCUS_00270 3405 3578 gene locus_tag LOCUS_00280 3405 3578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 5085 3697 gene locus_tag LOCUS_00290 5085 3697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 6299 5133 gene locus_tag LOCUS_00300 gene argE 6299 5133 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921458.1 protein_id gnl|my_center|LOCUS_00300 6232 6426 gene locus_tag LOCUS_00310 6232 6426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 6523 7434 gene locus_tag LOCUS_00320 6523 7434 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388187.1 protein_id gnl|my_center|LOCUS_00320 7445 8146 gene locus_tag LOCUS_00330 gene gmk 7445 8146 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388188.1 protein_id gnl|my_center|LOCUS_00330 >Feature sequence005 2013 469 gene locus_tag LOCUS_00340 gene ilvA 2013 469 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533024.1 protein_id gnl|my_center|LOCUS_00340 2310 3353 gene locus_tag LOCUS_00350 gene bchI 2310 3353 CDS product magnesium chelatase ATPase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625950.1 protein_id gnl|my_center|LOCUS_00350 3355 5217 gene locus_tag LOCUS_00360 3355 5217 CDS product magnesium chelatase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388245.1 protein_id gnl|my_center|LOCUS_00360 5223 6155 gene locus_tag LOCUS_00370 5223 6155 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388246.1 protein_id gnl|my_center|LOCUS_00370 6770 6207 gene locus_tag LOCUS_00380 6770 6207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390263.1 protein_id gnl|my_center|LOCUS_00380 7457 7038 gene locus_tag LOCUS_00390 gene arfB 7457 7038 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387858.1 protein_id gnl|my_center|LOCUS_00390 7772 7509 gene locus_tag LOCUS_00400 7772 7509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 >Feature sequence006 2527 656 gene locus_tag LOCUS_00410 2527 656 CDS product KAP family P-loop domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884100.1 protein_id gnl|my_center|LOCUS_00410 3706 2597 gene locus_tag LOCUS_00420 3706 2597 CDS product BsuBI/PstI family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390240.1 protein_id gnl|my_center|LOCUS_00420 5520 3706 gene locus_tag LOCUS_00430 5520 3706 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390241.1 protein_id gnl|my_center|LOCUS_00430 5735 5538 gene locus_tag LOCUS_00440 5735 5538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 6113 5892 gene locus_tag LOCUS_00450 6113 5892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 7370 6216 gene locus_tag LOCUS_00460 7370 6216 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073356551.1 protein_id gnl|my_center|LOCUS_00460 >Feature sequence007 3131 519 gene locus_tag LOCUS_00470 3131 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 4370 3564 gene locus_tag LOCUS_00480 4370 3564 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389674.1 protein_id gnl|my_center|LOCUS_00480 5236 4367 gene locus_tag LOCUS_00490 5236 4367 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205488.1 protein_id gnl|my_center|LOCUS_00490 6161 5241 gene locus_tag LOCUS_00500 6161 5241 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240148.1 protein_id gnl|my_center|LOCUS_00500 7264 6158 gene locus_tag LOCUS_00510 7264 6158 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199680.1 protein_id gnl|my_center|LOCUS_00510 >Feature sequence008 153 2255 gene locus_tag LOCUS_00520 153 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 2530 3072 gene locus_tag LOCUS_00530 2530 3072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 3124 3870 gene locus_tag LOCUS_00540 gene ccmA 3124 3870 CDS product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387801.1 protein_id gnl|my_center|LOCUS_00540 3867 4535 gene locus_tag LOCUS_00550 gene ccmB 3867 4535 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387800.1 protein_id gnl|my_center|LOCUS_00550 5189 4545 gene locus_tag LOCUS_00560 5189 4545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 5340 5894 gene locus_tag LOCUS_00570 5340 5894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 7067 5913 gene locus_tag LOCUS_00580 7067 5913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 >Feature sequence009 286 927 gene locus_tag LOCUS_00590 gene pncA 286 927 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404207.1 protein_id gnl|my_center|LOCUS_00590 2853 1165 gene locus_tag LOCUS_00600 2853 1165 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390812.1 protein_id gnl|my_center|LOCUS_00600 4273 2990 gene locus_tag LOCUS_00610 gene ccrA 4273 2990 CDS product crotonyl-CoA carboxylase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390811.1 protein_id gnl|my_center|LOCUS_00610 4524 6539 gene locus_tag LOCUS_00620 4524 6539 CDS product protein meaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390810.1 protein_id gnl|my_center|LOCUS_00620 7190 6615 gene locus_tag LOCUS_00630 7190 6615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 >Feature sequence010 847 2324 gene locus_tag LOCUS_r00010 847 2324 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2737 2813 gene locus_tag LOCUS_t00010 2737 2813 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 3036 3111 gene locus_tag LOCUS_t00020 3036 3111 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3690 6413 gene locus_tag LOCUS_r00020 3690 6413 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 6793 6901 gene locus_tag LOCUS_r00030 6793 6901 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence011 363 1217 gene locus_tag LOCUS_00640 363 1217 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925894.1 protein_id gnl|my_center|LOCUS_00640 1326 2522 gene locus_tag LOCUS_00650 1326 2522 CDS product 2-methylfumaryl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256085.1 protein_id gnl|my_center|LOCUS_00650 3164 2571 gene locus_tag LOCUS_00660 3164 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 6188 3843 gene locus_tag LOCUS_00670 gene clpA 6188 3843 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389862.1 protein_id gnl|my_center|LOCUS_00670 6530 6195 gene locus_tag LOCUS_00680 gene clpS 6530 6195 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440419.1 protein_id gnl|my_center|LOCUS_00680 7428 6910 gene locus_tag LOCUS_00690 7428 6910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 8361 7795 gene locus_tag LOCUS_00700 8361 7795 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088265.1 protein_id gnl|my_center|LOCUS_00700 8859 8407 gene locus_tag LOCUS_00710 8859 8407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 10865 8856 gene locus_tag LOCUS_00720 10865 8856 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389694.1 protein_id gnl|my_center|LOCUS_00720 11670 10873 gene locus_tag LOCUS_00730 11670 10873 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389695.1 protein_id gnl|my_center|LOCUS_00730 13438 11831 gene locus_tag LOCUS_00740 13438 11831 CDS product propionyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389696.1 protein_id gnl|my_center|LOCUS_00740 14099 13497 gene locus_tag LOCUS_00750 14099 13497 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389697.1 protein_id gnl|my_center|LOCUS_00750 14824 14141 gene locus_tag LOCUS_00760 14824 14141 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389698.1 protein_id gnl|my_center|LOCUS_00760 16078 14885 gene locus_tag LOCUS_00770 16078 14885 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190136.1 protein_id gnl|my_center|LOCUS_00770 16899 16075 gene locus_tag LOCUS_00780 16899 16075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 18072 16906 gene locus_tag LOCUS_00790 18072 16906 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243520.1 protein_id gnl|my_center|LOCUS_00790 18349 19755 gene locus_tag LOCUS_00800 18349 19755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389702.1 protein_id gnl|my_center|LOCUS_00800 21166 19781 gene locus_tag LOCUS_00810 gene mgtE 21166 19781 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389748.1 protein_id gnl|my_center|LOCUS_00810 22057 21254 gene locus_tag LOCUS_00820 gene hisN 22057 21254 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390913.1 protein_id gnl|my_center|LOCUS_00820 22249 22446 gene locus_tag LOCUS_00830 22249 22446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 22483 23469 gene locus_tag LOCUS_00840 22483 23469 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401697.1 protein_id gnl|my_center|LOCUS_00840 23466 24623 gene locus_tag LOCUS_00850 23466 24623 CDS product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401700.1 protein_id gnl|my_center|LOCUS_00850 25026 26249 gene locus_tag LOCUS_00860 25026 26249 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385507.1 protein_id gnl|my_center|LOCUS_00860 26285 26575 gene locus_tag LOCUS_00870 26285 26575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 26631 27119 gene locus_tag LOCUS_00880 26631 27119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 27264 27755 gene locus_tag LOCUS_00890 27264 27755 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388086.1 protein_id gnl|my_center|LOCUS_00890 28495 29376 gene locus_tag LOCUS_00900 28495 29376 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530247.1 protein_id gnl|my_center|LOCUS_00900 29653 29480 gene locus_tag LOCUS_00910 29653 29480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 29922 30329 gene locus_tag LOCUS_00920 29922 30329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 30295 31185 gene locus_tag LOCUS_00930 30295 31185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 32050 31310 gene locus_tag LOCUS_00940 32050 31310 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391305.1 protein_id gnl|my_center|LOCUS_00940 32248 34524 gene locus_tag LOCUS_00950 gene plpD 32248 34524 CDS product patatin-like phospholipase PlpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113139.1 protein_id gnl|my_center|LOCUS_00950 35240 34818 gene locus_tag LOCUS_00960 35240 34818 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391329.1 protein_id gnl|my_center|LOCUS_00960 35375 35668 gene locus_tag LOCUS_00970 35375 35668 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083363.1 protein_id gnl|my_center|LOCUS_00970 35955 37853 gene locus_tag LOCUS_00980 35955 37853 CDS product DUF4914 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082768.1 protein_id gnl|my_center|LOCUS_00980 38224 38297 gene locus_tag LOCUS_t00030 38224 38297 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 38969 38661 gene locus_tag LOCUS_00990 38969 38661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 38892 39524 gene locus_tag LOCUS_01000 gene can 38892 39524 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308055.1 protein_id gnl|my_center|LOCUS_01000 40839 39538 gene locus_tag LOCUS_01010 40839 39538 CDS product DUF3422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391173.1 protein_id gnl|my_center|LOCUS_01010 41504 40836 gene locus_tag LOCUS_01020 41504 40836 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391172.1 protein_id gnl|my_center|LOCUS_01020 42262 41519 gene locus_tag LOCUS_01030 gene pyrF 42262 41519 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391171.1 protein_id gnl|my_center|LOCUS_01030 43242 42355 gene locus_tag LOCUS_01040 43242 42355 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390252.1 protein_id gnl|my_center|LOCUS_01040 44219 43239 gene locus_tag LOCUS_01050 44219 43239 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390251.1 protein_id gnl|my_center|LOCUS_01050 44598 45155 gene locus_tag LOCUS_01060 44598 45155 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061383.1 protein_id gnl|my_center|LOCUS_01060 45448 47313 gene locus_tag LOCUS_01070 45448 47313 CDS product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971074.1 protein_id gnl|my_center|LOCUS_01070 47426 48661 gene locus_tag LOCUS_01080 47426 48661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 50126 48870 gene locus_tag LOCUS_01090 50126 48870 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019809.1 protein_id gnl|my_center|LOCUS_01090 51579 50116 gene locus_tag LOCUS_01100 51579 50116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 53549 51996 gene locus_tag LOCUS_01110 53549 51996 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202621.1 protein_id gnl|my_center|LOCUS_01110 55129 53546 gene locus_tag LOCUS_01120 55129 53546 CDS product methyltransferase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387742.1 protein_id gnl|my_center|LOCUS_01120 55889 55116 gene locus_tag LOCUS_01130 gene tagF 55889 55116 CDS product type VI secretion system-associated protein TagF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106966.1 protein_id gnl|my_center|LOCUS_01130 59594 55890 gene locus_tag LOCUS_01140 gene tssM 59594 55890 CDS product type VI secretion system membrane subunit TssM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190681.1 protein_id gnl|my_center|LOCUS_01140 61192 59654 gene locus_tag LOCUS_01150 61192 59654 CDS product DotU family type VI secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039003.1 protein_id gnl|my_center|LOCUS_01150 62572 61238 gene locus_tag LOCUS_01160 gene tssK 62572 61238 CDS product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973757.1 protein_id gnl|my_center|LOCUS_01160 63137 62607 gene locus_tag LOCUS_01170 63137 62607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 64970 63210 gene locus_tag LOCUS_01180 64970 63210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 65698 65012 gene locus_tag LOCUS_01190 65698 65012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 67697 65766 gene locus_tag LOCUS_01200 gene vgrG1b 67697 65766 CDS product type VI secretion system spike protein VgrG1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147059.1 protein_id gnl|my_center|LOCUS_01200 68286 67813 gene locus_tag LOCUS_01210 68286 67813 CDS product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003504561.1 protein_id gnl|my_center|LOCUS_01210 71193 68461 gene locus_tag LOCUS_01220 gene tssH 71193 68461 CDS product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269330.1 protein_id gnl|my_center|LOCUS_01220 71921 71430 gene locus_tag LOCUS_01230 71921 71430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 73263 72016 gene locus_tag LOCUS_01240 73263 72016 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532349.1 protein_id gnl|my_center|LOCUS_01240 73784 73260 gene locus_tag LOCUS_01250 73784 73260 CDS product invasion associated locus B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391120.1 protein_id gnl|my_center|LOCUS_01250 74639 74019 gene locus_tag LOCUS_01260 74639 74019 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391119.1 protein_id gnl|my_center|LOCUS_01260 75309 74689 gene locus_tag LOCUS_01270 75309 74689 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388953.1 protein_id gnl|my_center|LOCUS_01270 75666 75923 gene locus_tag LOCUS_01280 75666 75923 CDS product YjhX family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639915.1 protein_id gnl|my_center|LOCUS_01280 75994 76569 gene locus_tag LOCUS_01290 75994 76569 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146526238.1 protein_id gnl|my_center|LOCUS_01290 76821 76588 gene locus_tag LOCUS_01300 76821 76588 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141125.1 protein_id gnl|my_center|LOCUS_01300 77240 76818 gene locus_tag LOCUS_01310 77240 76818 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928694.1 protein_id gnl|my_center|LOCUS_01310 79191 77359 gene locus_tag LOCUS_01320 gene typA 79191 77359 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387909.1 protein_id gnl|my_center|LOCUS_01320 79729 79502 gene locus_tag LOCUS_01330 79729 79502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 80968 79925 gene locus_tag LOCUS_01340 80968 79925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 81547 81329 gene locus_tag LOCUS_01350 81547 81329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 81839 81645 gene locus_tag LOCUS_01360 81839 81645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 82174 81839 gene locus_tag LOCUS_01370 82174 81839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 83083 82508 gene locus_tag LOCUS_01380 83083 82508 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552315.1 protein_id gnl|my_center|LOCUS_01380 83392 83619 gene locus_tag LOCUS_01390 83392 83619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 >Feature sequence012 478 1026 gene locus_tag LOCUS_01400 gene ssb 478 1026 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389498.1 protein_id gnl|my_center|LOCUS_01400 2650 1082 gene locus_tag LOCUS_01410 2650 1082 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391336.1 protein_id gnl|my_center|LOCUS_01410 4276 3017 gene locus_tag LOCUS_01420 4276 3017 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067483.1 protein_id gnl|my_center|LOCUS_01420 6435 4432 gene locus_tag LOCUS_01430 6435 4432 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626003.1 protein_id gnl|my_center|LOCUS_01430 >Feature sequence013 324 82 gene locus_tag LOCUS_01440 324 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 656 339 gene locus_tag LOCUS_01450 656 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 1388 3076 gene locus_tag LOCUS_01460 gene pgi 1388 3076 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390697.1 protein_id gnl|my_center|LOCUS_01460 3073 4944 gene locus_tag LOCUS_01470 gene mutL 3073 4944 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390696.1 protein_id gnl|my_center|LOCUS_01470 5004 5330 gene locus_tag LOCUS_01480 5004 5330 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068497212.1 protein_id gnl|my_center|LOCUS_01480 5327 5617 gene locus_tag LOCUS_01490 5327 5617 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391158.1 protein_id gnl|my_center|LOCUS_01490 5749 6003 gene locus_tag LOCUS_01500 5749 6003 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528289.1 protein_id gnl|my_center|LOCUS_01500 6000 6413 gene locus_tag LOCUS_01510 6000 6413 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969348.1 protein_id gnl|my_center|LOCUS_01510 6743 6438 gene locus_tag LOCUS_01520 6743 6438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 >Feature sequence014 126 845 gene locus_tag LOCUS_01530 126 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 2339 930 gene locus_tag LOCUS_01540 2339 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 2549 6292 gene locus_tag LOCUS_01550 gene putA 2549 6292 CDS product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531234.1 protein_id gnl|my_center|LOCUS_01550 >Feature sequence015 2918 288 gene locus_tag LOCUS_01560 2918 288 CDS product DUF4175 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470595.1 protein_id gnl|my_center|LOCUS_01560 3844 5310 gene locus_tag LOCUS_01570 gene dnaA 3844 5310 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387762.1 protein_id gnl|my_center|LOCUS_01570 5325 5771 gene locus_tag LOCUS_01580 5325 5771 CDS product DUF1489 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389917.1 protein_id gnl|my_center|LOCUS_01580 >Feature sequence016 463 137 gene locus_tag LOCUS_01590 463 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 3743 570 gene locus_tag LOCUS_01600 3743 570 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261108.1 protein_id gnl|my_center|LOCUS_01600 5125 3740 gene locus_tag LOCUS_01610 5125 3740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 5368 5802 gene locus_tag LOCUS_01620 5368 5802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 >Feature sequence017 307 510 gene locus_tag LOCUS_01630 307 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 713 1423 gene locus_tag LOCUS_01640 713 1423 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388162.1 protein_id gnl|my_center|LOCUS_01640 2219 1425 gene locus_tag LOCUS_01650 2219 1425 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391017.1 protein_id gnl|my_center|LOCUS_01650 2325 3107 gene locus_tag LOCUS_01660 gene gloB 2325 3107 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391018.1 protein_id gnl|my_center|LOCUS_01660 4671 3259 gene locus_tag LOCUS_01670 gene mnmE 4671 3259 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391371.1 protein_id gnl|my_center|LOCUS_01670 4986 4732 gene locus_tag LOCUS_01680 4986 4732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 5451 5526 gene locus_tag LOCUS_t00040 5451 5526 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence018 460 122 gene locus_tag LOCUS_01690 460 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 5379 496 gene locus_tag LOCUS_01700 5379 496 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391410.1 protein_id gnl|my_center|LOCUS_01700 >Feature sequence019 1125 43 gene locus_tag LOCUS_01710 1125 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 1802 1470 gene locus_tag LOCUS_01720 1802 1470 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946461.1 protein_id gnl|my_center|LOCUS_01720 2068 1904 gene locus_tag LOCUS_01730 2068 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 2043 2213 gene locus_tag LOCUS_01740 2043 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 2437 2297 gene locus_tag LOCUS_01750 2437 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 2715 2542 gene locus_tag LOCUS_01760 2715 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 3191 2847 gene locus_tag LOCUS_01770 3191 2847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 3132 3287 gene locus_tag LOCUS_01780 3132 3287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 4904 4044 gene locus_tag LOCUS_01790 4904 4044 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531135.1 protein_id gnl|my_center|LOCUS_01790 5243 5016 gene locus_tag LOCUS_01800 5243 5016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 >Feature sequence020 406 942 gene locus_tag LOCUS_01810 406 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 1047 1895 gene locus_tag LOCUS_01820 gene rquA 1047 1895 CDS product rhodoquinone biosynthesis methyltransferase RquA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390975.1 protein_id gnl|my_center|LOCUS_01820 2017 5163 gene locus_tag LOCUS_01830 2017 5163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626538.1 protein_id gnl|my_center|LOCUS_01830 >Feature sequence021 2142 67 gene locus_tag LOCUS_01840 2142 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 2504 2139 gene locus_tag LOCUS_01850 2504 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 3405 3330 gene locus_tag LOCUS_t00050 3405 3330 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4270 3554 gene locus_tag LOCUS_01860 4270 3554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01860 4581 4666 gene locus_tag LOCUS_t00060 4581 4666 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 4702 4775 gene locus_tag LOCUS_t00070 4702 4775 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence022 1454 234 gene locus_tag LOCUS_01870 1454 234 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531687.1 protein_id gnl|my_center|LOCUS_01870 3051 1759 gene locus_tag LOCUS_01880 3051 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 4006 3431 gene locus_tag LOCUS_01890 4006 3431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 7099 4310 gene locus_tag LOCUS_01900 7099 4310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 7210 7785 gene locus_tag LOCUS_01910 7210 7785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389320.1 protein_id gnl|my_center|LOCUS_01910 8071 8550 gene locus_tag LOCUS_01920 8071 8550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 9643 8858 gene locus_tag LOCUS_01930 9643 8858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 10946 9759 gene locus_tag LOCUS_01940 10946 9759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 11049 12284 gene locus_tag LOCUS_01950 11049 12284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 12281 14347 gene locus_tag LOCUS_01960 12281 14347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 14429 14851 gene locus_tag LOCUS_01970 14429 14851 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259628.1 protein_id gnl|my_center|LOCUS_01970 14848 16488 gene locus_tag LOCUS_01980 14848 16488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 21371 16809 gene locus_tag LOCUS_01990 gene gltB 21371 16809 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387780.1 protein_id gnl|my_center|LOCUS_01990 22899 21436 gene locus_tag LOCUS_02000 22899 21436 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387779.1 protein_id gnl|my_center|LOCUS_02000 23298 24107 gene locus_tag LOCUS_02010 23298 24107 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387778.1 protein_id gnl|my_center|LOCUS_02010 24291 25088 gene locus_tag LOCUS_02020 gene pcaD 24291 25088 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973944.1 protein_id gnl|my_center|LOCUS_02020 25503 25123 gene locus_tag LOCUS_02030 25503 25123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 26223 25579 gene locus_tag LOCUS_02040 26223 25579 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388715.1 protein_id gnl|my_center|LOCUS_02040 27227 26286 gene locus_tag LOCUS_02050 27227 26286 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102239.1 protein_id gnl|my_center|LOCUS_02050 28100 27315 gene locus_tag LOCUS_02060 28100 27315 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388716.1 protein_id gnl|my_center|LOCUS_02060 29182 28247 gene locus_tag LOCUS_02070 29182 28247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 29322 29978 gene locus_tag LOCUS_02080 29322 29978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 30536 30009 gene locus_tag LOCUS_02090 30536 30009 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388878.1 protein_id gnl|my_center|LOCUS_02090 31009 30542 gene locus_tag LOCUS_02100 31009 30542 CDS product CreA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389836.1 protein_id gnl|my_center|LOCUS_02100 32196 31045 gene locus_tag LOCUS_02110 gene carA 32196 31045 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390635.1 protein_id gnl|my_center|LOCUS_02110 32824 33273 gene locus_tag LOCUS_02120 32824 33273 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390634.1 protein_id gnl|my_center|LOCUS_02120 33372 35237 gene locus_tag LOCUS_02130 gene dnaG 33372 35237 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390633.1 protein_id gnl|my_center|LOCUS_02130 35400 37472 gene locus_tag LOCUS_02140 gene rpoD 35400 37472 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390632.1 protein_id gnl|my_center|LOCUS_02140 38302 37736 gene locus_tag LOCUS_02150 38302 37736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470665.1 protein_id gnl|my_center|LOCUS_02150 38599 38354 gene locus_tag LOCUS_02160 38599 38354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 38776 39738 gene locus_tag LOCUS_02170 38776 39738 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390801.1 protein_id gnl|my_center|LOCUS_02170 39743 40225 gene locus_tag LOCUS_02180 gene rnhA 39743 40225 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193456.1 protein_id gnl|my_center|LOCUS_02180 40231 40653 gene locus_tag LOCUS_02190 40231 40653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02190 40732 41124 gene locus_tag LOCUS_02200 40732 41124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02200 42137 41097 gene locus_tag LOCUS_02210 42137 41097 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391323.1 protein_id gnl|my_center|LOCUS_02210 42394 44469 gene locus_tag LOCUS_02220 42394 44469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388125.1 protein_id gnl|my_center|LOCUS_02220 46465 44489 gene locus_tag LOCUS_02230 46465 44489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 47178 46525 gene locus_tag LOCUS_02240 47178 46525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 47396 49636 gene locus_tag LOCUS_02250 gene uvrB 47396 49636 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470604.1 protein_id gnl|my_center|LOCUS_02250 49916 50674 gene locus_tag LOCUS_02260 49916 50674 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388186.1 protein_id gnl|my_center|LOCUS_02260 50960 51733 gene locus_tag LOCUS_02270 50960 51733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 51726 52550 gene locus_tag LOCUS_02280 51726 52550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 52615 53631 gene locus_tag LOCUS_02290 gene cbiB 52615 53631 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391129.1 protein_id gnl|my_center|LOCUS_02290 53704 54657 gene locus_tag LOCUS_02300 gene thyX 53704 54657 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383016.1 protein_id gnl|my_center|LOCUS_02300 55602 54844 gene locus_tag LOCUS_02310 gene trmB 55602 54844 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391524.1 protein_id gnl|my_center|LOCUS_02310 56065 55658 gene locus_tag LOCUS_02320 56065 55658 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391535.1 protein_id gnl|my_center|LOCUS_02320 57574 56177 gene locus_tag LOCUS_02330 57574 56177 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391534.1 protein_id gnl|my_center|LOCUS_02330 58465 57701 gene locus_tag LOCUS_02340 58465 57701 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391533.1 protein_id gnl|my_center|LOCUS_02340 59454 58843 gene locus_tag LOCUS_02350 59454 58843 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809123.1 protein_id gnl|my_center|LOCUS_02350 59596 62934 gene locus_tag LOCUS_02360 59596 62934 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921044.1 protein_id gnl|my_center|LOCUS_02360 64129 62957 gene locus_tag LOCUS_02370 64129 62957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 64725 64126 gene locus_tag LOCUS_02380 gene recR 64725 64126 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391218.1 protein_id gnl|my_center|LOCUS_02380 65083 64760 gene locus_tag LOCUS_02390 65083 64760 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391219.1 protein_id gnl|my_center|LOCUS_02390 66978 65080 gene locus_tag LOCUS_02400 66978 65080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 70190 67479 gene locus_tag LOCUS_02410 70190 67479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 71530 70208 gene locus_tag LOCUS_02420 71530 70208 CDS product succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880832.1 protein_id gnl|my_center|LOCUS_02420 71787 72572 gene locus_tag LOCUS_02430 gene modA 71787 72572 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089689.1 protein_id gnl|my_center|LOCUS_02430 72743 73423 gene locus_tag LOCUS_02440 gene modB 72743 73423 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089690.1 protein_id gnl|my_center|LOCUS_02440 73420 74562 gene locus_tag LOCUS_02450 73420 74562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 74559 75410 gene locus_tag LOCUS_02460 gene modD 74559 75410 CDS product ModD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836200.1 protein_id gnl|my_center|LOCUS_02460 75573 75427 gene locus_tag LOCUS_02470 75573 75427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 76925 75699 gene locus_tag LOCUS_02480 76925 75699 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626639.1 protein_id gnl|my_center|LOCUS_02480 77043 77942 gene locus_tag LOCUS_02490 gene rsmI 77043 77942 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391440.1 protein_id gnl|my_center|LOCUS_02490 77939 78343 gene locus_tag LOCUS_02500 77939 78343 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391439.1 protein_id gnl|my_center|LOCUS_02500 78408 78686 gene locus_tag LOCUS_02510 78408 78686 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928690.1 protein_id gnl|my_center|LOCUS_02510 78673 78945 gene locus_tag LOCUS_02520 78673 78945 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081705261.1 protein_id gnl|my_center|LOCUS_02520 >Feature sequence023 2841 247 gene locus_tag LOCUS_02530 2841 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 3514 2846 gene locus_tag LOCUS_02540 3514 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 4833 4636 gene locus_tag LOCUS_02550 4833 4636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 >Feature sequence024 113 422 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcctcttccgcgttctcgagcggactgaaac 3706 533 gene locus_tag LOCUS_02560 3706 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 4134 3703 gene locus_tag LOCUS_02570 4134 3703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 >Feature sequence025 162 824 gene locus_tag LOCUS_02580 162 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 1725 829 gene locus_tag LOCUS_02590 1725 829 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403421.1 protein_id gnl|my_center|LOCUS_02590 4062 2107 gene locus_tag LOCUS_02600 4062 2107 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390019.1 protein_id gnl|my_center|LOCUS_02600 >Feature sequence026 256 678 gene locus_tag LOCUS_02610 256 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 1025 1492 gene locus_tag LOCUS_02620 1025 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 1393 3411 gene locus_tag LOCUS_02630 1393 3411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 >Feature sequence027 546 55 gene locus_tag LOCUS_02640 546 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 940 3561 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcttcaatgaggccggggcattactgccccggaagg >Feature sequence028 1345 890 gene locus_tag LOCUS_02650 1345 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 2077 1886 gene locus_tag LOCUS_02660 2077 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 2503 2210 gene locus_tag LOCUS_02670 2503 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 2642 3340 gene locus_tag LOCUS_02680 2642 3340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 >Feature sequence029 300 1424 gene locus_tag LOCUS_02690 300 1424 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031095.1 protein_id gnl|my_center|LOCUS_02690 1551 2732 gene locus_tag LOCUS_02700 1551 2732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 >Feature sequence030 681 118 gene locus_tag LOCUS_02710 681 118 CDS product DUF2937 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388036.1 protein_id gnl|my_center|LOCUS_02710 755 1051 gene locus_tag LOCUS_02720 755 1051 CDS product SemiSWEET transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089200.1 protein_id gnl|my_center|LOCUS_02720 1064 1279 gene locus_tag LOCUS_02730 1064 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 1357 2835 gene locus_tag LOCUS_02740 gene rfaE1 1357 2835 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387884.1 protein_id gnl|my_center|LOCUS_02740 >Feature sequence031 1648 143 gene locus_tag LOCUS_02750 1648 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 >Feature sequence032 864 70 gene locus_tag LOCUS_02760 864 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 >Feature sequence033 1773 313 gene locus_tag LOCUS_02770 1773 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 2312 1770 gene locus_tag LOCUS_02780 2312 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 2860 2303 gene locus_tag LOCUS_02790 2860 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 3997 3029 gene locus_tag LOCUS_02800 3997 3029 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920777.1 protein_id gnl|my_center|LOCUS_02800 5036 4005 gene locus_tag LOCUS_02810 5036 4005 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920778.1 protein_id gnl|my_center|LOCUS_02810 6339 5029 gene locus_tag LOCUS_02820 6339 5029 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084253.1 protein_id gnl|my_center|LOCUS_02820 7967 6744 gene locus_tag LOCUS_02830 7967 6744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 8736 8053 gene locus_tag LOCUS_02840 8736 8053 CDS product CpaD family pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651427.1 protein_id gnl|my_center|LOCUS_02840 10868 8742 gene locus_tag LOCUS_02850 10868 8742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 12243 11008 gene locus_tag LOCUS_02860 12243 11008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 12838 12311 gene locus_tag LOCUS_02870 12838 12311 CDS product prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920784.1 protein_id gnl|my_center|LOCUS_02870 13167 12976 gene locus_tag LOCUS_02880 13167 12976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 14067 13519 gene locus_tag LOCUS_02890 14067 13519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02890 14541 14095 gene locus_tag LOCUS_02900 14541 14095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02900 14917 14744 gene locus_tag LOCUS_02910 14917 14744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 16142 14976 gene locus_tag LOCUS_02920 16142 14976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 17779 16196 gene locus_tag LOCUS_02930 17779 16196 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966261.1 protein_id gnl|my_center|LOCUS_02930 18871 17930 gene locus_tag LOCUS_02940 18871 17930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 20010 18874 gene locus_tag LOCUS_02950 20010 18874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 21614 20163 gene locus_tag LOCUS_02960 21614 20163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 22046 21627 gene locus_tag LOCUS_02970 22046 21627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 23161 22157 gene locus_tag LOCUS_02980 23161 22157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 25410 23554 gene locus_tag LOCUS_02990 25410 23554 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390371.1 protein_id gnl|my_center|LOCUS_02990 26026 25454 gene locus_tag LOCUS_03000 26026 25454 CDS product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529007.1 protein_id gnl|my_center|LOCUS_03000 26289 27023 gene locus_tag LOCUS_03010 26289 27023 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478515.1 protein_id gnl|my_center|LOCUS_03010 27061 27864 gene locus_tag LOCUS_03020 27061 27864 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454529.1 protein_id gnl|my_center|LOCUS_03020 27861 28211 gene locus_tag LOCUS_03030 27861 28211 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005382084.1 protein_id gnl|my_center|LOCUS_03030 28208 28645 gene locus_tag LOCUS_03040 28208 28645 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263098.1 protein_id gnl|my_center|LOCUS_03040 28647 29636 gene locus_tag LOCUS_03050 28647 29636 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_03050 29666 30460 gene locus_tag LOCUS_03060 29666 30460 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389873.1 protein_id gnl|my_center|LOCUS_03060 30545 30970 gene locus_tag LOCUS_03070 30545 30970 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389874.1 protein_id gnl|my_center|LOCUS_03070 31564 33471 gene locus_tag LOCUS_03080 gene uvrC 31564 33471 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389875.1 protein_id gnl|my_center|LOCUS_03080 33514 34086 gene locus_tag LOCUS_03090 gene pgsA 33514 34086 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389876.1 protein_id gnl|my_center|LOCUS_03090 34083 35360 gene locus_tag LOCUS_03100 34083 35360 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389877.1 protein_id gnl|my_center|LOCUS_03100 35371 35622 gene locus_tag LOCUS_03110 gene moaD 35371 35622 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090205.1 protein_id gnl|my_center|LOCUS_03110 35626 36099 gene locus_tag LOCUS_03120 35626 36099 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390442.1 protein_id gnl|my_center|LOCUS_03120 37035 36226 gene locus_tag LOCUS_03130 37035 36226 CDS product family 1 encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228354.1 protein_id gnl|my_center|LOCUS_03130 37453 37040 gene locus_tag LOCUS_03140 37453 37040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 38874 37666 gene locus_tag LOCUS_03150 38874 37666 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390303.1 protein_id gnl|my_center|LOCUS_03150 39548 38871 gene locus_tag LOCUS_03160 39548 38871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 39679 40584 gene locus_tag LOCUS_03170 39679 40584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390305.1 protein_id gnl|my_center|LOCUS_03170 40648 41394 gene locus_tag LOCUS_03180 40648 41394 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390306.1 protein_id gnl|my_center|LOCUS_03180 42441 41554 gene locus_tag LOCUS_03190 gene folD 42441 41554 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338398.1 protein_id gnl|my_center|LOCUS_03190 42670 43335 gene locus_tag LOCUS_03200 42670 43335 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532893.1 protein_id gnl|my_center|LOCUS_03200 43591 43887 gene locus_tag LOCUS_03210 43591 43887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 44006 44875 gene locus_tag LOCUS_03220 gene purU 44006 44875 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388314.1 protein_id gnl|my_center|LOCUS_03220 45397 45723 gene locus_tag LOCUS_03230 45397 45723 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388313.1 protein_id gnl|my_center|LOCUS_03230 45735 47108 gene locus_tag LOCUS_03240 gene amt 45735 47108 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383316.1 protein_id gnl|my_center|LOCUS_03240 48137 47370 gene locus_tag LOCUS_03250 gene tpiA 48137 47370 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389642.1 protein_id gnl|my_center|LOCUS_03250 48353 50242 gene locus_tag LOCUS_03260 48353 50242 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389643.1 protein_id gnl|my_center|LOCUS_03260 50256 51755 gene locus_tag LOCUS_03270 gene trpE 50256 51755 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389644.1 protein_id gnl|my_center|LOCUS_03270 52390 51791 gene locus_tag LOCUS_03280 52390 51791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 52700 52398 gene locus_tag LOCUS_03290 52700 52398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 54183 52945 gene locus_tag LOCUS_03300 54183 52945 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390393.1 protein_id gnl|my_center|LOCUS_03300 54468 56357 gene locus_tag LOCUS_03310 54468 56357 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_03310 56838 56410 gene locus_tag LOCUS_03320 56838 56410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 59758 56858 gene locus_tag LOCUS_03330 59758 56858 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391286.1 protein_id gnl|my_center|LOCUS_03330 60098 61021 gene locus_tag LOCUS_03340 60098 61021 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389853.1 protein_id gnl|my_center|LOCUS_03340 61023 61838 gene locus_tag LOCUS_03350 61023 61838 CDS product TIGR02186 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440275.1 protein_id gnl|my_center|LOCUS_03350 61835 62398 gene locus_tag LOCUS_03360 61835 62398 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391279.1 protein_id gnl|my_center|LOCUS_03360 62446 64008 gene locus_tag LOCUS_03370 62446 64008 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389422.1 protein_id gnl|my_center|LOCUS_03370 64051 65523 gene locus_tag LOCUS_03380 64051 65523 CDS product malonyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440399.1 protein_id gnl|my_center|LOCUS_03380 65666 68395 gene locus_tag LOCUS_03390 65666 68395 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390312.1 protein_id gnl|my_center|LOCUS_03390 68392 69321 gene locus_tag LOCUS_03400 68392 69321 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390313.1 protein_id gnl|my_center|LOCUS_03400 70527 69328 gene locus_tag LOCUS_03410 gene metC 70527 69328 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389303.1 protein_id gnl|my_center|LOCUS_03410 71038 71322 gene locus_tag LOCUS_03420 71038 71322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389304.1 protein_id gnl|my_center|LOCUS_03420 72203 71670 gene locus_tag LOCUS_03430 gene pal 72203 71670 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388850.1 protein_id gnl|my_center|LOCUS_03430 72456 73472 gene locus_tag LOCUS_03440 72456 73472 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391318.1 protein_id gnl|my_center|LOCUS_03440 73577 73864 gene locus_tag LOCUS_03450 73577 73864 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391319.1 protein_id gnl|my_center|LOCUS_03450 73911 74198 gene locus_tag LOCUS_03460 73911 74198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 >Feature sequence034 <1 592 gene locus_tag LOCUS_03470 <1 592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038965939.1:AMP-binding protein 1129 782 gene locus_tag LOCUS_03480 1129 782 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088514.1 protein_id gnl|my_center|LOCUS_03480 1776 1600 gene locus_tag LOCUS_03490 1776 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 >Feature sequence035 1249 437 gene locus_tag LOCUS_03500 1249 437 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119813.1 protein_id gnl|my_center|LOCUS_03500 2299 1328 gene locus_tag LOCUS_03510 gene corA 2299 1328 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529992.1 protein_id gnl|my_center|LOCUS_03510 >Feature sequence036 1226 939 gene locus_tag LOCUS_03520 1226 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 1373 2308 gene locus_tag LOCUS_03530 1373 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 2312 2530 gene locus_tag LOCUS_03540 2312 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 >Feature sequence037 262 513 gene locus_tag LOCUS_03550 262 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 507 842 gene locus_tag LOCUS_03560 507 842 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680107.1 protein_id gnl|my_center|LOCUS_03560 1981 830 gene locus_tag LOCUS_03570 1981 830 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073356551.1 protein_id gnl|my_center|LOCUS_03570 >Feature sequence038 229 567 gene locus_tag LOCUS_03580 229 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 1073 588 gene locus_tag LOCUS_03590 1073 588 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037388632.1 protein_id gnl|my_center|LOCUS_03590 1364 1807 gene locus_tag LOCUS_03600 1364 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 2227 2006 gene locus_tag LOCUS_03610 2227 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 >Feature sequence039 990 2270 gene locus_tag LOCUS_03620 990 2270 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388993.1 protein_id gnl|my_center|LOCUS_03620 >Feature sequence040 181 867 gene locus_tag LOCUS_03630 181 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 854 1129 gene locus_tag LOCUS_03640 854 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 1248 1496 gene locus_tag LOCUS_03650 1248 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 2249 1923 gene locus_tag LOCUS_03660 2249 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 >Feature sequence041 607 1488 gene locus_tag LOCUS_03670 607 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 1598 1936 gene locus_tag LOCUS_03680 1598 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 >Feature sequence042 479 555 gene locus_tag LOCUS_t00080 479 555 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1956 595 gene locus_tag LOCUS_03690 1956 595 CDS product DUF4910 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707841.1 protein_id gnl|my_center|LOCUS_03690 >Feature sequence043 463 71 gene locus_tag LOCUS_03700 463 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 369 632 gene locus_tag LOCUS_03710 369 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 814 1626 gene locus_tag LOCUS_03720 814 1626 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162467624.1 protein_id gnl|my_center|LOCUS_03720 2068 1757 gene locus_tag LOCUS_03730 2068 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 >Feature sequence044 251 1447 gene locus_tag LOCUS_03740 251 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 1612 1536 gene locus_tag LOCUS_t00090 1612 1536 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2609 1791 gene locus_tag LOCUS_03750 2609 1791 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390489.1 protein_id gnl|my_center|LOCUS_03750 3005 2649 gene locus_tag LOCUS_03760 3005 2649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 3802 3002 gene locus_tag LOCUS_03770 3802 3002 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113515.1 protein_id gnl|my_center|LOCUS_03770 4556 3927 gene locus_tag LOCUS_03780 4556 3927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 9088 4556 gene locus_tag LOCUS_03790 9088 4556 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389851.1 protein_id gnl|my_center|LOCUS_03790 10949 9090 gene locus_tag LOCUS_03800 10949 9090 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626303.1 protein_id gnl|my_center|LOCUS_03800 11183 12043 gene locus_tag LOCUS_03810 11183 12043 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040241.1 protein_id gnl|my_center|LOCUS_03810 12105 13142 gene locus_tag LOCUS_03820 12105 13142 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227769.1 protein_id gnl|my_center|LOCUS_03820 13210 13761 gene locus_tag LOCUS_03830 13210 13761 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257143.1 protein_id gnl|my_center|LOCUS_03830 13749 15113 gene locus_tag LOCUS_03840 13749 15113 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403751.1 protein_id gnl|my_center|LOCUS_03840 15903 15229 gene locus_tag LOCUS_03850 15903 15229 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626630.1 protein_id gnl|my_center|LOCUS_03850 16107 17276 gene locus_tag LOCUS_03860 gene ribA 16107 17276 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391384.1 protein_id gnl|my_center|LOCUS_03860 17842 17387 gene locus_tag LOCUS_03870 17842 17387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391479.1 protein_id gnl|my_center|LOCUS_03870 18929 18144 gene locus_tag LOCUS_03880 18929 18144 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839117.1 protein_id gnl|my_center|LOCUS_03880 19102 19905 gene locus_tag LOCUS_03890 19102 19905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 21997 19892 gene locus_tag LOCUS_03900 21997 19892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 22950 21994 gene locus_tag LOCUS_03910 22950 21994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 23353 22937 gene locus_tag LOCUS_03920 23353 22937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 23577 24923 gene locus_tag LOCUS_03930 23577 24923 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920974.1 protein_id gnl|my_center|LOCUS_03930 28201 25394 gene locus_tag LOCUS_03940 28201 25394 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933304.1 protein_id gnl|my_center|LOCUS_03940 28545 29312 gene locus_tag LOCUS_03950 28545 29312 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390181.1 protein_id gnl|my_center|LOCUS_03950 29357 30427 gene locus_tag LOCUS_03960 29357 30427 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387829.1 protein_id gnl|my_center|LOCUS_03960 30527 31294 gene locus_tag LOCUS_03970 30527 31294 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391108.1 protein_id gnl|my_center|LOCUS_03970 31328 31996 gene locus_tag LOCUS_03980 31328 31996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 32109 32837 gene locus_tag LOCUS_03990 32109 32837 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387799.1 protein_id gnl|my_center|LOCUS_03990 32902 33198 gene locus_tag LOCUS_04000 32902 33198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 33195 33701 gene locus_tag LOCUS_04010 gene ccmE 33195 33701 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387797.1 protein_id gnl|my_center|LOCUS_04010 34169 36217 gene locus_tag LOCUS_04020 34169 36217 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387796.1 protein_id gnl|my_center|LOCUS_04020 36214 36756 gene locus_tag LOCUS_04030 36214 36756 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387795.1 protein_id gnl|my_center|LOCUS_04030 36780 37337 gene locus_tag LOCUS_04040 36780 37337 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387794.1 protein_id gnl|my_center|LOCUS_04040 37334 38935 gene locus_tag LOCUS_04050 gene ccmI 37334 38935 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387793.1 protein_id gnl|my_center|LOCUS_04050 38969 39778 gene locus_tag LOCUS_04060 gene moeB 38969 39778 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391540.1 protein_id gnl|my_center|LOCUS_04060 39775 40401 gene locus_tag LOCUS_04070 gene mobA 39775 40401 CDS product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921607.1 protein_id gnl|my_center|LOCUS_04070 41632 40382 gene locus_tag LOCUS_04080 41632 40382 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965724.1 protein_id gnl|my_center|LOCUS_04080 41755 42819 gene locus_tag LOCUS_04090 41755 42819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391309.1 protein_id gnl|my_center|LOCUS_04090 42997 42922 gene locus_tag LOCUS_t00100 42997 42922 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 44027 43182 gene locus_tag LOCUS_04100 44027 43182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 44612 44121 gene locus_tag LOCUS_04110 44612 44121 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389629.1 protein_id gnl|my_center|LOCUS_04110 45615 44617 gene locus_tag LOCUS_04120 gene lipA 45615 44617 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389630.1 protein_id gnl|my_center|LOCUS_04120 47038 45635 gene locus_tag LOCUS_04130 gene lpdA 47038 45635 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389631.1 protein_id gnl|my_center|LOCUS_04130 47288 47043 gene locus_tag LOCUS_04140 47288 47043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 48757 47456 gene locus_tag LOCUS_04150 48757 47456 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173608.1 protein_id gnl|my_center|LOCUS_04150 49950 48754 gene locus_tag LOCUS_04160 gene dauA 49950 48754 CDS product FAD-dependent catabolic D-arginine dehydrogenase DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113780.1 protein_id gnl|my_center|LOCUS_04160 50974 49943 gene locus_tag LOCUS_04170 50974 49943 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532102.1 protein_id gnl|my_center|LOCUS_04170 51992 51063 gene locus_tag LOCUS_04180 51992 51063 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532100.1 protein_id gnl|my_center|LOCUS_04180 53401 51989 gene locus_tag LOCUS_04190 53401 51989 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532099.1 protein_id gnl|my_center|LOCUS_04190 54872 53688 gene locus_tag LOCUS_04200 54872 53688 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257553.1 protein_id gnl|my_center|LOCUS_04200 56125 54971 gene locus_tag LOCUS_04210 56125 54971 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257556.1 protein_id gnl|my_center|LOCUS_04210 56972 56172 gene locus_tag LOCUS_04220 56972 56172 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398419.1 protein_id gnl|my_center|LOCUS_04220 57879 56998 gene locus_tag LOCUS_04230 gene potB 57879 56998 CDS product spermidine/putrescine ABC transporter permease PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715491.1 protein_id gnl|my_center|LOCUS_04230 58077 59153 gene locus_tag LOCUS_04240 58077 59153 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532093.1 protein_id gnl|my_center|LOCUS_04240 60059 59175 gene locus_tag LOCUS_04250 gene galU 60059 59175 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389966.1 protein_id gnl|my_center|LOCUS_04250 61007 60201 gene locus_tag LOCUS_04260 61007 60201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 61757 61011 gene locus_tag LOCUS_04270 61757 61011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087917.1 protein_id gnl|my_center|LOCUS_04270 63888 61882 gene locus_tag LOCUS_04280 63888 61882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 65609 63960 gene locus_tag LOCUS_04290 65609 63960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 66540 65665 gene locus_tag LOCUS_04300 66540 65665 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174491.1 protein_id gnl|my_center|LOCUS_04300 67783 66845 gene locus_tag LOCUS_04310 67783 66845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 70563 67966 gene locus_tag LOCUS_04320 gene clpB 70563 67966 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388511.1 protein_id gnl|my_center|LOCUS_04320 >Feature sequence045 1661 456 gene locus_tag LOCUS_04330 1661 456 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337850.1 protein_id gnl|my_center|LOCUS_04330 >Feature sequence046 291 1874 gene locus_tag LOCUS_04340 gene murJ 291 1874 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391285.1 protein_id gnl|my_center|LOCUS_04340 >Feature sequence047 950 63 gene locus_tag LOCUS_04350 950 63 CDS product replication initiator protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387735.1 protein_id gnl|my_center|LOCUS_04350 1276 947 gene locus_tag LOCUS_04360 1276 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 1958 1260 gene locus_tag LOCUS_04370 1958 1260 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074390.1 protein_id gnl|my_center|LOCUS_04370 >Feature sequence048 835 83 gene locus_tag LOCUS_04380 835 83 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884094.1 protein_id gnl|my_center|LOCUS_04380 >Feature sequence049 412 98 gene locus_tag LOCUS_04390 412 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 1345 422 gene locus_tag LOCUS_04400 1345 422 CDS product Mu-like prophage major head subunit gpT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939979.1 protein_id gnl|my_center|LOCUS_04400 1769 1362 gene locus_tag LOCUS_04410 1769 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 >Feature sequence050 407 643 gene locus_tag LOCUS_04420 407 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 >Feature sequence051 >Feature sequence052 82 1674 gene locus_tag LOCUS_04430 82 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 >Feature sequence053 1070 147 gene locus_tag LOCUS_04440 1070 147 CDS product Mu-like prophage major head subunit gpT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142982.1 protein_id gnl|my_center|LOCUS_04440 >Feature sequence054 981 352 gene locus_tag LOCUS_04450 981 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 >Feature sequence055 946 2190 gene locus_tag LOCUS_04460 946 2190 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510581.1 protein_id gnl|my_center|LOCUS_04460 2228 2698 gene locus_tag LOCUS_04470 2228 2698 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862045.1 protein_id gnl|my_center|LOCUS_04470 2722 3627 gene locus_tag LOCUS_04480 2722 3627 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174519602.1 protein_id gnl|my_center|LOCUS_04480 3641 4450 gene locus_tag LOCUS_04490 3641 4450 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895384.1 protein_id gnl|my_center|LOCUS_04490 4443 5747 gene locus_tag LOCUS_04500 4443 5747 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142660068.1 protein_id gnl|my_center|LOCUS_04500 5744 6289 gene locus_tag LOCUS_04510 gene cobU 5744 6289 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388428.1 protein_id gnl|my_center|LOCUS_04510 6956 6303 gene locus_tag LOCUS_04520 gene parA 6956 6303 CDS product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389279.1 protein_id gnl|my_center|LOCUS_04520 9452 7620 gene locus_tag LOCUS_04530 9452 7620 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390692.1 protein_id gnl|my_center|LOCUS_04530 10579 9449 gene locus_tag LOCUS_04540 gene lptF 10579 9449 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390693.1 protein_id gnl|my_center|LOCUS_04540 10775 11026 gene locus_tag LOCUS_04550 10775 11026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 11480 13033 gene locus_tag LOCUS_04560 11480 13033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 13126 13701 gene locus_tag LOCUS_04570 gene rsmD 13126 13701 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388411.1 protein_id gnl|my_center|LOCUS_04570 13979 15700 gene locus_tag LOCUS_04580 13979 15700 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387893.1 protein_id gnl|my_center|LOCUS_04580 18119 15837 gene locus_tag LOCUS_04590 18119 15837 CDS product protein-disulfide reductase DsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390806.1 protein_id gnl|my_center|LOCUS_04590 18545 19066 gene locus_tag LOCUS_04600 18545 19066 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440210.1 protein_id gnl|my_center|LOCUS_04600 19066 20088 gene locus_tag LOCUS_04610 19066 20088 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388975.1 protein_id gnl|my_center|LOCUS_04610 20501 20133 gene locus_tag LOCUS_04620 20501 20133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390518.1 protein_id gnl|my_center|LOCUS_04620 21267 20779 gene locus_tag LOCUS_04630 21267 20779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 22109 21267 gene locus_tag LOCUS_04640 22109 21267 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388410.1 protein_id gnl|my_center|LOCUS_04640 22781 22155 gene locus_tag LOCUS_04650 22781 22155 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526566.1 protein_id gnl|my_center|LOCUS_04650 22867 23520 gene locus_tag LOCUS_04660 22867 23520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 23620 25416 gene locus_tag LOCUS_04670 23620 25416 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388194.1 protein_id gnl|my_center|LOCUS_04670 26620 25643 gene locus_tag LOCUS_04680 26620 25643 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917982.1 protein_id gnl|my_center|LOCUS_04680 28852 26897 gene locus_tag LOCUS_04690 28852 26897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 30340 29117 gene locus_tag LOCUS_04700 30340 29117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 30626 30835 gene locus_tag LOCUS_04710 30626 30835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 30819 31340 gene locus_tag LOCUS_04720 30819 31340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 31620 31363 gene locus_tag LOCUS_04730 31620 31363 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971859.1 protein_id gnl|my_center|LOCUS_04730 31619 33835 gene locus_tag LOCUS_04740 gene recG 31619 33835 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389481.1 protein_id gnl|my_center|LOCUS_04740 34227 34418 gene locus_tag LOCUS_04750 34227 34418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 34431 35042 gene locus_tag LOCUS_04760 34431 35042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 36274 35375 gene locus_tag LOCUS_04770 36274 35375 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388335.1 protein_id gnl|my_center|LOCUS_04770 36638 37642 gene locus_tag LOCUS_04780 36638 37642 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201215821.1 protein_id gnl|my_center|LOCUS_04780 37658 38794 gene locus_tag LOCUS_04790 37658 38794 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388337.1 protein_id gnl|my_center|LOCUS_04790 38856 40166 gene locus_tag LOCUS_04800 38856 40166 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388339.1 protein_id gnl|my_center|LOCUS_04800 40153 41154 gene locus_tag LOCUS_04810 gene lpxK 40153 41154 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388340.1 protein_id gnl|my_center|LOCUS_04810 42296 41178 gene locus_tag LOCUS_04820 42296 41178 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337252.1 protein_id gnl|my_center|LOCUS_04820 43514 42543 gene locus_tag LOCUS_04830 43514 42543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 43977 43531 gene locus_tag LOCUS_04840 gene tolR 43977 43531 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388847.1 protein_id gnl|my_center|LOCUS_04840 45021 44056 gene locus_tag LOCUS_04850 gene tolQ 45021 44056 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388846.1 protein_id gnl|my_center|LOCUS_04850 45523 45032 gene locus_tag LOCUS_04860 45523 45032 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388845.1 protein_id gnl|my_center|LOCUS_04860 46620 45520 gene locus_tag LOCUS_04870 gene ruvB 46620 45520 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388844.1 protein_id gnl|my_center|LOCUS_04870 48030 46696 gene locus_tag LOCUS_04880 48030 46696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 48858 48217 gene locus_tag LOCUS_04890 gene ruvA 48858 48217 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388843.1 protein_id gnl|my_center|LOCUS_04890 49355 48855 gene locus_tag LOCUS_04900 gene ruvC 49355 48855 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388842.1 protein_id gnl|my_center|LOCUS_04900 50264 49515 gene locus_tag LOCUS_04910 50264 49515 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388841.1 protein_id gnl|my_center|LOCUS_04910 50592 52763 gene locus_tag LOCUS_04920 50592 52763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 52885 53772 gene locus_tag LOCUS_04930 52885 53772 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399088.1 protein_id gnl|my_center|LOCUS_04930 54378 55424 gene locus_tag LOCUS_04940 gene queA 54378 55424 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388034.1 protein_id gnl|my_center|LOCUS_04940 56085 55432 gene locus_tag LOCUS_04950 56085 55432 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389783.1 protein_id gnl|my_center|LOCUS_04950 56676 56107 gene locus_tag LOCUS_04960 56676 56107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 56648 57463 gene locus_tag LOCUS_04970 gene cysE 56648 57463 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389782.1 protein_id gnl|my_center|LOCUS_04970 57570 58031 gene locus_tag LOCUS_04980 57570 58031 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389781.1 protein_id gnl|my_center|LOCUS_04980 58127 59269 gene locus_tag LOCUS_04990 58127 59269 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389780.1 protein_id gnl|my_center|LOCUS_04990 59477 59806 gene locus_tag LOCUS_05000 59477 59806 CDS product ferredoxin family 2Fe-2S iron-sulfur cluster binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389779.1 protein_id gnl|my_center|LOCUS_05000 59836 60543 gene locus_tag LOCUS_05010 59836 60543 CDS product TenA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389778.1 protein_id gnl|my_center|LOCUS_05010 60533 61690 gene locus_tag LOCUS_05020 gene mnmA 60533 61690 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389777.1 protein_id gnl|my_center|LOCUS_05020 62236 61697 gene locus_tag LOCUS_05030 62236 61697 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390011.1 protein_id gnl|my_center|LOCUS_05030 62545 62315 gene locus_tag LOCUS_05040 62545 62315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 62427 64640 gene locus_tag LOCUS_05050 62427 64640 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390010.1 protein_id gnl|my_center|LOCUS_05050 64681 66261 gene locus_tag LOCUS_05060 gene ppx 64681 66261 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390009.1 protein_id gnl|my_center|LOCUS_05060 66413 66901 gene locus_tag LOCUS_05070 66413 66901 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391205.1 protein_id gnl|my_center|LOCUS_05070 68365 67091 gene locus_tag LOCUS_05080 68365 67091 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967741.1 protein_id gnl|my_center|LOCUS_05080 68970 68362 gene locus_tag LOCUS_05090 68970 68362 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225422.1 protein_id gnl|my_center|LOCUS_05090 70104 69190 gene locus_tag LOCUS_05100 70104 69190 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388043.1 protein_id gnl|my_center|LOCUS_05100 >Feature sequence056 >Feature sequence057 315 100 gene locus_tag LOCUS_05110 315 100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 464 1162 gene locus_tag LOCUS_05120 464 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 >Feature sequence058 405 481 gene locus_tag LOCUS_t00110 405 481 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 562 1242 gene locus_tag LOCUS_05130 562 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 >Feature sequence059 29 880 gene locus_tag LOCUS_05140 29 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 991 1212 gene locus_tag LOCUS_05150 991 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 >Feature sequence060 780 250 gene locus_tag LOCUS_05160 780 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 >Feature sequence061 1 399 gene locus_tag LOCUS_05170 1 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 472 1047 gene locus_tag LOCUS_05180 472 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 >Feature sequence062 >Feature sequence063 >Feature sequence064 289 897 gene locus_tag LOCUS_05190 289 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 >Feature sequence065 289 104 gene locus_tag LOCUS_05200 289 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 788 249 gene locus_tag LOCUS_05210 788 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 >Feature sequence066 2327 330 gene locus_tag LOCUS_05220 gene tkt 2327 330 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388353.1 protein_id gnl|my_center|LOCUS_05220 3407 2469 gene locus_tag LOCUS_05230 3407 2469 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144407.1 protein_id gnl|my_center|LOCUS_05230 4442 3480 gene locus_tag LOCUS_05240 gene glpX 4442 3480 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938831.1 protein_id gnl|my_center|LOCUS_05240 5238 4630 gene locus_tag LOCUS_05250 5238 4630 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329401.1 protein_id gnl|my_center|LOCUS_05250 5450 5851 gene locus_tag LOCUS_05260 gene gloA 5450 5851 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390219.1 protein_id gnl|my_center|LOCUS_05260 5891 6385 gene locus_tag LOCUS_05270 5891 6385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 6498 7754 gene locus_tag LOCUS_05280 6498 7754 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391154.1 protein_id gnl|my_center|LOCUS_05280 7941 9266 gene locus_tag LOCUS_05290 7941 9266 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389965.1 protein_id gnl|my_center|LOCUS_05290 9351 10988 gene locus_tag LOCUS_05300 9351 10988 CDS product alpha-D-glucose phosphate-specific phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389964.1 protein_id gnl|my_center|LOCUS_05300 11114 12292 gene locus_tag LOCUS_05310 11114 12292 CDS product peptidase C39 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532575.1 protein_id gnl|my_center|LOCUS_05310 12289 13752 gene locus_tag LOCUS_05320 12289 13752 CDS product RimK family alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532574.1 protein_id gnl|my_center|LOCUS_05320 14104 15648 gene locus_tag LOCUS_05330 14104 15648 CDS product glucan biosynthesis protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389984.1 protein_id gnl|my_center|LOCUS_05330 15667 16098 gene locus_tag LOCUS_05340 15667 16098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 16354 18417 gene locus_tag LOCUS_05350 gene mdoH 16354 18417 CDS product glucans biosynthesis glucosyltransferase MdoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389982.1 protein_id gnl|my_center|LOCUS_05350 18906 18442 gene locus_tag LOCUS_05360 18906 18442 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390579.1 protein_id gnl|my_center|LOCUS_05360 19415 18912 gene locus_tag LOCUS_05370 19415 18912 CDS product UPF0262 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390580.1 protein_id gnl|my_center|LOCUS_05370 20737 19415 gene locus_tag LOCUS_05380 gene hisD 20737 19415 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390581.1 protein_id gnl|my_center|LOCUS_05380 21389 20727 gene locus_tag LOCUS_05390 gene hisG 21389 20727 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390582.1 protein_id gnl|my_center|LOCUS_05390 21854 22966 gene locus_tag LOCUS_05400 21854 22966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 23002 24138 gene locus_tag LOCUS_05410 23002 24138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 24203 24745 gene locus_tag LOCUS_05420 24203 24745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 26071 24788 gene locus_tag LOCUS_05430 gene murA 26071 24788 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390681.1 protein_id gnl|my_center|LOCUS_05430 26705 26148 gene locus_tag LOCUS_05440 gene dcd 26705 26148 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092017.1 protein_id gnl|my_center|LOCUS_05440 26944 26696 gene locus_tag LOCUS_05450 26944 26696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 28434 26986 gene locus_tag LOCUS_05460 28434 26986 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551357.1 protein_id gnl|my_center|LOCUS_05460 28621 29646 gene locus_tag LOCUS_05470 28621 29646 CDS product threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114230.1 protein_id gnl|my_center|LOCUS_05470 29639 30358 gene locus_tag LOCUS_05480 29639 30358 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337268.1 protein_id gnl|my_center|LOCUS_05480 30944 30378 gene locus_tag LOCUS_05490 30944 30378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 32054 31176 gene locus_tag LOCUS_05500 32054 31176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 33604 32207 gene locus_tag LOCUS_05510 33604 32207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 34244 37495 gene locus_tag LOCUS_05520 34244 37495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 37572 38465 gene locus_tag LOCUS_05530 gene prmC 37572 38465 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388509.1 protein_id gnl|my_center|LOCUS_05530 39116 39976 gene locus_tag LOCUS_05540 39116 39976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 40322 40038 gene locus_tag LOCUS_05550 40322 40038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 41044 40445 gene locus_tag LOCUS_05560 41044 40445 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391007.1 protein_id gnl|my_center|LOCUS_05560 41176 42498 gene locus_tag LOCUS_05570 41176 42498 CDS product DUF2125 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337379.1 protein_id gnl|my_center|LOCUS_05570 42948 42544 gene locus_tag LOCUS_05580 42948 42544 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534958.1 protein_id gnl|my_center|LOCUS_05580 43187 43570 gene locus_tag LOCUS_05590 43187 43570 CDS product GcrA family cell cycle regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389346.1 protein_id gnl|my_center|LOCUS_05590 43792 45108 gene locus_tag LOCUS_05600 43792 45108 CDS product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538642.1 protein_id gnl|my_center|LOCUS_05600 46142 45006 gene locus_tag LOCUS_05610 46142 45006 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153441684.1 protein_id gnl|my_center|LOCUS_05610 46526 46218 gene locus_tag LOCUS_05620 46526 46218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 46691 47215 gene locus_tag LOCUS_05630 46691 47215 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974190.1 protein_id gnl|my_center|LOCUS_05630 47439 47819 gene locus_tag LOCUS_05640 47439 47819 CDS product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259291.1 protein_id gnl|my_center|LOCUS_05640 48566 47832 gene locus_tag LOCUS_05650 48566 47832 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470656.1 protein_id gnl|my_center|LOCUS_05650 48860 49960 gene locus_tag LOCUS_05660 48860 49960 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389599.1 protein_id gnl|my_center|LOCUS_05660 50120 50668 gene locus_tag LOCUS_05670 50120 50668 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808109.1 protein_id gnl|my_center|LOCUS_05670 50665 52248 gene locus_tag LOCUS_05680 50665 52248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 52258 52677 gene locus_tag LOCUS_05690 52258 52677 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632023.1 protein_id gnl|my_center|LOCUS_05690 52674 53018 gene locus_tag LOCUS_05700 52674 53018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 53267 53617 gene locus_tag LOCUS_05710 53267 53617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 54599 53646 gene locus_tag LOCUS_05720 gene gshB 54599 53646 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391437.1 protein_id gnl|my_center|LOCUS_05720 55045 54728 gene locus_tag LOCUS_05730 55045 54728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 56091 55132 gene locus_tag LOCUS_05740 56091 55132 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037434787.1 protein_id gnl|my_center|LOCUS_05740 56484 56107 gene locus_tag LOCUS_05750 56484 56107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 56626 57615 gene locus_tag LOCUS_05760 gene rfaD 56626 57615 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391026.1 protein_id gnl|my_center|LOCUS_05760 58485 57649 gene locus_tag LOCUS_05770 gene fghA 58485 57649 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526232.1 protein_id gnl|my_center|LOCUS_05770 58888 60363 gene locus_tag LOCUS_05780 58888 60363 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390050.1 protein_id gnl|my_center|LOCUS_05780 60416 60892 gene locus_tag LOCUS_05790 60416 60892 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390049.1 protein_id gnl|my_center|LOCUS_05790 61732 61187 gene locus_tag LOCUS_05800 61732 61187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 61842 62294 gene locus_tag LOCUS_05810 61842 62294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 62380 64449 gene locus_tag LOCUS_05820 62380 64449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 65138 66730 gene locus_tag LOCUS_05830 65138 66730 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388213.1 protein_id gnl|my_center|LOCUS_05830 66817 69267 gene locus_tag LOCUS_05840 66817 69267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 69264 69899 gene locus_tag LOCUS_05850 69264 69899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 >Feature sequence067 61 1038 gene locus_tag LOCUS_05860 61 1038 CDS product IS1595 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042652447.1 protein_id gnl|my_center|LOCUS_05860 >Feature sequence068 962 6 gene locus_tag LOCUS_05870 962 6 CDS product IS1595-like element ISRsp21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076611897.1 protein_id gnl|my_center|LOCUS_05870 >Feature sequence069 >Feature sequence070 >Feature sequence071 242 427 gene locus_tag LOCUS_05880 242 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 602 847 gene locus_tag LOCUS_05890 602 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 >Feature sequence072 531 169 gene locus_tag LOCUS_05900 531 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 >Feature sequence073 206 772 gene locus_tag LOCUS_05910 206 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 >Feature sequence074 >Feature sequence075 283 77 gene locus_tag LOCUS_05920 283 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 >Feature sequence076 >Feature sequence077 479 1129 gene locus_tag LOCUS_05930 479 1129 CDS product histidine phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388278.1 protein_id gnl|my_center|LOCUS_05930 1419 4301 gene locus_tag LOCUS_05940 1419 4301 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388279.1 protein_id gnl|my_center|LOCUS_05940 6490 4730 gene locus_tag LOCUS_05950 gene leuA 6490 4730 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389681.1 protein_id gnl|my_center|LOCUS_05950 8782 7316 gene locus_tag LOCUS_05960 8782 7316 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164930.1 protein_id gnl|my_center|LOCUS_05960 10256 8982 gene locus_tag LOCUS_05970 10256 8982 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389421.1 protein_id gnl|my_center|LOCUS_05970 11562 10366 gene locus_tag LOCUS_05980 11562 10366 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387974.1 protein_id gnl|my_center|LOCUS_05980 12706 11699 gene locus_tag LOCUS_05990 gene gap 12706 11699 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387975.1 protein_id gnl|my_center|LOCUS_05990 13033 14613 gene locus_tag LOCUS_06000 13033 14613 CDS product polyphosphate--AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387976.1 protein_id gnl|my_center|LOCUS_06000 15224 15625 gene locus_tag LOCUS_06010 gene erpA 15224 15625 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389534.1 protein_id gnl|my_center|LOCUS_06010 15783 16511 gene locus_tag LOCUS_06020 15783 16511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 16745 18241 gene locus_tag LOCUS_06030 gene ccoG 16745 18241 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626568.1 protein_id gnl|my_center|LOCUS_06030 19454 18279 gene locus_tag LOCUS_06040 19454 18279 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402650.1 protein_id gnl|my_center|LOCUS_06040 21144 19792 gene locus_tag LOCUS_06050 21144 19792 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387996.1 protein_id gnl|my_center|LOCUS_06050 22173 21190 gene locus_tag LOCUS_06060 22173 21190 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389332.1 protein_id gnl|my_center|LOCUS_06060 22419 22967 gene locus_tag LOCUS_06070 22419 22967 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066380.1 protein_id gnl|my_center|LOCUS_06070 24401 23103 gene locus_tag LOCUS_06080 24401 23103 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389663.1 protein_id gnl|my_center|LOCUS_06080 25004 25549 gene locus_tag LOCUS_06090 25004 25549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 25542 25757 gene locus_tag LOCUS_06100 25542 25757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 25794 26009 gene locus_tag LOCUS_06110 25794 26009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 27811 26036 gene locus_tag LOCUS_06120 27811 26036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 28028 28423 gene locus_tag LOCUS_06130 gene apaG 28028 28423 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388023.1 protein_id gnl|my_center|LOCUS_06130 28639 29847 gene locus_tag LOCUS_06140 28639 29847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 30759 30010 gene locus_tag LOCUS_06150 30759 30010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 31103 32716 gene locus_tag LOCUS_06160 gene purH 31103 32716 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391402.1 protein_id gnl|my_center|LOCUS_06160 32954 33574 gene locus_tag LOCUS_06170 gene leuD 32954 33574 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528787.1 protein_id gnl|my_center|LOCUS_06170 34395 33634 gene locus_tag LOCUS_06180 34395 33634 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388500.1 protein_id gnl|my_center|LOCUS_06180 34662 35894 gene locus_tag LOCUS_06190 34662 35894 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388501.1 protein_id gnl|my_center|LOCUS_06190 35973 37046 gene locus_tag LOCUS_06200 35973 37046 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388502.1 protein_id gnl|my_center|LOCUS_06200 37046 39310 gene locus_tag LOCUS_06210 gene ptsP 37046 39310 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388503.1 protein_id gnl|my_center|LOCUS_06210 40168 39341 gene locus_tag LOCUS_06220 gene thiD 40168 39341 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388857.1 protein_id gnl|my_center|LOCUS_06220 40719 40333 gene locus_tag LOCUS_06230 40719 40333 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811007.1 protein_id gnl|my_center|LOCUS_06230 42075 41167 gene locus_tag LOCUS_06240 42075 41167 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090229.1 protein_id gnl|my_center|LOCUS_06240 43325 42156 gene locus_tag LOCUS_06250 43325 42156 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388860.1 protein_id gnl|my_center|LOCUS_06250 43494 44165 gene locus_tag LOCUS_06260 43494 44165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 44633 45583 gene locus_tag LOCUS_06270 44633 45583 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390694.1 protein_id gnl|my_center|LOCUS_06270 45580 47163 gene locus_tag LOCUS_06280 45580 47163 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389677.1 protein_id gnl|my_center|LOCUS_06280 47298 47945 gene locus_tag LOCUS_06290 47298 47945 CDS product acyloxyacyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390225.1 protein_id gnl|my_center|LOCUS_06290 49090 48152 gene locus_tag LOCUS_06300 49090 48152 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391136.1 protein_id gnl|my_center|LOCUS_06300 50522 49095 gene locus_tag LOCUS_06310 50522 49095 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391137.1 protein_id gnl|my_center|LOCUS_06310 50727 51776 gene locus_tag LOCUS_06320 gene holA 50727 51776 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391376.1 protein_id gnl|my_center|LOCUS_06320 52955 51783 gene locus_tag LOCUS_06330 52955 51783 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390122.1 protein_id gnl|my_center|LOCUS_06330 55600 53123 gene locus_tag LOCUS_06340 55600 53123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06340 56233 55814 gene locus_tag LOCUS_06350 56233 55814 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389344.1 protein_id gnl|my_center|LOCUS_06350 57675 56386 gene locus_tag LOCUS_06360 57675 56386 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389343.1 protein_id gnl|my_center|LOCUS_06360 59549 58161 gene locus_tag LOCUS_06370 59549 58161 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390042.1 protein_id gnl|my_center|LOCUS_06370 61404 59551 gene locus_tag LOCUS_06380 61404 59551 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390041.1 protein_id gnl|my_center|LOCUS_06380 61609 63417 gene locus_tag LOCUS_06390 61609 63417 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390040.1 protein_id gnl|my_center|LOCUS_06390 63813 64235 gene locus_tag LOCUS_06400 63813 64235 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173696.1 protein_id gnl|my_center|LOCUS_06400 64615 65154 gene locus_tag LOCUS_06410 64615 65154 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391244.1 protein_id gnl|my_center|LOCUS_06410 65151 65744 gene locus_tag LOCUS_06420 65151 65744 CDS product demethoxyubiquinone hydroxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391245.1 protein_id gnl|my_center|LOCUS_06420 65924 66652 gene locus_tag LOCUS_06430 65924 66652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 66845 67318 gene locus_tag LOCUS_06440 66845 67318 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391031.1 protein_id gnl|my_center|LOCUS_06440 67527 68351 gene locus_tag LOCUS_06450 gene cobA 67527 68351 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391109.1 protein_id gnl|my_center|LOCUS_06450 >Feature sequence078 >Feature sequence079 332 81 gene locus_tag LOCUS_06460 332 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 681 605 gene locus_tag LOCUS_t00120 681 605 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence080 >Feature sequence081 33 326 gene locus_tag LOCUS_06470 33 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036760858.1 protein_id gnl|my_center|LOCUS_06470 >Feature sequence082 96 620 gene locus_tag LOCUS_06480 96 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 >Feature sequence083 112 531 gene locus_tag LOCUS_06490 112 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 >Feature sequence084 134 616 gene locus_tag LOCUS_06500 134 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 >Feature sequence085 >Feature sequence086 164 553 gene locus_tag LOCUS_06510 164 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 >Feature sequence087 >Feature sequence088 1515 547 gene locus_tag LOCUS_06520 1515 547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 1630 2958 gene locus_tag LOCUS_06530 1630 2958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 2958 5051 gene locus_tag LOCUS_06540 2958 5051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 5253 5936 gene locus_tag LOCUS_06550 5253 5936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 5933 8803 gene locus_tag LOCUS_06560 5933 8803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 9052 9675 gene locus_tag LOCUS_06570 9052 9675 CDS product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194239.1 protein_id gnl|my_center|LOCUS_06570 9672 10295 gene locus_tag LOCUS_06580 9672 10295 CDS product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522113.1 protein_id gnl|my_center|LOCUS_06580 10288 12012 gene locus_tag LOCUS_06590 10288 12012 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522112.1 protein_id gnl|my_center|LOCUS_06590 12046 12726 gene locus_tag LOCUS_06600 12046 12726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 12933 12658 gene locus_tag LOCUS_06610 12933 12658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 13363 14577 gene locus_tag LOCUS_06620 13363 14577 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969594.1 protein_id gnl|my_center|LOCUS_06620 14574 15191 gene locus_tag LOCUS_06630 14574 15191 CDS product ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723885.1 protein_id gnl|my_center|LOCUS_06630 15188 16036 gene locus_tag LOCUS_06640 15188 16036 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311615.1 protein_id gnl|my_center|LOCUS_06640 16038 16958 gene locus_tag LOCUS_06650 16038 16958 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969591.1 protein_id gnl|my_center|LOCUS_06650 17080 18750 gene locus_tag LOCUS_06660 17080 18750 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969590.1 protein_id gnl|my_center|LOCUS_06660 18740 19687 gene locus_tag LOCUS_06670 18740 19687 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975888.1 protein_id gnl|my_center|LOCUS_06670 19772 21616 gene locus_tag LOCUS_06680 19772 21616 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311613.1 protein_id gnl|my_center|LOCUS_06680 21955 23025 gene locus_tag LOCUS_06690 21955 23025 CDS product putative urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613280.1 protein_id gnl|my_center|LOCUS_06690 23105 23932 gene locus_tag LOCUS_06700 23105 23932 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764735.1 protein_id gnl|my_center|LOCUS_06700 23929 24738 gene locus_tag LOCUS_06710 23929 24738 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268763.1 protein_id gnl|my_center|LOCUS_06710 25040 25702 gene locus_tag LOCUS_06720 25040 25702 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764729.1 protein_id gnl|my_center|LOCUS_06720 25725 26363 gene locus_tag LOCUS_06730 25725 26363 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096803.1 protein_id gnl|my_center|LOCUS_06730 26383 29982 gene locus_tag LOCUS_06740 gene uca 26383 29982 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140960.1 protein_id gnl|my_center|LOCUS_06740 29979 31727 gene locus_tag LOCUS_06750 gene atzF 29979 31727 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140963.1 protein_id gnl|my_center|LOCUS_06750 31960 33237 gene locus_tag LOCUS_06760 31960 33237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 33628 34734 gene locus_tag LOCUS_06770 33628 34734 CDS product 2-aminoethylphosphonate--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015456681.1 protein_id gnl|my_center|LOCUS_06770 34731 35561 gene locus_tag LOCUS_06780 34731 35561 CDS product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206428.1 protein_id gnl|my_center|LOCUS_06780 36185 35565 gene locus_tag LOCUS_06790 36185 35565 CDS product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966112.1 protein_id gnl|my_center|LOCUS_06790 36901 36182 gene locus_tag LOCUS_06800 gene phnL 36901 36182 CDS product phosphonate C-P lyase system protein PhnL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611426.1 protein_id gnl|my_center|LOCUS_06800 37701 36898 gene locus_tag LOCUS_06810 gene phnK 37701 36898 CDS product phosphonate C-P lyase system protein PhnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529518.1 protein_id gnl|my_center|LOCUS_06810 38633 37698 gene locus_tag LOCUS_06820 38633 37698 CDS product alpha-D-ribose 1-methylphosphonate 5-phosphate C-P-lyase PhnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969859.1 protein_id gnl|my_center|LOCUS_06820 39733 38630 gene locus_tag LOCUS_06830 39733 38630 CDS product carbon-phosphorus lyase complex subunit PhnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091786.1 protein_id gnl|my_center|LOCUS_06830 40357 39737 gene locus_tag LOCUS_06840 gene phnH 40357 39737 CDS product phosphonate C-P lyase system protein PhnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529523.1 protein_id gnl|my_center|LOCUS_06840 40833 40354 gene locus_tag LOCUS_06850 gene phnG 40833 40354 CDS product phosphonate C-P lyase system protein PhnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246944.1 protein_id gnl|my_center|LOCUS_06850 41308 40940 gene locus_tag LOCUS_06860 41308 40940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 41217 42041 gene locus_tag LOCUS_06870 gene phnC 41217 42041 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975699.1 protein_id gnl|my_center|LOCUS_06870 42137 43072 gene locus_tag LOCUS_06880 gene phnD 42137 43072 CDS product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061597.1 protein_id gnl|my_center|LOCUS_06880 43130 43303 gene locus_tag LOCUS_06890 43130 43303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 43350 44219 gene locus_tag LOCUS_06900 gene phnE 43350 44219 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061596.1 protein_id gnl|my_center|LOCUS_06900 44216 45586 gene locus_tag LOCUS_06910 gene phnE 44216 45586 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529512.1 protein_id gnl|my_center|LOCUS_06910 45731 45976 gene locus_tag LOCUS_06920 45731 45976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 46135 49158 gene locus_tag LOCUS_06930 46135 49158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 50653 49463 gene locus_tag LOCUS_06940 50653 49463 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391405.1 protein_id gnl|my_center|LOCUS_06940 52337 50664 gene locus_tag LOCUS_06950 52337 50664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 54414 52423 gene locus_tag LOCUS_06960 gene asnB 54414 52423 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957840.1 protein_id gnl|my_center|LOCUS_06960 55412 54414 gene locus_tag LOCUS_06970 gene gmd 55412 54414 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140765.1 protein_id gnl|my_center|LOCUS_06970 56560 55409 gene locus_tag LOCUS_06980 56560 55409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 57443 56553 gene locus_tag LOCUS_06990 57443 56553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 59299 57440 gene locus_tag LOCUS_07000 gene asnB 59299 57440 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387983.1 protein_id gnl|my_center|LOCUS_07000 60485 59301 gene locus_tag LOCUS_07010 60485 59301 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_07010 61492 60482 gene locus_tag LOCUS_07020 61492 60482 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545566.1 protein_id gnl|my_center|LOCUS_07020 62569 61553 gene locus_tag LOCUS_07030 gene galE 62569 61553 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338033.1 protein_id gnl|my_center|LOCUS_07030 63203 62610 gene locus_tag LOCUS_07040 63203 62610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 63969 63214 gene locus_tag LOCUS_07050 63969 63214 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922020.1 protein_id gnl|my_center|LOCUS_07050 64922 63999 gene locus_tag LOCUS_07060 64922 63999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 66319 65045 gene locus_tag LOCUS_07070 66319 65045 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257983.1 protein_id gnl|my_center|LOCUS_07070 68054 66339 gene locus_tag LOCUS_07080 68054 66339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 >Feature sequence089 248 12 gene locus_tag LOCUS_07090 248 12 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339468.1 protein_id gnl|my_center|LOCUS_07090 >Feature sequence090 >Feature sequence091 87 227 gene locus_tag LOCUS_07100 87 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 >Feature sequence092 >Feature sequence093 >Feature sequence094 408 13 gene locus_tag LOCUS_07110 408 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 >Feature sequence095 >Feature sequence096 >Feature sequence097 >Feature sequence098 2341 188 gene locus_tag LOCUS_07120 2341 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 4762 2378 gene locus_tag LOCUS_07130 4762 2378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 5420 4839 gene locus_tag LOCUS_07140 5420 4839 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175667.1 protein_id gnl|my_center|LOCUS_07140 5875 5552 gene locus_tag LOCUS_07150 5875 5552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 8308 6233 gene locus_tag LOCUS_07160 8308 6233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 9081 8755 gene locus_tag LOCUS_07170 9081 8755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 11256 9292 gene locus_tag LOCUS_07180 11256 9292 CDS product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390754.1 protein_id gnl|my_center|LOCUS_07180 12302 11565 gene locus_tag LOCUS_07190 12302 11565 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966750.1 protein_id gnl|my_center|LOCUS_07190 13369 12581 gene locus_tag LOCUS_07200 13369 12581 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966750.1 protein_id gnl|my_center|LOCUS_07200 14124 13366 gene locus_tag LOCUS_07210 14124 13366 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085970.1 protein_id gnl|my_center|LOCUS_07210 15302 14145 gene locus_tag LOCUS_07220 15302 14145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 16335 15307 gene locus_tag LOCUS_07230 16335 15307 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086816.1 protein_id gnl|my_center|LOCUS_07230 17940 16597 gene locus_tag LOCUS_07240 17940 16597 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869553.1 protein_id gnl|my_center|LOCUS_07240 18251 19789 gene locus_tag LOCUS_07250 18251 19789 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392126.1 protein_id gnl|my_center|LOCUS_07250 20271 19849 gene locus_tag LOCUS_07260 20271 19849 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081160608.1 protein_id gnl|my_center|LOCUS_07260 20522 20268 gene locus_tag LOCUS_07270 20522 20268 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101799467.1 protein_id gnl|my_center|LOCUS_07270 21220 20612 gene locus_tag LOCUS_07280 21220 20612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 22377 21217 gene locus_tag LOCUS_07290 22377 21217 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530160.1 protein_id gnl|my_center|LOCUS_07290 23699 22485 gene locus_tag LOCUS_07300 23699 22485 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388109.1 protein_id gnl|my_center|LOCUS_07300 24183 25289 gene locus_tag LOCUS_07310 gene recA 24183 25289 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390446.1 protein_id gnl|my_center|LOCUS_07310 27608 25314 gene locus_tag LOCUS_07320 gene rnr 27608 25314 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390951.1 protein_id gnl|my_center|LOCUS_07320 28441 27689 gene locus_tag LOCUS_07330 28441 27689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 31947 28582 gene locus_tag LOCUS_07340 31947 28582 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262580.1 protein_id gnl|my_center|LOCUS_07340 33128 31944 gene locus_tag LOCUS_07350 gene vmeJ 33128 31944 CDS product multidrug efflux RND transporter periplasmic adaptor subunit VmeJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479099.1 protein_id gnl|my_center|LOCUS_07350 33807 33223 gene locus_tag LOCUS_07360 33807 33223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 34206 34009 gene locus_tag LOCUS_07370 34206 34009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 34225 35112 gene locus_tag LOCUS_07380 34225 35112 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388317.1 protein_id gnl|my_center|LOCUS_07380 35422 35811 gene locus_tag LOCUS_07390 35422 35811 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891161.1 protein_id gnl|my_center|LOCUS_07390 35808 36125 gene locus_tag LOCUS_07400 35808 36125 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969960.1 protein_id gnl|my_center|LOCUS_07400 37244 36141 gene locus_tag LOCUS_07410 gene ychF 37244 36141 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391495.1 protein_id gnl|my_center|LOCUS_07410 37797 37378 gene locus_tag LOCUS_07420 37797 37378 CDS product DUF2267 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174839365.1 protein_id gnl|my_center|LOCUS_07420 40511 37869 gene locus_tag LOCUS_07430 40511 37869 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389549.1 protein_id gnl|my_center|LOCUS_07430 41284 40616 gene locus_tag LOCUS_07440 41284 40616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 42778 41363 gene locus_tag LOCUS_07450 42778 41363 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626249.1 protein_id gnl|my_center|LOCUS_07450 43058 42786 gene locus_tag LOCUS_07460 43058 42786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 43742 43089 gene locus_tag LOCUS_07470 43742 43089 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389552.1 protein_id gnl|my_center|LOCUS_07470 43981 44054 gene locus_tag LOCUS_t00130 43981 44054 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 44096 44170 gene locus_tag LOCUS_t00140 44096 44170 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 45077 44436 gene locus_tag LOCUS_07480 45077 44436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 45900 46523 gene locus_tag LOCUS_07490 45900 46523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 47847 46642 gene locus_tag LOCUS_07500 47847 46642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 47752 47949 gene locus_tag LOCUS_07510 47752 47949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 48278 48202 gene locus_tag LOCUS_t00150 48278 48202 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 48491 48405 gene locus_tag LOCUS_t00160 48491 48405 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 48648 49343 gene locus_tag LOCUS_07520 gene lipB 48648 49343 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389749.1 protein_id gnl|my_center|LOCUS_07520 49450 49947 gene locus_tag LOCUS_07530 49450 49947 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390315.1 protein_id gnl|my_center|LOCUS_07530 50691 50011 gene locus_tag LOCUS_07540 50691 50011 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390821.1 protein_id gnl|my_center|LOCUS_07540 52264 50807 gene locus_tag LOCUS_07550 52264 50807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 53454 52357 gene locus_tag LOCUS_07560 gene lptG 53454 52357 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390823.1 protein_id gnl|my_center|LOCUS_07560 53896 54684 gene locus_tag LOCUS_07570 53896 54684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 55125 57299 gene locus_tag LOCUS_07580 55125 57299 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388417.1 protein_id gnl|my_center|LOCUS_07580 57376 62244 gene locus_tag LOCUS_07590 57376 62244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 >Feature sequence099 29 105 gene locus_tag LOCUS_t00170 29 105 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence100 >Feature sequence101 207 76 gene locus_tag LOCUS_07600 207 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 >Feature sequence102 >Feature sequence103 >Feature sequence104 >Feature sequence105 603 304 gene locus_tag LOCUS_07610 603 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 2927 846 gene locus_tag LOCUS_07620 2927 846 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030113.1 protein_id gnl|my_center|LOCUS_07620 3030 7520 gene locus_tag LOCUS_07630 3030 7520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 7517 8386 gene locus_tag LOCUS_07640 7517 8386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 8383 9396 gene locus_tag LOCUS_07650 8383 9396 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921459.1 protein_id gnl|my_center|LOCUS_07650 9393 12128 gene locus_tag LOCUS_07660 9393 12128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 12125 12505 gene locus_tag LOCUS_07670 12125 12505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 13739 12396 gene locus_tag LOCUS_07680 13739 12396 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389246.1 protein_id gnl|my_center|LOCUS_07680 13916 14755 gene locus_tag LOCUS_07690 13916 14755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 14831 15061 gene locus_tag LOCUS_07700 14831 15061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 15068 16762 gene locus_tag LOCUS_07710 15068 16762 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388445.1 protein_id gnl|my_center|LOCUS_07710 16776 17051 gene locus_tag LOCUS_07720 16776 17051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 18966 17062 gene locus_tag LOCUS_07730 18966 17062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 19483 20226 gene locus_tag LOCUS_07740 19483 20226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 20606 21346 gene locus_tag LOCUS_07750 20606 21346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 21545 22456 gene locus_tag LOCUS_07760 21545 22456 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390704.1 protein_id gnl|my_center|LOCUS_07760 22460 24700 gene locus_tag LOCUS_07770 gene glyS 22460 24700 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390705.1 protein_id gnl|my_center|LOCUS_07770 24707 27391 gene locus_tag LOCUS_07780 gene ppdK 24707 27391 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390706.1 protein_id gnl|my_center|LOCUS_07780 27794 28477 gene locus_tag LOCUS_07790 27794 28477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 29755 28676 gene locus_tag LOCUS_07800 29755 28676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 31142 29949 gene locus_tag LOCUS_07810 31142 29949 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389758.1 protein_id gnl|my_center|LOCUS_07810 31332 32018 gene locus_tag LOCUS_07820 31332 32018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 32818 32105 gene locus_tag LOCUS_07830 32818 32105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 33968 33893 gene locus_tag LOCUS_t00180 33968 33893 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 34455 34066 gene locus_tag LOCUS_07840 34455 34066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 34919 35185 gene locus_tag LOCUS_07850 34919 35185 CDS product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933465.1 protein_id gnl|my_center|LOCUS_07850 35204 36967 gene locus_tag LOCUS_07860 35204 36967 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933466.1 protein_id gnl|my_center|LOCUS_07860 37139 39037 gene locus_tag LOCUS_07870 37139 39037 CDS product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720742.1 protein_id gnl|my_center|LOCUS_07870 39077 39766 gene locus_tag LOCUS_07880 39077 39766 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014261.1 protein_id gnl|my_center|LOCUS_07880 40072 39791 gene locus_tag LOCUS_07890 40072 39791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390703.1 protein_id gnl|my_center|LOCUS_07890 41286 40135 gene locus_tag LOCUS_07900 gene folP 41286 40135 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388854.1 protein_id gnl|my_center|LOCUS_07900 43304 41367 gene locus_tag LOCUS_07910 gene ftsH 43304 41367 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388853.1 protein_id gnl|my_center|LOCUS_07910 44748 43366 gene locus_tag LOCUS_07920 gene tilS 44748 43366 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388852.1 protein_id gnl|my_center|LOCUS_07920 45530 44742 gene locus_tag LOCUS_07930 gene ybgF 45530 44742 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388851.1 protein_id gnl|my_center|LOCUS_07930 46707 45721 gene locus_tag LOCUS_07940 46707 45721 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387819.1 protein_id gnl|my_center|LOCUS_07940 46970 47968 gene locus_tag LOCUS_07950 gene ispH 46970 47968 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470638.1 protein_id gnl|my_center|LOCUS_07950 48018 49238 gene locus_tag LOCUS_07960 gene hpnH 48018 49238 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387821.1 protein_id gnl|my_center|LOCUS_07960 50516 49461 gene locus_tag LOCUS_07970 50516 49461 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970722.1 protein_id gnl|my_center|LOCUS_07970 52017 50509 gene locus_tag LOCUS_07980 52017 50509 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098090.1 protein_id gnl|my_center|LOCUS_07980 52468 52028 gene locus_tag LOCUS_07990 52468 52028 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764744.1 protein_id gnl|my_center|LOCUS_07990 53548 52580 gene locus_tag LOCUS_08000 53548 52580 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085519.1 protein_id gnl|my_center|LOCUS_08000 54420 53740 gene locus_tag LOCUS_08010 54420 53740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 54913 54488 gene locus_tag LOCUS_08020 54913 54488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086291.1 protein_id gnl|my_center|LOCUS_08020 55526 56041 gene locus_tag LOCUS_08030 55526 56041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 56109 56585 gene locus_tag LOCUS_08040 gene soxY 56109 56585 CDS product thiosulfate oxidation carrier protein SoxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086296.1 protein_id gnl|my_center|LOCUS_08040 56662 56988 gene locus_tag LOCUS_08050 gene soxZ 56662 56988 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086297.1 protein_id gnl|my_center|LOCUS_08050 57188 58021 gene locus_tag LOCUS_08060 gene soxA 57188 58021 CDS product sulfur oxidation c-type cytochrome SoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086298.1 protein_id gnl|my_center|LOCUS_08060 58246 59883 gene locus_tag LOCUS_08070 gene soxB 58246 59883 CDS product thiosulfohydrolase SoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086299.1 protein_id gnl|my_center|LOCUS_08070 60058 60801 gene locus_tag LOCUS_08080 60058 60801 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531914.1 protein_id gnl|my_center|LOCUS_08080 61384 60833 gene locus_tag LOCUS_08090 61384 60833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 >Feature sequence106 140 325 gene locus_tag LOCUS_08100 140 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 1748 573 gene locus_tag LOCUS_08110 1748 573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 1958 2431 gene locus_tag LOCUS_08120 gene moaC 1958 2431 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390440.1 protein_id gnl|my_center|LOCUS_08120 4459 2480 gene locus_tag LOCUS_08130 4459 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153339851.1 protein_id gnl|my_center|LOCUS_08130 4619 4446 gene locus_tag LOCUS_08140 4619 4446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 4782 5378 gene locus_tag LOCUS_08150 4782 5378 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391487.1 protein_id gnl|my_center|LOCUS_08150 5375 6520 gene locus_tag LOCUS_08160 gene aroB 5375 6520 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391488.1 protein_id gnl|my_center|LOCUS_08160 6593 7864 gene locus_tag LOCUS_08170 6593 7864 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083018.1 protein_id gnl|my_center|LOCUS_08170 8373 8008 gene locus_tag LOCUS_08180 8373 8008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 9427 8621 gene locus_tag LOCUS_08190 gene trpC 9427 8621 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389650.1 protein_id gnl|my_center|LOCUS_08190 10473 9424 gene locus_tag LOCUS_08200 gene trpD 10473 9424 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389649.1 protein_id gnl|my_center|LOCUS_08200 11090 10473 gene locus_tag LOCUS_08210 11090 10473 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389648.1 protein_id gnl|my_center|LOCUS_08210 11252 11545 gene locus_tag LOCUS_08220 11252 11545 CDS product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226572031.1 protein_id gnl|my_center|LOCUS_08220 11636 13852 gene locus_tag LOCUS_08230 11636 13852 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389647.1 protein_id gnl|my_center|LOCUS_08230 14020 14397 gene locus_tag LOCUS_08240 14020 14397 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390365.1 protein_id gnl|my_center|LOCUS_08240 14776 15657 gene locus_tag LOCUS_08250 14776 15657 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390910.1 protein_id gnl|my_center|LOCUS_08250 15993 16991 gene locus_tag LOCUS_08260 gene trpS 15993 16991 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391282.1 protein_id gnl|my_center|LOCUS_08260 17884 17808 gene locus_tag LOCUS_t00190 17884 17808 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 18425 19072 gene locus_tag LOCUS_08270 gene cobO 18425 19072 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391114.1 protein_id gnl|my_center|LOCUS_08270 20130 19069 gene locus_tag LOCUS_08280 gene nudC 20130 19069 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338430.1 protein_id gnl|my_center|LOCUS_08280 20807 20118 gene locus_tag LOCUS_08290 20807 20118 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388406.1 protein_id gnl|my_center|LOCUS_08290 20935 21639 gene locus_tag LOCUS_08300 20935 21639 CDS product DUF6134 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388488.1 protein_id gnl|my_center|LOCUS_08300 21632 22474 gene locus_tag LOCUS_08310 21632 22474 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388487.1 protein_id gnl|my_center|LOCUS_08310 22471 22959 gene locus_tag LOCUS_08320 22471 22959 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388486.1 protein_id gnl|my_center|LOCUS_08320 23932 23327 gene locus_tag LOCUS_08330 23932 23327 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391391.1 protein_id gnl|my_center|LOCUS_08330 25020 24118 gene locus_tag LOCUS_08340 25020 24118 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388016.1 protein_id gnl|my_center|LOCUS_08340 26885 25017 gene locus_tag LOCUS_08350 26885 25017 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388017.1 protein_id gnl|my_center|LOCUS_08350 28771 27140 gene locus_tag LOCUS_08360 28771 27140 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388018.1 protein_id gnl|my_center|LOCUS_08360 29822 28965 gene locus_tag LOCUS_08370 29822 28965 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338042.1 protein_id gnl|my_center|LOCUS_08370 31309 29942 gene locus_tag LOCUS_08380 31309 29942 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085744.1 protein_id gnl|my_center|LOCUS_08380 31938 31390 gene locus_tag LOCUS_08390 31938 31390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 35324 32025 gene locus_tag LOCUS_08400 35324 32025 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404715.1 protein_id gnl|my_center|LOCUS_08400 36421 35324 gene locus_tag LOCUS_08410 36421 35324 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967177.1 protein_id gnl|my_center|LOCUS_08410 36526 36849 gene locus_tag LOCUS_08420 36526 36849 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349423.1 protein_id gnl|my_center|LOCUS_08420 36889 37095 gene locus_tag LOCUS_08430 36889 37095 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073000.1 protein_id gnl|my_center|LOCUS_08430 37867 37259 gene locus_tag LOCUS_08440 37867 37259 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388110.1 protein_id gnl|my_center|LOCUS_08440 38025 38444 gene locus_tag LOCUS_08450 38025 38444 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390955.1 protein_id gnl|my_center|LOCUS_08450 38597 38962 gene locus_tag LOCUS_08460 38597 38962 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626534.1 protein_id gnl|my_center|LOCUS_08460 40533 39076 gene locus_tag LOCUS_08470 40533 39076 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388201.1 protein_id gnl|my_center|LOCUS_08470 41510 40530 gene locus_tag LOCUS_08480 gene serB 41510 40530 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388224.1 protein_id gnl|my_center|LOCUS_08480 42251 41601 gene locus_tag LOCUS_08490 42251 41601 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530940.1 protein_id gnl|my_center|LOCUS_08490 43497 42277 gene locus_tag LOCUS_08500 43497 42277 CDS product DUF3419 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530941.1 protein_id gnl|my_center|LOCUS_08500 44425 43640 gene locus_tag LOCUS_08510 44425 43640 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626396.1 protein_id gnl|my_center|LOCUS_08510 44562 45272 gene locus_tag LOCUS_08520 44562 45272 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390260.1 protein_id gnl|my_center|LOCUS_08520 45358 46170 gene locus_tag LOCUS_08530 45358 46170 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003105.1 protein_id gnl|my_center|LOCUS_08530 46218 47417 gene locus_tag LOCUS_08540 gene alr 46218 47417 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388168.1 protein_id gnl|my_center|LOCUS_08540 47414 48187 gene locus_tag LOCUS_08550 47414 48187 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388167.1 protein_id gnl|my_center|LOCUS_08550 48459 49271 gene locus_tag LOCUS_08560 48459 49271 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388166.1 protein_id gnl|my_center|LOCUS_08560 49607 49840 gene locus_tag LOCUS_08570 49607 49840 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388465.1 protein_id gnl|my_center|LOCUS_08570 49965 51425 gene locus_tag LOCUS_08580 49965 51425 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387895.1 protein_id gnl|my_center|LOCUS_08580 51495 52166 gene locus_tag LOCUS_08590 51495 52166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 52213 53487 gene locus_tag LOCUS_08600 52213 53487 CDS product UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391454.1 protein_id gnl|my_center|LOCUS_08600 54031 53567 gene locus_tag LOCUS_08610 gene rlmH 54031 53567 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388990.1 protein_id gnl|my_center|LOCUS_08610 54397 54116 gene locus_tag LOCUS_08620 54397 54116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 55240 54596 gene locus_tag LOCUS_08630 55240 54596 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388992.1 protein_id gnl|my_center|LOCUS_08630 56778 55258 gene locus_tag LOCUS_08640 56778 55258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 57492 56953 gene locus_tag LOCUS_08650 57492 56953 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962480.1 protein_id gnl|my_center|LOCUS_08650 58688 57489 gene locus_tag LOCUS_08660 58688 57489 CDS product geranylgeranyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720441.1 protein_id gnl|my_center|LOCUS_08660 60206 58773 gene locus_tag LOCUS_08670 60206 58773 CDS product BCD family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388386.1 protein_id gnl|my_center|LOCUS_08670 61120 60203 gene locus_tag LOCUS_08680 gene chlG 61120 60203 CDS product chlorophyll synthase ChlG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388385.1 protein_id gnl|my_center|LOCUS_08680 62685 61237 gene locus_tag LOCUS_08690 gene ppsR 62685 61237 CDS product transcriptional regulator PpsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388384.1 protein_id gnl|my_center|LOCUS_08690 63550 62759 gene locus_tag LOCUS_08700 63550 62759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 64317 64940 gene locus_tag LOCUS_08710 gene bchF 64317 64940 CDS product 2-vinyl bacteriochlorophyllide hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388382.1 protein_id gnl|my_center|LOCUS_08710 64937 66274 gene locus_tag LOCUS_08720 64937 66274 CDS product ferredoxin:protochlorophyllide reductase (ATP-dependent) subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388381.1 protein_id gnl|my_center|LOCUS_08720 66279 67985 gene locus_tag LOCUS_08730 gene bchB 66279 67985 CDS product ferredoxin:protochlorophyllide reductase (ATP-dependent) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388380.1 protein_id gnl|my_center|LOCUS_08730 67960 71736 gene locus_tag LOCUS_08740 67960 71736 CDS product magnesium chelatase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388379.1 protein_id gnl|my_center|LOCUS_08740 71774 72691 gene locus_tag LOCUS_08750 gene bchL 71774 72691 CDS product ferredoxin:protochlorophyllide reductase (ATP-dependent) iron-sulfur ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388378.1 protein_id gnl|my_center|LOCUS_08750 72691 73392 gene locus_tag LOCUS_08760 gene bchM 72691 73392 CDS product magnesium protoporphyrin IX methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388377.1 protein_id gnl|my_center|LOCUS_08760 73389 74903 gene locus_tag LOCUS_08770 73389 74903 CDS product BCD family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388376.1 protein_id gnl|my_center|LOCUS_08770 74929 75687 gene locus_tag LOCUS_08780 gene puhA 74929 75687 CDS product photosynthetic reaction center subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388375.1 protein_id gnl|my_center|LOCUS_08780 75931 76614 gene locus_tag LOCUS_08790 gene puhB 75931 76614 CDS product photosynthetic complex putative assembly protein PuhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338128.1 protein_id gnl|my_center|LOCUS_08790 76759 77364 gene locus_tag LOCUS_08800 76759 77364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 77564 79474 gene locus_tag LOCUS_08810 77564 79474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 79575 80276 gene locus_tag LOCUS_08820 gene bchJ 79575 80276 CDS product bacteriochlorophyll 4-vinyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388371.1 protein_id gnl|my_center|LOCUS_08820 80317 81834 gene locus_tag LOCUS_08830 80317 81834 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390980.1 protein_id gnl|my_center|LOCUS_08830 82218 82787 gene locus_tag LOCUS_08840 82218 82787 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064347.1 protein_id gnl|my_center|LOCUS_08840 82784 84355 gene locus_tag LOCUS_08850 82784 84355 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064348.1 protein_id gnl|my_center|LOCUS_08850 84393 87185 gene locus_tag LOCUS_08860 gene fdhF 84393 87185 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726709.1 protein_id gnl|my_center|LOCUS_08860 87257 88375 gene locus_tag LOCUS_08870 87257 88375 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384817.1 protein_id gnl|my_center|LOCUS_08870 88530 89312 gene locus_tag LOCUS_08880 gene fdhD 88530 89312 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085919.1 protein_id gnl|my_center|LOCUS_08880 89688 89302 gene locus_tag LOCUS_08890 89688 89302 CDS product flagellar basal body protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085958.1 protein_id gnl|my_center|LOCUS_08890 90018 89788 gene locus_tag LOCUS_08900 90018 89788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 90124 91083 gene locus_tag LOCUS_08910 gene miaA 90124 91083 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388225.1 protein_id gnl|my_center|LOCUS_08910 91191 92948 gene locus_tag LOCUS_08920 91191 92948 CDS product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388226.1 protein_id gnl|my_center|LOCUS_08920 93031 93555 gene locus_tag LOCUS_08930 gene ilvN 93031 93555 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388227.1 protein_id gnl|my_center|LOCUS_08930 93667 94686 gene locus_tag LOCUS_08940 gene ilvC 93667 94686 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388228.1 protein_id gnl|my_center|LOCUS_08940 95070 95801 gene locus_tag LOCUS_08950 95070 95801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 96198 95851 gene locus_tag LOCUS_08960 96198 95851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 96573 96334 gene locus_tag LOCUS_08970 96573 96334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 96874 97830 gene locus_tag LOCUS_08980 96874 97830 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088212.1 protein_id gnl|my_center|LOCUS_08980 99621 97963 gene locus_tag LOCUS_08990 99621 97963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 100997 99618 gene locus_tag LOCUS_09000 100997 99618 CDS product YcjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483259.1 protein_id gnl|my_center|LOCUS_09000 101727 101128 gene locus_tag LOCUS_09010 101727 101128 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114828.1 protein_id gnl|my_center|LOCUS_09010 101856 103652 gene locus_tag LOCUS_09020 101856 103652 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478911.1 protein_id gnl|my_center|LOCUS_09020 103649 104308 gene locus_tag LOCUS_09030 103649 104308 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338060.1 protein_id gnl|my_center|LOCUS_09030 104770 106293 gene locus_tag LOCUS_09040 104770 106293 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389680.1 protein_id gnl|my_center|LOCUS_09040 106401 106760 gene locus_tag LOCUS_09050 106401 106760 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339218.1 protein_id gnl|my_center|LOCUS_09050 106757 107464 gene locus_tag LOCUS_09060 106757 107464 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258956.1 protein_id gnl|my_center|LOCUS_09060 107576 107989 gene locus_tag LOCUS_09070 107576 107989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 108117 108536 gene locus_tag LOCUS_09080 108117 108536 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958154.1 protein_id gnl|my_center|LOCUS_09080 108751 109923 gene locus_tag LOCUS_09090 108751 109923 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970159.1 protein_id gnl|my_center|LOCUS_09090 110017 111600 gene locus_tag LOCUS_09100 gene serA 110017 111600 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090136.1 protein_id gnl|my_center|LOCUS_09100 111937 112647 gene locus_tag LOCUS_09110 111937 112647 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461004.1 protein_id gnl|my_center|LOCUS_09110 113138 112671 gene locus_tag LOCUS_09120 113138 112671 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339163.1 protein_id gnl|my_center|LOCUS_09120 114564 113188 gene locus_tag LOCUS_09130 gene trmFO 114564 113188 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389510.1 protein_id gnl|my_center|LOCUS_09130 114857 115336 gene locus_tag LOCUS_09140 114857 115336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 115878 115414 gene locus_tag LOCUS_09150 gene dksA 115878 115414 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390474.1 protein_id gnl|my_center|LOCUS_09150 116561 116079 gene locus_tag LOCUS_09160 116561 116079 CDS product flagellar assembly protein FliX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390475.1 protein_id gnl|my_center|LOCUS_09160 117111 118247 gene locus_tag LOCUS_09170 117111 118247 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390476.1 protein_id gnl|my_center|LOCUS_09170 118249 118587 gene locus_tag LOCUS_09180 118249 118587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 118632 119510 gene locus_tag LOCUS_09190 118632 119510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 119571 121769 gene locus_tag LOCUS_09200 gene flgK 119571 121769 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390479.1 protein_id gnl|my_center|LOCUS_09200 121879 123384 gene locus_tag LOCUS_09210 121879 123384 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390480.1 protein_id gnl|my_center|LOCUS_09210 124890 123439 gene locus_tag LOCUS_09220 124890 123439 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389832.1 protein_id gnl|my_center|LOCUS_09220 124781 125011 gene locus_tag LOCUS_09230 124781 125011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 125312 125055 gene locus_tag LOCUS_09240 125312 125055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 125223 126062 gene locus_tag LOCUS_09250 125223 126062 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200941.1 protein_id gnl|my_center|LOCUS_09250 126783 126214 gene locus_tag LOCUS_09260 126783 126214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 127349 126810 gene locus_tag LOCUS_09270 gene mopJ 127349 126810 CDS product motility/cell cycle regulatory protein MopJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265646.1 protein_id gnl|my_center|LOCUS_09270 128671 127502 gene locus_tag LOCUS_09280 128671 127502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 128894 130231 gene locus_tag LOCUS_09290 128894 130231 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946411.1 protein_id gnl|my_center|LOCUS_09290 130328 130825 gene locus_tag LOCUS_09300 130328 130825 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053808215.1 protein_id gnl|my_center|LOCUS_09300 130979 131782 gene locus_tag LOCUS_09310 130979 131782 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389905.1 protein_id gnl|my_center|LOCUS_09310 131845 132618 gene locus_tag LOCUS_09320 131845 132618 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096156.1 protein_id gnl|my_center|LOCUS_09320 132911 133687 gene locus_tag LOCUS_09330 132911 133687 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003342249.1 protein_id gnl|my_center|LOCUS_09330 133684 134412 gene locus_tag LOCUS_09340 133684 134412 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383265.1 protein_id gnl|my_center|LOCUS_09340 134684 135046 gene locus_tag LOCUS_09350 134684 135046 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667012.1 protein_id gnl|my_center|LOCUS_09350 135898 135086 gene locus_tag LOCUS_09360 135898 135086 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532775.1 protein_id gnl|my_center|LOCUS_09360 136482 135928 gene locus_tag LOCUS_09370 136482 135928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 138122 136479 gene locus_tag LOCUS_09380 gene ctaD 138122 136479 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083990.1 protein_id gnl|my_center|LOCUS_09380 139041 138166 gene locus_tag LOCUS_09390 139041 138166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 139707 140147 gene locus_tag LOCUS_09400 139707 140147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 140398 141270 gene locus_tag LOCUS_09410 140398 141270 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532778.1 protein_id gnl|my_center|LOCUS_09410 141275 142375 gene locus_tag LOCUS_09420 141275 142375 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975052.1 protein_id gnl|my_center|LOCUS_09420 142522 143826 gene locus_tag LOCUS_09430 142522 143826 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390624.1 protein_id gnl|my_center|LOCUS_09430 143848 144351 gene locus_tag LOCUS_09440 143848 144351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 144439 145578 gene locus_tag LOCUS_09450 144439 145578 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390623.1 protein_id gnl|my_center|LOCUS_09450 145831 146742 gene locus_tag LOCUS_09460 145831 146742 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938014.1 protein_id gnl|my_center|LOCUS_09460 146735 147784 gene locus_tag LOCUS_09470 146735 147784 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948215.1 protein_id gnl|my_center|LOCUS_09470 147781 148539 gene locus_tag LOCUS_09480 147781 148539 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938016.1 protein_id gnl|my_center|LOCUS_09480 148536 149249 gene locus_tag LOCUS_09490 148536 149249 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525180.1 protein_id gnl|my_center|LOCUS_09490 149645 150049 gene locus_tag LOCUS_09500 149645 150049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 150121 150846 gene locus_tag LOCUS_09510 150121 150846 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390994.1 protein_id gnl|my_center|LOCUS_09510 150941 151165 gene locus_tag LOCUS_09520 150941 151165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 151419 151910 gene locus_tag LOCUS_09530 151419 151910 CDS product ATP synthase subunit b 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390992.1 protein_id gnl|my_center|LOCUS_09530 151910 152458 gene locus_tag LOCUS_09540 151910 152458 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390991.1 protein_id gnl|my_center|LOCUS_09540 154078 152543 gene locus_tag LOCUS_09550 154078 152543 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815305.1 protein_id gnl|my_center|LOCUS_09550 155117 154071 gene locus_tag LOCUS_09560 155117 154071 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225688.1 protein_id gnl|my_center|LOCUS_09560 155278 156930 gene locus_tag LOCUS_09570 155278 156930 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389348.1 protein_id gnl|my_center|LOCUS_09570 156927 158168 gene locus_tag LOCUS_09580 156927 158168 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972257.1 protein_id gnl|my_center|LOCUS_09580 159550 158579 gene locus_tag LOCUS_09590 159550 158579 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389568.1 protein_id gnl|my_center|LOCUS_09590 159641 160564 gene locus_tag LOCUS_09600 159641 160564 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812339.1 protein_id gnl|my_center|LOCUS_09600 160622 161329 gene locus_tag LOCUS_09610 160622 161329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 161459 162598 gene locus_tag LOCUS_09620 161459 162598 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389588.1 protein_id gnl|my_center|LOCUS_09620 162741 163712 gene locus_tag LOCUS_09630 162741 163712 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389587.1 protein_id gnl|my_center|LOCUS_09630 163827 164729 gene locus_tag LOCUS_09640 gene mmsB 163827 164729 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389586.1 protein_id gnl|my_center|LOCUS_09640 164737 165642 gene locus_tag LOCUS_09650 gene mmsB 164737 165642 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389586.1 protein_id gnl|my_center|LOCUS_09650 165692 165898 gene locus_tag LOCUS_09660 165692 165898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 166372 165944 gene locus_tag LOCUS_09670 166372 165944 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389582.1 protein_id gnl|my_center|LOCUS_09670 167051 167650 gene locus_tag LOCUS_09680 167051 167650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 167718 169013 gene locus_tag LOCUS_09690 167718 169013 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389580.1 protein_id gnl|my_center|LOCUS_09690 169017 169475 gene locus_tag LOCUS_09700 gene nrdR 169017 169475 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389579.1 protein_id gnl|my_center|LOCUS_09700 169512 170672 gene locus_tag LOCUS_09710 gene ribD 169512 170672 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389578.1 protein_id gnl|my_center|LOCUS_09710 170688 171278 gene locus_tag LOCUS_09720 170688 171278 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389577.1 protein_id gnl|my_center|LOCUS_09720 171275 172441 gene locus_tag LOCUS_09730 gene ribB 171275 172441 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389576.1 protein_id gnl|my_center|LOCUS_09730 172438 172899 gene locus_tag LOCUS_09740 172438 172899 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389575.1 protein_id gnl|my_center|LOCUS_09740 172955 173464 gene locus_tag LOCUS_09750 gene nusB 172955 173464 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389574.1 protein_id gnl|my_center|LOCUS_09750 173493 174479 gene locus_tag LOCUS_09760 gene thiL 173493 174479 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389573.1 protein_id gnl|my_center|LOCUS_09760 174510 175013 gene locus_tag LOCUS_09770 174510 175013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 175204 175016 gene locus_tag LOCUS_09780 175204 175016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 175244 177364 gene locus_tag LOCUS_09790 175244 177364 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389571.1 protein_id gnl|my_center|LOCUS_09790 178832 177501 gene locus_tag LOCUS_09800 178832 177501 CDS product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000967516.1 protein_id gnl|my_center|LOCUS_09800 179212 178922 gene locus_tag LOCUS_09810 179212 178922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 179136 180875 gene locus_tag LOCUS_09820 179136 180875 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387925.1 protein_id gnl|my_center|LOCUS_09820 181516 180872 gene locus_tag LOCUS_09830 181516 180872 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389730.1 protein_id gnl|my_center|LOCUS_09830 183407 181521 gene locus_tag LOCUS_09840 183407 181521 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389731.1 protein_id gnl|my_center|LOCUS_09840 183799 184653 gene locus_tag LOCUS_09850 183799 184653 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171057.1 protein_id gnl|my_center|LOCUS_09850 184731 185765 gene locus_tag LOCUS_09860 gene dctP 184731 185765 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065227.1 protein_id gnl|my_center|LOCUS_09860 186118 186726 gene locus_tag LOCUS_09870 186118 186726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 186728 188056 gene locus_tag LOCUS_09880 186728 188056 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172863.1 protein_id gnl|my_center|LOCUS_09880 188068 189219 gene locus_tag LOCUS_09890 gene dgoD 188068 189219 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975371.1 protein_id gnl|my_center|LOCUS_09890 189213 189866 gene locus_tag LOCUS_09900 189213 189866 CDS product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528597.1 protein_id gnl|my_center|LOCUS_09900 190617 190186 gene locus_tag LOCUS_09910 190617 190186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 191116 192363 gene locus_tag LOCUS_09920 191116 192363 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974900.1 protein_id gnl|my_center|LOCUS_09920 192715 192431 gene locus_tag LOCUS_09930 192715 192431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 193277 192702 gene locus_tag LOCUS_09940 193277 192702 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391502.1 protein_id gnl|my_center|LOCUS_09940 194518 193403 gene locus_tag LOCUS_09950 194518 193403 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041669547.1 protein_id gnl|my_center|LOCUS_09950 196244 194553 gene locus_tag LOCUS_09960 196244 194553 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389287.1 protein_id gnl|my_center|LOCUS_09960 196493 196975 gene locus_tag LOCUS_09970 196493 196975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 197216 197581 gene locus_tag LOCUS_09980 197216 197581 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389430.1 protein_id gnl|my_center|LOCUS_09980 197578 198129 gene locus_tag LOCUS_09990 197578 198129 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389431.1 protein_id gnl|my_center|LOCUS_09990 198245 198889 gene locus_tag LOCUS_10000 198245 198889 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389432.1 protein_id gnl|my_center|LOCUS_10000 198929 200107 gene locus_tag LOCUS_10010 198929 200107 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389433.1 protein_id gnl|my_center|LOCUS_10010 200104 200778 gene locus_tag LOCUS_10020 200104 200778 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389434.1 protein_id gnl|my_center|LOCUS_10020 200792 202096 gene locus_tag LOCUS_10030 gene nuoF 200792 202096 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389435.1 protein_id gnl|my_center|LOCUS_10030 202137 204230 gene locus_tag LOCUS_10040 gene nuoG 202137 204230 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389436.1 protein_id gnl|my_center|LOCUS_10040 204223 205236 gene locus_tag LOCUS_10050 gene nuoH 204223 205236 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389437.1 protein_id gnl|my_center|LOCUS_10050 205272 205760 gene locus_tag LOCUS_10060 gene nuoI 205272 205760 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389438.1 protein_id gnl|my_center|LOCUS_10060 205972 206583 gene locus_tag LOCUS_10070 205972 206583 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389439.1 protein_id gnl|my_center|LOCUS_10070 206585 206896 gene locus_tag LOCUS_10080 gene nuoK 206585 206896 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389440.1 protein_id gnl|my_center|LOCUS_10080 206906 208987 gene locus_tag LOCUS_10090 206906 208987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 209095 210615 gene locus_tag LOCUS_10100 209095 210615 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389442.1 protein_id gnl|my_center|LOCUS_10100 210693 212135 gene locus_tag LOCUS_10110 gene nuoN 210693 212135 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389443.1 protein_id gnl|my_center|LOCUS_10110 212132 212980 gene locus_tag LOCUS_10120 212132 212980 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389444.1 protein_id gnl|my_center|LOCUS_10120 212984 213787 gene locus_tag LOCUS_10130 212984 213787 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389445.1 protein_id gnl|my_center|LOCUS_10130 213812 215488 gene locus_tag LOCUS_10140 213812 215488 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389446.1 protein_id gnl|my_center|LOCUS_10140 215557 215961 gene locus_tag LOCUS_10150 gene mce 215557 215961 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389447.1 protein_id gnl|my_center|LOCUS_10150 215985 216521 gene locus_tag LOCUS_10160 215985 216521 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389448.1 protein_id gnl|my_center|LOCUS_10160 216795 218603 gene locus_tag LOCUS_10170 216795 218603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 219465 218728 gene locus_tag LOCUS_10180 219465 218728 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391090.1 protein_id gnl|my_center|LOCUS_10180 220388 219588 gene locus_tag LOCUS_10190 220388 219588 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391124.1 protein_id gnl|my_center|LOCUS_10190 220488 221672 gene locus_tag LOCUS_10200 220488 221672 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470668.1 protein_id gnl|my_center|LOCUS_10200 221911 222912 gene locus_tag LOCUS_10210 221911 222912 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391122.1 protein_id gnl|my_center|LOCUS_10210 223329 224939 gene locus_tag LOCUS_10220 223329 224939 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704939.1 protein_id gnl|my_center|LOCUS_10220 225481 224861 gene locus_tag LOCUS_10230 225481 224861 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533965.1 protein_id gnl|my_center|LOCUS_10230 226254 225481 gene locus_tag LOCUS_10240 226254 225481 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957681.1 protein_id gnl|my_center|LOCUS_10240 226546 228453 gene locus_tag LOCUS_10250 226546 228453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 228450 228917 gene locus_tag LOCUS_10260 228450 228917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 229491 228952 gene locus_tag LOCUS_10270 229491 228952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387973.1 protein_id gnl|my_center|LOCUS_10270 229786 230133 gene locus_tag LOCUS_10280 229786 230133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 230526 230212 gene locus_tag LOCUS_10290 230526 230212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 232627 230825 gene locus_tag LOCUS_10300 gene lepA 232627 230825 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626581.1 protein_id gnl|my_center|LOCUS_10300 235131 232756 gene locus_tag LOCUS_10310 235131 232756 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388952.1 protein_id gnl|my_center|LOCUS_10310 235977 235324 gene locus_tag LOCUS_10320 235977 235324 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390941.1 protein_id gnl|my_center|LOCUS_10320 237336 236071 gene locus_tag LOCUS_10330 237336 236071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 240584 237393 gene locus_tag LOCUS_10340 240584 237393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 242045 241035 gene locus_tag LOCUS_10350 242045 241035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 243626 242121 gene locus_tag LOCUS_10360 243626 242121 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391128.1 protein_id gnl|my_center|LOCUS_10360 244686 243616 gene locus_tag LOCUS_10370 244686 243616 CDS product lipid-binding SYLF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391127.1 protein_id gnl|my_center|LOCUS_10370 244932 245423 gene locus_tag LOCUS_10380 244932 245423 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525883.1 protein_id gnl|my_center|LOCUS_10380 246016 245489 gene locus_tag LOCUS_10390 246016 245489 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112472.1 protein_id gnl|my_center|LOCUS_10390 246451 247935 gene locus_tag LOCUS_10400 246451 247935 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530323.1 protein_id gnl|my_center|LOCUS_10400 248016 249392 gene locus_tag LOCUS_10410 248016 249392 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975296.1 protein_id gnl|my_center|LOCUS_10410 250131 249688 gene locus_tag LOCUS_10420 250131 249688 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227162.1 protein_id gnl|my_center|LOCUS_10420 251502 250222 gene locus_tag LOCUS_10430 251502 250222 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461221.1 protein_id gnl|my_center|LOCUS_10430 252123 251515 gene locus_tag LOCUS_10440 252123 251515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 253295 252264 gene locus_tag LOCUS_10450 253295 252264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 253183 253599 gene locus_tag LOCUS_10460 253183 253599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 253908 254708 gene locus_tag LOCUS_10470 gene eutA 253908 254708 CDS product ectoine utilization protein EutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530330.1 protein_id gnl|my_center|LOCUS_10470 254708 255694 gene locus_tag LOCUS_10480 gene eutB 254708 255694 CDS product hydroxyectoine utilization dehydratase EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167355184.1 protein_id gnl|my_center|LOCUS_10480 255808 256803 gene locus_tag LOCUS_10490 gene eutC 255808 256803 CDS product ectoine utilization protein EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975301.1 protein_id gnl|my_center|LOCUS_10490 256814 257998 gene locus_tag LOCUS_10500 gene doeA 256814 257998 CDS product ectoine hydrolase DoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974131.1 protein_id gnl|my_center|LOCUS_10500 258048 259103 gene locus_tag LOCUS_10510 gene doeB 258048 259103 CDS product N(2)-acetyl-L-2,4-diaminobutanoate deacetylase DoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974130.1 protein_id gnl|my_center|LOCUS_10510 259848 259126 gene locus_tag LOCUS_10520 259848 259126 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337856.1 protein_id gnl|my_center|LOCUS_10520 261238 259862 gene locus_tag LOCUS_10530 261238 259862 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140219.1 protein_id gnl|my_center|LOCUS_10530 261399 262625 gene locus_tag LOCUS_10540 gene hutI 261399 262625 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242190.1 protein_id gnl|my_center|LOCUS_10540 262622 264181 gene locus_tag LOCUS_10550 gene hutH 262622 264181 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337859.1 protein_id gnl|my_center|LOCUS_10550 264178 264996 gene locus_tag LOCUS_10560 gene hutG 264178 264996 CDS product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391667.1 protein_id gnl|my_center|LOCUS_10560 >Feature sequence107 >Feature sequence108 >Feature sequence109 >Feature sequence110 <1 794 gene locus_tag LOCUS_10570 <1 794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389048.1:methyl-accepting chemotaxis protein 1524 3761 gene locus_tag LOCUS_10580 1524 3761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 4726 7464 gene locus_tag LOCUS_10590 4726 7464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 7720 10398 gene locus_tag LOCUS_10600 7720 10398 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389996.1 protein_id gnl|my_center|LOCUS_10600 11604 10399 gene locus_tag LOCUS_10610 11604 10399 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391721.1 protein_id gnl|my_center|LOCUS_10610 13222 11738 gene locus_tag LOCUS_10620 13222 11738 CDS product bifunctional enoyl-CoA hydratase/phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389222.1 protein_id gnl|my_center|LOCUS_10620 15408 13420 gene locus_tag LOCUS_10630 15408 13420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 15629 16060 gene locus_tag LOCUS_10640 15629 16060 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390712.1 protein_id gnl|my_center|LOCUS_10640 16264 16458 gene locus_tag LOCUS_10650 16264 16458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 16830 16492 gene locus_tag LOCUS_10660 16830 16492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 17044 16820 gene locus_tag LOCUS_10670 17044 16820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 17302 19173 gene locus_tag LOCUS_10680 17302 19173 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388875.1 protein_id gnl|my_center|LOCUS_10680 19189 19461 gene locus_tag LOCUS_10690 19189 19461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 19694 20644 gene locus_tag LOCUS_10700 19694 20644 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390713.1 protein_id gnl|my_center|LOCUS_10700 20648 23470 gene locus_tag LOCUS_10710 gene ileS 20648 23470 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390714.1 protein_id gnl|my_center|LOCUS_10710 23470 23982 gene locus_tag LOCUS_10720 gene lspA 23470 23982 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390715.1 protein_id gnl|my_center|LOCUS_10720 24006 24572 gene locus_tag LOCUS_10730 24006 24572 CDS product DUF3035 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390716.1 protein_id gnl|my_center|LOCUS_10730 24643 24984 gene locus_tag LOCUS_10740 24643 24984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 28367 26304 gene locus_tag LOCUS_10750 gene pbpC 28367 26304 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387866.1 protein_id gnl|my_center|LOCUS_10750 28720 28415 gene locus_tag LOCUS_10760 28720 28415 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390404.1 protein_id gnl|my_center|LOCUS_10760 28802 29503 gene locus_tag LOCUS_10770 28802 29503 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390405.1 protein_id gnl|my_center|LOCUS_10770 29652 30431 gene locus_tag LOCUS_10780 gene radC 29652 30431 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388490.1 protein_id gnl|my_center|LOCUS_10780 30502 31236 gene locus_tag LOCUS_10790 30502 31236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 31923 31264 gene locus_tag LOCUS_10800 31923 31264 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626628.1 protein_id gnl|my_center|LOCUS_10800 31966 32670 gene locus_tag LOCUS_10810 31966 32670 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626629.1 protein_id gnl|my_center|LOCUS_10810 32782 34935 gene locus_tag LOCUS_10820 32782 34935 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149560769.1 protein_id gnl|my_center|LOCUS_10820 36154 34997 gene locus_tag LOCUS_10830 36154 34997 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976258.1 protein_id gnl|my_center|LOCUS_10830 37542 36160 gene locus_tag LOCUS_10840 37542 36160 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337399.1 protein_id gnl|my_center|LOCUS_10840 41293 37742 gene locus_tag LOCUS_10850 41293 37742 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388324.1 protein_id gnl|my_center|LOCUS_10850 41704 42909 gene locus_tag LOCUS_10860 41704 42909 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093049.1 protein_id gnl|my_center|LOCUS_10860 43006 43494 gene locus_tag LOCUS_10870 gene msrA 43006 43494 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060839.1 protein_id gnl|my_center|LOCUS_10870 43632 44624 gene locus_tag LOCUS_10880 43632 44624 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390376.1 protein_id gnl|my_center|LOCUS_10880 45201 44650 gene locus_tag LOCUS_10890 45201 44650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 45540 46700 gene locus_tag LOCUS_10900 45540 46700 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815015.1 protein_id gnl|my_center|LOCUS_10900 46957 47823 gene locus_tag LOCUS_10910 46957 47823 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083884.1 protein_id gnl|my_center|LOCUS_10910 47816 48847 gene locus_tag LOCUS_10920 47816 48847 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083885.1 protein_id gnl|my_center|LOCUS_10920 48844 49617 gene locus_tag LOCUS_10930 48844 49617 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083886.1 protein_id gnl|my_center|LOCUS_10930 49602 50318 gene locus_tag LOCUS_10940 49602 50318 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083887.1 protein_id gnl|my_center|LOCUS_10940 53035 50330 gene locus_tag LOCUS_10950 53035 50330 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338040.1 protein_id gnl|my_center|LOCUS_10950 53337 53035 gene locus_tag LOCUS_10960 53337 53035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 53705 53334 gene locus_tag LOCUS_10970 53705 53334 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720317.1 protein_id gnl|my_center|LOCUS_10970 54677 53763 gene locus_tag LOCUS_10980 54677 53763 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266520.1 protein_id gnl|my_center|LOCUS_10980 56446 54932 gene locus_tag LOCUS_10990 gene gcvPB 56446 54932 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390796.1 protein_id gnl|my_center|LOCUS_10990 57798 56443 gene locus_tag LOCUS_11000 gene gcvPA 57798 56443 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390797.1 protein_id gnl|my_center|LOCUS_11000 58333 57956 gene locus_tag LOCUS_11010 gene gcvH 58333 57956 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390798.1 protein_id gnl|my_center|LOCUS_11010 59563 58385 gene locus_tag LOCUS_11020 gene gcvT 59563 58385 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390799.1 protein_id gnl|my_center|LOCUS_11020 >Feature sequence111 266 117 gene locus_tag LOCUS_11030 266 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 1286 552 gene locus_tag LOCUS_11040 1286 552 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143673.1 protein_id gnl|my_center|LOCUS_11040 4046 1290 gene locus_tag LOCUS_11050 4046 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 5259 4597 gene locus_tag LOCUS_11060 5259 4597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 7766 5613 gene locus_tag LOCUS_11070 7766 5613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 9058 7763 gene locus_tag LOCUS_11080 gene mtaB 9058 7763 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388937.1 protein_id gnl|my_center|LOCUS_11080 9876 9055 gene locus_tag LOCUS_11090 gene dapF 9876 9055 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388938.1 protein_id gnl|my_center|LOCUS_11090 11707 9989 gene locus_tag LOCUS_11100 11707 9989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 12678 12241 gene locus_tag LOCUS_11110 gene rplS 12678 12241 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388943.1 protein_id gnl|my_center|LOCUS_11110 13626 12826 gene locus_tag LOCUS_11120 gene trmD 13626 12826 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388942.1 protein_id gnl|my_center|LOCUS_11120 14203 13559 gene locus_tag LOCUS_11130 gene rimM 14203 13559 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388941.1 protein_id gnl|my_center|LOCUS_11130 14614 14228 gene locus_tag LOCUS_11140 gene rpsP 14614 14228 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388940.1 protein_id gnl|my_center|LOCUS_11140 16370 14700 gene locus_tag LOCUS_11150 gene ffh 16370 14700 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388939.1 protein_id gnl|my_center|LOCUS_11150 16731 17936 gene locus_tag LOCUS_11160 16731 17936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 18025 19140 gene locus_tag LOCUS_11170 18025 19140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 19207 19446 gene locus_tag LOCUS_11180 19207 19446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 19774 19466 gene locus_tag LOCUS_11190 19774 19466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388430.1 protein_id gnl|my_center|LOCUS_11190 20045 20137 gene locus_tag LOCUS_t00200 20045 20137 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 20631 21197 gene locus_tag LOCUS_11200 gene satP 20631 21197 CDS product acetate uptake transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815537.1 protein_id gnl|my_center|LOCUS_11200 21240 21818 gene locus_tag LOCUS_11210 21240 21818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 24870 21934 gene locus_tag LOCUS_11220 24870 21934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 25596 26006 gene locus_tag LOCUS_11230 25596 26006 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389345.1 protein_id gnl|my_center|LOCUS_11230 27043 25982 gene locus_tag LOCUS_11240 27043 25982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 27553 27068 gene locus_tag LOCUS_11250 27553 27068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 28642 27671 gene locus_tag LOCUS_11260 gene cysK 28642 27671 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626663.1 protein_id gnl|my_center|LOCUS_11260 28900 29427 gene locus_tag LOCUS_11270 28900 29427 CDS product DUF1178 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626011.1 protein_id gnl|my_center|LOCUS_11270 30077 30256 gene locus_tag LOCUS_11280 30077 30256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 30328 30489 gene locus_tag LOCUS_11290 30328 30489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 33007 30815 gene locus_tag LOCUS_11300 33007 30815 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389477.1 protein_id gnl|my_center|LOCUS_11300 33243 33560 gene locus_tag LOCUS_11310 33243 33560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 33557 33787 gene locus_tag LOCUS_11320 33557 33787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 33969 35372 gene locus_tag LOCUS_11330 gene gltX 33969 35372 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389476.1 protein_id gnl|my_center|LOCUS_11330 35690 36985 gene locus_tag LOCUS_11340 gene gltA 35690 36985 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389475.1 protein_id gnl|my_center|LOCUS_11340 37184 39103 gene locus_tag LOCUS_11350 gene ilvD 37184 39103 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087307.1 protein_id gnl|my_center|LOCUS_11350 39110 40048 gene locus_tag LOCUS_11360 39110 40048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 40608 42068 gene locus_tag LOCUS_11370 40608 42068 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388889.1 protein_id gnl|my_center|LOCUS_11370 42733 42065 gene locus_tag LOCUS_11380 42733 42065 CDS product nucleoside triphosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968604.1 protein_id gnl|my_center|LOCUS_11380 43029 42754 gene locus_tag LOCUS_11390 43029 42754 CDS product FliM/FliN family flagellar motor switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390918.1 protein_id gnl|my_center|LOCUS_11390 43306 43764 gene locus_tag LOCUS_11400 43306 43764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 44650 43799 gene locus_tag LOCUS_11410 44650 43799 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388983.1 protein_id gnl|my_center|LOCUS_11410 45700 44801 gene locus_tag LOCUS_11420 gene gluQRS 45700 44801 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391481.1 protein_id gnl|my_center|LOCUS_11420 45905 46468 gene locus_tag LOCUS_11430 45905 46468 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391480.1 protein_id gnl|my_center|LOCUS_11430 46472 47353 gene locus_tag LOCUS_11440 46472 47353 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704257.1 protein_id gnl|my_center|LOCUS_11440 47770 48975 gene locus_tag LOCUS_11450 gene proV 47770 48975 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein ProV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390228.1 protein_id gnl|my_center|LOCUS_11450 48968 50119 gene locus_tag LOCUS_11460 gene proW 48968 50119 CDS product glycine betaine/L-proline ABC transporter permease ProW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370072.1 protein_id gnl|my_center|LOCUS_11460 50292 51317 gene locus_tag LOCUS_11470 gene proX 50292 51317 CDS product glycine betaine/L-proline ABC transporter substrate-binding protein ProX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390230.1 protein_id gnl|my_center|LOCUS_11470 51962 52360 gene locus_tag LOCUS_11480 51962 52360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 52377 52658 gene locus_tag LOCUS_11490 52377 52658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 52829 53599 gene locus_tag LOCUS_11500 52829 53599 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388469.1 protein_id gnl|my_center|LOCUS_11500 53664 53915 gene locus_tag LOCUS_11510 gene purS 53664 53915 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388468.1 protein_id gnl|my_center|LOCUS_11510 54022 56352 gene locus_tag LOCUS_11520 54022 56352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 56450 57142 gene locus_tag LOCUS_11530 gene purQ 56450 57142 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388467.1 protein_id gnl|my_center|LOCUS_11530 57139 59337 gene locus_tag LOCUS_11540 gene purL 57139 59337 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388466.1 protein_id gnl|my_center|LOCUS_11540 >Feature sequence112 202 2634 gene locus_tag LOCUS_11550 202 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 2631 3701 gene locus_tag LOCUS_11560 2631 3701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 3741 4154 gene locus_tag LOCUS_11570 3741 4154 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946356.1 protein_id gnl|my_center|LOCUS_11570 4965 4168 gene locus_tag LOCUS_11580 4965 4168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 5112 6005 gene locus_tag LOCUS_11590 5112 6005 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626584.1 protein_id gnl|my_center|LOCUS_11590 6002 6664 gene locus_tag LOCUS_11600 6002 6664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 6720 7679 gene locus_tag LOCUS_11610 gene pip 6720 7679 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387845.1 protein_id gnl|my_center|LOCUS_11610 7965 7765 gene locus_tag LOCUS_11620 7965 7765 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388999.1 protein_id gnl|my_center|LOCUS_11620 8727 8035 gene locus_tag LOCUS_11630 8727 8035 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389000.1 protein_id gnl|my_center|LOCUS_11630 9766 8894 gene locus_tag LOCUS_11640 9766 8894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 9548 9477 gene locus_tag LOCUS_t00210 9548 9477 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 10046 9777 gene locus_tag LOCUS_11650 10046 9777 CDS product DUF2312 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388797.1 protein_id gnl|my_center|LOCUS_11650 10254 11309 gene locus_tag LOCUS_11660 10254 11309 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267317.1 protein_id gnl|my_center|LOCUS_11660 11306 12049 gene locus_tag LOCUS_11670 11306 12049 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228695.1 protein_id gnl|my_center|LOCUS_11670 13170 12238 gene locus_tag LOCUS_11680 13170 12238 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388403.1 protein_id gnl|my_center|LOCUS_11680 14515 13424 gene locus_tag LOCUS_11690 14515 13424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625984.1 protein_id gnl|my_center|LOCUS_11690 15294 14527 gene locus_tag LOCUS_11700 gene pgeF 15294 14527 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388401.1 protein_id gnl|my_center|LOCUS_11700 16389 15298 gene locus_tag LOCUS_11710 16389 15298 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388400.1 protein_id gnl|my_center|LOCUS_11710 17192 16386 gene locus_tag LOCUS_11720 gene lgt 17192 16386 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388399.1 protein_id gnl|my_center|LOCUS_11720 18047 17223 gene locus_tag LOCUS_11730 18047 17223 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388398.1 protein_id gnl|my_center|LOCUS_11730 18295 18810 gene locus_tag LOCUS_11740 18295 18810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 18934 20100 gene locus_tag LOCUS_11750 18934 20100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 20576 20097 gene locus_tag LOCUS_11760 gene dut 20576 20097 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083581.1 protein_id gnl|my_center|LOCUS_11760 21790 20573 gene locus_tag LOCUS_11770 gene coaBC 21790 20573 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338345.1 protein_id gnl|my_center|LOCUS_11770 23880 21940 gene locus_tag LOCUS_11780 23880 21940 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391403.1 protein_id gnl|my_center|LOCUS_11780 24714 24184 gene locus_tag LOCUS_11790 gene thpR 24714 24184 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391396.1 protein_id gnl|my_center|LOCUS_11790 25334 24693 gene locus_tag LOCUS_11800 25334 24693 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391397.1 protein_id gnl|my_center|LOCUS_11800 25444 26154 gene locus_tag LOCUS_11810 25444 26154 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470636.1 protein_id gnl|my_center|LOCUS_11810 26151 28700 gene locus_tag LOCUS_11820 26151 28700 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391400.1 protein_id gnl|my_center|LOCUS_11820 29198 28731 gene locus_tag LOCUS_11830 29198 28731 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390191.1 protein_id gnl|my_center|LOCUS_11830 29710 29213 gene locus_tag LOCUS_11840 29710 29213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 30086 29736 gene locus_tag LOCUS_11850 30086 29736 CDS product NADH:ubiquinone oxidoreductase subunit NDUFA12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390193.1 protein_id gnl|my_center|LOCUS_11850 30457 30245 gene locus_tag LOCUS_11860 30457 30245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 30896 30612 gene locus_tag LOCUS_11870 30896 30612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 30997 32772 gene locus_tag LOCUS_11880 30997 32772 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391140.1 protein_id gnl|my_center|LOCUS_11880 32901 34010 gene locus_tag LOCUS_11890 32901 34010 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144408.1 protein_id gnl|my_center|LOCUS_11890 34329 34051 gene locus_tag LOCUS_11900 34329 34051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389308.1 protein_id gnl|my_center|LOCUS_11900 35169 34846 gene locus_tag LOCUS_11910 35169 34846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 35857 35270 gene locus_tag LOCUS_11920 35857 35270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 37256 35985 gene locus_tag LOCUS_11930 gene lysA 37256 35985 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388155.1 protein_id gnl|my_center|LOCUS_11930 37520 37296 gene locus_tag LOCUS_11940 37520 37296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 38947 37517 gene locus_tag LOCUS_11950 gene argH 38947 37517 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388156.1 protein_id gnl|my_center|LOCUS_11950 38975 39574 gene locus_tag LOCUS_11960 38975 39574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 40310 39588 gene locus_tag LOCUS_11970 40310 39588 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388158.1 protein_id gnl|my_center|LOCUS_11970 40499 41134 gene locus_tag LOCUS_11980 40499 41134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 41678 41121 gene locus_tag LOCUS_11990 41678 41121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 41764 42882 gene locus_tag LOCUS_12000 41764 42882 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389655.1 protein_id gnl|my_center|LOCUS_12000 42953 43549 gene locus_tag LOCUS_12010 42953 43549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 43966 43565 gene locus_tag LOCUS_12020 43966 43565 CDS product HI0074 family nucleotidyltransferase substrate-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926036.1 protein_id gnl|my_center|LOCUS_12020 44292 43954 gene locus_tag LOCUS_12030 44292 43954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 47180 44310 gene locus_tag LOCUS_12040 gene uvrA 47180 44310 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389505.1 protein_id gnl|my_center|LOCUS_12040 49512 47296 gene locus_tag LOCUS_12050 49512 47296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 50854 49694 gene locus_tag LOCUS_12060 gene queG 50854 49694 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388032.1 protein_id gnl|my_center|LOCUS_12060 51050 52063 gene locus_tag LOCUS_12070 51050 52063 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387777.1 protein_id gnl|my_center|LOCUS_12070 52397 53608 gene locus_tag LOCUS_12080 52397 53608 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391025.1 protein_id gnl|my_center|LOCUS_12080 53610 54578 gene locus_tag LOCUS_12090 gene argF 53610 54578 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470667.1 protein_id gnl|my_center|LOCUS_12090 54642 55610 gene locus_tag LOCUS_12100 54642 55610 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391023.1 protein_id gnl|my_center|LOCUS_12100 55721 56314 gene locus_tag LOCUS_12110 55721 56314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391022.1 protein_id gnl|my_center|LOCUS_12110 56453 58006 gene locus_tag LOCUS_12120 56453 58006 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387812.1 protein_id gnl|my_center|LOCUS_12120 58140 58562 gene locus_tag LOCUS_12130 58140 58562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387811.1 protein_id gnl|my_center|LOCUS_12130 >Feature sequence113 407 1543 gene locus_tag LOCUS_12140 407 1543 CDS product 5-methylthioribulose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389751.1 protein_id gnl|my_center|LOCUS_12140 1559 2038 gene locus_tag LOCUS_12150 1559 2038 CDS product 1-methylthio-xylulose 5-phosphate sulfo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389753.1 protein_id gnl|my_center|LOCUS_12150 2861 2415 gene locus_tag LOCUS_12160 2861 2415 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083199.1 protein_id gnl|my_center|LOCUS_12160 5075 2883 gene locus_tag LOCUS_12170 5075 2883 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113258.1 protein_id gnl|my_center|LOCUS_12170 5282 6733 gene locus_tag LOCUS_12180 5282 6733 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390653.1 protein_id gnl|my_center|LOCUS_12180 7740 6865 gene locus_tag LOCUS_12190 gene sucD 7740 6865 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388967.1 protein_id gnl|my_center|LOCUS_12190 8939 7740 gene locus_tag LOCUS_12200 gene sucC 8939 7740 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388966.1 protein_id gnl|my_center|LOCUS_12200 9929 8973 gene locus_tag LOCUS_12210 gene mdh 9929 8973 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388965.1 protein_id gnl|my_center|LOCUS_12210 10237 11478 gene locus_tag LOCUS_12220 gene chrA 10237 11478 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184001.1 protein_id gnl|my_center|LOCUS_12220 11488 12462 gene locus_tag LOCUS_12230 11488 12462 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388087.1 protein_id gnl|my_center|LOCUS_12230 12377 12700 gene locus_tag LOCUS_tm00010 12377 12700 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 12611 12700 gene locus_tag LOCUS_t00220 12611 12700 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 13226 12762 gene locus_tag LOCUS_12240 13226 12762 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928801.1 protein_id gnl|my_center|LOCUS_12240 13939 13271 gene locus_tag LOCUS_12250 13939 13271 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229005.1 protein_id gnl|my_center|LOCUS_12250 14024 14614 gene locus_tag LOCUS_12260 14024 14614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 15717 14611 gene locus_tag LOCUS_12270 gene amrS 15717 14611 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444592.1 protein_id gnl|my_center|LOCUS_12270 16132 15923 gene locus_tag LOCUS_12280 16132 15923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 16055 17656 gene locus_tag LOCUS_12290 16055 17656 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625913.1 protein_id gnl|my_center|LOCUS_12290 17715 18383 gene locus_tag LOCUS_12300 17715 18383 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387783.1 protein_id gnl|my_center|LOCUS_12300 18411 19268 gene locus_tag LOCUS_12310 18411 19268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 19629 20639 gene locus_tag LOCUS_12320 19629 20639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 20702 22882 gene locus_tag LOCUS_12330 20702 22882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 23064 23255 gene locus_tag LOCUS_12340 23064 23255 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296638.1 protein_id gnl|my_center|LOCUS_12340 23860 26562 gene locus_tag LOCUS_12350 23860 26562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 26701 28257 gene locus_tag LOCUS_12360 26701 28257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 29752 28235 gene locus_tag LOCUS_12370 29752 28235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 32058 29752 gene locus_tag LOCUS_12380 32058 29752 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088793.1 protein_id gnl|my_center|LOCUS_12380 34542 32092 gene locus_tag LOCUS_12390 34542 32092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 35405 34539 gene locus_tag LOCUS_12400 35405 34539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 35677 35498 gene locus_tag LOCUS_12410 35677 35498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 38379 35905 gene locus_tag LOCUS_12420 38379 35905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 39164 40258 gene locus_tag LOCUS_12430 39164 40258 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337326.1 protein_id gnl|my_center|LOCUS_12430 40274 43408 gene locus_tag LOCUS_12440 40274 43408 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972023.1 protein_id gnl|my_center|LOCUS_12440 43405 44832 gene locus_tag LOCUS_12450 43405 44832 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530684.1 protein_id gnl|my_center|LOCUS_12450 45974 45024 gene locus_tag LOCUS_12460 45974 45024 CDS product choline ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104841.1 protein_id gnl|my_center|LOCUS_12460 47728 46049 gene locus_tag LOCUS_12470 gene betA 47728 46049 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009940671.1 protein_id gnl|my_center|LOCUS_12470 49209 47728 gene locus_tag LOCUS_12480 49209 47728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12480 49805 49206 gene locus_tag LOCUS_12490 gene betI 49805 49206 CDS product transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202513.1 protein_id gnl|my_center|LOCUS_12490 51651 49873 gene locus_tag LOCUS_12500 51651 49873 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389287.1 protein_id gnl|my_center|LOCUS_12500 52829 51783 gene locus_tag LOCUS_12510 52829 51783 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087119.1 protein_id gnl|my_center|LOCUS_12510 53733 53218 gene locus_tag LOCUS_12520 53733 53218 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389286.1 protein_id gnl|my_center|LOCUS_12520 54311 53826 gene locus_tag LOCUS_12530 54311 53826 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966456.1 protein_id gnl|my_center|LOCUS_12530 54531 55424 gene locus_tag LOCUS_12540 54531 55424 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389285.1 protein_id gnl|my_center|LOCUS_12540 56276 55476 gene locus_tag LOCUS_12550 56276 55476 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729029.1 protein_id gnl|my_center|LOCUS_12550 57733 56297 gene locus_tag LOCUS_12560 gene tldD 57733 56297 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388325.1 protein_id gnl|my_center|LOCUS_12560 57913 57989 gene locus_tag LOCUS_t00230 57913 57989 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence114 1828 293 gene locus_tag LOCUS_12570 1828 293 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767560.1 protein_id gnl|my_center|LOCUS_12570 4158 1834 gene locus_tag LOCUS_12580 4158 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 5219 4224 gene locus_tag LOCUS_12590 5219 4224 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390629.1 protein_id gnl|my_center|LOCUS_12590 6508 5216 gene locus_tag LOCUS_12600 6508 5216 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184431658.1 protein_id gnl|my_center|LOCUS_12600 6898 9252 gene locus_tag LOCUS_12610 6898 9252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 9716 11008 gene locus_tag LOCUS_12620 9716 11008 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086305.1 protein_id gnl|my_center|LOCUS_12620 11556 11014 gene locus_tag LOCUS_12630 11556 11014 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390134.1 protein_id gnl|my_center|LOCUS_12630 12294 11590 gene locus_tag LOCUS_12640 12294 11590 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532669.1 protein_id gnl|my_center|LOCUS_12640 14359 12338 gene locus_tag LOCUS_12650 14359 12338 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389619.1 protein_id gnl|my_center|LOCUS_12650 14734 15597 gene locus_tag LOCUS_12660 gene dapA 14734 15597 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389618.1 protein_id gnl|my_center|LOCUS_12660 15677 16168 gene locus_tag LOCUS_12670 gene smpB 15677 16168 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389617.1 protein_id gnl|my_center|LOCUS_12670 16251 16850 gene locus_tag LOCUS_12680 16251 16850 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389616.1 protein_id gnl|my_center|LOCUS_12680 17529 16858 gene locus_tag LOCUS_12690 17529 16858 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389613.1 protein_id gnl|my_center|LOCUS_12690 18200 17541 gene locus_tag LOCUS_12700 18200 17541 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389612.1 protein_id gnl|my_center|LOCUS_12700 18375 18896 gene locus_tag LOCUS_12710 gene folK 18375 18896 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389611.1 protein_id gnl|my_center|LOCUS_12710 19542 18889 gene locus_tag LOCUS_12720 19542 18889 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389675.1 protein_id gnl|my_center|LOCUS_12720 20727 19711 gene locus_tag LOCUS_12730 gene hemB 20727 19711 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389590.1 protein_id gnl|my_center|LOCUS_12730 22016 20724 gene locus_tag LOCUS_12740 22016 20724 CDS product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389589.1 protein_id gnl|my_center|LOCUS_12740 22573 22142 gene locus_tag LOCUS_12750 22573 22142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 22953 22627 gene locus_tag LOCUS_12760 22953 22627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 23728 22946 gene locus_tag LOCUS_12770 23728 22946 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393451.1 protein_id gnl|my_center|LOCUS_12770 24471 23725 gene locus_tag LOCUS_12780 24471 23725 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390008.1 protein_id gnl|my_center|LOCUS_12780 24565 25098 gene locus_tag LOCUS_12790 24565 25098 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256620.1 protein_id gnl|my_center|LOCUS_12790 28787 25260 gene locus_tag LOCUS_12800 gene metH 28787 25260 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389284.1 protein_id gnl|my_center|LOCUS_12800 28786 28941 gene locus_tag LOCUS_12810 28786 28941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 29825 28884 gene locus_tag LOCUS_12820 gene metF 29825 28884 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389283.1 protein_id gnl|my_center|LOCUS_12820 30808 29822 gene locus_tag LOCUS_12830 30808 29822 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389282.1 protein_id gnl|my_center|LOCUS_12830 31054 32049 gene locus_tag LOCUS_12840 gene meaB 31054 32049 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390231.1 protein_id gnl|my_center|LOCUS_12840 32772 32071 gene locus_tag LOCUS_12850 32772 32071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 33212 32883 gene locus_tag LOCUS_12860 33212 32883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 34976 33642 gene locus_tag LOCUS_12870 34976 33642 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390686.1 protein_id gnl|my_center|LOCUS_12870 36051 35011 gene locus_tag LOCUS_12880 36051 35011 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390688.1 protein_id gnl|my_center|LOCUS_12880 37177 36188 gene locus_tag LOCUS_12890 37177 36188 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389885.1 protein_id gnl|my_center|LOCUS_12890 38232 37174 gene locus_tag LOCUS_12900 38232 37174 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390689.1 protein_id gnl|my_center|LOCUS_12900 38337 39284 gene locus_tag LOCUS_12910 38337 39284 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390690.1 protein_id gnl|my_center|LOCUS_12910 41361 39295 gene locus_tag LOCUS_12920 41361 39295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 41737 42831 gene locus_tag LOCUS_12930 gene leuB 41737 42831 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388946.1 protein_id gnl|my_center|LOCUS_12930 45981 42835 gene locus_tag LOCUS_12940 45981 42835 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013850752.1 protein_id gnl|my_center|LOCUS_12940 47734 46046 gene locus_tag LOCUS_12950 gene paaN 47734 46046 CDS product phenylacetic acid degradation protein PaaN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549951.1 protein_id gnl|my_center|LOCUS_12950 48322 47801 gene locus_tag LOCUS_12960 gene mioC 48322 47801 CDS product FMN-binding protein MioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016352400.1 protein_id gnl|my_center|LOCUS_12960 48433 49209 gene locus_tag LOCUS_12970 48433 49209 CDS product phenylacetate-CoA oxygenase subunit PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399747.1 protein_id gnl|my_center|LOCUS_12970 49268 50059 gene locus_tag LOCUS_12980 gene paaG 49268 50059 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969790.1 protein_id gnl|my_center|LOCUS_12980 50083 50532 gene locus_tag LOCUS_12990 gene paaI 50083 50532 CDS product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535436.1 protein_id gnl|my_center|LOCUS_12990 50529 51734 gene locus_tag LOCUS_13000 gene pcaF 50529 51734 CDS product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039581.1 protein_id gnl|my_center|LOCUS_13000 51823 53136 gene locus_tag LOCUS_13010 gene paaF 51823 53136 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329391.1 protein_id gnl|my_center|LOCUS_13010 53178 53861 gene locus_tag LOCUS_13020 53178 53861 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388331.1 protein_id gnl|my_center|LOCUS_13020 53945 54163 gene locus_tag LOCUS_13030 53945 54163 CDS product bacterioferritin-associated ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921096.1 protein_id gnl|my_center|LOCUS_13030 54354 54839 gene locus_tag LOCUS_13040 gene bfr 54354 54839 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815898.1 protein_id gnl|my_center|LOCUS_13040 55015 55953 gene locus_tag LOCUS_13050 55015 55953 CDS product cell envelope integrity EipB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626297.1 protein_id gnl|my_center|LOCUS_13050 56015 56215 gene locus_tag LOCUS_13060 56015 56215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 56417 57082 gene locus_tag LOCUS_13070 56417 57082 CDS product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294588.1 protein_id gnl|my_center|LOCUS_13070 >Feature sequence115 928 581 gene locus_tag LOCUS_13080 928 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 927 1136 gene locus_tag LOCUS_13090 927 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 1256 2266 gene locus_tag LOCUS_13100 gene dusA 1256 2266 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626209.1 protein_id gnl|my_center|LOCUS_13100 4501 2288 gene locus_tag LOCUS_13110 4501 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 5134 9741 gene locus_tag LOCUS_13120 5134 9741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 11146 10058 gene locus_tag LOCUS_13130 gene obgE 11146 10058 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388995.1 protein_id gnl|my_center|LOCUS_13130 11830 11243 gene locus_tag LOCUS_13140 11830 11243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 12382 11960 gene locus_tag LOCUS_13150 12382 11960 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121094.1 protein_id gnl|my_center|LOCUS_13150 12611 13846 gene locus_tag LOCUS_13160 12611 13846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 13949 13874 gene locus_tag LOCUS_t00240 13949 13874 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 14686 15441 gene locus_tag LOCUS_13170 gene lexA 14686 15441 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389651.1 protein_id gnl|my_center|LOCUS_13170 15805 16206 gene locus_tag LOCUS_13180 15805 16206 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941070.1 protein_id gnl|my_center|LOCUS_13180 16890 16249 gene locus_tag LOCUS_13190 16890 16249 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390755.1 protein_id gnl|my_center|LOCUS_13190 17124 18110 gene locus_tag LOCUS_13200 17124 18110 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881241.1 protein_id gnl|my_center|LOCUS_13200 18299 19882 gene locus_tag LOCUS_13210 18299 19882 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421494.1 protein_id gnl|my_center|LOCUS_13210 20049 21011 gene locus_tag LOCUS_13220 20049 21011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 21555 22052 gene locus_tag LOCUS_13230 21555 22052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 22049 23050 gene locus_tag LOCUS_13240 gene rsmH 22049 23050 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388713.1 protein_id gnl|my_center|LOCUS_13240 23047 23481 gene locus_tag LOCUS_13250 23047 23481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388712.1 protein_id gnl|my_center|LOCUS_13250 23478 25277 gene locus_tag LOCUS_13260 23478 25277 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388711.1 protein_id gnl|my_center|LOCUS_13260 25264 26820 gene locus_tag LOCUS_13270 25264 26820 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388710.1 protein_id gnl|my_center|LOCUS_13270 26817 28289 gene locus_tag LOCUS_13280 gene murF 26817 28289 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388709.1 protein_id gnl|my_center|LOCUS_13280 28340 29425 gene locus_tag LOCUS_13290 gene mraY 28340 29425 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388708.1 protein_id gnl|my_center|LOCUS_13290 29445 30926 gene locus_tag LOCUS_13300 gene murD 29445 30926 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388707.1 protein_id gnl|my_center|LOCUS_13300 30923 32152 gene locus_tag LOCUS_13310 30923 32152 CDS product putative peptidoglycan glycosyltransferase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388706.1 protein_id gnl|my_center|LOCUS_13310 32149 33273 gene locus_tag LOCUS_13320 gene murG 32149 33273 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388705.1 protein_id gnl|my_center|LOCUS_13320 33270 34700 gene locus_tag LOCUS_13330 gene murC 33270 34700 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388704.1 protein_id gnl|my_center|LOCUS_13330 34697 35650 gene locus_tag LOCUS_13340 gene murB 34697 35650 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388703.1 protein_id gnl|my_center|LOCUS_13340 35647 36573 gene locus_tag LOCUS_13350 35647 36573 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388702.1 protein_id gnl|my_center|LOCUS_13350 36561 37532 gene locus_tag LOCUS_13360 36561 37532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 37538 38842 gene locus_tag LOCUS_13370 gene ftsA 37538 38842 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388700.1 protein_id gnl|my_center|LOCUS_13370 38842 41190 gene locus_tag LOCUS_13380 gene ftsZ 38842 41190 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388699.1 protein_id gnl|my_center|LOCUS_13380 41477 43135 gene locus_tag LOCUS_13390 41477 43135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 43232 43669 gene locus_tag LOCUS_13400 43232 43669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 43879 43673 gene locus_tag LOCUS_13410 43879 43673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 44753 44034 gene locus_tag LOCUS_13420 44753 44034 CDS product divalent cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922379.1 protein_id gnl|my_center|LOCUS_13420 45246 44968 gene locus_tag LOCUS_13430 gene rpmA 45246 44968 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388996.1 protein_id gnl|my_center|LOCUS_13430 45622 45323 gene locus_tag LOCUS_13440 gene rplU 45622 45323 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388997.1 protein_id gnl|my_center|LOCUS_13440 46155 45841 gene locus_tag LOCUS_13450 46155 45841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 46984 46220 gene locus_tag LOCUS_13460 gene recO 46984 46220 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389602.1 protein_id gnl|my_center|LOCUS_13460 48754 47021 gene locus_tag LOCUS_13470 48754 47021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 49023 49313 gene locus_tag LOCUS_13480 49023 49313 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531473.1 protein_id gnl|my_center|LOCUS_13480 49472 50152 gene locus_tag LOCUS_13490 gene aat 49472 50152 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390189.1 protein_id gnl|my_center|LOCUS_13490 50652 50062 gene locus_tag LOCUS_13500 50652 50062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 52848 50728 gene locus_tag LOCUS_13510 52848 50728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 53735 53016 gene locus_tag LOCUS_13520 53735 53016 CDS product DUF6134 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389069.1 protein_id gnl|my_center|LOCUS_13520 56234 53778 gene locus_tag LOCUS_13530 56234 53778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 >Feature sequence116 553 236 gene locus_tag LOCUS_13540 553 236 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034027947.1 protein_id gnl|my_center|LOCUS_13540 872 585 gene locus_tag LOCUS_13550 872 585 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265672.1 protein_id gnl|my_center|LOCUS_13550 1092 2363 gene locus_tag LOCUS_13560 1092 2363 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084679.1 protein_id gnl|my_center|LOCUS_13560 2465 4738 gene locus_tag LOCUS_13570 gene glgX 2465 4738 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388263.1 protein_id gnl|my_center|LOCUS_13570 4809 6677 gene locus_tag LOCUS_13580 gene treZ 4809 6677 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388264.1 protein_id gnl|my_center|LOCUS_13580 7617 6838 gene locus_tag LOCUS_13590 7617 6838 CDS product regulatory inactivation of DnaA Hda protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390012.1 protein_id gnl|my_center|LOCUS_13590 8189 7614 gene locus_tag LOCUS_13600 8189 7614 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390014.1 protein_id gnl|my_center|LOCUS_13600 9538 8186 gene locus_tag LOCUS_13610 9538 8186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 9486 10628 gene locus_tag LOCUS_13620 gene purM 9486 10628 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626325.1 protein_id gnl|my_center|LOCUS_13620 10625 11299 gene locus_tag LOCUS_13630 gene purN 10625 11299 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390017.1 protein_id gnl|my_center|LOCUS_13630 11634 12128 gene locus_tag LOCUS_13640 gene msrB 11634 12128 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967753.1 protein_id gnl|my_center|LOCUS_13640 12240 13001 gene locus_tag LOCUS_13650 12240 13001 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090570.1 protein_id gnl|my_center|LOCUS_13650 14243 13014 gene locus_tag LOCUS_13660 14243 13014 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098267.1 protein_id gnl|my_center|LOCUS_13660 15006 14485 gene locus_tag LOCUS_13670 15006 14485 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389313.1 protein_id gnl|my_center|LOCUS_13670 16195 15038 gene locus_tag LOCUS_13680 16195 15038 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626375.1 protein_id gnl|my_center|LOCUS_13680 17546 16245 gene locus_tag LOCUS_13690 17546 16245 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390177.1 protein_id gnl|my_center|LOCUS_13690 17662 19023 gene locus_tag LOCUS_13700 17662 19023 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390178.1 protein_id gnl|my_center|LOCUS_13700 19084 19287 gene locus_tag LOCUS_13710 19084 19287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 20058 19588 gene locus_tag LOCUS_13720 20058 19588 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086610.1 protein_id gnl|my_center|LOCUS_13720 20364 21551 gene locus_tag LOCUS_13730 20364 21551 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086611.1 protein_id gnl|my_center|LOCUS_13730 21566 22423 gene locus_tag LOCUS_13740 21566 22423 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528449.1 protein_id gnl|my_center|LOCUS_13740 22420 25191 gene locus_tag LOCUS_13750 22420 25191 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528450.1 protein_id gnl|my_center|LOCUS_13750 25188 26654 gene locus_tag LOCUS_13760 25188 26654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966263.1 protein_id gnl|my_center|LOCUS_13760 26672 27742 gene locus_tag LOCUS_13770 26672 27742 CDS product UPF0280 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086604.1 protein_id gnl|my_center|LOCUS_13770 27735 28331 gene locus_tag LOCUS_13780 27735 28331 CDS product amino acid synthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530297.1 protein_id gnl|my_center|LOCUS_13780 28328 28918 gene locus_tag LOCUS_13790 28328 28918 CDS product amino acid synthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086605.1 protein_id gnl|my_center|LOCUS_13790 29026 30279 gene locus_tag LOCUS_13800 29026 30279 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086606.1 protein_id gnl|my_center|LOCUS_13800 31208 30495 gene locus_tag LOCUS_13810 31208 30495 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470606.1 protein_id gnl|my_center|LOCUS_13810 32273 31275 gene locus_tag LOCUS_13820 32273 31275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 33953 32505 gene locus_tag LOCUS_13830 33953 32505 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085145.1 protein_id gnl|my_center|LOCUS_13830 34301 35434 gene locus_tag LOCUS_13840 34301 35434 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124958.1 protein_id gnl|my_center|LOCUS_13840 35316 35558 gene locus_tag LOCUS_13850 35316 35558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 35527 36198 gene locus_tag LOCUS_13860 35527 36198 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390739.1 protein_id gnl|my_center|LOCUS_13860 36189 36929 gene locus_tag LOCUS_13870 36189 36929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 36926 38779 gene locus_tag LOCUS_13880 gene cobJ 36926 38779 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203935.1 protein_id gnl|my_center|LOCUS_13880 38776 39540 gene locus_tag LOCUS_13890 gene cobM 38776 39540 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391131.1 protein_id gnl|my_center|LOCUS_13890 39625 41478 gene locus_tag LOCUS_13900 39625 41478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 45454 41909 gene locus_tag LOCUS_13910 gene smc 45454 41909 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390996.1 protein_id gnl|my_center|LOCUS_13910 46130 45441 gene locus_tag LOCUS_13920 46130 45441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 46496 47581 gene locus_tag LOCUS_13930 46496 47581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 48227 47607 gene locus_tag LOCUS_13940 48227 47607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 48365 49474 gene locus_tag LOCUS_13950 gene mutY 48365 49474 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390999.1 protein_id gnl|my_center|LOCUS_13950 49511 50680 gene locus_tag LOCUS_13960 49511 50680 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625896.1 protein_id gnl|my_center|LOCUS_13960 50824 52779 gene locus_tag LOCUS_13970 50824 52779 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391442.1 protein_id gnl|my_center|LOCUS_13970 52900 54426 gene locus_tag LOCUS_13980 52900 54426 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024502938.1 protein_id gnl|my_center|LOCUS_13980 54679 54464 gene locus_tag LOCUS_13990 54679 54464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 >Feature sequence117 215 290 gene locus_tag LOCUS_t00250 215 290 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1220 708 gene locus_tag LOCUS_14000 1220 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 2231 1245 gene locus_tag LOCUS_14010 2231 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 2875 2234 gene locus_tag LOCUS_14020 2875 2234 CDS product DUF2313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937529.1 protein_id gnl|my_center|LOCUS_14020 3924 2866 gene locus_tag LOCUS_14030 3924 2866 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940117.1 protein_id gnl|my_center|LOCUS_14030 7307 3927 gene locus_tag LOCUS_14040 7307 3927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 8173 7307 gene locus_tag LOCUS_14050 8173 7307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 8872 8177 gene locus_tag LOCUS_14060 8872 8177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 9395 8874 gene locus_tag LOCUS_14070 9395 8874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 10477 9392 gene locus_tag LOCUS_14080 10477 9392 CDS product contractile injection system protein, VgrG/Pvc8 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072645.1 protein_id gnl|my_center|LOCUS_14080 11718 10474 gene locus_tag LOCUS_14090 11718 10474 CDS product DNA circularization N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309364.1 protein_id gnl|my_center|LOCUS_14090 11763 12395 gene locus_tag LOCUS_14100 11763 12395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 14356 12398 gene locus_tag LOCUS_14110 14356 12398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 14871 14512 gene locus_tag LOCUS_14120 14871 14512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 15235 14873 gene locus_tag LOCUS_14130 15235 14873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 16719 15259 gene locus_tag LOCUS_14140 16719 15259 CDS product phage tail sheath subtilisin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937520.1 protein_id gnl|my_center|LOCUS_14140 16920 16723 gene locus_tag LOCUS_14150 16920 16723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 17378 16920 gene locus_tag LOCUS_14160 17378 16920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 18046 17531 gene locus_tag LOCUS_14170 18046 17531 CDS product phage virion morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938413.1 protein_id gnl|my_center|LOCUS_14170 18471 18049 gene locus_tag LOCUS_14180 18471 18049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 18838 18650 gene locus_tag LOCUS_14190 18838 18650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 19746 18853 gene locus_tag LOCUS_14200 19746 18853 CDS product Mu-like prophage major head subunit gpT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939979.1 protein_id gnl|my_center|LOCUS_14200 20165 19761 gene locus_tag LOCUS_14210 20165 19761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 21197 20169 gene locus_tag LOCUS_14220 21197 20169 CDS product phage protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072631.1 protein_id gnl|my_center|LOCUS_14220 23049 21769 gene locus_tag LOCUS_14230 23049 21769 CDS product PBECR2 nuclease fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110752062.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14230 24589 23039 gene locus_tag LOCUS_14240 24589 23039 CDS product DUF935 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072627.1 protein_id gnl|my_center|LOCUS_14240 26229 24586 gene locus_tag LOCUS_14250 26229 24586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938421.1 protein_id gnl|my_center|LOCUS_14250 26708 26229 gene locus_tag LOCUS_14260 26708 26229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 27097 26792 gene locus_tag LOCUS_14270 27097 26792 CDS product winged-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006249663.1 protein_id gnl|my_center|LOCUS_14270 27522 27094 gene locus_tag LOCUS_14280 27522 27094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 27749 27525 gene locus_tag LOCUS_14290 27749 27525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 28383 27742 gene locus_tag LOCUS_14300 28383 27742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 28583 28386 gene locus_tag LOCUS_14310 28583 28386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 29170 28583 gene locus_tag LOCUS_14320 29170 28583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 29694 29311 gene locus_tag LOCUS_14330 29694 29311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 30407 29691 gene locus_tag LOCUS_14340 30407 29691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 30661 30404 gene locus_tag LOCUS_14350 30661 30404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 31296 30658 gene locus_tag LOCUS_14360 31296 30658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 31517 31293 gene locus_tag LOCUS_14370 31517 31293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 31789 31514 gene locus_tag LOCUS_14380 31789 31514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 31971 31792 gene locus_tag LOCUS_14390 31971 31792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 32276 31971 gene locus_tag LOCUS_14400 32276 31971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 32803 32273 gene locus_tag LOCUS_14410 32803 32273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 33120 32800 gene locus_tag LOCUS_14420 33120 32800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 33548 33117 gene locus_tag LOCUS_14430 33548 33117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 33951 33541 gene locus_tag LOCUS_14440 33951 33541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 34489 33965 gene locus_tag LOCUS_14450 34489 33965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 34921 34601 gene locus_tag LOCUS_14460 34921 34601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 35301 34918 gene locus_tag LOCUS_14470 35301 34918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 35858 35298 gene locus_tag LOCUS_14480 35858 35298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 36260 35859 gene locus_tag LOCUS_14490 36260 35859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 36918 36253 gene locus_tag LOCUS_14500 36918 36253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 37688 36915 gene locus_tag LOCUS_14510 37688 36915 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070969.1 protein_id gnl|my_center|LOCUS_14510 39863 37752 gene locus_tag LOCUS_14520 39863 37752 CDS product Mu transposase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005992021.1 protein_id gnl|my_center|LOCUS_14520 40342 39863 gene locus_tag LOCUS_14530 40342 39863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 40363 40536 gene locus_tag LOCUS_14540 40363 40536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 40540 40803 gene locus_tag LOCUS_14550 40540 40803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 41075 40800 gene locus_tag LOCUS_14560 41075 40800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 41497 41099 gene locus_tag LOCUS_14570 41497 41099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 41844 41494 gene locus_tag LOCUS_14580 41844 41494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 42002 42610 gene locus_tag LOCUS_14590 42002 42610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 43918 43298 gene locus_tag LOCUS_14600 43918 43298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 45166 44897 gene locus_tag LOCUS_14610 45166 44897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 46461 45388 gene locus_tag LOCUS_14620 46461 45388 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388253.1 protein_id gnl|my_center|LOCUS_14620 47827 46442 gene locus_tag LOCUS_14630 47827 46442 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388252.1 protein_id gnl|my_center|LOCUS_14630 48615 48127 gene locus_tag LOCUS_14640 48615 48127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 49131 48661 gene locus_tag LOCUS_14650 gene ruvX 49131 48661 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390926.1 protein_id gnl|my_center|LOCUS_14650 49226 49513 gene locus_tag LOCUS_14660 gene gatC 49226 49513 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390925.1 protein_id gnl|my_center|LOCUS_14660 49526 51016 gene locus_tag LOCUS_14670 gene gatA 49526 51016 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390924.1 protein_id gnl|my_center|LOCUS_14670 51021 52496 gene locus_tag LOCUS_14680 gene gatB 51021 52496 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390923.1 protein_id gnl|my_center|LOCUS_14680 53015 52821 gene locus_tag LOCUS_14690 53015 52821 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545347.1 protein_id gnl|my_center|LOCUS_14690 >Feature sequence118 601 122 gene locus_tag LOCUS_14700 601 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 800 3664 gene locus_tag LOCUS_14710 800 3664 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918711.1 protein_id gnl|my_center|LOCUS_14710 3668 4510 gene locus_tag LOCUS_14720 3668 4510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 4652 4867 gene locus_tag LOCUS_14730 4652 4867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 4867 5754 gene locus_tag LOCUS_14740 4867 5754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 5754 7220 gene locus_tag LOCUS_14750 5754 7220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 7454 7379 gene locus_tag LOCUS_t00260 7454 7379 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 8181 7822 gene locus_tag LOCUS_14760 8181 7822 CDS product TIGR02300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388049.1 protein_id gnl|my_center|LOCUS_14760 8423 9829 gene locus_tag LOCUS_14770 8423 9829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 9908 11635 gene locus_tag LOCUS_14780 gene rpsA 9908 11635 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388046.1 protein_id gnl|my_center|LOCUS_14780 11925 12215 gene locus_tag LOCUS_14790 gene ihfB 11925 12215 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388045.1 protein_id gnl|my_center|LOCUS_14790 12454 12744 gene locus_tag LOCUS_14800 12454 12744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 13012 14079 gene locus_tag LOCUS_14810 13012 14079 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388203.1 protein_id gnl|my_center|LOCUS_14810 14181 15116 gene locus_tag LOCUS_14820 14181 15116 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388199.1 protein_id gnl|my_center|LOCUS_14820 15151 15777 gene locus_tag LOCUS_14830 gene phnN 15151 15777 CDS product phosphonate metabolism protein/1,5-bisphosphokinase (PRPP-forming) PhnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527702.1 protein_id gnl|my_center|LOCUS_14830 15995 17056 gene locus_tag LOCUS_14840 15995 17056 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388196.1 protein_id gnl|my_center|LOCUS_14840 18470 17649 gene locus_tag LOCUS_14850 18470 17649 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551552.1 protein_id gnl|my_center|LOCUS_14850 18857 20197 gene locus_tag LOCUS_14860 18857 20197 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173806.1 protein_id gnl|my_center|LOCUS_14860 21428 20382 gene locus_tag LOCUS_14870 21428 20382 CDS product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267571.1 protein_id gnl|my_center|LOCUS_14870 21478 22002 gene locus_tag LOCUS_14880 21478 22002 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387828.1 protein_id gnl|my_center|LOCUS_14880 22101 22988 gene locus_tag LOCUS_14890 22101 22988 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388696.1 protein_id gnl|my_center|LOCUS_14890 23099 24820 gene locus_tag LOCUS_14900 gene recN 23099 24820 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388695.1 protein_id gnl|my_center|LOCUS_14900 24817 26925 gene locus_tag LOCUS_14910 gene ligA 24817 26925 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388694.1 protein_id gnl|my_center|LOCUS_14910 28141 26882 gene locus_tag LOCUS_14920 28141 26882 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389347.1 protein_id gnl|my_center|LOCUS_14920 30400 28151 gene locus_tag LOCUS_14930 30400 28151 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063689.1 protein_id gnl|my_center|LOCUS_14930 30875 30405 gene locus_tag LOCUS_14940 30875 30405 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398951.1 protein_id gnl|my_center|LOCUS_14940 31439 31954 gene locus_tag LOCUS_14950 31439 31954 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391536.1 protein_id gnl|my_center|LOCUS_14950 31951 33282 gene locus_tag LOCUS_14960 31951 33282 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391408.1 protein_id gnl|my_center|LOCUS_14960 33374 34630 gene locus_tag LOCUS_14970 33374 34630 CDS product nucleoside transporter C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088367.1 protein_id gnl|my_center|LOCUS_14970 35516 34635 gene locus_tag LOCUS_14980 35516 34635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339015.1 protein_id gnl|my_center|LOCUS_14980 36791 35523 gene locus_tag LOCUS_14990 36791 35523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252818.1 protein_id gnl|my_center|LOCUS_14990 37356 38144 gene locus_tag LOCUS_15000 37356 38144 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072774606.1 protein_id gnl|my_center|LOCUS_15000 39048 38155 gene locus_tag LOCUS_15010 39048 38155 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440473.1 protein_id gnl|my_center|LOCUS_15010 40301 39339 gene locus_tag LOCUS_15020 gene trxB 40301 39339 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390648.1 protein_id gnl|my_center|LOCUS_15020 41112 40498 gene locus_tag LOCUS_15030 41112 40498 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390647.1 protein_id gnl|my_center|LOCUS_15030 42552 41332 gene locus_tag LOCUS_15040 gene serA 42552 41332 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626385.1 protein_id gnl|my_center|LOCUS_15040 42661 43131 gene locus_tag LOCUS_15050 42661 43131 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390210.1 protein_id gnl|my_center|LOCUS_15050 43375 45867 gene locus_tag LOCUS_15060 43375 45867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 45993 46247 gene locus_tag LOCUS_15070 45993 46247 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026614401.1 protein_id gnl|my_center|LOCUS_15070 46247 46675 gene locus_tag LOCUS_15080 46247 46675 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766948.1 protein_id gnl|my_center|LOCUS_15080 47305 47054 gene locus_tag LOCUS_15090 47305 47054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 47292 48410 gene locus_tag LOCUS_15100 gene dnaN 47292 48410 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387763.1 protein_id gnl|my_center|LOCUS_15100 48410 49606 gene locus_tag LOCUS_15110 gene recF 48410 49606 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387764.1 protein_id gnl|my_center|LOCUS_15110 49638 52049 gene locus_tag LOCUS_15120 gene gyrB 49638 52049 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387765.1 protein_id gnl|my_center|LOCUS_15120 >Feature sequence119 1585 317 gene locus_tag LOCUS_15130 1585 317 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388483.1 protein_id gnl|my_center|LOCUS_15130 2489 1608 gene locus_tag LOCUS_15140 2489 1608 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388482.1 protein_id gnl|my_center|LOCUS_15140 3931 2486 gene locus_tag LOCUS_15150 3931 2486 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971977.1 protein_id gnl|my_center|LOCUS_15150 4351 4902 gene locus_tag LOCUS_15160 4351 4902 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388480.1 protein_id gnl|my_center|LOCUS_15160 4899 5594 gene locus_tag LOCUS_15170 4899 5594 CDS product ChrR family anti-sigma-E factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388479.1 protein_id gnl|my_center|LOCUS_15170 5796 7397 gene locus_tag LOCUS_15180 5796 7397 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391296.1 protein_id gnl|my_center|LOCUS_15180 8605 7304 gene locus_tag LOCUS_15190 8605 7304 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162518500.1 protein_id gnl|my_center|LOCUS_15190 8489 8806 gene locus_tag LOCUS_15200 8489 8806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 9521 9099 gene locus_tag LOCUS_15210 gene ndk 9521 9099 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390018.1 protein_id gnl|my_center|LOCUS_15210 9846 10379 gene locus_tag LOCUS_15220 gene purE 9846 10379 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529209.1 protein_id gnl|my_center|LOCUS_15220 10376 11461 gene locus_tag LOCUS_15230 10376 11461 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388806.1 protein_id gnl|my_center|LOCUS_15230 11579 12565 gene locus_tag LOCUS_15240 11579 12565 CDS product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390710.1 protein_id gnl|my_center|LOCUS_15240 12747 14375 gene locus_tag LOCUS_15250 gene cimA 12747 14375 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388453.1 protein_id gnl|my_center|LOCUS_15250 16262 14745 gene locus_tag LOCUS_15260 gene purF 16262 14745 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086836.1 protein_id gnl|my_center|LOCUS_15260 16966 16259 gene locus_tag LOCUS_15270 16966 16259 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388164.1 protein_id gnl|my_center|LOCUS_15270 18464 16971 gene locus_tag LOCUS_15280 gene radA 18464 16971 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388165.1 protein_id gnl|my_center|LOCUS_15280 19423 18479 gene locus_tag LOCUS_15290 gene ubiA 19423 18479 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388330.1 protein_id gnl|my_center|LOCUS_15290 20034 21539 gene locus_tag LOCUS_15300 gene ccoN 20034 21539 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391079.1 protein_id gnl|my_center|LOCUS_15300 21554 22348 gene locus_tag LOCUS_15310 gene ccoO 21554 22348 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391078.1 protein_id gnl|my_center|LOCUS_15310 22376 22564 gene locus_tag LOCUS_15320 22376 22564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 22548 23411 gene locus_tag LOCUS_15330 gene ccoP 22548 23411 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391077.1 protein_id gnl|my_center|LOCUS_15330 24334 23690 gene locus_tag LOCUS_15340 24334 23690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 24753 25571 gene locus_tag LOCUS_15350 24753 25571 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391443.1 protein_id gnl|my_center|LOCUS_15350 26067 25816 gene locus_tag LOCUS_15360 26067 25816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 27131 26133 gene locus_tag LOCUS_15370 27131 26133 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086017.1 protein_id gnl|my_center|LOCUS_15370 28111 27128 gene locus_tag LOCUS_15380 28111 27128 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267878.1 protein_id gnl|my_center|LOCUS_15380 28963 28115 gene locus_tag LOCUS_15390 28963 28115 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086015.1 protein_id gnl|my_center|LOCUS_15390 29927 28956 gene locus_tag LOCUS_15400 29927 28956 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531217.1 protein_id gnl|my_center|LOCUS_15400 31496 29964 gene locus_tag LOCUS_15410 31496 29964 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531218.1 protein_id gnl|my_center|LOCUS_15410 32610 31576 gene locus_tag LOCUS_15420 32610 31576 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088424.1 protein_id gnl|my_center|LOCUS_15420 32715 33092 gene locus_tag LOCUS_15430 32715 33092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 33710 34075 gene locus_tag LOCUS_15440 33710 34075 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391345.1 protein_id gnl|my_center|LOCUS_15440 35959 34277 gene locus_tag LOCUS_15450 35959 34277 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388915.1 protein_id gnl|my_center|LOCUS_15450 36957 36250 gene locus_tag LOCUS_15460 gene phoB 36957 36250 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388361.1 protein_id gnl|my_center|LOCUS_15460 37723 36980 gene locus_tag LOCUS_15470 gene phoU 37723 36980 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388360.1 protein_id gnl|my_center|LOCUS_15470 38592 37759 gene locus_tag LOCUS_15480 gene pstB 38592 37759 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081467712.1 protein_id gnl|my_center|LOCUS_15480 39953 38598 gene locus_tag LOCUS_15490 gene pstA 39953 38598 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388358.1 protein_id gnl|my_center|LOCUS_15490 41477 40011 gene locus_tag LOCUS_15500 gene pstC 41477 40011 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388357.1 protein_id gnl|my_center|LOCUS_15500 42687 41665 gene locus_tag LOCUS_15510 42687 41665 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 protein_id gnl|my_center|LOCUS_15510 44201 42951 gene locus_tag LOCUS_15520 gene tyrS 44201 42951 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389785.1 protein_id gnl|my_center|LOCUS_15520 44299 45468 gene locus_tag LOCUS_15530 44299 45468 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389784.1 protein_id gnl|my_center|LOCUS_15530 45517 46857 gene locus_tag LOCUS_15540 45517 46857 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969917.1 protein_id gnl|my_center|LOCUS_15540 46965 47576 gene locus_tag LOCUS_15550 46965 47576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 47798 47947 gene locus_tag LOCUS_15560 47798 47947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 48232 49395 gene locus_tag LOCUS_15570 48232 49395 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040052.1 protein_id gnl|my_center|LOCUS_15570 49485 50381 gene locus_tag LOCUS_15580 49485 50381 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810750.1 protein_id gnl|my_center|LOCUS_15580 50383 51426 gene locus_tag LOCUS_15590 50383 51426 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810748.1 protein_id gnl|my_center|LOCUS_15590 51423 52184 gene locus_tag LOCUS_15600 51423 52184 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816696.1 protein_id gnl|my_center|LOCUS_15600 >Feature sequence120 402 644 gene locus_tag LOCUS_15610 402 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 699 2915 gene locus_tag LOCUS_15620 699 2915 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556205.1 protein_id gnl|my_center|LOCUS_15620 3007 3849 gene locus_tag LOCUS_15630 3007 3849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 3929 5692 gene locus_tag LOCUS_15640 gene frdA 3929 5692 CDS product fumarate reductase (quinol) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262735.1 protein_id gnl|my_center|LOCUS_15640 5689 6435 gene locus_tag LOCUS_15650 5689 6435 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706985.1 protein_id gnl|my_center|LOCUS_15650 6432 6824 gene locus_tag LOCUS_15660 6432 6824 CDS product fumarate reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298336.1 protein_id gnl|my_center|LOCUS_15660 6826 7173 gene locus_tag LOCUS_15670 gene frdD 6826 7173 CDS product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706986.1 protein_id gnl|my_center|LOCUS_15670 7472 10552 gene locus_tag LOCUS_15680 gene treY 7472 10552 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014454409.1 protein_id gnl|my_center|LOCUS_15680 12115 10568 gene locus_tag LOCUS_15690 12115 10568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 12379 12305 gene locus_tag LOCUS_t00270 12379 12305 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 13187 12459 gene locus_tag LOCUS_15700 gene gph 13187 12459 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390779.1 protein_id gnl|my_center|LOCUS_15700 13362 14705 gene locus_tag LOCUS_15710 gene glmU 13362 14705 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626497.1 protein_id gnl|my_center|LOCUS_15710 14725 16554 gene locus_tag LOCUS_15720 gene glmS 14725 16554 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390777.1 protein_id gnl|my_center|LOCUS_15720 16855 18012 gene locus_tag LOCUS_15730 16855 18012 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942829.1 protein_id gnl|my_center|LOCUS_15730 18873 18223 gene locus_tag LOCUS_15740 18873 18223 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_15740 18922 19725 gene locus_tag LOCUS_15750 18922 19725 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390265.1 protein_id gnl|my_center|LOCUS_15750 19840 20004 gene locus_tag LOCUS_15760 19840 20004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 21536 20241 gene locus_tag LOCUS_15770 21536 20241 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391407.1 protein_id gnl|my_center|LOCUS_15770 22539 21574 gene locus_tag LOCUS_15780 gene htpX 22539 21574 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391326.1 protein_id gnl|my_center|LOCUS_15780 22632 23567 gene locus_tag LOCUS_15790 gene mepA 22632 23567 CDS product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171929.1 protein_id gnl|my_center|LOCUS_15790 23655 25415 gene locus_tag LOCUS_15800 23655 25415 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389689.1 protein_id gnl|my_center|LOCUS_15800 25610 27505 gene locus_tag LOCUS_15810 25610 27505 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388801.1 protein_id gnl|my_center|LOCUS_15810 27881 30478 gene locus_tag LOCUS_15820 27881 30478 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390885.1 protein_id gnl|my_center|LOCUS_15820 31920 30523 gene locus_tag LOCUS_15830 gene thrC 31920 30523 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390981.1 protein_id gnl|my_center|LOCUS_15830 32696 31971 gene locus_tag LOCUS_15840 32696 31971 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731199.1 protein_id gnl|my_center|LOCUS_15840 33144 33458 gene locus_tag LOCUS_15850 gene trxA 33144 33458 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391180.1 protein_id gnl|my_center|LOCUS_15850 34390 33665 gene locus_tag LOCUS_15860 34390 33665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 36111 34720 gene locus_tag LOCUS_15870 36111 34720 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390030.1 protein_id gnl|my_center|LOCUS_15870 36555 36124 gene locus_tag LOCUS_15880 36555 36124 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390031.1 protein_id gnl|my_center|LOCUS_15880 37724 36570 gene locus_tag LOCUS_15890 37724 36570 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390032.1 protein_id gnl|my_center|LOCUS_15890 38313 39128 gene locus_tag LOCUS_15900 38313 39128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 39199 39753 gene locus_tag LOCUS_15910 39199 39753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 39882 40694 gene locus_tag LOCUS_15920 39882 40694 CDS product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390537.1 protein_id gnl|my_center|LOCUS_15920 40952 40704 gene locus_tag LOCUS_15930 40952 40704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388150.1 protein_id gnl|my_center|LOCUS_15930 42119 41319 gene locus_tag LOCUS_15940 42119 41319 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389537.1 protein_id gnl|my_center|LOCUS_15940 42229 42933 gene locus_tag LOCUS_15950 42229 42933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389536.1 protein_id gnl|my_center|LOCUS_15950 43074 43958 gene locus_tag LOCUS_15960 43074 43958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 43996 44364 gene locus_tag LOCUS_15970 43996 44364 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389491.1 protein_id gnl|my_center|LOCUS_15970 47126 44931 gene locus_tag LOCUS_15980 gene scpA 47126 44931 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390232.1 protein_id gnl|my_center|LOCUS_15980 49255 47123 gene locus_tag LOCUS_15990 49255 47123 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390233.1 protein_id gnl|my_center|LOCUS_15990 49764 49405 gene locus_tag LOCUS_16000 49764 49405 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331456.1 protein_id gnl|my_center|LOCUS_16000 51097 49958 gene locus_tag LOCUS_16010 gene mltG 51097 49958 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388178.1 protein_id gnl|my_center|LOCUS_16010 52379 51108 gene locus_tag LOCUS_16020 gene fabF 52379 51108 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388177.1 protein_id gnl|my_center|LOCUS_16020 52835 52599 gene locus_tag LOCUS_16030 52835 52599 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388176.1 protein_id gnl|my_center|LOCUS_16030 53865 53125 gene locus_tag LOCUS_16040 gene fabG 53865 53125 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719615.1 protein_id gnl|my_center|LOCUS_16040 54927 53950 gene locus_tag LOCUS_16050 gene fabD 54927 53950 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388174.1 protein_id gnl|my_center|LOCUS_16050 55412 55882 gene locus_tag LOCUS_16060 55412 55882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 55886 56116 gene locus_tag LOCUS_16070 gene rpsR 55886 56116 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007592020.1 protein_id gnl|my_center|LOCUS_16070 56175 57146 gene locus_tag LOCUS_16080 56175 57146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388171.1 protein_id gnl|my_center|LOCUS_16080 57149 57754 gene locus_tag LOCUS_16090 gene rplI 57149 57754 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625933.1 protein_id gnl|my_center|LOCUS_16090 57905 58834 gene locus_tag LOCUS_16100 57905 58834 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391485.1 protein_id gnl|my_center|LOCUS_16100 58831 60060 gene locus_tag LOCUS_16110 58831 60060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 60533 60057 gene locus_tag LOCUS_16120 60533 60057 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388408.1 protein_id gnl|my_center|LOCUS_16120 60639 61169 gene locus_tag LOCUS_16130 60639 61169 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329295.1 protein_id gnl|my_center|LOCUS_16130 63943 61235 gene locus_tag LOCUS_16140 63943 61235 CDS product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626250.1 protein_id gnl|my_center|LOCUS_16140 65576 64299 gene locus_tag LOCUS_16150 gene eno 65576 64299 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389638.1 protein_id gnl|my_center|LOCUS_16150 66539 65661 gene locus_tag LOCUS_16160 gene kdsA 66539 65661 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389639.1 protein_id gnl|my_center|LOCUS_16160 68226 66592 gene locus_tag LOCUS_16170 68226 66592 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389640.1 protein_id gnl|my_center|LOCUS_16170 68764 68372 gene locus_tag LOCUS_16180 gene secG 68764 68372 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389641.1 protein_id gnl|my_center|LOCUS_16180 69204 71906 gene locus_tag LOCUS_16190 gene lptD 69204 71906 CDS product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388193.1 protein_id gnl|my_center|LOCUS_16190 71917 73236 gene locus_tag LOCUS_16200 71917 73236 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625938.1 protein_id gnl|my_center|LOCUS_16200 73279 74337 gene locus_tag LOCUS_16210 gene pdxA 73279 74337 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388191.1 protein_id gnl|my_center|LOCUS_16210 74334 75200 gene locus_tag LOCUS_16220 gene rsmA 74334 75200 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388190.1 protein_id gnl|my_center|LOCUS_16220 75989 75207 gene locus_tag LOCUS_16230 75989 75207 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389242.1 protein_id gnl|my_center|LOCUS_16230 76328 77701 gene locus_tag LOCUS_16240 76328 77701 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387885.1 protein_id gnl|my_center|LOCUS_16240 77694 79169 gene locus_tag LOCUS_16250 77694 79169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 79166 79918 gene locus_tag LOCUS_16260 79166 79918 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387887.1 protein_id gnl|my_center|LOCUS_16260 80659 79931 gene locus_tag LOCUS_16270 80659 79931 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965197.1 protein_id gnl|my_center|LOCUS_16270 81137 82228 gene locus_tag LOCUS_16280 81137 82228 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722797.1 protein_id gnl|my_center|LOCUS_16280 82294 83394 gene locus_tag LOCUS_16290 82294 83394 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012643541.1 protein_id gnl|my_center|LOCUS_16290 83516 84793 gene locus_tag LOCUS_16300 83516 84793 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337052.1 protein_id gnl|my_center|LOCUS_16300 84818 85672 gene locus_tag LOCUS_16310 84818 85672 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455010.1 protein_id gnl|my_center|LOCUS_16310 85683 86714 gene locus_tag LOCUS_16320 85683 86714 CDS product C45 family autoproteolytic acyltransferase/hydolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190976.1 protein_id gnl|my_center|LOCUS_16320 86763 87539 gene locus_tag LOCUS_16330 86763 87539 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977492.1 protein_id gnl|my_center|LOCUS_16330 87644 88471 gene locus_tag LOCUS_16340 87644 88471 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389564.1 protein_id gnl|my_center|LOCUS_16340 88510 88794 gene locus_tag LOCUS_16350 88510 88794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 89629 88814 gene locus_tag LOCUS_16360 89629 88814 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816142.1 protein_id gnl|my_center|LOCUS_16360 89655 90041 gene locus_tag LOCUS_16370 89655 90041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 91112 90126 gene locus_tag LOCUS_16380 gene cobS 91112 90126 CDS product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387959.1 protein_id gnl|my_center|LOCUS_16380 91664 91191 gene locus_tag LOCUS_16390 91664 91191 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387958.1 protein_id gnl|my_center|LOCUS_16390 92031 92375 gene locus_tag LOCUS_16400 92031 92375 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387957.1 protein_id gnl|my_center|LOCUS_16400 92458 93366 gene locus_tag LOCUS_16410 92458 93366 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064986.1 protein_id gnl|my_center|LOCUS_16410 94272 93571 gene locus_tag LOCUS_16420 94272 93571 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388998.1 protein_id gnl|my_center|LOCUS_16420 94624 94319 gene locus_tag LOCUS_16430 94624 94319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 94797 95306 gene locus_tag LOCUS_16440 94797 95306 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390934.1 protein_id gnl|my_center|LOCUS_16440 95306 95977 gene locus_tag LOCUS_16450 95306 95977 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339372.1 protein_id gnl|my_center|LOCUS_16450 95974 97407 gene locus_tag LOCUS_16460 95974 97407 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339373.1 protein_id gnl|my_center|LOCUS_16460 97480 97635 gene locus_tag LOCUS_16470 97480 97635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 100618 97886 gene locus_tag LOCUS_16480 100618 97886 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390447.1 protein_id gnl|my_center|LOCUS_16480 101654 100587 gene locus_tag LOCUS_16490 gene flhB 101654 100587 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390448.1 protein_id gnl|my_center|LOCUS_16490 102436 101675 gene locus_tag LOCUS_16500 gene fliR 102436 101675 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390449.1 protein_id gnl|my_center|LOCUS_16500 102737 102471 gene locus_tag LOCUS_16510 gene fliQ 102737 102471 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626457.1 protein_id gnl|my_center|LOCUS_16510 103135 102809 gene locus_tag LOCUS_16520 103135 102809 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390451.1 protein_id gnl|my_center|LOCUS_16520 103598 103188 gene locus_tag LOCUS_16530 gene flgC 103598 103188 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390452.1 protein_id gnl|my_center|LOCUS_16530 104055 103639 gene locus_tag LOCUS_16540 gene flgB 104055 103639 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626458.1 protein_id gnl|my_center|LOCUS_16540 104318 104070 gene locus_tag LOCUS_16550 104318 104070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 104251 104670 gene locus_tag LOCUS_16560 104251 104670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 104667 105263 gene locus_tag LOCUS_16570 104667 105263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 105327 105698 gene locus_tag LOCUS_16580 105327 105698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 105713 106501 gene locus_tag LOCUS_16590 gene fliP 105713 106501 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390457.1 protein_id gnl|my_center|LOCUS_16590 106686 107147 gene locus_tag LOCUS_16600 106686 107147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 107845 107198 gene locus_tag LOCUS_16610 107845 107198 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966301.1 protein_id gnl|my_center|LOCUS_16610 110649 108202 gene locus_tag LOCUS_16620 110649 108202 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971758.1 protein_id gnl|my_center|LOCUS_16620 111573 110902 gene locus_tag LOCUS_16630 111573 110902 CDS product sarcosine oxidase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973541.1 protein_id gnl|my_center|LOCUS_16630 114616 111554 gene locus_tag LOCUS_16640 114616 111554 CDS product sarcosine oxidase subunit alpha family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202495.1 protein_id gnl|my_center|LOCUS_16640 114912 114613 gene locus_tag LOCUS_16650 114912 114613 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229308.1 protein_id gnl|my_center|LOCUS_16650 116203 114950 gene locus_tag LOCUS_16660 116203 114950 CDS product sarcosine oxidase subunit beta family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524302.1 protein_id gnl|my_center|LOCUS_16660 116496 117503 gene locus_tag LOCUS_16670 116496 117503 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399686.1 protein_id gnl|my_center|LOCUS_16670 117624 118790 gene locus_tag LOCUS_16680 117624 118790 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402189.1 protein_id gnl|my_center|LOCUS_16680 119158 119439 gene locus_tag LOCUS_16690 119158 119439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 120073 119450 gene locus_tag LOCUS_16700 gene elbB 120073 119450 CDS product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390979.1 protein_id gnl|my_center|LOCUS_16700 121145 120234 gene locus_tag LOCUS_16710 121145 120234 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338699.1 protein_id gnl|my_center|LOCUS_16710 121534 121217 gene locus_tag LOCUS_16720 121534 121217 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626266.1 protein_id gnl|my_center|LOCUS_16720 122744 121923 gene locus_tag LOCUS_16730 122744 121923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 123732 122845 gene locus_tag LOCUS_16740 123732 122845 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626403.1 protein_id gnl|my_center|LOCUS_16740 123935 124009 gene locus_tag LOCUS_t00280 123935 124009 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 124245 125117 gene locus_tag LOCUS_16750 124245 125117 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384138.1 protein_id gnl|my_center|LOCUS_16750 125114 125818 gene locus_tag LOCUS_16760 125114 125818 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720082.1 protein_id gnl|my_center|LOCUS_16760 125828 126688 gene locus_tag LOCUS_16770 125828 126688 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057431.1 protein_id gnl|my_center|LOCUS_16770 126705 127643 gene locus_tag LOCUS_16780 126705 127643 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173609.1 protein_id gnl|my_center|LOCUS_16780 128365 127898 gene locus_tag LOCUS_16790 gene bamE 128365 127898 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389352.1 protein_id gnl|my_center|LOCUS_16790 128623 129243 gene locus_tag LOCUS_16800 128623 129243 CDS product ubiquinol-cytochrome C chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389353.1 protein_id gnl|my_center|LOCUS_16800 129252 129848 gene locus_tag LOCUS_16810 129252 129848 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389354.1 protein_id gnl|my_center|LOCUS_16810 130089 130271 gene locus_tag LOCUS_16820 gene rpmF 130089 130271 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389355.1 protein_id gnl|my_center|LOCUS_16820 130359 131420 gene locus_tag LOCUS_16830 gene plsX 130359 131420 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389356.1 protein_id gnl|my_center|LOCUS_16830 131420 132397 gene locus_tag LOCUS_16840 131420 132397 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389357.1 protein_id gnl|my_center|LOCUS_16840 132696 133013 gene locus_tag LOCUS_16850 132696 133013 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389358.1 protein_id gnl|my_center|LOCUS_16850 133013 133645 gene locus_tag LOCUS_16860 133013 133645 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389359.1 protein_id gnl|my_center|LOCUS_16860 134766 133894 gene locus_tag LOCUS_16870 134766 133894 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389519.1 protein_id gnl|my_center|LOCUS_16870 134981 135071 gene locus_tag LOCUS_t00290 134981 135071 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 135126 135575 gene locus_tag LOCUS_16880 135126 135575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 135616 137178 gene locus_tag LOCUS_16890 135616 137178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16890 137191 138168 gene locus_tag LOCUS_16900 137191 138168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16900 138234 138596 gene locus_tag LOCUS_16910 138234 138596 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389515.1 protein_id gnl|my_center|LOCUS_16910 138709 138785 gene locus_tag LOCUS_t00300 138709 138785 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 139986 138877 gene locus_tag LOCUS_16920 139986 138877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 140211 141443 gene locus_tag LOCUS_16930 140211 141443 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382995.1 protein_id gnl|my_center|LOCUS_16930 141440 142213 gene locus_tag LOCUS_16940 141440 142213 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173869.1 protein_id gnl|my_center|LOCUS_16940 144727 142214 gene locus_tag LOCUS_16950 144727 142214 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942708.1 protein_id gnl|my_center|LOCUS_16950 148759 144869 gene locus_tag LOCUS_16960 gene cobN 148759 144869 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066873425.1 protein_id gnl|my_center|LOCUS_16960 149863 148877 gene locus_tag LOCUS_16970 149863 148877 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391115.1 protein_id gnl|my_center|LOCUS_16970 151585 150017 gene locus_tag LOCUS_16980 151585 150017 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119278.1 protein_id gnl|my_center|LOCUS_16980 152752 151844 gene locus_tag LOCUS_16990 152752 151844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 153101 153847 gene locus_tag LOCUS_17000 gene aruR 153101 153847 CDS product two-component system response regulator AruR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095718.1 protein_id gnl|my_center|LOCUS_17000 158671 153854 gene locus_tag LOCUS_17010 158671 153854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 159073 158684 gene locus_tag LOCUS_17020 159073 158684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 159077 159322 gene locus_tag LOCUS_17030 159077 159322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 159453 159656 gene locus_tag LOCUS_17040 gene rpmI 159453 159656 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391268.1 protein_id gnl|my_center|LOCUS_17040 159704 160060 gene locus_tag LOCUS_17050 gene rplT 159704 160060 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391269.1 protein_id gnl|my_center|LOCUS_17050 160296 161372 gene locus_tag LOCUS_17060 gene pheS 160296 161372 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391270.1 protein_id gnl|my_center|LOCUS_17060 161369 163780 gene locus_tag LOCUS_17070 gene pheT 161369 163780 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391271.1 protein_id gnl|my_center|LOCUS_17070 163894 164808 gene locus_tag LOCUS_17080 163894 164808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 164890 165639 gene locus_tag LOCUS_17090 164890 165639 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963158.1 protein_id gnl|my_center|LOCUS_17090 165745 166134 gene locus_tag LOCUS_17100 165745 166134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927161.1 protein_id gnl|my_center|LOCUS_17100 166353 167429 gene locus_tag LOCUS_17110 166353 167429 CDS product ChaN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113451.1 protein_id gnl|my_center|LOCUS_17110 167526 168911 gene locus_tag LOCUS_17120 167526 168911 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073584.1 protein_id gnl|my_center|LOCUS_17120 169312 168932 gene locus_tag LOCUS_17130 169312 168932 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141056643.1 protein_id gnl|my_center|LOCUS_17130 169641 169309 gene locus_tag LOCUS_17140 169641 169309 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403413.1 protein_id gnl|my_center|LOCUS_17140 171944 169677 gene locus_tag LOCUS_17150 171944 169677 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529032.1 protein_id gnl|my_center|LOCUS_17150 172032 172694 gene locus_tag LOCUS_17160 gene fsa 172032 172694 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720727.1 protein_id gnl|my_center|LOCUS_17160 172787 174010 gene locus_tag LOCUS_17170 172787 174010 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626386.1 protein_id gnl|my_center|LOCUS_17170 174079 174351 gene locus_tag LOCUS_17180 174079 174351 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037389965.1 protein_id gnl|my_center|LOCUS_17180 174348 174941 gene locus_tag LOCUS_17190 174348 174941 CDS product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143855.1 protein_id gnl|my_center|LOCUS_17190 177729 175090 gene locus_tag LOCUS_17200 177729 175090 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387818.1 protein_id gnl|my_center|LOCUS_17200 177914 178132 gene locus_tag LOCUS_17210 177914 178132 CDS product DUF3126 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389736.1 protein_id gnl|my_center|LOCUS_17210 178925 178161 gene locus_tag LOCUS_17220 178925 178161 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389598.1 protein_id gnl|my_center|LOCUS_17220 180334 179279 gene locus_tag LOCUS_17230 180334 179279 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389596.1 protein_id gnl|my_center|LOCUS_17230 181310 180453 gene locus_tag LOCUS_17240 gene motA 181310 180453 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389595.1 protein_id gnl|my_center|LOCUS_17240 181580 182020 gene locus_tag LOCUS_17250 181580 182020 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389594.1 protein_id gnl|my_center|LOCUS_17250 182092 183678 gene locus_tag LOCUS_17260 182092 183678 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389658.1 protein_id gnl|my_center|LOCUS_17260 183668 184786 gene locus_tag LOCUS_17270 183668 184786 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389657.1 protein_id gnl|my_center|LOCUS_17270 184788 185717 gene locus_tag LOCUS_17280 184788 185717 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389656.1 protein_id gnl|my_center|LOCUS_17280 185792 186541 gene locus_tag LOCUS_17290 185792 186541 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921117.1 protein_id gnl|my_center|LOCUS_17290 187433 186834 gene locus_tag LOCUS_17300 187433 186834 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440414.1 protein_id gnl|my_center|LOCUS_17300 187524 188393 gene locus_tag LOCUS_17310 187524 188393 CDS product squalene/phytoene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389512.1 protein_id gnl|my_center|LOCUS_17310 188851 189069 gene locus_tag LOCUS_17320 188851 189069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 190772 189183 gene locus_tag LOCUS_17330 190772 189183 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035546.1 protein_id gnl|my_center|LOCUS_17330 192604 190823 gene locus_tag LOCUS_17340 192604 190823 CDS product TRAP transporter fused permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271912.1 protein_id gnl|my_center|LOCUS_17340 193724 192690 gene locus_tag LOCUS_17350 193724 192690 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064624.1 protein_id gnl|my_center|LOCUS_17350 195364 193760 gene locus_tag LOCUS_17360 195364 193760 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139954.1 protein_id gnl|my_center|LOCUS_17360 196504 195665 gene locus_tag LOCUS_17370 196504 195665 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389482.1 protein_id gnl|my_center|LOCUS_17370 >Feature sequence121 336 1190 gene locus_tag LOCUS_17380 336 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 2004 1210 gene locus_tag LOCUS_17390 2004 1210 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390005.1 protein_id gnl|my_center|LOCUS_17390 2684 2061 gene locus_tag LOCUS_17400 2684 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528236.1 protein_id gnl|my_center|LOCUS_17400 2776 3264 gene locus_tag LOCUS_17410 2776 3264 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087727.1 protein_id gnl|my_center|LOCUS_17410 3417 3881 gene locus_tag LOCUS_17420 gene rplM 3417 3881 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390001.1 protein_id gnl|my_center|LOCUS_17420 3885 4400 gene locus_tag LOCUS_17430 gene rpsI 3885 4400 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390000.1 protein_id gnl|my_center|LOCUS_17430 4653 5666 gene locus_tag LOCUS_17440 4653 5666 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721134.1 protein_id gnl|my_center|LOCUS_17440 5760 6326 gene locus_tag LOCUS_17450 5760 6326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 6323 7594 gene locus_tag LOCUS_17460 6323 7594 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813565.1 protein_id gnl|my_center|LOCUS_17460 7726 8949 gene locus_tag LOCUS_17470 7726 8949 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390164.1 protein_id gnl|my_center|LOCUS_17470 8955 10247 gene locus_tag LOCUS_17480 8955 10247 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390163.1 protein_id gnl|my_center|LOCUS_17480 10407 11432 gene locus_tag LOCUS_17490 gene glpX 10407 11432 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390162.1 protein_id gnl|my_center|LOCUS_17490 11429 13207 gene locus_tag LOCUS_17500 gene recJ 11429 13207 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390161.1 protein_id gnl|my_center|LOCUS_17500 13373 14683 gene locus_tag LOCUS_17510 13373 14683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 14781 16082 gene locus_tag LOCUS_17520 14781 16082 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626230.1 protein_id gnl|my_center|LOCUS_17520 16261 17184 gene locus_tag LOCUS_17530 16261 17184 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389395.1 protein_id gnl|my_center|LOCUS_17530 17286 18554 gene locus_tag LOCUS_17540 17286 18554 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389394.1 protein_id gnl|my_center|LOCUS_17540 18562 19239 gene locus_tag LOCUS_17550 gene tmk 18562 19239 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626229.1 protein_id gnl|my_center|LOCUS_17550 19250 20398 gene locus_tag LOCUS_17560 19250 20398 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389392.1 protein_id gnl|my_center|LOCUS_17560 20448 22004 gene locus_tag LOCUS_17570 gene metG 20448 22004 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389391.1 protein_id gnl|my_center|LOCUS_17570 22008 22805 gene locus_tag LOCUS_17580 22008 22805 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389390.1 protein_id gnl|my_center|LOCUS_17580 22809 23690 gene locus_tag LOCUS_17590 22809 23690 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389389.1 protein_id gnl|my_center|LOCUS_17590 25211 23829 gene locus_tag LOCUS_17600 25211 23829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 25311 28790 gene locus_tag LOCUS_17610 gene dnaE 25311 28790 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389457.1 protein_id gnl|my_center|LOCUS_17610 29408 28896 gene locus_tag LOCUS_17620 29408 28896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 29671 29417 gene locus_tag LOCUS_17630 29671 29417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 31892 29859 gene locus_tag LOCUS_17640 31892 29859 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388895.1 protein_id gnl|my_center|LOCUS_17640 32578 32192 gene locus_tag LOCUS_17650 32578 32192 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387836.1 protein_id gnl|my_center|LOCUS_17650 35157 32575 gene locus_tag LOCUS_17660 35157 32575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17660 35619 35278 gene locus_tag LOCUS_17670 35619 35278 CDS product HPF/RaiA family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387834.1 protein_id gnl|my_center|LOCUS_17670 35995 37899 gene locus_tag LOCUS_17680 gene htpG 35995 37899 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387833.1 protein_id gnl|my_center|LOCUS_17680 38409 37933 gene locus_tag LOCUS_17690 38409 37933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 40521 38452 gene locus_tag LOCUS_17700 40521 38452 CDS product protein kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388862.1 protein_id gnl|my_center|LOCUS_17700 41914 40625 gene locus_tag LOCUS_17710 41914 40625 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388861.1 protein_id gnl|my_center|LOCUS_17710 42958 41984 gene locus_tag LOCUS_17720 42958 41984 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388962.1 protein_id gnl|my_center|LOCUS_17720 44150 43086 gene locus_tag LOCUS_17730 44150 43086 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390379.1 protein_id gnl|my_center|LOCUS_17730 44996 44220 gene locus_tag LOCUS_17740 44996 44220 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390406.1 protein_id gnl|my_center|LOCUS_17740 47595 45082 gene locus_tag LOCUS_17750 47595 45082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 48425 47745 gene locus_tag LOCUS_17760 48425 47745 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390408.1 protein_id gnl|my_center|LOCUS_17760 48868 48422 gene locus_tag LOCUS_17770 48868 48422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 49851 48865 gene locus_tag LOCUS_17780 49851 48865 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390409.1 protein_id gnl|my_center|LOCUS_17780 50288 49905 gene locus_tag LOCUS_17790 gene crcB 50288 49905 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971646.1 protein_id gnl|my_center|LOCUS_17790 50489 50707 gene locus_tag LOCUS_17800 50489 50707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 >Feature sequence122 323 973 gene locus_tag LOCUS_17810 323 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 1750 983 gene locus_tag LOCUS_17820 1750 983 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390370.1 protein_id gnl|my_center|LOCUS_17820 2463 1747 gene locus_tag LOCUS_17830 gene dnaQ 2463 1747 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391358.1 protein_id gnl|my_center|LOCUS_17830 3134 2460 gene locus_tag LOCUS_17840 gene coaE 3134 2460 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391359.1 protein_id gnl|my_center|LOCUS_17840 4027 3131 gene locus_tag LOCUS_17850 4027 3131 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391360.1 protein_id gnl|my_center|LOCUS_17850 4659 4024 gene locus_tag LOCUS_17860 4659 4024 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083465.1 protein_id gnl|my_center|LOCUS_17860 5506 4667 gene locus_tag LOCUS_17870 5506 4667 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391362.1 protein_id gnl|my_center|LOCUS_17870 6087 7157 gene locus_tag LOCUS_17880 gene hemE 6087 7157 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391363.1 protein_id gnl|my_center|LOCUS_17880 7218 8327 gene locus_tag LOCUS_17890 gene hemH 7218 8327 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391364.1 protein_id gnl|my_center|LOCUS_17890 8370 8828 gene locus_tag LOCUS_17900 gene hemJ 8370 8828 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391365.1 protein_id gnl|my_center|LOCUS_17900 10260 9556 gene locus_tag LOCUS_17910 10260 9556 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626211.1 protein_id gnl|my_center|LOCUS_17910 10733 12181 gene locus_tag LOCUS_17920 10733 12181 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391106.1 protein_id gnl|my_center|LOCUS_17920 12396 12935 gene locus_tag LOCUS_17930 12396 12935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 12938 13666 gene locus_tag LOCUS_17940 12938 13666 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391101.1 protein_id gnl|my_center|LOCUS_17940 17303 13698 gene locus_tag LOCUS_17950 17303 13698 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389864.1 protein_id gnl|my_center|LOCUS_17950 17697 17512 gene locus_tag LOCUS_17960 17697 17512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 17696 18649 gene locus_tag LOCUS_17970 17696 18649 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625895.1 protein_id gnl|my_center|LOCUS_17970 18705 19238 gene locus_tag LOCUS_17980 18705 19238 CDS product L-2-amino-thiazoline-4-carboxylic acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390622.1 protein_id gnl|my_center|LOCUS_17980 19235 20425 gene locus_tag LOCUS_17990 19235 20425 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390621.1 protein_id gnl|my_center|LOCUS_17990 20783 21808 gene locus_tag LOCUS_18000 20783 21808 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389867.1 protein_id gnl|my_center|LOCUS_18000 23080 22103 gene locus_tag LOCUS_18010 23080 22103 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387970.1 protein_id gnl|my_center|LOCUS_18010 23577 24386 gene locus_tag LOCUS_18020 gene iclR 23577 24386 CDS product glyoxylate bypass operon transcriptional repressor IclR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095025.1 protein_id gnl|my_center|LOCUS_18020 25129 24383 gene locus_tag LOCUS_18030 25129 24383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 25458 26477 gene locus_tag LOCUS_18040 25458 26477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 26667 27332 gene locus_tag LOCUS_18050 26667 27332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 27857 27378 gene locus_tag LOCUS_18060 27857 27378 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975694.1 protein_id gnl|my_center|LOCUS_18060 28181 28741 gene locus_tag LOCUS_18070 gene petA 28181 28741 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388117.1 protein_id gnl|my_center|LOCUS_18070 28746 29987 gene locus_tag LOCUS_18080 28746 29987 CDS product cytochrome b/b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388116.1 protein_id gnl|my_center|LOCUS_18080 29984 30793 gene locus_tag LOCUS_18090 29984 30793 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388115.1 protein_id gnl|my_center|LOCUS_18090 32917 31523 gene locus_tag LOCUS_18100 32917 31523 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390789.1 protein_id gnl|my_center|LOCUS_18100 33004 33978 gene locus_tag LOCUS_18110 33004 33978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 33972 34199 gene locus_tag LOCUS_18120 33972 34199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 35227 34223 gene locus_tag LOCUS_18130 gene glk 35227 34223 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390239.1 protein_id gnl|my_center|LOCUS_18130 36671 35250 gene locus_tag LOCUS_18140 36671 35250 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390238.1 protein_id gnl|my_center|LOCUS_18140 39271 36824 gene locus_tag LOCUS_18150 39271 36824 CDS product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027248.1 protein_id gnl|my_center|LOCUS_18150 40282 39458 gene locus_tag LOCUS_18160 gene otsB 40282 39458 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390302.1 protein_id gnl|my_center|LOCUS_18160 41030 40272 gene locus_tag LOCUS_18170 41030 40272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18170 41463 41906 gene locus_tag LOCUS_18180 41463 41906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 42764 41919 gene locus_tag LOCUS_18190 gene rlmJ 42764 41919 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389691.1 protein_id gnl|my_center|LOCUS_18190 44550 42784 gene locus_tag LOCUS_18200 gene phaC 44550 42784 CDS product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390166.1 protein_id gnl|my_center|LOCUS_18200 44756 44830 gene locus_tag LOCUS_t00310 44756 44830 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 45026 46111 gene locus_tag LOCUS_18210 gene cobW 45026 46111 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388429.1 protein_id gnl|my_center|LOCUS_18210 46206 46895 gene locus_tag LOCUS_18220 46206 46895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18220 46802 47227 gene locus_tag LOCUS_18230 46802 47227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18230 47224 47691 gene locus_tag LOCUS_18240 47224 47691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 47854 49350 gene locus_tag LOCUS_18250 47854 49350 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085833.1 protein_id gnl|my_center|LOCUS_18250 49440 50186 gene locus_tag LOCUS_18260 49440 50186 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966100.1 protein_id gnl|my_center|LOCUS_18260 >Feature sequence123 2454 379 gene locus_tag LOCUS_18270 2454 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 4916 2337 gene locus_tag LOCUS_18280 4916 2337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 5136 6716 gene locus_tag LOCUS_18290 5136 6716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 6719 7912 gene locus_tag LOCUS_18300 6719 7912 CDS product glycine amidinotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228026.1 protein_id gnl|my_center|LOCUS_18300 8923 7922 gene locus_tag LOCUS_18310 8923 7922 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140080.1 protein_id gnl|my_center|LOCUS_18310 9228 9710 gene locus_tag LOCUS_18320 9228 9710 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259306.1 protein_id gnl|my_center|LOCUS_18320 9715 12108 gene locus_tag LOCUS_18330 9715 12108 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388721.1 protein_id gnl|my_center|LOCUS_18330 12132 12926 gene locus_tag LOCUS_18340 12132 12926 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088410.1 protein_id gnl|my_center|LOCUS_18340 13324 13076 gene locus_tag LOCUS_18350 13324 13076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 14600 13698 gene locus_tag LOCUS_18360 14600 13698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 14870 15814 gene locus_tag LOCUS_18370 14870 15814 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088409.1 protein_id gnl|my_center|LOCUS_18370 15795 17048 gene locus_tag LOCUS_18380 15795 17048 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388724.1 protein_id gnl|my_center|LOCUS_18380 18586 17264 gene locus_tag LOCUS_18390 18586 17264 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339198.1 protein_id gnl|my_center|LOCUS_18390 19942 18782 gene locus_tag LOCUS_18400 19942 18782 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704392.1 protein_id gnl|my_center|LOCUS_18400 23745 19957 gene locus_tag LOCUS_18410 23745 19957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 24576 23752 gene locus_tag LOCUS_18420 gene modA 24576 23752 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249668.1 protein_id gnl|my_center|LOCUS_18420 25868 24981 gene locus_tag LOCUS_18430 25868 24981 CDS product prephenate/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391011.1 protein_id gnl|my_center|LOCUS_18430 26956 25865 gene locus_tag LOCUS_18440 gene hisC 26956 25865 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391012.1 protein_id gnl|my_center|LOCUS_18440 27900 27040 gene locus_tag LOCUS_18450 27900 27040 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391013.1 protein_id gnl|my_center|LOCUS_18450 28105 27935 gene locus_tag LOCUS_18460 28105 27935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 28090 29247 gene locus_tag LOCUS_18470 28090 29247 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391014.1 protein_id gnl|my_center|LOCUS_18470 29244 29945 gene locus_tag LOCUS_18480 gene metW 29244 29945 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391015.1 protein_id gnl|my_center|LOCUS_18480 29942 30550 gene locus_tag LOCUS_18490 29942 30550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 31792 30587 gene locus_tag LOCUS_18500 31792 30587 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968018.1 protein_id gnl|my_center|LOCUS_18500 32242 31868 gene locus_tag LOCUS_18510 32242 31868 CDS product DUF5368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390059.1 protein_id gnl|my_center|LOCUS_18510 33611 32265 gene locus_tag LOCUS_18520 33611 32265 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390060.1 protein_id gnl|my_center|LOCUS_18520 34412 33801 gene locus_tag LOCUS_18530 34412 33801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 34880 34458 gene locus_tag LOCUS_18540 34880 34458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 35429 34974 gene locus_tag LOCUS_18550 gene zur 35429 34974 CDS product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971685.1 protein_id gnl|my_center|LOCUS_18550 36244 35426 gene locus_tag LOCUS_18560 gene znuB 36244 35426 CDS product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975837.1 protein_id gnl|my_center|LOCUS_18560 37037 36234 gene locus_tag LOCUS_18570 37037 36234 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240527.1 protein_id gnl|my_center|LOCUS_18570 37163 38164 gene locus_tag LOCUS_18580 gene znuA 37163 38164 CDS product zinc ABC transporter substrate-binding protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971688.1 protein_id gnl|my_center|LOCUS_18580 38474 39424 gene locus_tag LOCUS_18590 38474 39424 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360266.1 protein_id gnl|my_center|LOCUS_18590 40807 39452 gene locus_tag LOCUS_18600 40807 39452 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258192.1 protein_id gnl|my_center|LOCUS_18600 41559 40972 gene locus_tag LOCUS_18610 41559 40972 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257143.1 protein_id gnl|my_center|LOCUS_18610 42782 41688 gene locus_tag LOCUS_18620 42782 41688 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970762.1 protein_id gnl|my_center|LOCUS_18620 43932 43192 gene locus_tag LOCUS_18630 gene map 43932 43192 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388491.1 protein_id gnl|my_center|LOCUS_18630 44720 44004 gene locus_tag LOCUS_18640 gene sfsA 44720 44004 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388493.1 protein_id gnl|my_center|LOCUS_18640 45816 44878 gene locus_tag LOCUS_18650 45816 44878 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388494.1 protein_id gnl|my_center|LOCUS_18650 45872 46681 gene locus_tag LOCUS_18660 45872 46681 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388495.1 protein_id gnl|my_center|LOCUS_18660 46683 49190 gene locus_tag LOCUS_18670 gene hrpB 46683 49190 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440436.1 protein_id gnl|my_center|LOCUS_18670 49219 49581 gene locus_tag LOCUS_18680 49219 49581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 >Feature sequence124 1261 323 gene locus_tag LOCUS_18690 1261 323 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390930.1 protein_id gnl|my_center|LOCUS_18690 2289 1303 gene locus_tag LOCUS_18700 2289 1303 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391537.1 protein_id gnl|my_center|LOCUS_18700 2526 3014 gene locus_tag LOCUS_18710 2526 3014 CDS product LEA type 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112629.1 protein_id gnl|my_center|LOCUS_18710 3045 4274 gene locus_tag LOCUS_18720 3045 4274 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921422.1 protein_id gnl|my_center|LOCUS_18720 4377 4946 gene locus_tag LOCUS_18730 gene hslV 4377 4946 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391346.1 protein_id gnl|my_center|LOCUS_18730 5004 6314 gene locus_tag LOCUS_18740 gene hslU 5004 6314 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391347.1 protein_id gnl|my_center|LOCUS_18740 7591 8352 gene locus_tag LOCUS_18750 7591 8352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 12255 8728 gene locus_tag LOCUS_18760 12255 8728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 13346 12699 gene locus_tag LOCUS_18770 13346 12699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 14561 14238 gene locus_tag LOCUS_18780 14561 14238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 15652 16611 gene locus_tag LOCUS_18790 15652 16611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 16903 17973 gene locus_tag LOCUS_18800 gene gmd 16903 17973 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639973.1 protein_id gnl|my_center|LOCUS_18800 18117 20483 gene locus_tag LOCUS_18810 18117 20483 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388721.1 protein_id gnl|my_center|LOCUS_18810 20480 21304 gene locus_tag LOCUS_18820 gene cysQ 20480 21304 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388204.1 protein_id gnl|my_center|LOCUS_18820 21294 22103 gene locus_tag LOCUS_18830 21294 22103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 22181 22948 gene locus_tag LOCUS_18840 22181 22948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 23315 22974 gene locus_tag LOCUS_18850 gene grxD 23315 22974 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388463.1 protein_id gnl|my_center|LOCUS_18850 24509 23625 gene locus_tag LOCUS_18860 24509 23625 CDS product TIGR01459 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388273.1 protein_id gnl|my_center|LOCUS_18860 25588 24506 gene locus_tag LOCUS_18870 25588 24506 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388272.1 protein_id gnl|my_center|LOCUS_18870 25980 25585 gene locus_tag LOCUS_18880 25980 25585 CDS product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388271.1 protein_id gnl|my_center|LOCUS_18880 26750 26067 gene locus_tag LOCUS_18890 26750 26067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 27242 26802 gene locus_tag LOCUS_18900 27242 26802 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388367.1 protein_id gnl|my_center|LOCUS_18900 29859 27268 gene locus_tag LOCUS_18910 29859 27268 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067553987.1 protein_id gnl|my_center|LOCUS_18910 30920 29952 gene locus_tag LOCUS_18920 30920 29952 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464586.1 protein_id gnl|my_center|LOCUS_18920 31842 30949 gene locus_tag LOCUS_18930 31842 30949 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533453.1 protein_id gnl|my_center|LOCUS_18930 32139 34361 gene locus_tag LOCUS_18940 32139 34361 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061787.1 protein_id gnl|my_center|LOCUS_18940 35418 34627 gene locus_tag LOCUS_18950 35418 34627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 35743 36405 gene locus_tag LOCUS_18960 35743 36405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 36689 37846 gene locus_tag LOCUS_18970 gene tgt 36689 37846 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388033.1 protein_id gnl|my_center|LOCUS_18970 39094 37892 gene locus_tag LOCUS_18980 gene nhaA 39094 37892 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387889.1 protein_id gnl|my_center|LOCUS_18980 39024 39200 gene locus_tag LOCUS_18990 39024 39200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 39562 39993 gene locus_tag LOCUS_19000 39562 39993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 40061 41404 gene locus_tag LOCUS_19010 40061 41404 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388774.1 protein_id gnl|my_center|LOCUS_19010 41500 42510 gene locus_tag LOCUS_19020 41500 42510 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388811.1 protein_id gnl|my_center|LOCUS_19020 42727 43350 gene locus_tag LOCUS_19030 42727 43350 CDS product DUF1013 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388810.1 protein_id gnl|my_center|LOCUS_19030 44346 43378 gene locus_tag LOCUS_19040 44346 43378 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470590.1 protein_id gnl|my_center|LOCUS_19040 44585 45739 gene locus_tag LOCUS_19050 44585 45739 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532676.1 protein_id gnl|my_center|LOCUS_19050 46448 45777 gene locus_tag LOCUS_19060 46448 45777 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162185828.1 protein_id gnl|my_center|LOCUS_19060 47664 46432 gene locus_tag LOCUS_19070 gene soxC 47664 46432 CDS product sulfite dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086300.1 protein_id gnl|my_center|LOCUS_19070 >Feature sequence125 375 1496 gene locus_tag LOCUS_19080 375 1496 CDS product DUF2336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388368.1 protein_id gnl|my_center|LOCUS_19080 1857 3887 gene locus_tag LOCUS_19090 1857 3887 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390978.1 protein_id gnl|my_center|LOCUS_19090 3877 3785 gene locus_tag LOCUS_t00320 3877 3785 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3945 4496 gene locus_tag LOCUS_19100 3945 4496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389746.1 protein_id gnl|my_center|LOCUS_19100 5181 5816 gene locus_tag LOCUS_19110 5181 5816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 6688 5960 gene locus_tag LOCUS_19120 6688 5960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 6887 8452 gene locus_tag LOCUS_19130 6887 8452 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921597.1 protein_id gnl|my_center|LOCUS_19130 8452 8784 gene locus_tag LOCUS_19140 8452 8784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 9701 9078 gene locus_tag LOCUS_19150 gene bluB 9701 9078 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391283.1 protein_id gnl|my_center|LOCUS_19150 11258 9885 gene locus_tag LOCUS_19160 11258 9885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 11970 11236 gene locus_tag LOCUS_19170 11970 11236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 12454 13263 gene locus_tag LOCUS_19180 gene pppA 12454 13263 CDS product serine/threonine phosphatase PppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106965.1 protein_id gnl|my_center|LOCUS_19180 13256 15223 gene locus_tag LOCUS_19190 13256 15223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 15493 16626 gene locus_tag LOCUS_19200 gene tssA 15493 16626 CDS product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480330.1 protein_id gnl|my_center|LOCUS_19200 16873 17409 gene locus_tag LOCUS_19210 gene tssB 16873 17409 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973761.1 protein_id gnl|my_center|LOCUS_19210 17406 18899 gene locus_tag LOCUS_19220 gene tssC 17406 18899 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463811.1 protein_id gnl|my_center|LOCUS_19220 19078 20670 gene locus_tag LOCUS_19230 gene tssC 19078 20670 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521953.1 protein_id gnl|my_center|LOCUS_19230 20723 21550 gene locus_tag LOCUS_19240 20723 21550 CDS product type VI secretion system accessory protein TagJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315897.1 protein_id gnl|my_center|LOCUS_19240 21558 22061 gene locus_tag LOCUS_19250 gene tssE 21558 22061 CDS product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315898.1 protein_id gnl|my_center|LOCUS_19250 22054 23880 gene locus_tag LOCUS_19260 gene tssF 22054 23880 CDS product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973760.1 protein_id gnl|my_center|LOCUS_19260 23877 24956 gene locus_tag LOCUS_19270 gene tssG 23877 24956 CDS product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269329.1 protein_id gnl|my_center|LOCUS_19270 24953 25885 gene locus_tag LOCUS_19280 24953 25885 CDS product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036918.1 protein_id gnl|my_center|LOCUS_19280 26206 26661 gene locus_tag LOCUS_19290 26206 26661 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389911.1 protein_id gnl|my_center|LOCUS_19290 27408 27974 gene locus_tag LOCUS_19300 27408 27974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 28201 28839 gene locus_tag LOCUS_19310 28201 28839 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211304.1 protein_id gnl|my_center|LOCUS_19310 29127 29882 gene locus_tag LOCUS_19320 gene phaR 29127 29882 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388029.1 protein_id gnl|my_center|LOCUS_19320 29963 31039 gene locus_tag LOCUS_19330 29963 31039 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014906119.1 protein_id gnl|my_center|LOCUS_19330 31042 32001 gene locus_tag LOCUS_19340 31042 32001 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815883.1 protein_id gnl|my_center|LOCUS_19340 32233 33231 gene locus_tag LOCUS_19350 32233 33231 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065036.1 protein_id gnl|my_center|LOCUS_19350 33228 34298 gene locus_tag LOCUS_19360 33228 34298 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065037.1 protein_id gnl|my_center|LOCUS_19360 34295 34927 gene locus_tag LOCUS_19370 34295 34927 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929111.1 protein_id gnl|my_center|LOCUS_19370 35061 35489 gene locus_tag LOCUS_19380 35061 35489 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388367.1 protein_id gnl|my_center|LOCUS_19380 36825 35662 gene locus_tag LOCUS_19390 gene rodA 36825 35662 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719488.1 protein_id gnl|my_center|LOCUS_19390 38816 36822 gene locus_tag LOCUS_19400 gene mrdA 38816 36822 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388232.1 protein_id gnl|my_center|LOCUS_19400 39344 38829 gene locus_tag LOCUS_19410 gene mreD 39344 38829 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388231.1 protein_id gnl|my_center|LOCUS_19410 40223 39351 gene locus_tag LOCUS_19420 gene mreC 40223 39351 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388230.1 protein_id gnl|my_center|LOCUS_19420 41367 40339 gene locus_tag LOCUS_19430 41367 40339 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625945.1 protein_id gnl|my_center|LOCUS_19430 41938 44010 gene locus_tag LOCUS_19440 41938 44010 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388334.1 protein_id gnl|my_center|LOCUS_19440 44439 45494 gene locus_tag LOCUS_19450 44439 45494 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011214278.1 protein_id gnl|my_center|LOCUS_19450 46535 45903 gene locus_tag LOCUS_19460 46535 45903 CDS product DUF3833 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388485.1 protein_id gnl|my_center|LOCUS_19460 47878 46532 gene locus_tag LOCUS_19470 47878 46532 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388484.1 protein_id gnl|my_center|LOCUS_19470 >Feature sequence126 332 1174 gene locus_tag LOCUS_19480 gene dapD 332 1174 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391226.1 protein_id gnl|my_center|LOCUS_19480 1167 2393 gene locus_tag LOCUS_19490 gene dapE 1167 2393 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391227.1 protein_id gnl|my_center|LOCUS_19490 2474 3064 gene locus_tag LOCUS_19500 2474 3064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 4363 3137 gene locus_tag LOCUS_19510 4363 3137 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626653.1 protein_id gnl|my_center|LOCUS_19510 5689 4448 gene locus_tag LOCUS_19520 5689 4448 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992353.1 protein_id gnl|my_center|LOCUS_19520 6913 5705 gene locus_tag LOCUS_19530 6913 5705 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310733.1 protein_id gnl|my_center|LOCUS_19530 7491 7012 gene locus_tag LOCUS_19540 7491 7012 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921223.1 protein_id gnl|my_center|LOCUS_19540 7938 7624 gene locus_tag LOCUS_19550 7938 7624 CDS product DUF1244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314681.1 protein_id gnl|my_center|LOCUS_19550 8172 8654 gene locus_tag LOCUS_19560 gene aroQ 8172 8654 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106162.1 protein_id gnl|my_center|LOCUS_19560 8651 9184 gene locus_tag LOCUS_19570 8651 9184 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390187.1 protein_id gnl|my_center|LOCUS_19570 9188 10585 gene locus_tag LOCUS_19580 gene accC 9188 10585 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390188.1 protein_id gnl|my_center|LOCUS_19580 11719 10808 gene locus_tag LOCUS_19590 11719 10808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 11718 12593 gene locus_tag LOCUS_19600 gene rfbA 11718 12593 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077983464.1 protein_id gnl|my_center|LOCUS_19600 12603 14525 gene locus_tag LOCUS_19610 12603 14525 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387750.1 protein_id gnl|my_center|LOCUS_19610 14783 15256 gene locus_tag LOCUS_19620 14783 15256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 15253 15579 gene locus_tag LOCUS_19630 15253 15579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674683.1 protein_id gnl|my_center|LOCUS_19630 15612 16400 gene locus_tag LOCUS_19640 15612 16400 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679851.1 protein_id gnl|my_center|LOCUS_19640 16499 19048 gene locus_tag LOCUS_19650 gene feoB 16499 19048 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939841.1 protein_id gnl|my_center|LOCUS_19650 19045 19260 gene locus_tag LOCUS_19660 19045 19260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 20103 19291 gene locus_tag LOCUS_19670 20103 19291 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815215.1 protein_id gnl|my_center|LOCUS_19670 21827 20100 gene locus_tag LOCUS_19680 21827 20100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 22321 21989 gene locus_tag LOCUS_19690 22321 21989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 22469 25921 gene locus_tag LOCUS_19700 22469 25921 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387961.1 protein_id gnl|my_center|LOCUS_19700 27252 25957 gene locus_tag LOCUS_19710 27252 25957 CDS product hydroxyacid-oxoacid transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222287.1 protein_id gnl|my_center|LOCUS_19710 28226 27333 gene locus_tag LOCUS_19720 28226 27333 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391516.1 protein_id gnl|my_center|LOCUS_19720 29101 28292 gene locus_tag LOCUS_19730 29101 28292 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391515.1 protein_id gnl|my_center|LOCUS_19730 29795 29364 gene locus_tag LOCUS_19740 29795 29364 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391514.1 protein_id gnl|my_center|LOCUS_19740 30400 30029 gene locus_tag LOCUS_19750 30400 30029 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391513.1 protein_id gnl|my_center|LOCUS_19750 30866 30630 gene locus_tag LOCUS_19760 30866 30630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 31520 30951 gene locus_tag LOCUS_19770 31520 30951 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391511.1 protein_id gnl|my_center|LOCUS_19770 32224 31517 gene locus_tag LOCUS_19780 gene tsaB 32224 31517 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391510.1 protein_id gnl|my_center|LOCUS_19780 32790 32221 gene locus_tag LOCUS_19790 gene ddpX 32790 32221 CDS product D-alanyl-D-alanine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391509.1 protein_id gnl|my_center|LOCUS_19790 33416 32814 gene locus_tag LOCUS_19800 33416 32814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 33714 35645 gene locus_tag LOCUS_19810 gene dnaK 33714 35645 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391302.1 protein_id gnl|my_center|LOCUS_19810 35800 36945 gene locus_tag LOCUS_19820 gene dnaJ 35800 36945 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626618.1 protein_id gnl|my_center|LOCUS_19820 37167 37748 gene locus_tag LOCUS_19830 37167 37748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 37839 39710 gene locus_tag LOCUS_19840 37839 39710 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086607.1 protein_id gnl|my_center|LOCUS_19840 39707 40474 gene locus_tag LOCUS_19850 39707 40474 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086608.1 protein_id gnl|my_center|LOCUS_19850 40471 41175 gene locus_tag LOCUS_19860 40471 41175 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086609.1 protein_id gnl|my_center|LOCUS_19860 41417 41890 gene locus_tag LOCUS_19870 41417 41890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 42038 45097 gene locus_tag LOCUS_19880 42038 45097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 45094 45486 gene locus_tag LOCUS_19890 45094 45486 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969399.1 protein_id gnl|my_center|LOCUS_19890 45483 46670 gene locus_tag LOCUS_19900 45483 46670 CDS product EAL domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391241.1 protein_id gnl|my_center|LOCUS_19900 46667 47026 gene locus_tag LOCUS_19910 46667 47026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 >Feature sequence127 1 1191 gene locus_tag LOCUS_19920 gene tuf 1 1191 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390500.1 protein_id gnl|my_center|LOCUS_19920 1412 1487 gene locus_tag LOCUS_t00330 1412 1487 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 1630 1854 gene locus_tag LOCUS_19930 gene secE 1630 1854 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390511.1 protein_id gnl|my_center|LOCUS_19930 1861 2391 gene locus_tag LOCUS_19940 gene nusG 1861 2391 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390510.1 protein_id gnl|my_center|LOCUS_19940 2571 2999 gene locus_tag LOCUS_19950 gene rplK 2571 2999 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390509.1 protein_id gnl|my_center|LOCUS_19950 3006 3707 gene locus_tag LOCUS_19960 gene rplA 3006 3707 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390508.1 protein_id gnl|my_center|LOCUS_19960 4258 4743 gene locus_tag LOCUS_19970 gene rplJ 4258 4743 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390507.1 protein_id gnl|my_center|LOCUS_19970 4810 5190 gene locus_tag LOCUS_19980 gene rplL 4810 5190 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390506.1 protein_id gnl|my_center|LOCUS_19980 5617 9813 gene locus_tag LOCUS_19990 gene rpoB 5617 9813 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390505.1 protein_id gnl|my_center|LOCUS_19990 9965 14191 gene locus_tag LOCUS_20000 gene rpoC 9965 14191 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390504.1 protein_id gnl|my_center|LOCUS_20000 14729 15100 gene locus_tag LOCUS_20010 gene rpsL 14729 15100 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390503.1 protein_id gnl|my_center|LOCUS_20010 15113 15583 gene locus_tag LOCUS_20020 gene rpsG 15113 15583 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390502.1 protein_id gnl|my_center|LOCUS_20020 15654 17732 gene locus_tag LOCUS_20030 gene fusA 15654 17732 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390501.1 protein_id gnl|my_center|LOCUS_20030 17784 18218 gene locus_tag LOCUS_20040 17784 18218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20040 18231 18974 gene locus_tag LOCUS_20050 18231 18974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20050 19419 19736 gene locus_tag LOCUS_20060 gene rpsJ 19419 19736 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390499.1 protein_id gnl|my_center|LOCUS_20060 19964 20713 gene locus_tag LOCUS_20070 gene rplC 19964 20713 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390498.1 protein_id gnl|my_center|LOCUS_20070 20719 21339 gene locus_tag LOCUS_20080 gene rplD 20719 21339 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390437.1 protein_id gnl|my_center|LOCUS_20080 21336 21650 gene locus_tag LOCUS_20090 21336 21650 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440457.1 protein_id gnl|my_center|LOCUS_20090 21655 22491 gene locus_tag LOCUS_20100 gene rplB 21655 22491 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390435.1 protein_id gnl|my_center|LOCUS_20100 22504 22782 gene locus_tag LOCUS_20110 gene rpsS 22504 22782 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390434.1 protein_id gnl|my_center|LOCUS_20110 22785 23165 gene locus_tag LOCUS_20120 gene rplV 22785 23165 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390433.1 protein_id gnl|my_center|LOCUS_20120 23165 23836 gene locus_tag LOCUS_20130 gene rpsC 23165 23836 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390432.1 protein_id gnl|my_center|LOCUS_20130 23869 24282 gene locus_tag LOCUS_20140 gene rplP 23869 24282 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390431.1 protein_id gnl|my_center|LOCUS_20140 24288 24503 gene locus_tag LOCUS_20150 gene rpmC 24288 24503 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390430.1 protein_id gnl|my_center|LOCUS_20150 24518 24760 gene locus_tag LOCUS_20160 gene rpsQ 24518 24760 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390429.1 protein_id gnl|my_center|LOCUS_20160 24815 25183 gene locus_tag LOCUS_20170 gene rplN 24815 25183 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390428.1 protein_id gnl|my_center|LOCUS_20170 25183 25500 gene locus_tag LOCUS_20180 gene rplX 25183 25500 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390427.1 protein_id gnl|my_center|LOCUS_20180 25511 26053 gene locus_tag LOCUS_20190 gene rplE 25511 26053 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390426.1 protein_id gnl|my_center|LOCUS_20190 26074 26379 gene locus_tag LOCUS_20200 gene rpsN 26074 26379 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390425.1 protein_id gnl|my_center|LOCUS_20200 26392 26790 gene locus_tag LOCUS_20210 gene rpsH 26392 26790 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390424.1 protein_id gnl|my_center|LOCUS_20210 26833 27342 gene locus_tag LOCUS_20220 gene rplF 26833 27342 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390423.1 protein_id gnl|my_center|LOCUS_20220 27357 27722 gene locus_tag LOCUS_20230 gene rplR 27357 27722 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037383041.1 protein_id gnl|my_center|LOCUS_20230 27754 28404 gene locus_tag LOCUS_20240 27754 28404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 28411 28605 gene locus_tag LOCUS_20250 gene rpmD 28411 28605 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390420.1 protein_id gnl|my_center|LOCUS_20250 28684 29172 gene locus_tag LOCUS_20260 gene rplO 28684 29172 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390419.1 protein_id gnl|my_center|LOCUS_20260 29375 30721 gene locus_tag LOCUS_20270 gene secY 29375 30721 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390418.1 protein_id gnl|my_center|LOCUS_20270 30718 31383 gene locus_tag LOCUS_20280 30718 31383 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561944.1 protein_id gnl|my_center|LOCUS_20280 31553 31921 gene locus_tag LOCUS_20290 gene rpsM 31553 31921 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390416.1 protein_id gnl|my_center|LOCUS_20290 32033 32422 gene locus_tag LOCUS_20300 gene rpsK 32033 32422 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390415.1 protein_id gnl|my_center|LOCUS_20300 32759 33781 gene locus_tag LOCUS_20310 32759 33781 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626433.1 protein_id gnl|my_center|LOCUS_20310 34088 34513 gene locus_tag LOCUS_20320 gene rplQ 34088 34513 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390413.1 protein_id gnl|my_center|LOCUS_20320 34702 35277 gene locus_tag LOCUS_20330 34702 35277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 35408 37243 gene locus_tag LOCUS_20340 gene aspS 35408 37243 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389825.1 protein_id gnl|my_center|LOCUS_20340 37804 37427 gene locus_tag LOCUS_20350 37804 37427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 37820 39622 gene locus_tag LOCUS_20360 gene thiC 37820 39622 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243935.1 protein_id gnl|my_center|LOCUS_20360 >Feature sequence128 536 234 gene locus_tag LOCUS_20370 536 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 843 541 gene locus_tag LOCUS_20380 843 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 1360 932 gene locus_tag LOCUS_20390 gene ptsN 1360 932 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387770.1 protein_id gnl|my_center|LOCUS_20390 1389 1796 gene locus_tag LOCUS_20400 1389 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 2662 1985 gene locus_tag LOCUS_20410 2662 1985 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389141.1 protein_id gnl|my_center|LOCUS_20410 3240 2722 gene locus_tag LOCUS_20420 3240 2722 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389004.1 protein_id gnl|my_center|LOCUS_20420 3292 6066 gene locus_tag LOCUS_20430 3292 6066 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390784.1 protein_id gnl|my_center|LOCUS_20430 6339 7460 gene locus_tag LOCUS_20440 6339 7460 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194770.1 protein_id gnl|my_center|LOCUS_20440 7525 8298 gene locus_tag LOCUS_20450 7525 8298 CDS product hydroxypyruvate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266418.1 protein_id gnl|my_center|LOCUS_20450 8348 9277 gene locus_tag LOCUS_20460 8348 9277 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967128.1 protein_id gnl|my_center|LOCUS_20460 9538 10629 gene locus_tag LOCUS_20470 9538 10629 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259287.1 protein_id gnl|my_center|LOCUS_20470 10694 12028 gene locus_tag LOCUS_20480 10694 12028 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049832539.1 protein_id gnl|my_center|LOCUS_20480 12136 13050 gene locus_tag LOCUS_20490 12136 13050 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244087.1 protein_id gnl|my_center|LOCUS_20490 13054 13923 gene locus_tag LOCUS_20500 13054 13923 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213186.1 protein_id gnl|my_center|LOCUS_20500 14247 15641 gene locus_tag LOCUS_20510 gene aroA 14247 15641 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229519.1 protein_id gnl|my_center|LOCUS_20510 16363 15683 gene locus_tag LOCUS_20520 16363 15683 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390977.1 protein_id gnl|my_center|LOCUS_20520 17106 16681 gene locus_tag LOCUS_20530 17106 16681 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626602.1 protein_id gnl|my_center|LOCUS_20530 18157 17201 gene locus_tag LOCUS_20540 18157 17201 CDS product division plane positioning ATPase MipZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389967.1 protein_id gnl|my_center|LOCUS_20540 20334 18175 gene locus_tag LOCUS_20550 20334 18175 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389968.1 protein_id gnl|my_center|LOCUS_20550 23472 20506 gene locus_tag LOCUS_20560 23472 20506 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389791.1 protein_id gnl|my_center|LOCUS_20560 23537 26911 gene locus_tag LOCUS_20570 23537 26911 CDS product AsmA-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389790.1 protein_id gnl|my_center|LOCUS_20570 27269 27673 gene locus_tag LOCUS_20580 27269 27673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 28573 27764 gene locus_tag LOCUS_20590 28573 27764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 28957 30744 gene locus_tag LOCUS_20600 28957 30744 CDS product tetrathionate reductase family octaheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940402.1 protein_id gnl|my_center|LOCUS_20600 30763 31413 gene locus_tag LOCUS_20610 30763 31413 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940403.1 protein_id gnl|my_center|LOCUS_20610 31604 33184 gene locus_tag LOCUS_20620 31604 33184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 33273 34280 gene locus_tag LOCUS_20630 33273 34280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 35567 34365 gene locus_tag LOCUS_20640 35567 34365 CDS product DUF2336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391111.1 protein_id gnl|my_center|LOCUS_20640 36007 37221 gene locus_tag LOCUS_20650 gene metZ 36007 37221 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390962.1 protein_id gnl|my_center|LOCUS_20650 38389 37358 gene locus_tag LOCUS_20660 38389 37358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 38519 39526 gene locus_tag LOCUS_20670 38519 39526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 >Feature sequence129 <1 1343 gene locus_tag LOCUS_20680 <1 1343 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391065.1:gamma-glutamyltransferase 2290 1337 gene locus_tag LOCUS_20690 gene cbbR 2290 1337 CDS product LysR family transcriptional regulator CbbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338845.1 protein_id gnl|my_center|LOCUS_20690 2404 3420 gene locus_tag LOCUS_20700 2404 3420 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041669849.1 protein_id gnl|my_center|LOCUS_20700 3490 4371 gene locus_tag LOCUS_20710 3490 4371 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721831.1 protein_id gnl|my_center|LOCUS_20710 4449 5912 gene locus_tag LOCUS_20720 4449 5912 CDS product form I ribulose bisphosphate carboxylase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085371.1 protein_id gnl|my_center|LOCUS_20720 5951 6370 gene locus_tag LOCUS_20730 5951 6370 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085372.1 protein_id gnl|my_center|LOCUS_20730 6577 7509 gene locus_tag LOCUS_20740 gene cbbX 6577 7509 CDS product CbbX protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140002.1 protein_id gnl|my_center|LOCUS_20740 7540 8238 gene locus_tag LOCUS_20750 gene rpe 7540 8238 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337745.1 protein_id gnl|my_center|LOCUS_20750 8344 9354 gene locus_tag LOCUS_20760 8344 9354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388322.1 protein_id gnl|my_center|LOCUS_20760 9593 10012 gene locus_tag LOCUS_20770 9593 10012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 11829 10036 gene locus_tag LOCUS_20780 11829 10036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 13035 11848 gene locus_tag LOCUS_20790 13035 11848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440088.1 protein_id gnl|my_center|LOCUS_20790 14582 13062 gene locus_tag LOCUS_20800 14582 13062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20800 15656 14772 gene locus_tag LOCUS_20810 15656 14772 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388831.1 protein_id gnl|my_center|LOCUS_20810 16229 15663 gene locus_tag LOCUS_20820 gene efp 16229 15663 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388832.1 protein_id gnl|my_center|LOCUS_20820 16331 17398 gene locus_tag LOCUS_20830 gene epmA 16331 17398 CDS product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388833.1 protein_id gnl|my_center|LOCUS_20830 17411 17671 gene locus_tag LOCUS_20840 17411 17671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 17933 18976 gene locus_tag LOCUS_20850 gene pdhA 17933 18976 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389634.1 protein_id gnl|my_center|LOCUS_20850 18998 20464 gene locus_tag LOCUS_20860 18998 20464 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531482.1 protein_id gnl|my_center|LOCUS_20860 20480 21865 gene locus_tag LOCUS_20870 20480 21865 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975254.1 protein_id gnl|my_center|LOCUS_20870 21974 23737 gene locus_tag LOCUS_20880 21974 23737 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387750.1 protein_id gnl|my_center|LOCUS_20880 23755 25143 gene locus_tag LOCUS_20890 23755 25143 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387751.1 protein_id gnl|my_center|LOCUS_20890 25188 25991 gene locus_tag LOCUS_20900 gene dapB 25188 25991 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387915.1 protein_id gnl|my_center|LOCUS_20900 26211 27155 gene locus_tag LOCUS_20910 26211 27155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 27161 28012 gene locus_tag LOCUS_20920 27161 28012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 28903 27983 gene locus_tag LOCUS_20930 28903 27983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 30669 28900 gene locus_tag LOCUS_20940 30669 28900 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219893520.1 protein_id gnl|my_center|LOCUS_20940 31576 30767 gene locus_tag LOCUS_20950 31576 30767 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193173633.1 protein_id gnl|my_center|LOCUS_20950 33128 31773 gene locus_tag LOCUS_20960 33128 31773 CDS product glycine cleavage T C-terminal barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775991.1 protein_id gnl|my_center|LOCUS_20960 33650 35614 gene locus_tag LOCUS_20970 33650 35614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20970 37004 35643 gene locus_tag LOCUS_20980 gene fliI 37004 35643 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388284.1 protein_id gnl|my_center|LOCUS_20980 37439 38140 gene locus_tag LOCUS_20990 37439 38140 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388283.1 protein_id gnl|my_center|LOCUS_20990 38946 38266 gene locus_tag LOCUS_21000 38946 38266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 >Feature sequence130 <1 528 gene locus_tag LOCUS_21010 <1 528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_112131468.1:integrase core domain-containing protein 2002 626 gene locus_tag LOCUS_21020 2002 626 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388328.1 protein_id gnl|my_center|LOCUS_21020 2894 2049 gene locus_tag LOCUS_21030 2894 2049 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388329.1 protein_id gnl|my_center|LOCUS_21030 2322 2245 gene locus_tag LOCUS_t00340 2322 2245 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3110 3670 gene locus_tag LOCUS_21040 3110 3670 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330816.1 protein_id gnl|my_center|LOCUS_21040 4175 3906 gene locus_tag LOCUS_21050 4175 3906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 6208 5459 gene locus_tag LOCUS_21060 gene pncA 6208 5459 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083504.1 protein_id gnl|my_center|LOCUS_21060 6778 6398 gene locus_tag LOCUS_21070 6778 6398 CDS product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035690.1 protein_id gnl|my_center|LOCUS_21070 10674 6940 gene locus_tag LOCUS_21080 10674 6940 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390194.1 protein_id gnl|my_center|LOCUS_21080 11208 12308 gene locus_tag LOCUS_21090 11208 12308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389361.1 protein_id gnl|my_center|LOCUS_21090 13754 12534 gene locus_tag LOCUS_21100 13754 12534 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387806.1 protein_id gnl|my_center|LOCUS_21100 14061 13810 gene locus_tag LOCUS_21110 14061 13810 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387805.1 protein_id gnl|my_center|LOCUS_21110 15309 14107 gene locus_tag LOCUS_21120 gene lpxD 15309 14107 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387804.1 protein_id gnl|my_center|LOCUS_21120 15889 16485 gene locus_tag LOCUS_21130 15889 16485 CDS product NnrU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704609.1 protein_id gnl|my_center|LOCUS_21130 17356 16574 gene locus_tag LOCUS_21140 17356 16574 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388812.1 protein_id gnl|my_center|LOCUS_21140 18190 17543 gene locus_tag LOCUS_21150 18190 17543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 21017 18600 gene locus_tag LOCUS_21160 21017 18600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 21504 22046 gene locus_tag LOCUS_21170 21504 22046 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933872.1 protein_id gnl|my_center|LOCUS_21170 22116 22985 gene locus_tag LOCUS_21180 22116 22985 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114604.1 protein_id gnl|my_center|LOCUS_21180 23018 23398 gene locus_tag LOCUS_21190 23018 23398 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114392.1 protein_id gnl|my_center|LOCUS_21190 24214 23585 gene locus_tag LOCUS_21200 24214 23585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 24466 24251 gene locus_tag LOCUS_21210 gene rpmE 24466 24251 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388827.1 protein_id gnl|my_center|LOCUS_21210 24781 25554 gene locus_tag LOCUS_21220 24781 25554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 25612 27375 gene locus_tag LOCUS_21230 25612 27375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 28122 27394 gene locus_tag LOCUS_21240 gene rph 28122 27394 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391388.1 protein_id gnl|my_center|LOCUS_21240 28377 29321 gene locus_tag LOCUS_21250 28377 29321 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388123.1 protein_id gnl|my_center|LOCUS_21250 29363 32122 gene locus_tag LOCUS_21260 29363 32122 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388124.1 protein_id gnl|my_center|LOCUS_21260 32425 32979 gene locus_tag LOCUS_21270 32425 32979 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024413.1 protein_id gnl|my_center|LOCUS_21270 33068 33478 gene locus_tag LOCUS_21280 33068 33478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 34231 33647 gene locus_tag LOCUS_21290 34231 33647 CDS product GAD-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104019.1 protein_id gnl|my_center|LOCUS_21290 >Feature sequence131 978 193 gene locus_tag LOCUS_21300 978 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 1514 975 gene locus_tag LOCUS_21310 1514 975 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970030.1 protein_id gnl|my_center|LOCUS_21310 1644 3413 gene locus_tag LOCUS_21320 1644 3413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 3570 4208 gene locus_tag LOCUS_21330 3570 4208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 4232 4822 gene locus_tag LOCUS_21340 4232 4822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 4834 5691 gene locus_tag LOCUS_21350 4834 5691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 5717 6784 gene locus_tag LOCUS_21360 5717 6784 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013491.1 protein_id gnl|my_center|LOCUS_21360 6781 8445 gene locus_tag LOCUS_21370 6781 8445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 8612 8950 gene locus_tag LOCUS_21380 8612 8950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 8947 9807 gene locus_tag LOCUS_21390 8947 9807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21390 9954 9865 gene locus_tag LOCUS_t00350 9954 9865 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 10072 10722 gene locus_tag LOCUS_21400 10072 10722 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390957.1 protein_id gnl|my_center|LOCUS_21400 10897 12030 gene locus_tag LOCUS_21410 10897 12030 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390958.1 protein_id gnl|my_center|LOCUS_21410 12741 12286 gene locus_tag LOCUS_21420 12741 12286 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388478.1 protein_id gnl|my_center|LOCUS_21420 14233 13016 gene locus_tag LOCUS_21430 gene proB 14233 13016 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388994.1 protein_id gnl|my_center|LOCUS_21430 15255 14389 gene locus_tag LOCUS_21440 15255 14389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 15637 15819 gene locus_tag LOCUS_21450 15637 15819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 16041 17318 gene locus_tag LOCUS_21460 16041 17318 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389068.1 protein_id gnl|my_center|LOCUS_21460 17413 19458 gene locus_tag LOCUS_21470 17413 19458 CDS product tetratricopeptide repeat-containing sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389868.1 protein_id gnl|my_center|LOCUS_21470 20053 19463 gene locus_tag LOCUS_21480 20053 19463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 21063 20245 gene locus_tag LOCUS_21490 gene mazG 21063 20245 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389380.1 protein_id gnl|my_center|LOCUS_21490 21197 21640 gene locus_tag LOCUS_21500 gene rpoZ 21197 21640 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389610.1 protein_id gnl|my_center|LOCUS_21500 21875 24031 gene locus_tag LOCUS_21510 21875 24031 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193385014.1 protein_id gnl|my_center|LOCUS_21510 24116 24901 gene locus_tag LOCUS_21520 24116 24901 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389607.1 protein_id gnl|my_center|LOCUS_21520 24996 25736 gene locus_tag LOCUS_21530 gene lepB 24996 25736 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389606.1 protein_id gnl|my_center|LOCUS_21530 25750 26454 gene locus_tag LOCUS_21540 gene rnc 25750 26454 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389605.1 protein_id gnl|my_center|LOCUS_21540 26556 27422 gene locus_tag LOCUS_21550 gene era 26556 27422 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389604.1 protein_id gnl|my_center|LOCUS_21550 27738 28376 gene locus_tag LOCUS_21560 27738 28376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 29979 28687 gene locus_tag LOCUS_21570 29979 28687 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926703.1 protein_id gnl|my_center|LOCUS_21570 30512 29979 gene locus_tag LOCUS_21580 30512 29979 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811089.1 protein_id gnl|my_center|LOCUS_21580 31687 30680 gene locus_tag LOCUS_21590 31687 30680 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930616.1 protein_id gnl|my_center|LOCUS_21590 31931 32665 gene locus_tag LOCUS_21600 31931 32665 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089550.1 protein_id gnl|my_center|LOCUS_21600 32797 34473 gene locus_tag LOCUS_21610 32797 34473 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969768.1 protein_id gnl|my_center|LOCUS_21610 34550 36667 gene locus_tag LOCUS_21620 34550 36667 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390356.1 protein_id gnl|my_center|LOCUS_21620 37856 36705 gene locus_tag LOCUS_21630 37856 36705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 38979 37849 gene locus_tag LOCUS_21640 38979 37849 CDS product DUF2336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391111.1 protein_id gnl|my_center|LOCUS_21640 39675 39944 gene locus_tag LOCUS_21650 39675 39944 CDS product DUF3253 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389896.1 protein_id gnl|my_center|LOCUS_21650 40597 39953 gene locus_tag LOCUS_21660 40597 39953 CDS product sulfoxide reductase heme-binding subunit YedZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388352.1 protein_id gnl|my_center|LOCUS_21660 41631 40657 gene locus_tag LOCUS_21670 gene msrP 41631 40657 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196774.1 protein_id gnl|my_center|LOCUS_21670 42433 41762 gene locus_tag LOCUS_21680 42433 41762 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391445.1 protein_id gnl|my_center|LOCUS_21680 42708 44231 gene locus_tag LOCUS_21690 42708 44231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 44231 44794 gene locus_tag LOCUS_21700 44231 44794 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391382.1 protein_id gnl|my_center|LOCUS_21700 45151 46794 gene locus_tag LOCUS_21710 45151 46794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 46905 47852 gene locus_tag LOCUS_21720 46905 47852 CDS product XrtA-associated tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176618.1 protein_id gnl|my_center|LOCUS_21720 48034 48903 gene locus_tag LOCUS_21730 48034 48903 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132696218.1 protein_id gnl|my_center|LOCUS_21730 50458 48938 gene locus_tag LOCUS_21740 gene glpK 50458 48938 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973406.1 protein_id gnl|my_center|LOCUS_21740 52108 50573 gene locus_tag LOCUS_21750 gene glpD 52108 50573 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531813.1 protein_id gnl|my_center|LOCUS_21750 52902 52105 gene locus_tag LOCUS_21760 52902 52105 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973411.1 protein_id gnl|my_center|LOCUS_21760 53156 54892 gene locus_tag LOCUS_21770 53156 54892 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337642.1 protein_id gnl|my_center|LOCUS_21770 55031 56098 gene locus_tag LOCUS_21780 55031 56098 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337645.1 protein_id gnl|my_center|LOCUS_21780 56283 57398 gene locus_tag LOCUS_21790 56283 57398 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973408.1 protein_id gnl|my_center|LOCUS_21790 57395 58258 gene locus_tag LOCUS_21800 57395 58258 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530331.1 protein_id gnl|my_center|LOCUS_21800 58272 59072 gene locus_tag LOCUS_21810 58272 59072 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067119.1 protein_id gnl|my_center|LOCUS_21810 59104 59385 gene locus_tag LOCUS_21820 59104 59385 CDS product DUF2160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252300.1 protein_id gnl|my_center|LOCUS_21820 59473 60897 gene locus_tag LOCUS_21830 gene gltX 59473 60897 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388446.1 protein_id gnl|my_center|LOCUS_21830 60914 61567 gene locus_tag LOCUS_21840 gene upp 60914 61567 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389910.1 protein_id gnl|my_center|LOCUS_21840 61564 61929 gene locus_tag LOCUS_21850 61564 61929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 62327 62566 gene locus_tag LOCUS_21860 62327 62566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 62715 64109 gene locus_tag LOCUS_21870 gene cysS 62715 64109 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388447.1 protein_id gnl|my_center|LOCUS_21870 64382 64951 gene locus_tag LOCUS_21880 64382 64951 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390865.1 protein_id gnl|my_center|LOCUS_21880 65100 66488 gene locus_tag LOCUS_21890 65100 66488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 66658 68250 gene locus_tag LOCUS_21900 66658 68250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 70299 68311 gene locus_tag LOCUS_21910 70299 68311 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085717.1 protein_id gnl|my_center|LOCUS_21910 72823 70550 gene locus_tag LOCUS_21920 gene parC 72823 70550 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389601.1 protein_id gnl|my_center|LOCUS_21920 73422 72934 gene locus_tag LOCUS_21930 73422 72934 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390646.1 protein_id gnl|my_center|LOCUS_21930 73620 74243 gene locus_tag LOCUS_21940 73620 74243 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529595.1 protein_id gnl|my_center|LOCUS_21940 76263 74338 gene locus_tag LOCUS_21950 gene glgX 76263 74338 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390327.1 protein_id gnl|my_center|LOCUS_21950 78502 76268 gene locus_tag LOCUS_21960 gene glgB 78502 76268 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390326.1 protein_id gnl|my_center|LOCUS_21960 79306 78962 gene locus_tag LOCUS_21970 79306 78962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 79860 80357 gene locus_tag LOCUS_21980 79860 80357 CDS product SUF system Fe-S cluster assembly regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390324.1 protein_id gnl|my_center|LOCUS_21980 80429 81883 gene locus_tag LOCUS_21990 gene sufB 80429 81883 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390323.1 protein_id gnl|my_center|LOCUS_21990 81957 82727 gene locus_tag LOCUS_22000 gene sufC 81957 82727 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390322.1 protein_id gnl|my_center|LOCUS_22000 82763 84094 gene locus_tag LOCUS_22010 gene sufD 82763 84094 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390321.1 protein_id gnl|my_center|LOCUS_22010 84091 85371 gene locus_tag LOCUS_22020 84091 85371 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390320.1 protein_id gnl|my_center|LOCUS_22020 85440 85838 gene locus_tag LOCUS_22030 85440 85838 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390319.1 protein_id gnl|my_center|LOCUS_22030 86120 86494 gene locus_tag LOCUS_22040 86120 86494 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390318.1 protein_id gnl|my_center|LOCUS_22040 86539 87237 gene locus_tag LOCUS_22050 86539 87237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 87272 88729 gene locus_tag LOCUS_22060 87272 88729 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965780.1 protein_id gnl|my_center|LOCUS_22060 88965 88708 gene locus_tag LOCUS_22070 88965 88708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 89846 89163 gene locus_tag LOCUS_22080 89846 89163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 90969 89839 gene locus_tag LOCUS_22090 90969 89839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 92111 90972 gene locus_tag LOCUS_22100 92111 90972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 93665 92304 gene locus_tag LOCUS_22110 gene tolB 93665 92304 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388849.1 protein_id gnl|my_center|LOCUS_22110 94631 93801 gene locus_tag LOCUS_22120 94631 93801 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975209.1 protein_id gnl|my_center|LOCUS_22120 95560 94628 gene locus_tag LOCUS_22130 95560 94628 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403357.1 protein_id gnl|my_center|LOCUS_22130 96820 95567 gene locus_tag LOCUS_22140 96820 95567 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266612.1 protein_id gnl|my_center|LOCUS_22140 97042 97857 gene locus_tag LOCUS_22150 97042 97857 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103399.1 protein_id gnl|my_center|LOCUS_22150 98458 97868 gene locus_tag LOCUS_22160 98458 97868 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389625.1 protein_id gnl|my_center|LOCUS_22160 98533 99000 gene locus_tag LOCUS_22170 98533 99000 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530371.1 protein_id gnl|my_center|LOCUS_22170 99272 99060 gene locus_tag LOCUS_22180 99272 99060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 99271 101586 gene locus_tag LOCUS_22190 99271 101586 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390352.1 protein_id gnl|my_center|LOCUS_22190 101980 103899 gene locus_tag LOCUS_22200 101980 103899 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942954.1 protein_id gnl|my_center|LOCUS_22200 103969 104172 gene locus_tag LOCUS_22210 103969 104172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 104237 106009 gene locus_tag LOCUS_22220 gene ggt 104237 106009 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041670404.1 protein_id gnl|my_center|LOCUS_22220 108734 106011 gene locus_tag LOCUS_22230 108734 106011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 109809 108997 gene locus_tag LOCUS_22240 gene flgH 109809 108997 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390472.1 protein_id gnl|my_center|LOCUS_22240 111167 109947 gene locus_tag LOCUS_22250 111167 109947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 112022 111237 gene locus_tag LOCUS_22260 gene flgG 112022 111237 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390470.1 protein_id gnl|my_center|LOCUS_22260 112785 112042 gene locus_tag LOCUS_22270 gene flgF 112785 112042 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390469.1 protein_id gnl|my_center|LOCUS_22270 113203 113796 gene locus_tag LOCUS_22280 113203 113796 CDS product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626461.1 protein_id gnl|my_center|LOCUS_22280 113884 115071 gene locus_tag LOCUS_22290 gene fliM 113884 115071 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390467.1 protein_id gnl|my_center|LOCUS_22290 115136 115783 gene locus_tag LOCUS_22300 115136 115783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 116364 117872 gene locus_tag LOCUS_22310 gene oadA 116364 117872 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105555.1 protein_id gnl|my_center|LOCUS_22310 117975 119555 gene locus_tag LOCUS_22320 117975 119555 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258907.1 protein_id gnl|my_center|LOCUS_22320 119608 119925 gene locus_tag LOCUS_22330 119608 119925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 120055 120465 gene locus_tag LOCUS_22340 120055 120465 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263230.1 protein_id gnl|my_center|LOCUS_22340 >Feature sequence132 1479 211 gene locus_tag LOCUS_22350 1479 211 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240716.1 protein_id gnl|my_center|LOCUS_22350 2266 1952 gene locus_tag LOCUS_22360 2266 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 2383 2607 gene locus_tag LOCUS_22370 2383 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389935.1 protein_id gnl|my_center|LOCUS_22370 4115 2616 gene locus_tag LOCUS_22380 4115 2616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 4456 5274 gene locus_tag LOCUS_22390 gene rpsB 4456 5274 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389461.1 protein_id gnl|my_center|LOCUS_22390 5556 6482 gene locus_tag LOCUS_22400 gene tsf 5556 6482 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389462.1 protein_id gnl|my_center|LOCUS_22400 6809 7582 gene locus_tag LOCUS_22410 gene pyrH 6809 7582 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389463.1 protein_id gnl|my_center|LOCUS_22410 7584 8159 gene locus_tag LOCUS_22420 gene frr 7584 8159 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389464.1 protein_id gnl|my_center|LOCUS_22420 8294 9031 gene locus_tag LOCUS_22430 8294 9031 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389465.1 protein_id gnl|my_center|LOCUS_22430 9044 9871 gene locus_tag LOCUS_22440 9044 9871 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389466.1 protein_id gnl|my_center|LOCUS_22440 9865 11097 gene locus_tag LOCUS_22450 9865 11097 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389467.1 protein_id gnl|my_center|LOCUS_22450 11140 12243 gene locus_tag LOCUS_22460 gene rseP 11140 12243 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389468.1 protein_id gnl|my_center|LOCUS_22460 12630 12430 gene locus_tag LOCUS_22470 12630 12430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 12548 14788 gene locus_tag LOCUS_22480 gene bamA 12548 14788 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440405.1 protein_id gnl|my_center|LOCUS_22480 14911 15522 gene locus_tag LOCUS_22490 14911 15522 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389470.1 protein_id gnl|my_center|LOCUS_22490 15694 16164 gene locus_tag LOCUS_22500 gene fabZ 15694 16164 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389471.1 protein_id gnl|my_center|LOCUS_22500 16249 17055 gene locus_tag LOCUS_22510 gene lpxA 16249 17055 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389472.1 protein_id gnl|my_center|LOCUS_22510 17073 19124 gene locus_tag LOCUS_22520 17073 19124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 19757 19158 gene locus_tag LOCUS_22530 19757 19158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 20356 19775 gene locus_tag LOCUS_22540 20356 19775 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108825999.1 protein_id gnl|my_center|LOCUS_22540 21372 20353 gene locus_tag LOCUS_22550 21372 20353 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141003.1 protein_id gnl|my_center|LOCUS_22550 21727 21407 gene locus_tag LOCUS_22560 21727 21407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 22812 21802 gene locus_tag LOCUS_22570 22812 21802 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257655.1 protein_id gnl|my_center|LOCUS_22570 23162 22953 gene locus_tag LOCUS_22580 23162 22953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 23458 23159 gene locus_tag LOCUS_22590 23458 23159 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124711.1 protein_id gnl|my_center|LOCUS_22590 23815 23498 gene locus_tag LOCUS_22600 23815 23498 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006169870.1 protein_id gnl|my_center|LOCUS_22600 24163 23858 gene locus_tag LOCUS_22610 24163 23858 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006169870.1 protein_id gnl|my_center|LOCUS_22610 24451 24194 gene locus_tag LOCUS_22620 24451 24194 CDS product carboxysome peptide B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124709.1 protein_id gnl|my_center|LOCUS_22620 24705 24451 gene locus_tag LOCUS_22630 24705 24451 CDS product carboxysome peptide A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124708.1 protein_id gnl|my_center|LOCUS_22630 26378 24702 gene locus_tag LOCUS_22640 26378 24702 CDS product carboxysome shell carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124707.1 protein_id gnl|my_center|LOCUS_22640 28344 26392 gene locus_tag LOCUS_22650 28344 26392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 28759 28406 gene locus_tag LOCUS_22660 28759 28406 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124705.1 protein_id gnl|my_center|LOCUS_22660 30233 28818 gene locus_tag LOCUS_22670 30233 28818 CDS product form I ribulose bisphosphate carboxylase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124704.1 protein_id gnl|my_center|LOCUS_22670 30558 31784 gene locus_tag LOCUS_22680 30558 31784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256189.1 protein_id gnl|my_center|LOCUS_22680 35386 31850 gene locus_tag LOCUS_22690 35386 31850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 36007 36507 gene locus_tag LOCUS_22700 36007 36507 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142243.1 protein_id gnl|my_center|LOCUS_22700 36710 36621 gene locus_tag LOCUS_t00360 36710 36621 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 37913 36837 gene locus_tag LOCUS_22710 37913 36837 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975906.1 protein_id gnl|my_center|LOCUS_22710 38793 37903 gene locus_tag LOCUS_22720 38793 37903 CDS product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313746.1 protein_id gnl|my_center|LOCUS_22720 >Feature sequence133 1894 410 gene locus_tag LOCUS_22730 1894 410 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011342568.1 protein_id gnl|my_center|LOCUS_22730 2351 1968 gene locus_tag LOCUS_22740 2351 1968 CDS product cysteine-rich small domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391294.1 protein_id gnl|my_center|LOCUS_22740 4076 2502 gene locus_tag LOCUS_22750 4076 2502 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262867.1 protein_id gnl|my_center|LOCUS_22750 4617 5024 gene locus_tag LOCUS_22760 gene hisI 4617 5024 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389302.1 protein_id gnl|my_center|LOCUS_22760 5021 6064 gene locus_tag LOCUS_22770 5021 6064 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389301.1 protein_id gnl|my_center|LOCUS_22770 6529 7251 gene locus_tag LOCUS_22780 6529 7251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 7465 8139 gene locus_tag LOCUS_22790 7465 8139 CDS product HpnM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387817.1 protein_id gnl|my_center|LOCUS_22790 8541 8083 gene locus_tag LOCUS_22800 8541 8083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 8716 8970 gene locus_tag LOCUS_22810 8716 8970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 8978 9346 gene locus_tag LOCUS_22820 8978 9346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 9544 10191 gene locus_tag LOCUS_22830 9544 10191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 10191 11039 gene locus_tag LOCUS_22840 10191 11039 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388840.1 protein_id gnl|my_center|LOCUS_22840 11297 12046 gene locus_tag LOCUS_22850 11297 12046 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390825.1 protein_id gnl|my_center|LOCUS_22850 12050 12988 gene locus_tag LOCUS_22860 12050 12988 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390826.1 protein_id gnl|my_center|LOCUS_22860 13028 13957 gene locus_tag LOCUS_22870 13028 13957 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390827.1 protein_id gnl|my_center|LOCUS_22870 17078 14034 gene locus_tag LOCUS_22880 17078 14034 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389861.1 protein_id gnl|my_center|LOCUS_22880 17471 18517 gene locus_tag LOCUS_22890 17471 18517 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038004.1 protein_id gnl|my_center|LOCUS_22890 18550 19059 gene locus_tag LOCUS_22900 18550 19059 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529725.1 protein_id gnl|my_center|LOCUS_22900 19056 19484 gene locus_tag LOCUS_22910 19056 19484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 19484 19816 gene locus_tag LOCUS_22920 19484 19816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 21395 19806 gene locus_tag LOCUS_22930 21395 19806 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142355.1 protein_id gnl|my_center|LOCUS_22930 22271 21672 gene locus_tag LOCUS_22940 22271 21672 CDS product DUF2889 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391492.1 protein_id gnl|my_center|LOCUS_22940 22685 25081 gene locus_tag LOCUS_22950 22685 25081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 25201 25380 gene locus_tag LOCUS_22960 25201 25380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 25377 25706 gene locus_tag LOCUS_22970 25377 25706 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100771155.1 protein_id gnl|my_center|LOCUS_22970 27091 25712 gene locus_tag LOCUS_22980 gene gor 27091 25712 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388440.1 protein_id gnl|my_center|LOCUS_22980 27225 28277 gene locus_tag LOCUS_22990 27225 28277 CDS product mitochondrial fission ELM1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389733.1 protein_id gnl|my_center|LOCUS_22990 28408 29442 gene locus_tag LOCUS_23000 28408 29442 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459299.1 protein_id gnl|my_center|LOCUS_23000 29906 29529 gene locus_tag LOCUS_23010 29906 29529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 29998 30705 gene locus_tag LOCUS_23020 29998 30705 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391444.1 protein_id gnl|my_center|LOCUS_23020 32330 30702 gene locus_tag LOCUS_23030 32330 30702 CDS product stimulus-sensing domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391170.1 protein_id gnl|my_center|LOCUS_23030 33130 32429 gene locus_tag LOCUS_23040 33130 32429 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391169.1 protein_id gnl|my_center|LOCUS_23040 33833 33309 gene locus_tag LOCUS_23050 33833 33309 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388161.1 protein_id gnl|my_center|LOCUS_23050 34685 34026 gene locus_tag LOCUS_23060 34685 34026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 36733 35039 gene locus_tag LOCUS_23070 36733 35039 CDS product di-heme-cytochrome C peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113489.1 protein_id gnl|my_center|LOCUS_23070 >Feature sequence134 893 36 gene locus_tag LOCUS_23080 893 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 2267 987 gene locus_tag LOCUS_23090 2267 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 3730 2291 gene locus_tag LOCUS_23100 3730 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 4577 3765 gene locus_tag LOCUS_23110 4577 3765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 5611 4574 gene locus_tag LOCUS_23120 5611 4574 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929514.1 protein_id gnl|my_center|LOCUS_23120 6900 5653 gene locus_tag LOCUS_23130 6900 5653 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285879.1 protein_id gnl|my_center|LOCUS_23130 7910 6921 gene locus_tag LOCUS_23140 7910 6921 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403376.1 protein_id gnl|my_center|LOCUS_23140 9287 7932 gene locus_tag LOCUS_23150 9287 7932 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876469.1 protein_id gnl|my_center|LOCUS_23150 9865 9293 gene locus_tag LOCUS_23160 9865 9293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 10587 9862 gene locus_tag LOCUS_23170 10587 9862 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545779.1 protein_id gnl|my_center|LOCUS_23170 11625 10636 gene locus_tag LOCUS_23180 11625 10636 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015456646.1 protein_id gnl|my_center|LOCUS_23180 12894 11854 gene locus_tag LOCUS_23190 12894 11854 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937626.1 protein_id gnl|my_center|LOCUS_23190 14113 12965 gene locus_tag LOCUS_23200 gene neuC 14113 12965 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545909.1 protein_id gnl|my_center|LOCUS_23200 15150 14110 gene locus_tag LOCUS_23210 15150 14110 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546727.1 protein_id gnl|my_center|LOCUS_23210 16441 15275 gene locus_tag LOCUS_23220 16441 15275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 17253 16753 gene locus_tag LOCUS_23230 gene rfaH 17253 16753 CDS product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957829.1 protein_id gnl|my_center|LOCUS_23230 17959 17255 gene locus_tag LOCUS_23240 17959 17255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 18113 19513 gene locus_tag LOCUS_23250 18113 19513 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387756.1 protein_id gnl|my_center|LOCUS_23250 19581 21056 gene locus_tag LOCUS_23260 19581 21056 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387757.1 protein_id gnl|my_center|LOCUS_23260 22047 21082 gene locus_tag LOCUS_23270 22047 21082 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268560.1 protein_id gnl|my_center|LOCUS_23270 22623 24668 gene locus_tag LOCUS_23280 22623 24668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 25168 25686 gene locus_tag LOCUS_23290 25168 25686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 26069 27661 gene locus_tag LOCUS_23300 26069 27661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 27804 31106 gene locus_tag LOCUS_23310 27804 31106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 31531 31223 gene locus_tag LOCUS_23320 31531 31223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 32056 32481 gene locus_tag LOCUS_23330 32056 32481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 33350 32499 gene locus_tag LOCUS_23340 33350 32499 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388497.1 protein_id gnl|my_center|LOCUS_23340 33616 33350 gene locus_tag LOCUS_23350 gene grxC 33616 33350 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385447.1 protein_id gnl|my_center|LOCUS_23350 33794 35812 gene locus_tag LOCUS_23360 33794 35812 CDS product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626129.1 protein_id gnl|my_center|LOCUS_23360 35805 36317 gene locus_tag LOCUS_23370 35805 36317 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388985.1 protein_id gnl|my_center|LOCUS_23370 36334 36771 gene locus_tag LOCUS_23380 36334 36771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 >Feature sequence135 116 904 gene locus_tag LOCUS_23390 116 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 955 2748 gene locus_tag LOCUS_23400 955 2748 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388917.1 protein_id gnl|my_center|LOCUS_23400 2786 3520 gene locus_tag LOCUS_23410 gene cybH 2786 3520 CDS product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089678.1 protein_id gnl|my_center|LOCUS_23410 3768 4361 gene locus_tag LOCUS_23420 3768 4361 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089677.1 protein_id gnl|my_center|LOCUS_23420 4395 4700 gene locus_tag LOCUS_23430 4395 4700 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089676.1 protein_id gnl|my_center|LOCUS_23430 4697 5587 gene locus_tag LOCUS_23440 4697 5587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 6066 5713 gene locus_tag LOCUS_23450 6066 5713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 7101 6262 gene locus_tag LOCUS_23460 7101 6262 CDS product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388282.1 protein_id gnl|my_center|LOCUS_23460 8269 7106 gene locus_tag LOCUS_23470 8269 7106 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197948963.1 protein_id gnl|my_center|LOCUS_23470 8793 8422 gene locus_tag LOCUS_23480 8793 8422 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388280.1 protein_id gnl|my_center|LOCUS_23480 11891 9228 gene locus_tag LOCUS_23490 gene alaS 11891 9228 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390445.1 protein_id gnl|my_center|LOCUS_23490 13036 11996 gene locus_tag LOCUS_23500 13036 11996 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388951.1 protein_id gnl|my_center|LOCUS_23500 14082 13336 gene locus_tag LOCUS_23510 14082 13336 CDS product cell wall hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626122.1 protein_id gnl|my_center|LOCUS_23510 15065 14886 gene locus_tag LOCUS_23520 15065 14886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 14995 18546 gene locus_tag LOCUS_23530 14995 18546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 19310 18552 gene locus_tag LOCUS_23540 19310 18552 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388471.1 protein_id gnl|my_center|LOCUS_23540 20051 19569 gene locus_tag LOCUS_23550 20051 19569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388205.1 protein_id gnl|my_center|LOCUS_23550 21535 20048 gene locus_tag LOCUS_23560 21535 20048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 22349 21615 gene locus_tag LOCUS_23570 22349 21615 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391390.1 protein_id gnl|my_center|LOCUS_23570 23449 22421 gene locus_tag LOCUS_23580 gene hrcA 23449 22421 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391389.1 protein_id gnl|my_center|LOCUS_23580 23757 26189 gene locus_tag LOCUS_23590 23757 26189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 26227 28623 gene locus_tag LOCUS_23600 26227 28623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 28947 29963 gene locus_tag LOCUS_23610 gene dctP 28947 29963 CDS product TRAP transporter solute-binding subunit DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476112.1 protein_id gnl|my_center|LOCUS_23610 30085 30726 gene locus_tag LOCUS_23620 30085 30726 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479032.1 protein_id gnl|my_center|LOCUS_23620 30731 32095 gene locus_tag LOCUS_23630 30731 32095 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479029.1 protein_id gnl|my_center|LOCUS_23630 32218 32808 gene locus_tag LOCUS_23640 32218 32808 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470637.1 protein_id gnl|my_center|LOCUS_23640 33123 32836 gene locus_tag LOCUS_23650 33123 32836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 35543 33120 gene locus_tag LOCUS_23660 gene feoB 35543 33120 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939841.1 protein_id gnl|my_center|LOCUS_23660 36183 35536 gene locus_tag LOCUS_23670 36183 35536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 >Feature sequence136 371 96 gene locus_tag LOCUS_23680 371 96 CDS product DUF6489 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391370.1 protein_id gnl|my_center|LOCUS_23680 537 2618 gene locus_tag LOCUS_23690 537 2618 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391369.1 protein_id gnl|my_center|LOCUS_23690 2803 3783 gene locus_tag LOCUS_23700 2803 3783 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391367.1 protein_id gnl|my_center|LOCUS_23700 4207 6177 gene locus_tag LOCUS_23710 gene mnmG 4207 6177 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391372.1 protein_id gnl|my_center|LOCUS_23710 6615 7472 gene locus_tag LOCUS_23720 6615 7472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 7453 8259 gene locus_tag LOCUS_23730 7453 8259 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391374.1 protein_id gnl|my_center|LOCUS_23730 8264 9238 gene locus_tag LOCUS_23740 8264 9238 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391375.1 protein_id gnl|my_center|LOCUS_23740 10884 9319 gene locus_tag LOCUS_23750 gene rpoN 10884 9319 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387771.1 protein_id gnl|my_center|LOCUS_23750 11735 10953 gene locus_tag LOCUS_23760 gene lptB 11735 10953 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387772.1 protein_id gnl|my_center|LOCUS_23760 12778 11771 gene locus_tag LOCUS_23770 12778 11771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387773.1 protein_id gnl|my_center|LOCUS_23770 13503 12775 gene locus_tag LOCUS_23780 13503 12775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 14590 13598 gene locus_tag LOCUS_23790 14590 13598 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625856.1 protein_id gnl|my_center|LOCUS_23790 15343 14708 gene locus_tag LOCUS_23800 15343 14708 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083544.1 protein_id gnl|my_center|LOCUS_23800 15639 15553 gene locus_tag LOCUS_t00370 15639 15553 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 16284 15763 gene locus_tag LOCUS_23810 gene secB 16284 15763 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391357.1 protein_id gnl|my_center|LOCUS_23810 17320 16718 gene locus_tag LOCUS_23820 17320 16718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 17670 18389 gene locus_tag LOCUS_23830 17670 18389 CDS product Tim44/TimA family putative adaptor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391355.1 protein_id gnl|my_center|LOCUS_23830 18400 19920 gene locus_tag LOCUS_23840 18400 19920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 21647 20241 gene locus_tag LOCUS_23850 21647 20241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 22415 21684 gene locus_tag LOCUS_23860 22415 21684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 23179 22742 gene locus_tag LOCUS_23870 23179 22742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 23803 25605 gene locus_tag LOCUS_23880 23803 25605 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389828.1 protein_id gnl|my_center|LOCUS_23880 25780 26493 gene locus_tag LOCUS_23890 25780 26493 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081162185.1 protein_id gnl|my_center|LOCUS_23890 27256 26837 gene locus_tag LOCUS_23900 27256 26837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 27446 28036 gene locus_tag LOCUS_23910 27446 28036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 28880 28050 gene locus_tag LOCUS_23920 28880 28050 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088209.1 protein_id gnl|my_center|LOCUS_23920 29511 28969 gene locus_tag LOCUS_23930 29511 28969 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390527.1 protein_id gnl|my_center|LOCUS_23930 30374 29595 gene locus_tag LOCUS_23940 30374 29595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 30522 30896 gene locus_tag LOCUS_23950 30522 30896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 30893 31345 gene locus_tag LOCUS_23960 30893 31345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 31332 32225 gene locus_tag LOCUS_23970 31332 32225 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390794.1 protein_id gnl|my_center|LOCUS_23970 32482 33249 gene locus_tag LOCUS_23980 32482 33249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494120.1 protein_id gnl|my_center|LOCUS_23980 >Feature sequence137 1977 853 gene locus_tag LOCUS_23990 gene ada 1977 853 CDS product bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147548.1 protein_id gnl|my_center|LOCUS_23990 2930 1974 gene locus_tag LOCUS_24000 2930 1974 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310430.1 protein_id gnl|my_center|LOCUS_24000 3130 4524 gene locus_tag LOCUS_24010 3130 4524 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707798.1 protein_id gnl|my_center|LOCUS_24010 4579 5697 gene locus_tag LOCUS_24020 4579 5697 CDS product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388773.1 protein_id gnl|my_center|LOCUS_24020 5794 6990 gene locus_tag LOCUS_24030 gene potA 5794 6990 CDS product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388772.1 protein_id gnl|my_center|LOCUS_24030 6987 8018 gene locus_tag LOCUS_24040 6987 8018 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388771.1 protein_id gnl|my_center|LOCUS_24040 8020 8865 gene locus_tag LOCUS_24050 8020 8865 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388770.1 protein_id gnl|my_center|LOCUS_24050 8862 9515 gene locus_tag LOCUS_24060 8862 9515 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111484.1 protein_id gnl|my_center|LOCUS_24060 11681 9540 gene locus_tag LOCUS_24070 11681 9540 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390299.1 protein_id gnl|my_center|LOCUS_24070 11971 12711 gene locus_tag LOCUS_24080 11971 12711 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249137.1 protein_id gnl|my_center|LOCUS_24080 14465 12771 gene locus_tag LOCUS_24090 gene ureC 14465 12771 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170136789.1 protein_id gnl|my_center|LOCUS_24090 14789 14472 gene locus_tag LOCUS_24100 14789 14472 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066609.1 protein_id gnl|my_center|LOCUS_24100 15102 14800 gene locus_tag LOCUS_24110 15102 14800 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525618.1 protein_id gnl|my_center|LOCUS_24110 16239 15466 gene locus_tag LOCUS_24120 16239 15466 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390960.1 protein_id gnl|my_center|LOCUS_24120 16564 18150 gene locus_tag LOCUS_24130 gene gpmI 16564 18150 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388989.1 protein_id gnl|my_center|LOCUS_24130 18119 19579 gene locus_tag LOCUS_24140 18119 19579 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470651.1 protein_id gnl|my_center|LOCUS_24140 19576 20883 gene locus_tag LOCUS_24150 19576 20883 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388987.1 protein_id gnl|my_center|LOCUS_24150 21460 21086 gene locus_tag LOCUS_24160 21460 21086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 21929 24064 gene locus_tag LOCUS_24170 21929 24064 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390492.1 protein_id gnl|my_center|LOCUS_24170 24920 24075 gene locus_tag LOCUS_24180 24920 24075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 26175 24901 gene locus_tag LOCUS_24190 26175 24901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 26310 26489 gene locus_tag LOCUS_24200 26310 26489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 27252 27034 gene locus_tag LOCUS_24210 27252 27034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 27522 27890 gene locus_tag LOCUS_24220 27522 27890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 29614 27962 gene locus_tag LOCUS_24230 gene ipdC 29614 27962 CDS product indolepyruvate/phenylpyruvate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390529.1 protein_id gnl|my_center|LOCUS_24230 29779 31398 gene locus_tag LOCUS_24240 29779 31398 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390250.1 protein_id gnl|my_center|LOCUS_24240 32851 31514 gene locus_tag LOCUS_24250 32851 31514 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720129.1 protein_id gnl|my_center|LOCUS_24250 32968 33333 gene locus_tag LOCUS_24260 32968 33333 CDS product glyoxalase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972193.1 protein_id gnl|my_center|LOCUS_24260 >Feature sequence138 380 676 gene locus_tag LOCUS_24270 gene rpmB 380 676 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387963.1 protein_id gnl|my_center|LOCUS_24270 1835 807 gene locus_tag LOCUS_24280 1835 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 2151 3692 gene locus_tag LOCUS_24290 2151 3692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 3985 3734 gene locus_tag LOCUS_24300 3985 3734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 5334 4303 gene locus_tag LOCUS_24310 5334 4303 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391186.1 protein_id gnl|my_center|LOCUS_24310 5465 5980 gene locus_tag LOCUS_24320 gene tsaE 5465 5980 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391185.1 protein_id gnl|my_center|LOCUS_24320 5980 6984 gene locus_tag LOCUS_24330 5980 6984 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391184.1 protein_id gnl|my_center|LOCUS_24330 6981 7763 gene locus_tag LOCUS_24340 6981 7763 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391183.1 protein_id gnl|my_center|LOCUS_24340 7787 10792 gene locus_tag LOCUS_24350 gene addB 7787 10792 CDS product double-strand break repair protein AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391182.1 protein_id gnl|my_center|LOCUS_24350 10789 14328 gene locus_tag LOCUS_24360 gene addA 10789 14328 CDS product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391181.1 protein_id gnl|my_center|LOCUS_24360 14366 15793 gene locus_tag LOCUS_24370 14366 15793 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390412.1 protein_id gnl|my_center|LOCUS_24370 15790 17154 gene locus_tag LOCUS_24380 15790 17154 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390410.1 protein_id gnl|my_center|LOCUS_24380 19874 17199 gene locus_tag LOCUS_24390 gene acnA 19874 17199 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391258.1 protein_id gnl|my_center|LOCUS_24390 20287 21102 gene locus_tag LOCUS_24400 20287 21102 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391257.1 protein_id gnl|my_center|LOCUS_24400 21102 23063 gene locus_tag LOCUS_24410 21102 23063 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391256.1 protein_id gnl|my_center|LOCUS_24410 23216 24103 gene locus_tag LOCUS_24420 23216 24103 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391255.1 protein_id gnl|my_center|LOCUS_24420 24134 25267 gene locus_tag LOCUS_24430 24134 25267 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391254.1 protein_id gnl|my_center|LOCUS_24430 25342 26586 gene locus_tag LOCUS_24440 25342 26586 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391253.1 protein_id gnl|my_center|LOCUS_24440 26713 27558 gene locus_tag LOCUS_24450 26713 27558 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391252.1 protein_id gnl|my_center|LOCUS_24450 27668 28915 gene locus_tag LOCUS_24460 27668 28915 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391251.1 protein_id gnl|my_center|LOCUS_24460 29894 29307 gene locus_tag LOCUS_24470 29894 29307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 31203 29878 gene locus_tag LOCUS_24480 31203 29878 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389621.1 protein_id gnl|my_center|LOCUS_24480 31713 32168 gene locus_tag LOCUS_24490 31713 32168 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389622.1 protein_id gnl|my_center|LOCUS_24490 32165 32719 gene locus_tag LOCUS_24500 32165 32719 CDS product nicotinamide-nucleotide amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389623.1 protein_id gnl|my_center|LOCUS_24500 >Feature sequence139 132 596 gene locus_tag LOCUS_24510 132 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 598 1683 gene locus_tag LOCUS_24520 598 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 1734 3005 gene locus_tag LOCUS_24530 1734 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 3019 4167 gene locus_tag LOCUS_24540 3019 4167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 4347 6389 gene locus_tag LOCUS_24550 4347 6389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 6423 7946 gene locus_tag LOCUS_24560 6423 7946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 8010 10520 gene locus_tag LOCUS_24570 8010 10520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 10716 12551 gene locus_tag LOCUS_24580 10716 12551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 12548 13240 gene locus_tag LOCUS_24590 12548 13240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 13180 15405 gene locus_tag LOCUS_24600 13180 15405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 15423 16601 gene locus_tag LOCUS_24610 15423 16601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 16598 19927 gene locus_tag LOCUS_24620 16598 19927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 19924 21177 gene locus_tag LOCUS_24630 19924 21177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 21174 22133 gene locus_tag LOCUS_24640 gene cmr4 21174 22133 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229141.1 protein_id gnl|my_center|LOCUS_24640 22130 22561 gene locus_tag LOCUS_24650 22130 22561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 22565 23428 gene locus_tag LOCUS_24660 22565 23428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 23733 24779 gene locus_tag LOCUS_24670 23733 24779 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330578.1 protein_id gnl|my_center|LOCUS_24670 24776 27205 gene locus_tag LOCUS_24680 24776 27205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 27202 31524 gene locus_tag LOCUS_24690 27202 31524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 31542 32741 gene locus_tag LOCUS_24700 31542 32741 CDS product EAL domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029301722.1 protein_id gnl|my_center|LOCUS_24700 >Feature sequence140 395 973 gene locus_tag LOCUS_24710 gene ectA 395 973 CDS product diaminobutyrate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776470.1 protein_id gnl|my_center|LOCUS_24710 1044 2336 gene locus_tag LOCUS_24720 gene ectB 1044 2336 CDS product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230319.1 protein_id gnl|my_center|LOCUS_24720 2444 2836 gene locus_tag LOCUS_24730 2444 2836 CDS product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776472.1 protein_id gnl|my_center|LOCUS_24730 2961 3635 gene locus_tag LOCUS_24740 2961 3635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 3671 4615 gene locus_tag LOCUS_24750 3671 4615 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389548.1 protein_id gnl|my_center|LOCUS_24750 5051 7036 gene locus_tag LOCUS_24760 5051 7036 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387919.1 protein_id gnl|my_center|LOCUS_24760 7070 7426 gene locus_tag LOCUS_24770 7070 7426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 7488 9290 gene locus_tag LOCUS_24780 7488 9290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 9394 9747 gene locus_tag LOCUS_24790 9394 9747 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327476.1 protein_id gnl|my_center|LOCUS_24790 9744 10925 gene locus_tag LOCUS_24800 9744 10925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 10978 11604 gene locus_tag LOCUS_24810 10978 11604 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390884.1 protein_id gnl|my_center|LOCUS_24810 11659 12675 gene locus_tag LOCUS_24820 11659 12675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 13125 12877 gene locus_tag LOCUS_24830 13125 12877 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389863.1 protein_id gnl|my_center|LOCUS_24830 13505 13122 gene locus_tag LOCUS_24840 13505 13122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 14065 13502 gene locus_tag LOCUS_24850 14065 13502 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969927.1 protein_id gnl|my_center|LOCUS_24850 14588 14169 gene locus_tag LOCUS_24860 14588 14169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 14965 14585 gene locus_tag LOCUS_24870 14965 14585 CDS product DUF2794 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390836.1 protein_id gnl|my_center|LOCUS_24870 15626 15192 gene locus_tag LOCUS_24880 15626 15192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390835.1 protein_id gnl|my_center|LOCUS_24880 15865 16326 gene locus_tag LOCUS_24890 15865 16326 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532060.1 protein_id gnl|my_center|LOCUS_24890 16465 17205 gene locus_tag LOCUS_24900 16465 17205 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390834.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24900 17208 18563 gene locus_tag LOCUS_24910 17208 18563 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384150.1 protein_id gnl|my_center|LOCUS_24910 18600 20054 gene locus_tag LOCUS_24920 gene der 18600 20054 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390832.1 protein_id gnl|my_center|LOCUS_24920 20292 20071 gene locus_tag LOCUS_24930 20292 20071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 20763 20383 gene locus_tag LOCUS_24940 20763 20383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 20763 21086 gene locus_tag LOCUS_24950 20763 21086 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389363.1 protein_id gnl|my_center|LOCUS_24950 22304 21114 gene locus_tag LOCUS_24960 22304 21114 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389364.1 protein_id gnl|my_center|LOCUS_24960 22473 23273 gene locus_tag LOCUS_24970 gene ccsA 22473 23273 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626222.1 protein_id gnl|my_center|LOCUS_24970 23392 24399 gene locus_tag LOCUS_24980 gene dusB 23392 24399 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389366.1 protein_id gnl|my_center|LOCUS_24980 24396 25571 gene locus_tag LOCUS_24990 24396 25571 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389367.1 protein_id gnl|my_center|LOCUS_24990 25568 27070 gene locus_tag LOCUS_25000 gene ntrC 25568 27070 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389368.1 protein_id gnl|my_center|LOCUS_25000 27086 29440 gene locus_tag LOCUS_25010 27086 29440 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389369.1 protein_id gnl|my_center|LOCUS_25010 29562 31034 gene locus_tag LOCUS_25020 29562 31034 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389370.1 protein_id gnl|my_center|LOCUS_25020 31069 32445 gene locus_tag LOCUS_25030 gene trkA 31069 32445 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389371.1 protein_id gnl|my_center|LOCUS_25030 >Feature sequence141 1324 455 gene locus_tag LOCUS_25040 1324 455 CDS product TIR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461945.1 protein_id gnl|my_center|LOCUS_25040 1772 1548 gene locus_tag LOCUS_25050 1772 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 2140 1784 gene locus_tag LOCUS_25060 2140 1784 CDS product DUF2958 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533281.1 protein_id gnl|my_center|LOCUS_25060 2533 2300 gene locus_tag LOCUS_25070 2533 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 3264 2488 gene locus_tag LOCUS_25080 3264 2488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25080 3593 3817 gene locus_tag LOCUS_25090 3593 3817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 3976 4275 gene locus_tag LOCUS_25100 3976 4275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 4566 6227 gene locus_tag LOCUS_25110 4566 6227 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209489743.1 protein_id gnl|my_center|LOCUS_25110 6427 7599 gene locus_tag LOCUS_25120 6427 7599 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074377.1 protein_id gnl|my_center|LOCUS_25120 8147 7842 gene locus_tag LOCUS_25130 8147 7842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 8341 9609 gene locus_tag LOCUS_25140 8341 9609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 9636 10655 gene locus_tag LOCUS_25150 9636 10655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 11900 10638 gene locus_tag LOCUS_25160 11900 10638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 13027 11897 gene locus_tag LOCUS_25170 13027 11897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 14531 13011 gene locus_tag LOCUS_25180 14531 13011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 14998 14660 gene locus_tag LOCUS_25190 14998 14660 CDS product DUF736 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920532.1 protein_id gnl|my_center|LOCUS_25190 15312 14995 gene locus_tag LOCUS_25200 15312 14995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 16524 15316 gene locus_tag LOCUS_25210 16524 15316 CDS product TrbI/VirB10 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533262.1 protein_id gnl|my_center|LOCUS_25210 17522 16521 gene locus_tag LOCUS_25220 gene trbG 17522 16521 CDS product P-type conjugative transfer protein TrbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533263.1 protein_id gnl|my_center|LOCUS_25220 18292 17519 gene locus_tag LOCUS_25230 gene trbF 18292 17519 CDS product conjugal transfer protein TrbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533264.1 protein_id gnl|my_center|LOCUS_25230 19588 18296 gene locus_tag LOCUS_25240 gene trbL 19588 18296 CDS product P-type conjugative transfer protein TrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533265.1 protein_id gnl|my_center|LOCUS_25240 20344 19631 gene locus_tag LOCUS_25250 gene trbJ 20344 19631 CDS product P-type conjugative transfer protein TrbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533266.1 protein_id gnl|my_center|LOCUS_25250 22794 20341 gene locus_tag LOCUS_25260 gene trbE 22794 20341 CDS product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533267.1 protein_id gnl|my_center|LOCUS_25260 23060 22788 gene locus_tag LOCUS_25270 23060 22788 CDS product VirB3 family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533268.1 protein_id gnl|my_center|LOCUS_25270 23395 23057 gene locus_tag LOCUS_25280 23395 23057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 24392 23424 gene locus_tag LOCUS_25290 gene trbB 24392 23424 CDS product P-type conjugative transfer ATPase TrbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533270.1 protein_id gnl|my_center|LOCUS_25290 24805 24389 gene locus_tag LOCUS_25300 24805 24389 CDS product CopG family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533271.1 protein_id gnl|my_center|LOCUS_25300 26972 24936 gene locus_tag LOCUS_25310 26972 24936 CDS product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533272.1 protein_id gnl|my_center|LOCUS_25310 26265 26338 gene locus_tag LOCUS_t00380 26265 26338 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 29104 27137 gene locus_tag LOCUS_25320 gene rlxS 29104 27137 CDS product relaxase/mobilization nuclease RlxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533275.1 protein_id gnl|my_center|LOCUS_25320 30017 29352 gene locus_tag LOCUS_25330 30017 29352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 30541 30005 gene locus_tag LOCUS_25340 30541 30005 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533277.1 protein_id gnl|my_center|LOCUS_25340 30789 30538 gene locus_tag LOCUS_25350 30789 30538 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533278.1 protein_id gnl|my_center|LOCUS_25350 31324 30986 gene locus_tag LOCUS_25360 31324 30986 CDS product DUF736 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533279.1 protein_id gnl|my_center|LOCUS_25360 >Feature sequence142 139 723 gene locus_tag LOCUS_25370 139 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549603.1 protein_id gnl|my_center|LOCUS_25370 824 3964 gene locus_tag LOCUS_25380 824 3964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 4637 3978 gene locus_tag LOCUS_25390 4637 3978 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095694.1 protein_id gnl|my_center|LOCUS_25390 5090 5734 gene locus_tag LOCUS_25400 5090 5734 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089987.1 protein_id gnl|my_center|LOCUS_25400 6834 5731 gene locus_tag LOCUS_25410 gene ugpC 6834 5731 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975931.1 protein_id gnl|my_center|LOCUS_25410 8022 7072 gene locus_tag LOCUS_25420 gene argB 8022 7072 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391088.1 protein_id gnl|my_center|LOCUS_25420 8764 8084 gene locus_tag LOCUS_25430 gene yihA 8764 8084 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391087.1 protein_id gnl|my_center|LOCUS_25430 10553 8757 gene locus_tag LOCUS_25440 gene yidC 10553 8757 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391086.1 protein_id gnl|my_center|LOCUS_25440 11020 10652 gene locus_tag LOCUS_25450 gene yidD 11020 10652 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391085.1 protein_id gnl|my_center|LOCUS_25450 11535 11017 gene locus_tag LOCUS_25460 11535 11017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 12016 12750 gene locus_tag LOCUS_25470 12016 12750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25470 12747 14192 gene locus_tag LOCUS_25480 12747 14192 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338686.1 protein_id gnl|my_center|LOCUS_25480 14295 15836 gene locus_tag LOCUS_25490 14295 15836 CDS product acyl--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336835.1 protein_id gnl|my_center|LOCUS_25490 15833 16813 gene locus_tag LOCUS_25500 15833 16813 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011840243.1 protein_id gnl|my_center|LOCUS_25500 17167 19731 gene locus_tag LOCUS_25510 17167 19731 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391190.1 protein_id gnl|my_center|LOCUS_25510 19799 20998 gene locus_tag LOCUS_25520 19799 20998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 21830 20946 gene locus_tag LOCUS_25530 21830 20946 CDS product DUF4743 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387967.1 protein_id gnl|my_center|LOCUS_25530 21995 22762 gene locus_tag LOCUS_25540 21995 22762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 22875 23894 gene locus_tag LOCUS_25550 22875 23894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 23887 24333 gene locus_tag LOCUS_25560 23887 24333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 24460 25188 gene locus_tag LOCUS_25570 24460 25188 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387964.1 protein_id gnl|my_center|LOCUS_25570 25235 26530 gene locus_tag LOCUS_25580 25235 26530 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390983.1 protein_id gnl|my_center|LOCUS_25580 26527 30069 gene locus_tag LOCUS_25590 26527 30069 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975072.1 protein_id gnl|my_center|LOCUS_25590 30152 30844 gene locus_tag LOCUS_25600 30152 30844 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388085.1 protein_id gnl|my_center|LOCUS_25600 31899 31384 gene locus_tag LOCUS_25610 31899 31384 CDS product MmcB family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183417335.1 protein_id gnl|my_center|LOCUS_25610 33092 31977 gene locus_tag LOCUS_25620 33092 31977 CDS product DUF1835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112344.1 protein_id gnl|my_center|LOCUS_25620 35517 33079 gene locus_tag LOCUS_25630 35517 33079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 36265 35816 gene locus_tag LOCUS_25640 36265 35816 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389850.1 protein_id gnl|my_center|LOCUS_25640 40394 36465 gene locus_tag LOCUS_25650 40394 36465 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141852.1 protein_id gnl|my_center|LOCUS_25650 40788 41297 gene locus_tag LOCUS_25660 40788 41297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387786.1 protein_id gnl|my_center|LOCUS_25660 41380 42777 gene locus_tag LOCUS_25670 41380 42777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387787.1 protein_id gnl|my_center|LOCUS_25670 42779 43513 gene locus_tag LOCUS_25680 gene mtgA 42779 43513 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387788.1 protein_id gnl|my_center|LOCUS_25680 43690 44049 gene locus_tag LOCUS_25690 43690 44049 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088514.1 protein_id gnl|my_center|LOCUS_25690 45631 44063 gene locus_tag LOCUS_25700 45631 44063 CDS product bifunctional aminoglycoside phosphotransferase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390363.1 protein_id gnl|my_center|LOCUS_25700 46602 46198 gene locus_tag LOCUS_25710 46602 46198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 47367 46876 gene locus_tag LOCUS_25720 47367 46876 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383049.1 protein_id gnl|my_center|LOCUS_25720 47578 48696 gene locus_tag LOCUS_25730 gene ald 47578 48696 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391433.1 protein_id gnl|my_center|LOCUS_25730 49090 49788 gene locus_tag LOCUS_25740 49090 49788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 51801 49810 gene locus_tag LOCUS_25750 gene tkt 51801 49810 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388353.1 protein_id gnl|my_center|LOCUS_25750 52814 51798 gene locus_tag LOCUS_25760 52814 51798 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194986.1 protein_id gnl|my_center|LOCUS_25760 53504 52860 gene locus_tag LOCUS_25770 53504 52860 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244129.1 protein_id gnl|my_center|LOCUS_25770 54805 53501 gene locus_tag LOCUS_25780 54805 53501 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194989.1 protein_id gnl|my_center|LOCUS_25780 54928 55935 gene locus_tag LOCUS_25790 54928 55935 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969408.1 protein_id gnl|my_center|LOCUS_25790 57178 55922 gene locus_tag LOCUS_25800 57178 55922 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969406.1 protein_id gnl|my_center|LOCUS_25800 57761 57195 gene locus_tag LOCUS_25810 57761 57195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 58911 57928 gene locus_tag LOCUS_25820 58911 57928 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969404.1 protein_id gnl|my_center|LOCUS_25820 59774 59022 gene locus_tag LOCUS_25830 59774 59022 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969401.1 protein_id gnl|my_center|LOCUS_25830 60835 59837 gene locus_tag LOCUS_25840 60835 59837 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092584911.1 protein_id gnl|my_center|LOCUS_25840 61662 60832 gene locus_tag LOCUS_25850 61662 60832 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969403.1 protein_id gnl|my_center|LOCUS_25850 63272 62343 gene locus_tag LOCUS_25860 63272 62343 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388962.1 protein_id gnl|my_center|LOCUS_25860 63675 63328 gene locus_tag LOCUS_25870 63675 63328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 63575 63979 gene locus_tag LOCUS_25880 63575 63979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 64243 64974 gene locus_tag LOCUS_25890 64243 64974 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390977.1 protein_id gnl|my_center|LOCUS_25890 64971 66161 gene locus_tag LOCUS_25900 gene zapE 64971 66161 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388963.1 protein_id gnl|my_center|LOCUS_25900 67196 66351 gene locus_tag LOCUS_25910 67196 66351 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028152332.1 protein_id gnl|my_center|LOCUS_25910 68229 67327 gene locus_tag LOCUS_25920 68229 67327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 70489 68549 gene locus_tag LOCUS_25930 gene dxs 70489 68549 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387815.1 protein_id gnl|my_center|LOCUS_25930 71512 70571 gene locus_tag LOCUS_25940 71512 70571 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626423.1 protein_id gnl|my_center|LOCUS_25940 71950 71615 gene locus_tag LOCUS_25950 71950 71615 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626422.1 protein_id gnl|my_center|LOCUS_25950 72163 72870 gene locus_tag LOCUS_25960 72163 72870 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705775.1 protein_id gnl|my_center|LOCUS_25960 72977 74155 gene locus_tag LOCUS_25970 72977 74155 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068376.1 protein_id gnl|my_center|LOCUS_25970 74152 75390 gene locus_tag LOCUS_25980 74152 75390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 76166 75402 gene locus_tag LOCUS_25990 76166 75402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 76575 76267 gene locus_tag LOCUS_26000 76575 76267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 76932 76600 gene locus_tag LOCUS_26010 76932 76600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 77188 76949 gene locus_tag LOCUS_26020 77188 76949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 78737 78099 gene locus_tag LOCUS_26030 78737 78099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 79101 78883 gene locus_tag LOCUS_26040 79101 78883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 80641 79151 gene locus_tag LOCUS_26050 80641 79151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 80972 80634 gene locus_tag LOCUS_26060 80972 80634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 82213 80996 gene locus_tag LOCUS_26070 82213 80996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 83006 82335 gene locus_tag LOCUS_26080 83006 82335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 85468 83006 gene locus_tag LOCUS_26090 85468 83006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 86281 85547 gene locus_tag LOCUS_26100 86281 85547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 88185 86281 gene locus_tag LOCUS_26110 88185 86281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791750.1 protein_id gnl|my_center|LOCUS_26110 88754 88182 gene locus_tag LOCUS_26120 88754 88182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 89082 88840 gene locus_tag LOCUS_26130 89082 88840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 90081 89263 gene locus_tag LOCUS_26140 90081 89263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 91019 90234 gene locus_tag LOCUS_26150 91019 90234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 91398 91120 gene locus_tag LOCUS_26160 91398 91120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 93088 91388 gene locus_tag LOCUS_26170 93088 91388 CDS product portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064788614.1 protein_id gnl|my_center|LOCUS_26170 93386 93093 gene locus_tag LOCUS_26180 93386 93093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 95079 93907 gene locus_tag LOCUS_26190 gene metK 95079 93907 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391523.1 protein_id gnl|my_center|LOCUS_26190 96297 95554 gene locus_tag LOCUS_26200 gene pth 96297 95554 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391494.1 protein_id gnl|my_center|LOCUS_26200 96991 96383 gene locus_tag LOCUS_26210 96991 96383 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391493.1 protein_id gnl|my_center|LOCUS_26210 98166 97396 gene locus_tag LOCUS_26220 98166 97396 CDS product COQ9 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388800.1 protein_id gnl|my_center|LOCUS_26220 98785 98231 gene locus_tag LOCUS_26230 gene def 98785 98231 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388799.1 protein_id gnl|my_center|LOCUS_26230 99767 98835 gene locus_tag LOCUS_26240 99767 98835 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388796.1 protein_id gnl|my_center|LOCUS_26240 99896 100525 gene locus_tag LOCUS_26250 99896 100525 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339565.1 protein_id gnl|my_center|LOCUS_26250 100552 101427 gene locus_tag LOCUS_26260 100552 101427 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261699.1 protein_id gnl|my_center|LOCUS_26260 102055 101477 gene locus_tag LOCUS_26270 102055 101477 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114135.1 protein_id gnl|my_center|LOCUS_26270 101961 102302 gene locus_tag LOCUS_26280 101961 102302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 102721 103659 gene locus_tag LOCUS_26290 gene rpoH 102721 103659 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388776.1 protein_id gnl|my_center|LOCUS_26290 105367 103706 gene locus_tag LOCUS_26300 105367 103706 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470643.1 protein_id gnl|my_center|LOCUS_26300 105980 105522 gene locus_tag LOCUS_26310 105980 105522 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387840.1 protein_id gnl|my_center|LOCUS_26310 106991 106653 gene locus_tag LOCUS_26320 106991 106653 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387838.1 protein_id gnl|my_center|LOCUS_26320 107554 107090 gene locus_tag LOCUS_26330 107554 107090 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387837.1 protein_id gnl|my_center|LOCUS_26330 107707 108351 gene locus_tag LOCUS_26340 107707 108351 CDS product DUF938 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525148.1 protein_id gnl|my_center|LOCUS_26340 108460 108546 gene locus_tag LOCUS_t00390 108460 108546 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 109686 108652 gene locus_tag LOCUS_26350 109686 108652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 >Feature sequence143 1038 490 gene locus_tag LOCUS_26360 1038 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 4807 1031 gene locus_tag LOCUS_26370 4807 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 8511 4804 gene locus_tag LOCUS_26380 8511 4804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 9647 8508 gene locus_tag LOCUS_26390 9647 8508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 13381 9644 gene locus_tag LOCUS_26400 13381 9644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 15999 13378 gene locus_tag LOCUS_26410 15999 13378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 18569 15999 gene locus_tag LOCUS_26420 18569 15999 CDS product putative baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258037.1 protein_id gnl|my_center|LOCUS_26420 19545 19162 gene locus_tag LOCUS_26430 19545 19162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 20084 19545 gene locus_tag LOCUS_26440 20084 19545 CDS product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258034.1 protein_id gnl|my_center|LOCUS_26440 21220 20081 gene locus_tag LOCUS_26450 21220 20081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 21541 21254 gene locus_tag LOCUS_26460 21541 21254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 22305 21610 gene locus_tag LOCUS_26470 22305 21610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258031.1 protein_id gnl|my_center|LOCUS_26470 22553 22305 gene locus_tag LOCUS_26480 22553 22305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 24604 22550 gene locus_tag LOCUS_26490 24604 22550 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226676.1 protein_id gnl|my_center|LOCUS_26490 26031 24604 gene locus_tag LOCUS_26500 26031 24604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 26973 26035 gene locus_tag LOCUS_26510 26973 26035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 27770 26964 gene locus_tag LOCUS_26520 27770 26964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 28302 27799 gene locus_tag LOCUS_26530 28302 27799 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258023.1 protein_id gnl|my_center|LOCUS_26530 30703 28343 gene locus_tag LOCUS_26540 30703 28343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 >Feature sequence144 205 933 gene locus_tag LOCUS_26550 205 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 2768 1596 gene locus_tag LOCUS_26560 2768 1596 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388027.1 protein_id gnl|my_center|LOCUS_26560 4227 2974 gene locus_tag LOCUS_26570 4227 2974 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388028.1 protein_id gnl|my_center|LOCUS_26570 4519 4112 gene locus_tag LOCUS_26580 4519 4112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 5115 4624 gene locus_tag LOCUS_26590 5115 4624 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391542.1 protein_id gnl|my_center|LOCUS_26590 5429 6298 gene locus_tag LOCUS_26600 5429 6298 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390362.1 protein_id gnl|my_center|LOCUS_26600 6347 6772 gene locus_tag LOCUS_26610 6347 6772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389947.1 protein_id gnl|my_center|LOCUS_26610 7271 6726 gene locus_tag LOCUS_26620 7271 6726 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920991.1 protein_id gnl|my_center|LOCUS_26620 7482 9335 gene locus_tag LOCUS_26630 7482 9335 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388768.1 protein_id gnl|my_center|LOCUS_26630 10285 9356 gene locus_tag LOCUS_26640 10285 9356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 10875 11207 gene locus_tag LOCUS_26650 10875 11207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 11597 12049 gene locus_tag LOCUS_26660 11597 12049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 13495 12434 gene locus_tag LOCUS_26670 gene prfA 13495 12434 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388508.1 protein_id gnl|my_center|LOCUS_26670 14850 13492 gene locus_tag LOCUS_26680 gene hemA 14850 13492 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626014.1 protein_id gnl|my_center|LOCUS_26680 16091 14847 gene locus_tag LOCUS_26690 gene hisS 16091 14847 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388506.1 protein_id gnl|my_center|LOCUS_26690 16858 16247 gene locus_tag LOCUS_26700 16858 16247 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532395.1 protein_id gnl|my_center|LOCUS_26700 18181 17033 gene locus_tag LOCUS_26710 gene ispG 18181 17033 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388505.1 protein_id gnl|my_center|LOCUS_26710 19901 18285 gene locus_tag LOCUS_26720 19901 18285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 20153 21337 gene locus_tag LOCUS_26730 20153 21337 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037469338.1 protein_id gnl|my_center|LOCUS_26730 21373 22170 gene locus_tag LOCUS_26740 21373 22170 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061519.1 protein_id gnl|my_center|LOCUS_26740 22167 24137 gene locus_tag LOCUS_26750 22167 24137 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975624.1 protein_id gnl|my_center|LOCUS_26750 24137 26173 gene locus_tag LOCUS_26760 24137 26173 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391465.1 protein_id gnl|my_center|LOCUS_26760 26188 27186 gene locus_tag LOCUS_26770 26188 27186 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241956.1 protein_id gnl|my_center|LOCUS_26770 27183 28385 gene locus_tag LOCUS_26780 27183 28385 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013850755.1 protein_id gnl|my_center|LOCUS_26780 28566 29912 gene locus_tag LOCUS_26790 28566 29912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 29931 30842 gene locus_tag LOCUS_26800 29931 30842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 >Feature sequence145 379 1533 gene locus_tag LOCUS_26810 379 1533 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530004.1 protein_id gnl|my_center|LOCUS_26810 1706 3370 gene locus_tag LOCUS_26820 gene kaiC 1706 3370 CDS product circadian clock protein KaiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444621.1 protein_id gnl|my_center|LOCUS_26820 3367 3696 gene locus_tag LOCUS_26830 3367 3696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 3689 5131 gene locus_tag LOCUS_26840 3689 5131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 5947 5153 gene locus_tag LOCUS_26850 5947 5153 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336750.1 protein_id gnl|my_center|LOCUS_26850 6753 5944 gene locus_tag LOCUS_26860 6753 5944 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528029.1 protein_id gnl|my_center|LOCUS_26860 7001 7957 gene locus_tag LOCUS_26870 7001 7957 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532888.1 protein_id gnl|my_center|LOCUS_26870 8191 9225 gene locus_tag LOCUS_26880 8191 9225 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532889.1 protein_id gnl|my_center|LOCUS_26880 9222 11231 gene locus_tag LOCUS_26890 9222 11231 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532890.1 protein_id gnl|my_center|LOCUS_26890 11271 12155 gene locus_tag LOCUS_26900 11271 12155 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528030.1 protein_id gnl|my_center|LOCUS_26900 12162 14612 gene locus_tag LOCUS_26910 12162 14612 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528031.1 protein_id gnl|my_center|LOCUS_26910 14783 14708 gene locus_tag LOCUS_t00400 14783 14708 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 15476 15204 gene locus_tag LOCUS_26920 15476 15204 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389428.1 protein_id gnl|my_center|LOCUS_26920 18254 15837 gene locus_tag LOCUS_26930 gene lon 18254 15837 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389427.1 protein_id gnl|my_center|LOCUS_26930 19808 18543 gene locus_tag LOCUS_26940 gene clpX 19808 18543 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389426.1 protein_id gnl|my_center|LOCUS_26940 20658 20020 gene locus_tag LOCUS_26950 gene clpP 20658 20020 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389425.1 protein_id gnl|my_center|LOCUS_26950 22156 20804 gene locus_tag LOCUS_26960 gene tig 22156 20804 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922580.1 protein_id gnl|my_center|LOCUS_26960 22334 22249 gene locus_tag LOCUS_t00410 22334 22249 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 22630 23970 gene locus_tag LOCUS_26970 22630 23970 CDS product globin-coupled sensor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387881.1 protein_id gnl|my_center|LOCUS_26970 25106 24096 gene locus_tag LOCUS_26980 gene cydB 25106 24096 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339132.1 protein_id gnl|my_center|LOCUS_26980 26523 25120 gene locus_tag LOCUS_26990 26523 25120 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188183.1 protein_id gnl|my_center|LOCUS_26990 27551 26853 gene locus_tag LOCUS_27000 27551 26853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 28438 27806 gene locus_tag LOCUS_27010 28438 27806 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446319.1 protein_id gnl|my_center|LOCUS_27010 28569 29132 gene locus_tag LOCUS_27020 28569 29132 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531226.1 protein_id gnl|my_center|LOCUS_27020 30077 29178 gene locus_tag LOCUS_27030 gene panC 30077 29178 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626566.1 protein_id gnl|my_center|LOCUS_27030 30901 30074 gene locus_tag LOCUS_27040 gene panB 30901 30074 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391068.1 protein_id gnl|my_center|LOCUS_27040 >Feature sequence146 557 3040 gene locus_tag LOCUS_27050 gene torA 557 3040 CDS product trimethylamine-N-oxide reductase TorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389042.1 protein_id gnl|my_center|LOCUS_27050 3153 4052 gene locus_tag LOCUS_27060 3153 4052 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413363.1 protein_id gnl|my_center|LOCUS_27060 4784 4107 gene locus_tag LOCUS_27070 4784 4107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 5895 6155 gene locus_tag LOCUS_27080 5895 6155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 6234 7133 gene locus_tag LOCUS_27090 6234 7133 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173508789.1 protein_id gnl|my_center|LOCUS_27090 7133 8002 gene locus_tag LOCUS_27100 7133 8002 CDS product putative DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173508790.1 protein_id gnl|my_center|LOCUS_27100 7999 8508 gene locus_tag LOCUS_27110 7999 8508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 9265 8489 gene locus_tag LOCUS_27120 9265 8489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 9761 9270 gene locus_tag LOCUS_27130 9761 9270 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389735.1 protein_id gnl|my_center|LOCUS_27130 10879 9860 gene locus_tag LOCUS_27140 gene lpxC 10879 9860 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719270.1 protein_id gnl|my_center|LOCUS_27140 12494 11253 gene locus_tag LOCUS_27150 12494 11253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 13676 12519 gene locus_tag LOCUS_27160 13676 12519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 14597 13725 gene locus_tag LOCUS_27170 gene menA 14597 13725 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391135.1 protein_id gnl|my_center|LOCUS_27170 15379 14621 gene locus_tag LOCUS_27180 gene ubiE 15379 14621 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721909.1 protein_id gnl|my_center|LOCUS_27180 15852 15376 gene locus_tag LOCUS_27190 15852 15376 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315362.1 protein_id gnl|my_center|LOCUS_27190 16633 15980 gene locus_tag LOCUS_27200 16633 15980 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388427.1 protein_id gnl|my_center|LOCUS_27200 17482 16682 gene locus_tag LOCUS_27210 gene cobS 17482 16682 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388426.1 protein_id gnl|my_center|LOCUS_27210 17601 18638 gene locus_tag LOCUS_27220 gene cobT 17601 18638 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388425.1 protein_id gnl|my_center|LOCUS_27220 18635 19576 gene locus_tag LOCUS_27230 18635 19576 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385088.1 protein_id gnl|my_center|LOCUS_27230 19654 22320 gene locus_tag LOCUS_27240 19654 22320 CDS product DUF2339 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969037.1 protein_id gnl|my_center|LOCUS_27240 22808 22419 gene locus_tag LOCUS_27250 22808 22419 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390464.1 protein_id gnl|my_center|LOCUS_27250 23672 22944 gene locus_tag LOCUS_27260 23672 22944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390465.1 protein_id gnl|my_center|LOCUS_27260 24644 24057 gene locus_tag LOCUS_27270 24644 24057 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105229.1 protein_id gnl|my_center|LOCUS_27270 25062 25469 gene locus_tag LOCUS_27280 25062 25469 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387900.1 protein_id gnl|my_center|LOCUS_27280 25955 25686 gene locus_tag LOCUS_27290 25955 25686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 26842 26192 gene locus_tag LOCUS_27300 26842 26192 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389281.1 protein_id gnl|my_center|LOCUS_27300 27477 28007 gene locus_tag LOCUS_27310 27477 28007 CDS product ClpXP protease specificity-enhancing factor SspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390054.1 protein_id gnl|my_center|LOCUS_27310 28220 29830 gene locus_tag LOCUS_27320 28220 29830 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626330.1 protein_id gnl|my_center|LOCUS_27320 >Feature sequence147 296 847 gene locus_tag LOCUS_27330 gene moaB 296 847 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388021.1 protein_id gnl|my_center|LOCUS_27330 844 1140 gene locus_tag LOCUS_27340 844 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 1877 1422 gene locus_tag LOCUS_27350 1877 1422 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706203.1 protein_id gnl|my_center|LOCUS_27350 3470 1890 gene locus_tag LOCUS_27360 3470 1890 CDS product bifunctional GNAT family N-acetyltransferase/carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245514.1 protein_id gnl|my_center|LOCUS_27360 4183 3569 gene locus_tag LOCUS_27370 4183 3569 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532736.1 protein_id gnl|my_center|LOCUS_27370 6320 4983 gene locus_tag LOCUS_27380 6320 4983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 8110 6317 gene locus_tag LOCUS_27390 8110 6317 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391225.1 protein_id gnl|my_center|LOCUS_27390 9181 8294 gene locus_tag LOCUS_27400 gene rfbD 9181 8294 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387760.1 protein_id gnl|my_center|LOCUS_27400 10227 9178 gene locus_tag LOCUS_27410 gene rfbB 10227 9178 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387761.1 protein_id gnl|my_center|LOCUS_27410 10389 10955 gene locus_tag LOCUS_27420 gene rfbC 10389 10955 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387749.1 protein_id gnl|my_center|LOCUS_27420 11489 12745 gene locus_tag LOCUS_27430 gene rho 11489 12745 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391366.1 protein_id gnl|my_center|LOCUS_27430 13341 13775 gene locus_tag LOCUS_27440 gene nikR 13341 13775 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190057.1 protein_id gnl|my_center|LOCUS_27440 15200 13761 gene locus_tag LOCUS_27450 15200 13761 CDS product leucyl aminopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387899.1 protein_id gnl|my_center|LOCUS_27450 16341 15244 gene locus_tag LOCUS_27460 16341 15244 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625873.1 protein_id gnl|my_center|LOCUS_27460 17423 16491 gene locus_tag LOCUS_27470 17423 16491 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387897.1 protein_id gnl|my_center|LOCUS_27470 17833 17465 gene locus_tag LOCUS_27480 17833 17465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 18156 17830 gene locus_tag LOCUS_27490 18156 17830 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971536.1 protein_id gnl|my_center|LOCUS_27490 18350 19303 gene locus_tag LOCUS_27500 18350 19303 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388127.1 protein_id gnl|my_center|LOCUS_27500 19688 20932 gene locus_tag LOCUS_27510 19688 20932 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626572.1 protein_id gnl|my_center|LOCUS_27510 21611 21402 gene locus_tag LOCUS_27520 21611 21402 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389645.1 protein_id gnl|my_center|LOCUS_27520 22642 21911 gene locus_tag LOCUS_27530 22642 21911 CDS product DUF1045 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388791.1 protein_id gnl|my_center|LOCUS_27530 23790 22636 gene locus_tag LOCUS_27540 23790 22636 CDS product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388792.1 protein_id gnl|my_center|LOCUS_27540 24098 24844 gene locus_tag LOCUS_27550 gene phnF 24098 24844 CDS product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203732.1 protein_id gnl|my_center|LOCUS_27550 25016 25687 gene locus_tag LOCUS_27560 gene folE 25016 25687 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388024.1 protein_id gnl|my_center|LOCUS_27560 25793 26257 gene locus_tag LOCUS_27570 25793 26257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 27170 26289 gene locus_tag LOCUS_27580 27170 26289 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078815548.1 protein_id gnl|my_center|LOCUS_27580 28397 27825 gene locus_tag LOCUS_27590 28397 27825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 30043 28436 gene locus_tag LOCUS_27600 30043 28436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 >Feature sequence148 252 43 gene locus_tag LOCUS_27610 252 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 2050 254 gene locus_tag LOCUS_27620 2050 254 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080566.1 protein_id gnl|my_center|LOCUS_27620 4182 2053 gene locus_tag LOCUS_27630 4182 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 4899 4204 gene locus_tag LOCUS_27640 4899 4204 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533388.1 protein_id gnl|my_center|LOCUS_27640 5300 4896 gene locus_tag LOCUS_27650 5300 4896 CDS product MbcA/ParS/Xre antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525097.1 protein_id gnl|my_center|LOCUS_27650 5649 5428 gene locus_tag LOCUS_27660 5649 5428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 6876 5740 gene locus_tag LOCUS_27670 6876 5740 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073356551.1 protein_id gnl|my_center|LOCUS_27670 7653 7318 gene locus_tag LOCUS_27680 7653 7318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 8377 7775 gene locus_tag LOCUS_27690 8377 7775 CDS product plasmid pRiA4b ORF-3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209606428.1 protein_id gnl|my_center|LOCUS_27690 10020 8374 gene locus_tag LOCUS_27700 10020 8374 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167540391.1 protein_id gnl|my_center|LOCUS_27700 10437 10090 gene locus_tag LOCUS_27710 gene tnpB 10437 10090 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041414013.1 protein_id gnl|my_center|LOCUS_27710 10871 10434 gene locus_tag LOCUS_27720 10871 10434 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097612582.1 protein_id gnl|my_center|LOCUS_27720 12320 11400 gene locus_tag LOCUS_27730 12320 11400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 12595 13035 gene locus_tag LOCUS_27740 12595 13035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 13065 15212 gene locus_tag LOCUS_27750 13065 15212 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933069.1 protein_id gnl|my_center|LOCUS_27750 16036 15305 gene locus_tag LOCUS_27760 16036 15305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 16851 17426 gene locus_tag LOCUS_27770 16851 17426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27770 17524 18477 gene locus_tag LOCUS_27780 17524 18477 CDS product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014498063.1 protein_id gnl|my_center|LOCUS_27780 18477 18992 gene locus_tag LOCUS_27790 18477 18992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 18989 19378 gene locus_tag LOCUS_27800 18989 19378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 19454 21619 gene locus_tag LOCUS_27810 19454 21619 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028176021.1 protein_id gnl|my_center|LOCUS_27810 21691 22692 gene locus_tag LOCUS_27820 21691 22692 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092718104.1 protein_id gnl|my_center|LOCUS_27820 22911 23885 gene locus_tag LOCUS_27830 22911 23885 CDS product DUF2493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082895.1 protein_id gnl|my_center|LOCUS_27830 26671 24047 gene locus_tag LOCUS_27840 26671 24047 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146312796.1 protein_id gnl|my_center|LOCUS_27840 27400 28659 gene locus_tag LOCUS_27850 gene istA 27400 28659 CDS product IS21-like element ISMac3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020064.1 protein_id gnl|my_center|LOCUS_27850 >Feature sequence149 290 601 gene locus_tag LOCUS_27860 290 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 1089 487 gene locus_tag LOCUS_27870 1089 487 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992379.1 protein_id gnl|my_center|LOCUS_27870 1221 1847 gene locus_tag LOCUS_27880 1221 1847 CDS product MT-A70 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384784.1 protein_id gnl|my_center|LOCUS_27880 2100 2720 gene locus_tag LOCUS_27890 2100 2720 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063170453.1 protein_id gnl|my_center|LOCUS_27890 3167 2733 gene locus_tag LOCUS_27900 3167 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 3886 3173 gene locus_tag LOCUS_27910 3886 3173 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815182.1 protein_id gnl|my_center|LOCUS_27910 5211 3901 gene locus_tag LOCUS_27920 5211 3901 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069810832.1 protein_id gnl|my_center|LOCUS_27920 5567 5208 gene locus_tag LOCUS_27930 5567 5208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 6802 5579 gene locus_tag LOCUS_27940 6802 5579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 8203 6806 gene locus_tag LOCUS_27950 8203 6806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 8717 10672 gene locus_tag LOCUS_27960 8717 10672 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083710.1 protein_id gnl|my_center|LOCUS_27960 10772 11263 gene locus_tag LOCUS_27970 10772 11263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 11253 12056 gene locus_tag LOCUS_27980 11253 12056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 13349 12066 gene locus_tag LOCUS_27990 gene siaM 13349 12066 CDS product sialic acid TRAP transporter large permease SiaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233105.1 protein_id gnl|my_center|LOCUS_27990 13891 13346 gene locus_tag LOCUS_28000 13891 13346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 14185 16224 gene locus_tag LOCUS_28010 14185 16224 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162491196.1 protein_id gnl|my_center|LOCUS_28010 16229 17899 gene locus_tag LOCUS_28020 16229 17899 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538203.1 protein_id gnl|my_center|LOCUS_28020 17896 19062 gene locus_tag LOCUS_28030 17896 19062 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897686.1 protein_id gnl|my_center|LOCUS_28030 19116 19886 gene locus_tag LOCUS_28040 19116 19886 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383452.1 protein_id gnl|my_center|LOCUS_28040 20285 21055 gene locus_tag LOCUS_28050 20285 21055 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972743.1 protein_id gnl|my_center|LOCUS_28050 21152 22159 gene locus_tag LOCUS_28060 21152 22159 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 protein_id gnl|my_center|LOCUS_28060 22425 23693 gene locus_tag LOCUS_28070 22425 23693 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528423.1 protein_id gnl|my_center|LOCUS_28070 23826 26669 gene locus_tag LOCUS_28080 23826 26669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 26945 26679 gene locus_tag LOCUS_28090 26945 26679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 27379 27011 gene locus_tag LOCUS_28100 27379 27011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 27512 28504 gene locus_tag LOCUS_28110 27512 28504 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970313.1 protein_id gnl|my_center|LOCUS_28110 >Feature sequence150 830 357 gene locus_tag LOCUS_28120 830 357 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388825.1 protein_id gnl|my_center|LOCUS_28120 1432 2226 gene locus_tag LOCUS_28130 1432 2226 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090722.1 protein_id gnl|my_center|LOCUS_28130 2233 3645 gene locus_tag LOCUS_28140 2233 3645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 3755 5026 gene locus_tag LOCUS_28150 3755 5026 CDS product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970796.1 protein_id gnl|my_center|LOCUS_28150 5041 6489 gene locus_tag LOCUS_28160 5041 6489 CDS product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527913.1 protein_id gnl|my_center|LOCUS_28160 6504 7550 gene locus_tag LOCUS_28170 6504 7550 CDS product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064172.1 protein_id gnl|my_center|LOCUS_28170 7554 8681 gene locus_tag LOCUS_28180 7554 8681 CDS product DUF1513 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019249265.1 protein_id gnl|my_center|LOCUS_28180 10395 8698 gene locus_tag LOCUS_28190 10395 8698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 11510 10404 gene locus_tag LOCUS_28200 11510 10404 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524498.1 protein_id gnl|my_center|LOCUS_28200 12133 11909 gene locus_tag LOCUS_28210 12133 11909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 12021 13847 gene locus_tag LOCUS_28220 12021 13847 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391308.1 protein_id gnl|my_center|LOCUS_28220 13941 15053 gene locus_tag LOCUS_28230 gene dctP 13941 15053 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 protein_id gnl|my_center|LOCUS_28230 16760 15546 gene locus_tag LOCUS_28240 gene hemA 16760 15546 CDS product 5-aminolevulinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390261.1 protein_id gnl|my_center|LOCUS_28240 18455 16992 gene locus_tag LOCUS_28250 18455 16992 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975253.1 protein_id gnl|my_center|LOCUS_28250 18755 19819 gene locus_tag LOCUS_28260 18755 19819 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337841.1 protein_id gnl|my_center|LOCUS_28260 20497 20000 gene locus_tag LOCUS_28270 20497 20000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 20691 21290 gene locus_tag LOCUS_28280 gene hisB 20691 21290 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391344.1 protein_id gnl|my_center|LOCUS_28280 22836 21361 gene locus_tag LOCUS_28290 22836 21361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 23123 23767 gene locus_tag LOCUS_28300 gene hisH 23123 23767 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391343.1 protein_id gnl|my_center|LOCUS_28300 23772 24521 gene locus_tag LOCUS_28310 gene hisA 23772 24521 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391342.1 protein_id gnl|my_center|LOCUS_28310 24523 25305 gene locus_tag LOCUS_28320 gene hisF 24523 25305 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391341.1 protein_id gnl|my_center|LOCUS_28320 25286 25651 gene locus_tag LOCUS_28330 25286 25651 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391340.1 protein_id gnl|my_center|LOCUS_28330 26638 25715 gene locus_tag LOCUS_28340 26638 25715 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086303.1 protein_id gnl|my_center|LOCUS_28340 28296 26677 gene locus_tag LOCUS_28350 28296 26677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 >Feature sequence151 179 730 gene locus_tag LOCUS_28360 179 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 1441 743 gene locus_tag LOCUS_28370 1441 743 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201216122.1 protein_id gnl|my_center|LOCUS_28370 2681 1434 gene locus_tag LOCUS_28380 2681 1434 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389453.1 protein_id gnl|my_center|LOCUS_28380 4221 2917 gene locus_tag LOCUS_28390 4221 2917 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389451.1 protein_id gnl|my_center|LOCUS_28390 4730 4263 gene locus_tag LOCUS_28400 4730 4263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 5883 5497 gene locus_tag LOCUS_28410 5883 5497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 6238 7203 gene locus_tag LOCUS_28420 6238 7203 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470590.1 protein_id gnl|my_center|LOCUS_28420 9709 7232 gene locus_tag LOCUS_28430 9709 7232 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389899.1 protein_id gnl|my_center|LOCUS_28430 11283 9841 gene locus_tag LOCUS_28440 gene glgA 11283 9841 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389900.1 protein_id gnl|my_center|LOCUS_28440 11518 12837 gene locus_tag LOCUS_28450 gene glgC 11518 12837 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389901.1 protein_id gnl|my_center|LOCUS_28450 13896 12853 gene locus_tag LOCUS_28460 13896 12853 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389904.1 protein_id gnl|my_center|LOCUS_28460 15251 13908 gene locus_tag LOCUS_28470 15251 13908 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388333.1 protein_id gnl|my_center|LOCUS_28470 16921 15398 gene locus_tag LOCUS_28480 16921 15398 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388332.1 protein_id gnl|my_center|LOCUS_28480 18340 16970 gene locus_tag LOCUS_28490 18340 16970 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529682.1 protein_id gnl|my_center|LOCUS_28490 18505 20175 gene locus_tag LOCUS_28500 18505 20175 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966515.1 protein_id gnl|my_center|LOCUS_28500 20499 20999 gene locus_tag LOCUS_28510 20499 20999 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391028.1 protein_id gnl|my_center|LOCUS_28510 21003 21842 gene locus_tag LOCUS_28520 gene proC 21003 21842 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391029.1 protein_id gnl|my_center|LOCUS_28520 22015 22689 gene locus_tag LOCUS_28530 22015 22689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 23132 23530 gene locus_tag LOCUS_28540 23132 23530 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388031.1 protein_id gnl|my_center|LOCUS_28540 25408 23675 gene locus_tag LOCUS_28550 25408 23675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 25669 27099 gene locus_tag LOCUS_28560 25669 27099 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626273.1 protein_id gnl|my_center|LOCUS_28560 >Feature sequence152 192 953 gene locus_tag LOCUS_28570 192 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 2125 962 gene locus_tag LOCUS_28580 2125 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 2342 2130 gene locus_tag LOCUS_28590 2342 2130 CDS product tail protein X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970908.1 protein_id gnl|my_center|LOCUS_28590 2767 2339 gene locus_tag LOCUS_28600 2767 2339 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038111.1 protein_id gnl|my_center|LOCUS_28600 5354 2754 gene locus_tag LOCUS_28610 5354 2754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 5605 5465 gene locus_tag LOCUS_28620 5605 5465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 5988 5614 gene locus_tag LOCUS_28630 5988 5614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 6522 5995 gene locus_tag LOCUS_28640 6522 5995 CDS product phage major tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247634.1 protein_id gnl|my_center|LOCUS_28640 8022 6607 gene locus_tag LOCUS_28650 8022 6607 CDS product phage tail sheath subtilisin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729859.1 protein_id gnl|my_center|LOCUS_28650 8547 8035 gene locus_tag LOCUS_28660 8547 8035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 9913 8549 gene locus_tag LOCUS_28670 9913 8549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 10186 9923 gene locus_tag LOCUS_28680 10186 9923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 10862 10191 gene locus_tag LOCUS_28690 10862 10191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 12112 10862 gene locus_tag LOCUS_28700 12112 10862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 12583 12116 gene locus_tag LOCUS_28710 12583 12116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28710 12828 12580 gene locus_tag LOCUS_28720 12828 12580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28720 13039 12821 gene locus_tag LOCUS_28730 13039 12821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 14129 13032 gene locus_tag LOCUS_28740 14129 13032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 14470 14126 gene locus_tag LOCUS_28750 14470 14126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 14766 14473 gene locus_tag LOCUS_28760 14766 14473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 15253 14777 gene locus_tag LOCUS_28770 15253 14777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 15822 15253 gene locus_tag LOCUS_28780 15822 15253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 16161 15829 gene locus_tag LOCUS_28790 16161 15829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 16378 16148 gene locus_tag LOCUS_28800 16378 16148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 17421 16378 gene locus_tag LOCUS_28810 17421 16378 CDS product major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975797.1 protein_id gnl|my_center|LOCUS_28810 17789 17436 gene locus_tag LOCUS_28820 17789 17436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 18355 17801 gene locus_tag LOCUS_28830 18355 17801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 19209 18352 gene locus_tag LOCUS_28840 19209 18352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28840 20768 19221 gene locus_tag LOCUS_28850 20768 19221 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975801.1 protein_id gnl|my_center|LOCUS_28850 21041 20829 gene locus_tag LOCUS_28860 21041 20829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 22999 21053 gene locus_tag LOCUS_28870 22999 21053 CDS product phage terminase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975803.1 protein_id gnl|my_center|LOCUS_28870 23728 23012 gene locus_tag LOCUS_28880 23728 23012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 24554 23829 gene locus_tag LOCUS_28890 24554 23829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 24963 24748 gene locus_tag LOCUS_28900 24963 24748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 >Feature sequence153 <1 506 gene locus_tag LOCUS_28910 <1 506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010969783.1:IS256-like element ISRm5 family transposase 838 542 gene locus_tag LOCUS_28920 838 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 1245 2474 gene locus_tag LOCUS_28930 1245 2474 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388922.1 protein_id gnl|my_center|LOCUS_28930 2440 2808 gene locus_tag LOCUS_28940 gene hypA 2440 2808 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388923.1 protein_id gnl|my_center|LOCUS_28940 2808 3668 gene locus_tag LOCUS_28950 gene hypB 2808 3668 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388924.1 protein_id gnl|my_center|LOCUS_28950 3665 4819 gene locus_tag LOCUS_28960 3665 4819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 4836 5093 gene locus_tag LOCUS_28970 4836 5093 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089667.1 protein_id gnl|my_center|LOCUS_28970 5090 6235 gene locus_tag LOCUS_28980 gene hypD 5090 6235 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089666.1 protein_id gnl|my_center|LOCUS_28980 6237 7280 gene locus_tag LOCUS_28990 gene hypE 6237 7280 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948173.1 protein_id gnl|my_center|LOCUS_28990 7749 7318 gene locus_tag LOCUS_29000 7749 7318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 8287 7823 gene locus_tag LOCUS_29010 8287 7823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927660.1 protein_id gnl|my_center|LOCUS_29010 8665 8297 gene locus_tag LOCUS_29020 8665 8297 CDS product DUF6152 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536268.1 protein_id gnl|my_center|LOCUS_29020 9269 8796 gene locus_tag LOCUS_29030 9269 8796 CDS product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197050165.1 protein_id gnl|my_center|LOCUS_29030 9871 9410 gene locus_tag LOCUS_29040 9871 9410 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398241.1 protein_id gnl|my_center|LOCUS_29040 10035 10481 gene locus_tag LOCUS_29050 10035 10481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128261979.1 protein_id gnl|my_center|LOCUS_29050 10510 10926 gene locus_tag LOCUS_29060 10510 10926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 11041 11949 gene locus_tag LOCUS_29070 11041 11949 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389693.1 protein_id gnl|my_center|LOCUS_29070 13860 12181 gene locus_tag LOCUS_29080 13860 12181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 15057 13879 gene locus_tag LOCUS_29090 gene metK 15057 13879 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533374.1 protein_id gnl|my_center|LOCUS_29090 16532 15588 gene locus_tag LOCUS_29100 16532 15588 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804632.1 protein_id gnl|my_center|LOCUS_29100 17732 16950 gene locus_tag LOCUS_29110 17732 16950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 18290 18057 gene locus_tag LOCUS_29120 18290 18057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 18458 19939 gene locus_tag LOCUS_29130 18458 19939 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966426.1 protein_id gnl|my_center|LOCUS_29130 20941 19946 gene locus_tag LOCUS_29140 20941 19946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 21410 22321 gene locus_tag LOCUS_29150 21410 22321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 22318 22731 gene locus_tag LOCUS_29160 22318 22731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 22738 24054 gene locus_tag LOCUS_29170 22738 24054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940069.1 protein_id gnl|my_center|LOCUS_29170 24267 25538 gene locus_tag LOCUS_29180 24267 25538 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940070.1 protein_id gnl|my_center|LOCUS_29180 25541 26161 gene locus_tag LOCUS_29190 25541 26161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 27044 26271 gene locus_tag LOCUS_29200 27044 26271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 27536 32839 gene locus_tag LOCUS_29210 27536 32839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 34215 32887 gene locus_tag LOCUS_29220 34215 32887 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389881.1 protein_id gnl|my_center|LOCUS_29220 34974 34219 gene locus_tag LOCUS_29230 34974 34219 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389880.1 protein_id gnl|my_center|LOCUS_29230 35411 34971 gene locus_tag LOCUS_29240 35411 34971 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389879.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29240 35617 36531 gene locus_tag LOCUS_29250 35617 36531 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389878.1 protein_id gnl|my_center|LOCUS_29250 36557 37615 gene locus_tag LOCUS_29260 36557 37615 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973469.1 protein_id gnl|my_center|LOCUS_29260 37679 38518 gene locus_tag LOCUS_29270 37679 38518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 39329 38538 gene locus_tag LOCUS_29280 39329 38538 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391312.1 protein_id gnl|my_center|LOCUS_29280 40815 39580 gene locus_tag LOCUS_29290 40815 39580 CDS product heme biosynthesis HemY N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391313.1 protein_id gnl|my_center|LOCUS_29290 43021 40820 gene locus_tag LOCUS_29300 43021 40820 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391314.1 protein_id gnl|my_center|LOCUS_29300 44188 43214 gene locus_tag LOCUS_29310 gene hemC 44188 43214 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391315.1 protein_id gnl|my_center|LOCUS_29310 44245 45309 gene locus_tag LOCUS_29320 gene tsaD 44245 45309 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626621.1 protein_id gnl|my_center|LOCUS_29320 46541 45501 gene locus_tag LOCUS_29330 46541 45501 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390165.1 protein_id gnl|my_center|LOCUS_29330 46910 46701 gene locus_tag LOCUS_29340 46910 46701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 47004 48818 gene locus_tag LOCUS_29350 gene phaC 47004 48818 CDS product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390166.1 protein_id gnl|my_center|LOCUS_29350 48928 49122 gene locus_tag LOCUS_29360 48928 49122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 50824 49580 gene locus_tag LOCUS_29370 50824 49580 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388692.1 protein_id gnl|my_center|LOCUS_29370 51255 51446 gene locus_tag LOCUS_29380 51255 51446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 51769 53379 gene locus_tag LOCUS_29390 51769 53379 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470630.1 protein_id gnl|my_center|LOCUS_29390 54006 53839 gene locus_tag LOCUS_29400 gene rpmG 54006 53839 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390953.1 protein_id gnl|my_center|LOCUS_29400 54686 55366 gene locus_tag LOCUS_29410 54686 55366 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083659.1 protein_id gnl|my_center|LOCUS_29410 55455 56342 gene locus_tag LOCUS_29420 55455 56342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971058.1 protein_id gnl|my_center|LOCUS_29420 56786 56358 gene locus_tag LOCUS_29430 56786 56358 CDS product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390786.1 protein_id gnl|my_center|LOCUS_29430 57387 56884 gene locus_tag LOCUS_29440 57387 56884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 58769 57714 gene locus_tag LOCUS_29450 58769 57714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 59498 59175 gene locus_tag LOCUS_29460 59498 59175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 60490 59507 gene locus_tag LOCUS_29470 60490 59507 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969505.1 protein_id gnl|my_center|LOCUS_29470 61490 60483 gene locus_tag LOCUS_29480 61490 60483 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390310.1 protein_id gnl|my_center|LOCUS_29480 61822 63339 gene locus_tag LOCUS_29490 61822 63339 CDS product malonyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967081.1 protein_id gnl|my_center|LOCUS_29490 63425 64582 gene locus_tag LOCUS_29500 gene dprA 63425 64582 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390942.1 protein_id gnl|my_center|LOCUS_29500 64645 67470 gene locus_tag LOCUS_29510 gene topA 64645 67470 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390950.1 protein_id gnl|my_center|LOCUS_29510 67897 68241 gene locus_tag LOCUS_29520 67897 68241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 68705 69103 gene locus_tag LOCUS_29530 68705 69103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 69491 69276 gene locus_tag LOCUS_29540 69491 69276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 70614 69631 gene locus_tag LOCUS_29550 70614 69631 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391118.1 protein_id gnl|my_center|LOCUS_29550 71422 70634 gene locus_tag LOCUS_29560 71422 70634 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389242.1 protein_id gnl|my_center|LOCUS_29560 73571 71439 gene locus_tag LOCUS_29570 73571 71439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 73796 74416 gene locus_tag LOCUS_29580 73796 74416 CDS product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294588.1 protein_id gnl|my_center|LOCUS_29580 74413 75420 gene locus_tag LOCUS_29590 74413 75420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 76106 75417 gene locus_tag LOCUS_29600 76106 75417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 77586 76123 gene locus_tag LOCUS_29610 77586 76123 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626100.1 protein_id gnl|my_center|LOCUS_29610 78792 77896 gene locus_tag LOCUS_29620 78792 77896 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390493.1 protein_id gnl|my_center|LOCUS_29620 79309 78818 gene locus_tag LOCUS_29630 gene fliJ 79309 78818 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388285.1 protein_id gnl|my_center|LOCUS_29630 80446 79319 gene locus_tag LOCUS_29640 80446 79319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 81325 80657 gene locus_tag LOCUS_29650 81325 80657 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389521.1 protein_id gnl|my_center|LOCUS_29650 82113 81322 gene locus_tag LOCUS_29660 gene surE 82113 81322 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389522.1 protein_id gnl|my_center|LOCUS_29660 83380 82106 gene locus_tag LOCUS_29670 gene serS 83380 82106 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389523.1 protein_id gnl|my_center|LOCUS_29670 84461 83418 gene locus_tag LOCUS_29680 84461 83418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 84969 84466 gene locus_tag LOCUS_29690 84969 84466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 85345 85112 gene locus_tag LOCUS_29700 85345 85112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 86797 85463 gene locus_tag LOCUS_29710 86797 85463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 87287 86856 gene locus_tag LOCUS_29720 87287 86856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 88588 87284 gene locus_tag LOCUS_29730 88588 87284 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463605.1 protein_id gnl|my_center|LOCUS_29730 89321 88986 gene locus_tag LOCUS_29740 89321 88986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 92374 89318 gene locus_tag LOCUS_29750 gene vexK 92374 89318 CDS product efflux RND transporter permease subunit VexK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625968.1 protein_id gnl|my_center|LOCUS_29750 93562 92384 gene locus_tag LOCUS_29760 93562 92384 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837901.1 protein_id gnl|my_center|LOCUS_29760 94256 93609 gene locus_tag LOCUS_29770 gene maiA 94256 93609 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810527.1 protein_id gnl|my_center|LOCUS_29770 94789 94253 gene locus_tag LOCUS_29780 94789 94253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 95210 94800 gene locus_tag LOCUS_29790 95210 94800 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941070.1 protein_id gnl|my_center|LOCUS_29790 96519 95218 gene locus_tag LOCUS_29800 96519 95218 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812141.1 protein_id gnl|my_center|LOCUS_29800 97057 96524 gene locus_tag LOCUS_29810 97057 96524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 98679 97657 gene locus_tag LOCUS_29820 98679 97657 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538040.1 protein_id gnl|my_center|LOCUS_29820 99004 99540 gene locus_tag LOCUS_29830 99004 99540 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085118.1 protein_id gnl|my_center|LOCUS_29830 99679 100698 gene locus_tag LOCUS_29840 99679 100698 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034855886.1 protein_id gnl|my_center|LOCUS_29840 100702 102330 gene locus_tag LOCUS_29850 100702 102330 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085117.1 protein_id gnl|my_center|LOCUS_29850 102348 102542 gene locus_tag LOCUS_29860 102348 102542 CDS product DUF2783 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808487.1 protein_id gnl|my_center|LOCUS_29860 102565 103518 gene locus_tag LOCUS_29870 102565 103518 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185661.1 protein_id gnl|my_center|LOCUS_29870 103524 104717 gene locus_tag LOCUS_29880 103524 104717 CDS product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706371.1 protein_id gnl|my_center|LOCUS_29880 >Feature sequence154 329 1978 gene locus_tag LOCUS_29890 gene fliF 329 1978 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388303.1 protein_id gnl|my_center|LOCUS_29890 2018 3037 gene locus_tag LOCUS_29900 gene fliG 2018 3037 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388302.1 protein_id gnl|my_center|LOCUS_29900 3174 4103 gene locus_tag LOCUS_29910 3174 4103 CDS product FliH/SctL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388301.1 protein_id gnl|my_center|LOCUS_29910 4114 4476 gene locus_tag LOCUS_29920 gene fliN 4114 4476 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388300.1 protein_id gnl|my_center|LOCUS_29920 4481 5320 gene locus_tag LOCUS_29930 4481 5320 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388299.1 protein_id gnl|my_center|LOCUS_29930 5387 6778 gene locus_tag LOCUS_29940 5387 6778 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388298.1 protein_id gnl|my_center|LOCUS_29940 6852 9023 gene locus_tag LOCUS_29950 gene flhA 6852 9023 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388297.1 protein_id gnl|my_center|LOCUS_29950 9183 10241 gene locus_tag LOCUS_29960 9183 10241 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440034.1 protein_id gnl|my_center|LOCUS_29960 10238 11029 gene locus_tag LOCUS_29970 10238 11029 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440322.1 protein_id gnl|my_center|LOCUS_29970 11206 12999 gene locus_tag LOCUS_29980 11206 12999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388289.1 protein_id gnl|my_center|LOCUS_29980 13429 13031 gene locus_tag LOCUS_29990 13429 13031 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252024.1 protein_id gnl|my_center|LOCUS_29990 13674 13426 gene locus_tag LOCUS_30000 13674 13426 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061623.1 protein_id gnl|my_center|LOCUS_30000 13817 15001 gene locus_tag LOCUS_30010 13817 15001 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919935.1 protein_id gnl|my_center|LOCUS_30010 15590 15063 gene locus_tag LOCUS_30020 15590 15063 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265507.1 protein_id gnl|my_center|LOCUS_30020 17117 15666 gene locus_tag LOCUS_30030 17117 15666 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066922.1 protein_id gnl|my_center|LOCUS_30030 18098 17256 gene locus_tag LOCUS_30040 18098 17256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 19150 18683 gene locus_tag LOCUS_30050 19150 18683 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391209.1 protein_id gnl|my_center|LOCUS_30050 21419 19464 gene locus_tag LOCUS_30060 21419 19464 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391207.1 protein_id gnl|my_center|LOCUS_30060 21738 21466 gene locus_tag LOCUS_30070 21738 21466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 21902 22165 gene locus_tag LOCUS_30080 21902 22165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 24468 22192 gene locus_tag LOCUS_30090 24468 22192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 >Feature sequence155 1501 833 gene locus_tag LOCUS_30100 1501 833 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268731.1 protein_id gnl|my_center|LOCUS_30100 3561 1528 gene locus_tag LOCUS_30110 3561 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 5011 3785 gene locus_tag LOCUS_30120 5011 3785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 7018 5606 gene locus_tag LOCUS_30130 7018 5606 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085916.1 protein_id gnl|my_center|LOCUS_30130 7718 7041 gene locus_tag LOCUS_30140 7718 7041 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390663.1 protein_id gnl|my_center|LOCUS_30140 7632 7856 gene locus_tag LOCUS_30150 7632 7856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 9710 8391 gene locus_tag LOCUS_30160 9710 8391 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388286.1 protein_id gnl|my_center|LOCUS_30160 10211 9717 gene locus_tag LOCUS_30170 10211 9717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 11166 10417 gene locus_tag LOCUS_30180 11166 10417 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640545.1 protein_id gnl|my_center|LOCUS_30180 11739 13199 gene locus_tag LOCUS_30190 11739 13199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 13196 15232 gene locus_tag LOCUS_30200 13196 15232 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389479.1 protein_id gnl|my_center|LOCUS_30200 15296 18631 gene locus_tag LOCUS_30210 gene treS 15296 18631 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389295.1 protein_id gnl|my_center|LOCUS_30210 18648 20837 gene locus_tag LOCUS_30220 gene glgX 18648 20837 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389296.1 protein_id gnl|my_center|LOCUS_30220 20866 23076 gene locus_tag LOCUS_30230 gene malQ 20866 23076 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389297.1 protein_id gnl|my_center|LOCUS_30230 24120 23719 gene locus_tag LOCUS_30240 24120 23719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 >Feature sequence156 269 856 gene locus_tag LOCUS_30250 269 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 1905 1024 gene locus_tag LOCUS_30260 1905 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 2043 2411 gene locus_tag LOCUS_30270 2043 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 3959 2607 gene locus_tag LOCUS_30280 gene hemN 3959 2607 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390257.1 protein_id gnl|my_center|LOCUS_30280 4070 4861 gene locus_tag LOCUS_30290 4070 4861 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390256.1 protein_id gnl|my_center|LOCUS_30290 5539 4862 gene locus_tag LOCUS_30300 5539 4862 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389560.1 protein_id gnl|my_center|LOCUS_30300 6636 5833 gene locus_tag LOCUS_30310 6636 5833 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389559.1 protein_id gnl|my_center|LOCUS_30310 6945 10133 gene locus_tag LOCUS_30320 6945 10133 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389558.1 protein_id gnl|my_center|LOCUS_30320 10619 11029 gene locus_tag LOCUS_30330 10619 11029 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388775.1 protein_id gnl|my_center|LOCUS_30330 12354 11113 gene locus_tag LOCUS_30340 12354 11113 CDS product flagellar hook-basal body complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390184.1 protein_id gnl|my_center|LOCUS_30340 13583 12582 gene locus_tag LOCUS_30350 gene thiS 13583 12582 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390185.1 protein_id gnl|my_center|LOCUS_30350 14580 13792 gene locus_tag LOCUS_30360 14580 13792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 14880 16337 gene locus_tag LOCUS_30370 14880 16337 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626309.1 protein_id gnl|my_center|LOCUS_30370 17802 16393 gene locus_tag LOCUS_30380 17802 16393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 20490 18553 gene locus_tag LOCUS_30390 gene acs 20490 18553 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391322.1 protein_id gnl|my_center|LOCUS_30390 21056 20724 gene locus_tag LOCUS_30400 21056 20724 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391321.1 protein_id gnl|my_center|LOCUS_30400 21427 21065 gene locus_tag LOCUS_30410 21427 21065 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391339.1 protein_id gnl|my_center|LOCUS_30410 23498 21486 gene locus_tag LOCUS_30420 23498 21486 CDS product cobalt chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387960.1 protein_id gnl|my_center|LOCUS_30420 >Feature sequence157 255 180 gene locus_tag LOCUS_t00420 255 180 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 798 454 gene locus_tag LOCUS_30430 798 454 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724123.1 protein_id gnl|my_center|LOCUS_30430 989 4621 gene locus_tag LOCUS_30440 989 4621 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063869.1 protein_id gnl|my_center|LOCUS_30440 5312 4659 gene locus_tag LOCUS_30450 5312 4659 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405133.1 protein_id gnl|my_center|LOCUS_30450 5693 5481 gene locus_tag LOCUS_30460 5693 5481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 5856 7583 gene locus_tag LOCUS_30470 5856 7583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 7641 8321 gene locus_tag LOCUS_30480 7641 8321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 9092 8328 gene locus_tag LOCUS_30490 9092 8328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 9601 9095 gene locus_tag LOCUS_30500 9601 9095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 10578 9733 gene locus_tag LOCUS_30510 10578 9733 CDS product carotenoid 1,2-hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390733.1 protein_id gnl|my_center|LOCUS_30510 12179 10617 gene locus_tag LOCUS_30520 gene crtI 12179 10617 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390732.1 protein_id gnl|my_center|LOCUS_30520 12384 13253 gene locus_tag LOCUS_30530 12384 13253 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390731.1 protein_id gnl|my_center|LOCUS_30530 13372 14505 gene locus_tag LOCUS_30540 13372 14505 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390730.1 protein_id gnl|my_center|LOCUS_30540 14658 15602 gene locus_tag LOCUS_30550 gene bchC 14658 15602 CDS product chlorophyll synthesis pathway protein BchC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390729.1 protein_id gnl|my_center|LOCUS_30550 15599 16534 gene locus_tag LOCUS_30560 15599 16534 CDS product chlorophyllide a reductase iron protein subunit X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390728.1 protein_id gnl|my_center|LOCUS_30560 16571 18112 gene locus_tag LOCUS_30570 gene bchY 16571 18112 CDS product chlorophyllide a reductase subunit Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390727.1 protein_id gnl|my_center|LOCUS_30570 18112 19569 gene locus_tag LOCUS_30580 gene bchZ 18112 19569 CDS product chlorophyllide a reductase subunit Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390726.1 protein_id gnl|my_center|LOCUS_30580 19779 19985 gene locus_tag LOCUS_30590 gene pufB 19779 19985 CDS product light-harvesting antenna LH1, beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126701591.1 protein_id gnl|my_center|LOCUS_30590 19997 20164 gene locus_tag LOCUS_30600 19997 20164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 20304 21128 gene locus_tag LOCUS_30610 gene pufL 20304 21128 CDS product photosynthetic reaction center subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390723.1 protein_id gnl|my_center|LOCUS_30610 21147 22124 gene locus_tag LOCUS_30620 gene pufM 21147 22124 CDS product photosynthetic reaction center subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390722.1 protein_id gnl|my_center|LOCUS_30620 >Feature sequence158 1245 256 gene locus_tag LOCUS_30630 gene draG 1245 256 CDS product ADP-ribosyl-[dinitrogen reductase] hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388763.1 protein_id gnl|my_center|LOCUS_30630 2072 1242 gene locus_tag LOCUS_30640 2072 1242 CDS product NAD(+)--dinitrogen-reductase ADP-D-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626076.1 protein_id gnl|my_center|LOCUS_30640 2455 3339 gene locus_tag LOCUS_30650 gene nifH 2455 3339 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720705.1 protein_id gnl|my_center|LOCUS_30650 3349 4890 gene locus_tag LOCUS_30660 gene nifD 3349 4890 CDS product nitrogenase molybdenum-iron protein alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388766.1 protein_id gnl|my_center|LOCUS_30660 4914 6452 gene locus_tag LOCUS_30670 gene nifK 4914 6452 CDS product nitrogenase molybdenum-iron protein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338303.1 protein_id gnl|my_center|LOCUS_30670 6534 6830 gene locus_tag LOCUS_30680 6534 6830 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389919.1 protein_id gnl|my_center|LOCUS_30680 7705 7448 gene locus_tag LOCUS_30690 7705 7448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 8052 8128 gene locus_tag LOCUS_t00430 8052 8128 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 8240 8545 gene locus_tag LOCUS_30700 8240 8545 CDS product ETC complex I subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389336.1 protein_id gnl|my_center|LOCUS_30700 8834 10228 gene locus_tag LOCUS_30710 gene nifE 8834 10228 CDS product nitrogenase iron-molybdenum cofactor biosynthesis protein NifE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389941.1 protein_id gnl|my_center|LOCUS_30710 10225 11613 gene locus_tag LOCUS_30720 gene nifN 10225 11613 CDS product nitrogenase iron-molybdenum cofactor biosynthesis protein NifN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389940.1 protein_id gnl|my_center|LOCUS_30720 11684 12130 gene locus_tag LOCUS_30730 gene nifX 11684 12130 CDS product nitrogen fixation protein NifX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440142.1 protein_id gnl|my_center|LOCUS_30730 12144 12701 gene locus_tag LOCUS_30740 12144 12701 CDS product NifX-associated nitrogen fixation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533485.1 protein_id gnl|my_center|LOCUS_30740 12758 13060 gene locus_tag LOCUS_30750 gene fdxB 12758 13060 CDS product ferredoxin III, nif-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389937.1 protein_id gnl|my_center|LOCUS_30750 13133 13684 gene locus_tag LOCUS_30760 13133 13684 CDS product nitrogen fixation protein NifQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389936.1 protein_id gnl|my_center|LOCUS_30760 13908 14954 gene locus_tag LOCUS_30770 gene argC 13908 14954 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390174.1 protein_id gnl|my_center|LOCUS_30770 15294 16148 gene locus_tag LOCUS_30780 15294 16148 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389488.1 protein_id gnl|my_center|LOCUS_30780 16183 16305 gene locus_tag LOCUS_30790 16183 16305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 16568 17815 gene locus_tag LOCUS_30800 16568 17815 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389486.1 protein_id gnl|my_center|LOCUS_30800 17964 18440 gene locus_tag LOCUS_30810 17964 18440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 20708 18630 gene locus_tag LOCUS_30820 20708 18630 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390482.1 protein_id gnl|my_center|LOCUS_30820 21126 20854 gene locus_tag LOCUS_30830 21126 20854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 21429 21773 gene locus_tag LOCUS_30840 21429 21773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389484.1 protein_id gnl|my_center|LOCUS_30840 22336 21794 gene locus_tag LOCUS_30850 22336 21794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 >Feature sequence159 1371 169 gene locus_tag LOCUS_30860 gene hemW 1371 169 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391386.1 protein_id gnl|my_center|LOCUS_30860 1471 1986 gene locus_tag LOCUS_30870 1471 1986 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388365.1 protein_id gnl|my_center|LOCUS_30870 2343 2915 gene locus_tag LOCUS_30880 2343 2915 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389951.1 protein_id gnl|my_center|LOCUS_30880 2969 3277 gene locus_tag LOCUS_30890 2969 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 5059 3287 gene locus_tag LOCUS_30900 5059 3287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390048.1 protein_id gnl|my_center|LOCUS_30900 5351 6367 gene locus_tag LOCUS_30910 5351 6367 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625876.1 protein_id gnl|my_center|LOCUS_30910 7378 6446 gene locus_tag LOCUS_30920 7378 6446 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169775301.1 protein_id gnl|my_center|LOCUS_30920 7474 8355 gene locus_tag LOCUS_30930 7474 8355 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390216.1 protein_id gnl|my_center|LOCUS_30930 8421 9566 gene locus_tag LOCUS_30940 8421 9566 CDS product carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390215.1 protein_id gnl|my_center|LOCUS_30940 9633 11528 gene locus_tag LOCUS_30950 9633 11528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 14033 12048 gene locus_tag LOCUS_30960 14033 12048 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387813.1 protein_id gnl|my_center|LOCUS_30960 14167 14553 gene locus_tag LOCUS_30970 14167 14553 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035636367.1 protein_id gnl|my_center|LOCUS_30970 16808 15276 gene locus_tag LOCUS_30980 16808 15276 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387814.1 protein_id gnl|my_center|LOCUS_30980 18600 17086 gene locus_tag LOCUS_30990 18600 17086 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391290.1 protein_id gnl|my_center|LOCUS_30990 20963 18693 gene locus_tag LOCUS_31000 20963 18693 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391289.1 protein_id gnl|my_center|LOCUS_31000 21388 22389 gene locus_tag LOCUS_31010 21388 22389 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339009.1 protein_id gnl|my_center|LOCUS_31010 >Feature sequence160 531 130 gene locus_tag LOCUS_31020 531 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 2120 786 gene locus_tag LOCUS_31030 2120 786 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391178.1 protein_id gnl|my_center|LOCUS_31030 3217 2123 gene locus_tag LOCUS_31040 gene accD 3217 2123 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626593.1 protein_id gnl|my_center|LOCUS_31040 4073 3234 gene locus_tag LOCUS_31050 gene trpA 4073 3234 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391175.1 protein_id gnl|my_center|LOCUS_31050 5299 4073 gene locus_tag LOCUS_31060 gene trpB 5299 4073 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391174.1 protein_id gnl|my_center|LOCUS_31060 5625 7106 gene locus_tag LOCUS_31070 5625 7106 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_31070 7140 7727 gene locus_tag LOCUS_31080 7140 7727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 7802 9313 gene locus_tag LOCUS_31090 7802 9313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 9310 10230 gene locus_tag LOCUS_31100 9310 10230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 11882 10335 gene locus_tag LOCUS_31110 gene ubiB 11882 10335 CDS product 2-polyprenylphenol 6-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391544.1 protein_id gnl|my_center|LOCUS_31110 12797 11922 gene locus_tag LOCUS_31120 gene ubiE 12797 11922 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626664.1 protein_id gnl|my_center|LOCUS_31120 12902 13738 gene locus_tag LOCUS_31130 gene mutM 12902 13738 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391546.1 protein_id gnl|my_center|LOCUS_31130 13754 14209 gene locus_tag LOCUS_31140 13754 14209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 14306 15082 gene locus_tag LOCUS_31150 14306 15082 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391548.1 protein_id gnl|my_center|LOCUS_31150 15318 15584 gene locus_tag LOCUS_31160 gene rpsT 15318 15584 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391549.1 protein_id gnl|my_center|LOCUS_31160 15816 16361 gene locus_tag LOCUS_31170 15816 16361 CDS product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391072.1 protein_id gnl|my_center|LOCUS_31170 16366 18855 gene locus_tag LOCUS_31180 16366 18855 CDS product heavy metal translocating P-type ATPase metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391071.1 protein_id gnl|my_center|LOCUS_31180 18852 19016 gene locus_tag LOCUS_31190 18852 19016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 19154 19951 gene locus_tag LOCUS_31200 19154 19951 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391069.1 protein_id gnl|my_center|LOCUS_31200 20482 19964 gene locus_tag LOCUS_31210 gene gpt 20482 19964 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391066.1 protein_id gnl|my_center|LOCUS_31210 >Feature sequence161 1445 144 gene locus_tag LOCUS_31220 1445 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 2004 1928 gene locus_tag LOCUS_t00440 2004 1928 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2280 3482 gene locus_tag LOCUS_31230 2280 3482 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387999.1 protein_id gnl|my_center|LOCUS_31230 3479 4267 gene locus_tag LOCUS_31240 3479 4267 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387998.1 protein_id gnl|my_center|LOCUS_31240 4455 5918 gene locus_tag LOCUS_31250 gene guaB 4455 5918 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387997.1 protein_id gnl|my_center|LOCUS_31250 6083 6622 gene locus_tag LOCUS_31260 6083 6622 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390173.1 protein_id gnl|my_center|LOCUS_31260 6636 7418 gene locus_tag LOCUS_31270 6636 7418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 8204 7647 gene locus_tag LOCUS_31280 8204 7647 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929688.1 protein_id gnl|my_center|LOCUS_31280 8581 8312 gene locus_tag LOCUS_31290 8581 8312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 8911 9963 gene locus_tag LOCUS_31300 8911 9963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 10155 11615 gene locus_tag LOCUS_31310 gene cysG 10155 11615 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405073.1 protein_id gnl|my_center|LOCUS_31310 11619 11954 gene locus_tag LOCUS_31320 11619 11954 CDS product DUF2849 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084294.1 protein_id gnl|my_center|LOCUS_31320 11975 13636 gene locus_tag LOCUS_31330 11975 13636 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084295.1 protein_id gnl|my_center|LOCUS_31330 13623 14159 gene locus_tag LOCUS_31340 13623 14159 CDS product DUF934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084296.1 protein_id gnl|my_center|LOCUS_31340 14156 14914 gene locus_tag LOCUS_31350 14156 14914 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389682.1 protein_id gnl|my_center|LOCUS_31350 15412 15047 gene locus_tag LOCUS_31360 15412 15047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528001.1 protein_id gnl|my_center|LOCUS_31360 16234 15425 gene locus_tag LOCUS_31370 16234 15425 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389377.1 protein_id gnl|my_center|LOCUS_31370 16519 16250 gene locus_tag LOCUS_31380 16519 16250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389376.1 protein_id gnl|my_center|LOCUS_31380 17969 16587 gene locus_tag LOCUS_31390 gene hflX 17969 16587 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389375.1 protein_id gnl|my_center|LOCUS_31390 18227 17973 gene locus_tag LOCUS_31400 gene hfq 18227 17973 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389374.1 protein_id gnl|my_center|LOCUS_31400 19165 18443 gene locus_tag LOCUS_31410 19165 18443 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389373.1 protein_id gnl|my_center|LOCUS_31410 20040 19162 gene locus_tag LOCUS_31420 20040 19162 CDS product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389372.1 protein_id gnl|my_center|LOCUS_31420 >Feature sequence162 852 172 gene locus_tag LOCUS_31430 gene thiE 852 172 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388835.1 protein_id gnl|my_center|LOCUS_31430 1926 895 gene locus_tag LOCUS_31440 1926 895 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133291485.1 protein_id gnl|my_center|LOCUS_31440 3239 1938 gene locus_tag LOCUS_31450 3239 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 4354 3236 gene locus_tag LOCUS_31460 4354 3236 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390398.1 protein_id gnl|my_center|LOCUS_31460 4526 5578 gene locus_tag LOCUS_31470 4526 5578 CDS product DUF3179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626430.1 protein_id gnl|my_center|LOCUS_31470 5575 6129 gene locus_tag LOCUS_31480 5575 6129 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531338.1 protein_id gnl|my_center|LOCUS_31480 6122 6778 gene locus_tag LOCUS_31490 6122 6778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 6810 7244 gene locus_tag LOCUS_31500 6810 7244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 7854 8120 gene locus_tag LOCUS_31510 7854 8120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 8307 8594 gene locus_tag LOCUS_31520 8307 8594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 9159 9776 gene locus_tag LOCUS_31530 9159 9776 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920504.1 protein_id gnl|my_center|LOCUS_31530 9842 10855 gene locus_tag LOCUS_31540 9842 10855 CDS product SLAC1 anion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049788774.1 protein_id gnl|my_center|LOCUS_31540 11550 11176 gene locus_tag LOCUS_31550 gene flaF 11550 11176 CDS product flagellar biosynthesis regulator FlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626463.1 protein_id gnl|my_center|LOCUS_31550 11986 11474 gene locus_tag LOCUS_31560 11986 11474 CDS product flagellar biosynthesis repressor FlbT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390484.1 protein_id gnl|my_center|LOCUS_31560 12899 12105 gene locus_tag LOCUS_31570 gene cobF 12899 12105 CDS product precorrin-6A synthase (deacetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390718.1 protein_id gnl|my_center|LOCUS_31570 14110 12896 gene locus_tag LOCUS_31580 gene cbiE 14110 12896 CDS product precorrin-6y C5,15-methyltransferase (decarboxylating) subunit CbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114023.1 protein_id gnl|my_center|LOCUS_31580 14974 14114 gene locus_tag LOCUS_31590 14974 14114 CDS product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531081.1 protein_id gnl|my_center|LOCUS_31590 15554 14967 gene locus_tag LOCUS_31600 15554 14967 CDS product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195469.1 protein_id gnl|my_center|LOCUS_31600 16179 15631 gene locus_tag LOCUS_31610 16179 15631 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391278.1 protein_id gnl|my_center|LOCUS_31610 16794 16405 gene locus_tag LOCUS_31620 16794 16405 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531698.1 protein_id gnl|my_center|LOCUS_31620 17051 16791 gene locus_tag LOCUS_31630 17051 16791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 17789 17124 gene locus_tag LOCUS_31640 17789 17124 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391457.1 protein_id gnl|my_center|LOCUS_31640 18871 17834 gene locus_tag LOCUS_31650 18871 17834 CDS product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391458.1 protein_id gnl|my_center|LOCUS_31650 19185 19259 gene locus_tag LOCUS_t00450 19185 19259 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 19825 19475 gene locus_tag LOCUS_31660 19825 19475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 19887 20042 gene locus_tag LOCUS_31670 19887 20042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 20058 20270 gene locus_tag LOCUS_31680 20058 20270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 >Feature sequence163 85 414 gene locus_tag LOCUS_31690 85 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 1174 434 gene locus_tag LOCUS_31700 gene cobB 1174 434 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391392.1 protein_id gnl|my_center|LOCUS_31700 2908 1235 gene locus_tag LOCUS_31710 2908 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 3535 3344 gene locus_tag LOCUS_31720 3535 3344 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387972.1 protein_id gnl|my_center|LOCUS_31720 5288 3675 gene locus_tag LOCUS_31730 5288 3675 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029723090.1 protein_id gnl|my_center|LOCUS_31730 6084 5290 gene locus_tag LOCUS_31740 6084 5290 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707648.1 protein_id gnl|my_center|LOCUS_31740 6973 6071 gene locus_tag LOCUS_31750 gene folD 6973 6071 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338398.1 protein_id gnl|my_center|LOCUS_31750 7349 7008 gene locus_tag LOCUS_31760 7349 7008 CDS product DUF167 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391273.1 protein_id gnl|my_center|LOCUS_31760 7659 7360 gene locus_tag LOCUS_31770 7659 7360 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391274.1 protein_id gnl|my_center|LOCUS_31770 8368 7763 gene locus_tag LOCUS_31780 8368 7763 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529755.1 protein_id gnl|my_center|LOCUS_31780 10597 8720 gene locus_tag LOCUS_31790 10597 8720 CDS product flagellar hook-basal body complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388304.1 protein_id gnl|my_center|LOCUS_31790 11448 10708 gene locus_tag LOCUS_31800 11448 10708 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388305.1 protein_id gnl|my_center|LOCUS_31800 13399 11462 gene locus_tag LOCUS_31810 13399 11462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 13717 14163 gene locus_tag LOCUS_31820 13717 14163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 14211 14963 gene locus_tag LOCUS_31830 gene truA 14211 14963 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391099.1 protein_id gnl|my_center|LOCUS_31830 14970 15293 gene locus_tag LOCUS_31840 14970 15293 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933123.1 protein_id gnl|my_center|LOCUS_31840 15387 15677 gene locus_tag LOCUS_31850 15387 15677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 15812 16309 gene locus_tag LOCUS_31860 15812 16309 CDS product RT0821/Lpp0805 family surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596824.1 protein_id gnl|my_center|LOCUS_31860 16391 17479 gene locus_tag LOCUS_31870 16391 17479 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391404.1 protein_id gnl|my_center|LOCUS_31870 17562 17636 gene locus_tag LOCUS_t00460 17562 17636 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 17885 19771 gene locus_tag LOCUS_31880 17885 19771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 >Feature sequence164 1196 345 gene locus_tag LOCUS_31890 1196 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 2806 1313 gene locus_tag LOCUS_31900 2806 1313 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808822.1 protein_id gnl|my_center|LOCUS_31900 3016 3909 gene locus_tag LOCUS_31910 3016 3909 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389591.1 protein_id gnl|my_center|LOCUS_31910 4231 4515 gene locus_tag LOCUS_31920 4231 4515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 5127 4669 gene locus_tag LOCUS_31930 5127 4669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 7410 5302 gene locus_tag LOCUS_31940 7410 5302 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122785.1 protein_id gnl|my_center|LOCUS_31940 8772 7414 gene locus_tag LOCUS_31950 8772 7414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 9521 8769 gene locus_tag LOCUS_31960 9521 8769 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389848.1 protein_id gnl|my_center|LOCUS_31960 11088 9526 gene locus_tag LOCUS_31970 11088 9526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 17239 11291 gene locus_tag LOCUS_31980 17239 11291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 18239 17289 gene locus_tag LOCUS_31990 18239 17289 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521465.1 protein_id gnl|my_center|LOCUS_31990 19285 18578 gene locus_tag LOCUS_32000 19285 18578 CDS product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188582106.1 protein_id gnl|my_center|LOCUS_32000 20199 19507 gene locus_tag LOCUS_32010 gene scpB 20199 19507 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389527.1 protein_id gnl|my_center|LOCUS_32010 21028 20189 gene locus_tag LOCUS_32020 21028 20189 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389528.1 protein_id gnl|my_center|LOCUS_32020 21732 21052 gene locus_tag LOCUS_32030 21732 21052 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086687.1 protein_id gnl|my_center|LOCUS_32030 22751 21729 gene locus_tag LOCUS_32040 gene nagZ 22751 21729 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640386.1 protein_id gnl|my_center|LOCUS_32040 23877 22738 gene locus_tag LOCUS_32050 23877 22738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 25715 23940 gene locus_tag LOCUS_32060 gene argS 25715 23940 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389532.1 protein_id gnl|my_center|LOCUS_32060 26930 25752 gene locus_tag LOCUS_32070 26930 25752 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389533.1 protein_id gnl|my_center|LOCUS_32070 26815 27135 gene locus_tag LOCUS_32080 26815 27135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 27350 27105 gene locus_tag LOCUS_32090 27350 27105 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005334896.1 protein_id gnl|my_center|LOCUS_32090 27695 29416 gene locus_tag LOCUS_32100 27695 29416 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390531.1 protein_id gnl|my_center|LOCUS_32100 29430 30254 gene locus_tag LOCUS_32110 29430 30254 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390532.1 protein_id gnl|my_center|LOCUS_32110 30305 30808 gene locus_tag LOCUS_32120 30305 30808 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390533.1 protein_id gnl|my_center|LOCUS_32120 30845 31897 gene locus_tag LOCUS_32130 30845 31897 CDS product alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105384656.1 protein_id gnl|my_center|LOCUS_32130 31960 32676 gene locus_tag LOCUS_32140 31960 32676 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390534.1 protein_id gnl|my_center|LOCUS_32140 32961 35291 gene locus_tag LOCUS_32150 32961 35291 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089908.1 protein_id gnl|my_center|LOCUS_32150 35497 36459 gene locus_tag LOCUS_32160 gene rarD 35497 36459 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044965.1 protein_id gnl|my_center|LOCUS_32160 36578 36967 gene locus_tag LOCUS_32170 36578 36967 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147119.1 protein_id gnl|my_center|LOCUS_32170 36974 37276 gene locus_tag LOCUS_32180 36974 37276 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095863.1 protein_id gnl|my_center|LOCUS_32180 39267 37291 gene locus_tag LOCUS_32190 39267 37291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 40082 43609 gene locus_tag LOCUS_32200 gene mfd 40082 43609 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389416.1 protein_id gnl|my_center|LOCUS_32200 44396 43869 gene locus_tag LOCUS_32210 gene lptE 44396 43869 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391377.1 protein_id gnl|my_center|LOCUS_32210 47011 44393 gene locus_tag LOCUS_32220 gene leuS 47011 44393 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391378.1 protein_id gnl|my_center|LOCUS_32220 47795 47229 gene locus_tag LOCUS_32230 47795 47229 CDS product DUF3576 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391379.1 protein_id gnl|my_center|LOCUS_32230 48192 47983 gene locus_tag LOCUS_32240 48192 47983 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084262.1 protein_id gnl|my_center|LOCUS_32240 49714 48284 gene locus_tag LOCUS_32250 49714 48284 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918720.1 protein_id gnl|my_center|LOCUS_32250 50071 50853 gene locus_tag LOCUS_32260 50071 50853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 50850 52154 gene locus_tag LOCUS_32270 50850 52154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 52185 52949 gene locus_tag LOCUS_32280 52185 52949 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337690.1 protein_id gnl|my_center|LOCUS_32280 52939 53787 gene locus_tag LOCUS_32290 52939 53787 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387888.1 protein_id gnl|my_center|LOCUS_32290 54043 54231 gene locus_tag LOCUS_32300 54043 54231 CDS product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531032.1 protein_id gnl|my_center|LOCUS_32300 55624 54281 gene locus_tag LOCUS_32310 55624 54281 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390721.1 protein_id gnl|my_center|LOCUS_32310 57088 55637 gene locus_tag LOCUS_32320 57088 55637 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390720.1 protein_id gnl|my_center|LOCUS_32320 57294 57557 gene locus_tag LOCUS_32330 57294 57557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 57574 57972 gene locus_tag LOCUS_32340 57574 57972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 59458 57980 gene locus_tag LOCUS_32350 59458 57980 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921045.1 protein_id gnl|my_center|LOCUS_32350 60242 59370 gene locus_tag LOCUS_32360 60242 59370 CDS product ImuA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972865.1 protein_id gnl|my_center|LOCUS_32360 60502 61413 gene locus_tag LOCUS_32370 gene cysD 60502 61413 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707309.1 protein_id gnl|my_center|LOCUS_32370 61413 63323 gene locus_tag LOCUS_32380 gene cysN 61413 63323 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919356.1 protein_id gnl|my_center|LOCUS_32380 63400 64071 gene locus_tag LOCUS_32390 63400 64071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 64793 64068 gene locus_tag LOCUS_32400 64793 64068 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388409.1 protein_id gnl|my_center|LOCUS_32400 65020 66276 gene locus_tag LOCUS_32410 65020 66276 CDS product GAF domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928864.1 protein_id gnl|my_center|LOCUS_32410 66372 67256 gene locus_tag LOCUS_32420 66372 67256 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388114.1 protein_id gnl|my_center|LOCUS_32420 67290 68495 gene locus_tag LOCUS_32430 67290 68495 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932589.1 protein_id gnl|my_center|LOCUS_32430 68495 69148 gene locus_tag LOCUS_32440 68495 69148 CDS product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986868.1 protein_id gnl|my_center|LOCUS_32440 69145 70251 gene locus_tag LOCUS_32450 gene mtnA 69145 70251 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388113.1 protein_id gnl|my_center|LOCUS_32450 70828 72189 gene locus_tag LOCUS_32460 70828 72189 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389732.1 protein_id gnl|my_center|LOCUS_32460 72327 73301 gene locus_tag LOCUS_32470 72327 73301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211410235.1 protein_id gnl|my_center|LOCUS_32470 74487 73528 gene locus_tag LOCUS_32480 74487 73528 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941237.1 protein_id gnl|my_center|LOCUS_32480 74704 75129 gene locus_tag LOCUS_32490 74704 75129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 75343 77370 gene locus_tag LOCUS_32500 75343 77370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 77423 77827 gene locus_tag LOCUS_32510 77423 77827 CDS product DUF1491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918949.1 protein_id gnl|my_center|LOCUS_32510 77896 78822 gene locus_tag LOCUS_32520 77896 78822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 79170 80516 gene locus_tag LOCUS_32530 79170 80516 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387979.1 protein_id gnl|my_center|LOCUS_32530 80521 81210 gene locus_tag LOCUS_32540 80521 81210 CDS product HD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387978.1 protein_id gnl|my_center|LOCUS_32540 81549 81229 gene locus_tag LOCUS_32550 81549 81229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 81605 82207 gene locus_tag LOCUS_32560 81605 82207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 83454 82507 gene locus_tag LOCUS_32570 83454 82507 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404019.1 protein_id gnl|my_center|LOCUS_32570 83809 84255 gene locus_tag LOCUS_32580 83809 84255 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391491.1 protein_id gnl|my_center|LOCUS_32580 85249 84272 gene locus_tag LOCUS_32590 85249 84272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 85442 86419 gene locus_tag LOCUS_32600 85442 86419 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533213.1 protein_id gnl|my_center|LOCUS_32600 87223 86426 gene locus_tag LOCUS_32610 87223 86426 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085533.1 protein_id gnl|my_center|LOCUS_32610 87330 87929 gene locus_tag LOCUS_32620 gene caiE 87330 87929 CDS product carnitine operon protein CaiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122865.1 protein_id gnl|my_center|LOCUS_32620 88482 88745 gene locus_tag LOCUS_32630 88482 88745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 88839 90356 gene locus_tag LOCUS_32640 88839 90356 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388169.1 protein_id gnl|my_center|LOCUS_32640 90961 91548 gene locus_tag LOCUS_32650 90961 91548 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530074.1 protein_id gnl|my_center|LOCUS_32650 91576 92202 gene locus_tag LOCUS_32660 gene rdgB 91576 92202 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391387.1 protein_id gnl|my_center|LOCUS_32660 92685 93650 gene locus_tag LOCUS_32670 gene prfB 92685 93650 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148265477.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32670 93670 94542 gene locus_tag LOCUS_32680 93670 94542 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389792.1 protein_id gnl|my_center|LOCUS_32680 94627 94953 gene locus_tag LOCUS_32690 94627 94953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 95053 95541 gene locus_tag LOCUS_32700 95053 95541 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391393.1 protein_id gnl|my_center|LOCUS_32700 95541 96392 gene locus_tag LOCUS_32710 95541 96392 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391395.1 protein_id gnl|my_center|LOCUS_32710 96486 101822 gene locus_tag LOCUS_32720 96486 101822 CDS product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625869.1 protein_id gnl|my_center|LOCUS_32720 >Feature sequence165 1288 224 gene locus_tag LOCUS_32730 1288 224 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257883.1 protein_id gnl|my_center|LOCUS_32730 2816 1323 gene locus_tag LOCUS_32740 2816 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 2876 3784 gene locus_tag LOCUS_32750 2876 3784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 4976 4176 gene locus_tag LOCUS_32760 4976 4176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 6022 4973 gene locus_tag LOCUS_32770 6022 4973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 6738 6019 gene locus_tag LOCUS_32780 6738 6019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 7987 6743 gene locus_tag LOCUS_32790 gene grrM 7987 6743 CDS product GRRM system radical SAM/SPASM domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970460.1 protein_id gnl|my_center|LOCUS_32790 8260 8108 gene locus_tag LOCUS_32800 8260 8108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 8573 9121 gene locus_tag LOCUS_32810 8573 9121 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391429.1 protein_id gnl|my_center|LOCUS_32810 9306 9124 gene locus_tag LOCUS_32820 9306 9124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 9816 9340 gene locus_tag LOCUS_32830 9816 9340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32830 9924 11162 gene locus_tag LOCUS_32840 9924 11162 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339206.1 protein_id gnl|my_center|LOCUS_32840 11178 14342 gene locus_tag LOCUS_32850 11178 14342 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339205.1 protein_id gnl|my_center|LOCUS_32850 14406 15323 gene locus_tag LOCUS_32860 14406 15323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 15435 15362 gene locus_tag LOCUS_t00470 15435 15362 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 15987 17792 gene locus_tag LOCUS_32870 gene bchE 15987 17792 CDS product magnesium-protoporphyrin IX monomethyl ester anaerobic oxidative cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391295.1 protein_id gnl|my_center|LOCUS_32870 >Feature sequence166 187 531 gene locus_tag LOCUS_32880 187 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 690 611 gene locus_tag LOCUS_t00480 690 611 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4142 639 gene locus_tag LOCUS_32890 4142 639 CDS product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390034.1 protein_id gnl|my_center|LOCUS_32890 4384 4674 gene locus_tag LOCUS_32900 4384 4674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 4671 4943 gene locus_tag LOCUS_32910 4671 4943 CDS product type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944457.1 protein_id gnl|my_center|LOCUS_32910 5061 5354 gene locus_tag LOCUS_32920 5061 5354 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967242.1 protein_id gnl|my_center|LOCUS_32920 5335 5622 gene locus_tag LOCUS_32930 5335 5622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 5894 7456 gene locus_tag LOCUS_32940 5894 7456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 7919 7476 gene locus_tag LOCUS_32950 7919 7476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 8767 7955 gene locus_tag LOCUS_32960 8767 7955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 9054 10004 gene locus_tag LOCUS_32970 gene paaX 9054 10004 CDS product phenylacetic acid degradation operon negative regulatory protein PaaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039887.1 protein_id gnl|my_center|LOCUS_32970 10001 11359 gene locus_tag LOCUS_32980 10001 11359 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479549.1 protein_id gnl|my_center|LOCUS_32980 11892 11356 gene locus_tag LOCUS_32990 11892 11356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 12310 11867 gene locus_tag LOCUS_33000 12310 11867 CDS product DUF4065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143885.1 protein_id gnl|my_center|LOCUS_33000 12651 13742 gene locus_tag LOCUS_33010 12651 13742 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390916.1 protein_id gnl|my_center|LOCUS_33010 13742 15412 gene locus_tag LOCUS_33020 13742 15412 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390917.1 protein_id gnl|my_center|LOCUS_33020 15546 16343 gene locus_tag LOCUS_33030 15546 16343 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390485.1 protein_id gnl|my_center|LOCUS_33030 17793 16930 gene locus_tag LOCUS_33040 gene speE 17793 16930 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003371548.1 protein_id gnl|my_center|LOCUS_33040 18005 17790 gene locus_tag LOCUS_33050 18005 17790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 >Feature sequence167 3 287 gene locus_tag LOCUS_33060 3 287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 308 508 gene locus_tag LOCUS_33070 308 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 642 2549 gene locus_tag LOCUS_33080 642 2549 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261752.1 protein_id gnl|my_center|LOCUS_33080 4916 2613 gene locus_tag LOCUS_33090 4916 2613 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337057.1 protein_id gnl|my_center|LOCUS_33090 7614 5071 gene locus_tag LOCUS_33100 7614 5071 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720592.1 protein_id gnl|my_center|LOCUS_33100 8185 9078 gene locus_tag LOCUS_33110 8185 9078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 9075 10538 gene locus_tag LOCUS_33120 9075 10538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 10525 11862 gene locus_tag LOCUS_33130 gene atoC 10525 11862 CDS product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125298.1 protein_id gnl|my_center|LOCUS_33130 12072 12566 gene locus_tag LOCUS_33140 12072 12566 CDS product arsenate reductase (azurin) small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229170.1 protein_id gnl|my_center|LOCUS_33140 12649 15123 gene locus_tag LOCUS_33150 12649 15123 CDS product arsenate reductase (azurin) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257094.1 protein_id gnl|my_center|LOCUS_33150 16235 15183 gene locus_tag LOCUS_33160 16235 15183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 16338 17258 gene locus_tag LOCUS_33170 16338 17258 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529404.1 protein_id gnl|my_center|LOCUS_33170 >Feature sequence168 403 921 gene locus_tag LOCUS_33180 403 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 989 1225 gene locus_tag LOCUS_33190 989 1225 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034798187.1 protein_id gnl|my_center|LOCUS_33190 1215 1502 gene locus_tag LOCUS_33200 1215 1502 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640626.1 protein_id gnl|my_center|LOCUS_33200 1708 3387 gene locus_tag LOCUS_33210 gene ettA 1708 3387 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389280.1 protein_id gnl|my_center|LOCUS_33210 3464 6976 gene locus_tag LOCUS_33220 3464 6976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 7213 8280 gene locus_tag LOCUS_33230 7213 8280 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444931.1 protein_id gnl|my_center|LOCUS_33230 8481 8296 gene locus_tag LOCUS_33240 8481 8296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 10478 9231 gene locus_tag LOCUS_33250 10478 9231 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440409.1 protein_id gnl|my_center|LOCUS_33250 11106 10606 gene locus_tag LOCUS_33260 gene speD 11106 10606 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389382.1 protein_id gnl|my_center|LOCUS_33260 11434 12279 gene locus_tag LOCUS_33270 11434 12279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 12504 12295 gene locus_tag LOCUS_33280 12504 12295 CDS product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388803.1 protein_id gnl|my_center|LOCUS_33280 12861 13955 gene locus_tag LOCUS_33290 12861 13955 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388802.1 protein_id gnl|my_center|LOCUS_33290 14598 14005 gene locus_tag LOCUS_33300 14598 14005 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086312.1 protein_id gnl|my_center|LOCUS_33300 14748 14918 gene locus_tag LOCUS_33310 14748 14918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 16443 15340 gene locus_tag LOCUS_33320 16443 15340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391064.1 protein_id gnl|my_center|LOCUS_33320 16930 17006 gene locus_tag LOCUS_t00490 16930 17006 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence169 392 36 gene locus_tag LOCUS_33330 392 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 616 1932 gene locus_tag LOCUS_33340 gene purB 616 1932 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388474.1 protein_id gnl|my_center|LOCUS_33340 2551 2069 gene locus_tag LOCUS_33350 2551 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 3141 2548 gene locus_tag LOCUS_33360 3141 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 4248 3241 gene locus_tag LOCUS_33370 4248 3241 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390378.1 protein_id gnl|my_center|LOCUS_33370 4893 4288 gene locus_tag LOCUS_33380 gene pdxH 4893 4288 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390377.1 protein_id gnl|my_center|LOCUS_33380 5236 6372 gene locus_tag LOCUS_33390 5236 6372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 6377 7195 gene locus_tag LOCUS_33400 6377 7195 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389334.1 protein_id gnl|my_center|LOCUS_33400 7192 7953 gene locus_tag LOCUS_33410 7192 7953 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389333.1 protein_id gnl|my_center|LOCUS_33410 8266 8637 gene locus_tag LOCUS_33420 8266 8637 CDS product flagellar biosynthesis regulator FlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390473.1 protein_id gnl|my_center|LOCUS_33420 9486 8764 gene locus_tag LOCUS_33430 9486 8764 CDS product purine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387822.1 protein_id gnl|my_center|LOCUS_33430 11640 9496 gene locus_tag LOCUS_33440 gene shc 11640 9496 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387823.1 protein_id gnl|my_center|LOCUS_33440 13388 12105 gene locus_tag LOCUS_33450 gene hpnE 13388 12105 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387824.1 protein_id gnl|my_center|LOCUS_33450 14302 13388 gene locus_tag LOCUS_33460 14302 13388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33460 15495 14299 gene locus_tag LOCUS_33470 15495 14299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33470 16499 15609 gene locus_tag LOCUS_33480 gene hpnC 16499 15609 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387826.1 protein_id gnl|my_center|LOCUS_33480 >Feature sequence170 267 500 gene locus_tag LOCUS_33490 267 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 722 1492 gene locus_tag LOCUS_33500 722 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 2332 1517 gene locus_tag LOCUS_33510 2332 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 2572 3223 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcagtccgctcgagaacgcggaagaggcctcagc 3435 5414 gene locus_tag LOCUS_33520 3435 5414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 5435 5722 gene locus_tag LOCUS_33530 5435 5722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 5933 6100 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggcctcttccgcgttctcgagcggactgaaac 7331 6408 gene locus_tag LOCUS_33540 7331 6408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 7542 9341 gene locus_tag LOCUS_33550 7542 9341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081467686.1 protein_id gnl|my_center|LOCUS_33550 9338 11302 gene locus_tag LOCUS_33560 9338 11302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387944.1 protein_id gnl|my_center|LOCUS_33560 11299 12927 gene locus_tag LOCUS_33570 11299 12927 CDS product RAMP superfamily CRISPR-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387943.1 protein_id gnl|my_center|LOCUS_33570 12929 15589 gene locus_tag LOCUS_33580 12929 15589 CDS product TIGR03986 family CRISPR-associated RAMP protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387942.1 protein_id gnl|my_center|LOCUS_33580 >Feature sequence171 1487 234 gene locus_tag LOCUS_33590 1487 234 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390627.1 protein_id gnl|my_center|LOCUS_33590 2304 1585 gene locus_tag LOCUS_33600 2304 1585 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083382.1 protein_id gnl|my_center|LOCUS_33600 2723 2301 gene locus_tag LOCUS_33610 2723 2301 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390519.1 protein_id gnl|my_center|LOCUS_33610 2872 3846 gene locus_tag LOCUS_33620 2872 3846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 3940 5958 gene locus_tag LOCUS_33630 gene parE 3940 5958 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390520.1 protein_id gnl|my_center|LOCUS_33630 6035 6346 gene locus_tag LOCUS_33640 6035 6346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 6333 7019 gene locus_tag LOCUS_33650 6333 7019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 7803 7186 gene locus_tag LOCUS_33660 7803 7186 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389865.1 protein_id gnl|my_center|LOCUS_33660 8747 7815 gene locus_tag LOCUS_33670 8747 7815 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089449.1 protein_id gnl|my_center|LOCUS_33670 10761 8881 gene locus_tag LOCUS_33680 gene nifA 10761 8881 CDS product nif-specific transcriptional activator NifA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388748.1 protein_id gnl|my_center|LOCUS_33680 12409 10847 gene locus_tag LOCUS_33690 12409 10847 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975851.1 protein_id gnl|my_center|LOCUS_33690 12939 12409 gene locus_tag LOCUS_33700 12939 12409 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808109.1 protein_id gnl|my_center|LOCUS_33700 14123 13023 gene locus_tag LOCUS_33710 14123 13023 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389599.1 protein_id gnl|my_center|LOCUS_33710 15840 14173 gene locus_tag LOCUS_33720 15840 14173 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532300.1 protein_id gnl|my_center|LOCUS_33720 >Feature sequence172 193 732 gene locus_tag LOCUS_33730 193 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 782 1471 gene locus_tag LOCUS_33740 782 1471 CDS product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391018.1 protein_id gnl|my_center|LOCUS_33740 2106 2393 gene locus_tag LOCUS_33750 2106 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 2395 2952 gene locus_tag LOCUS_33760 2395 2952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 4783 3128 gene locus_tag LOCUS_33770 4783 3128 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534776.1 protein_id gnl|my_center|LOCUS_33770 6578 4773 gene locus_tag LOCUS_33780 6578 4773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 5585 5498 gene locus_tag LOCUS_t00500 5585 5498 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 6746 9472 gene locus_tag LOCUS_33790 gene mutS 6746 9472 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391288.1 protein_id gnl|my_center|LOCUS_33790 9949 12252 gene locus_tag LOCUS_33800 9949 12252 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626003.1 protein_id gnl|my_center|LOCUS_33800 13832 12672 gene locus_tag LOCUS_33810 gene torC 13832 12672 CDS product pentaheme c-type cytochrome TorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389038.1 protein_id gnl|my_center|LOCUS_33810 14055 14753 gene locus_tag LOCUS_33820 14055 14753 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626143.1 protein_id gnl|my_center|LOCUS_33820 14815 15483 gene locus_tag LOCUS_33830 gene torD 14815 15483 CDS product molecular chaperone TorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262143.1 protein_id gnl|my_center|LOCUS_33830 >Feature sequence173 1165 248 gene locus_tag LOCUS_33840 1165 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 2508 1537 gene locus_tag LOCUS_33850 2508 1537 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391781.1 protein_id gnl|my_center|LOCUS_33850 3341 2505 gene locus_tag LOCUS_33860 3341 2505 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080608.1 protein_id gnl|my_center|LOCUS_33860 4241 3471 gene locus_tag LOCUS_33870 gene fabG 4241 3471 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966837.1 protein_id gnl|my_center|LOCUS_33870 4684 4238 gene locus_tag LOCUS_33880 4684 4238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 6282 4681 gene locus_tag LOCUS_33890 6282 4681 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921426.1 protein_id gnl|my_center|LOCUS_33890 6756 6289 gene locus_tag LOCUS_33900 gene fabZ 6756 6289 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391761.1 protein_id gnl|my_center|LOCUS_33900 8003 6798 gene locus_tag LOCUS_33910 8003 6798 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222164.1 protein_id gnl|my_center|LOCUS_33910 9087 7993 gene locus_tag LOCUS_33920 9087 7993 CDS product acyl-protein synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707830.1 protein_id gnl|my_center|LOCUS_33920 10481 9051 gene locus_tag LOCUS_33930 10481 9051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 10717 10478 gene locus_tag LOCUS_33940 10717 10478 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707833.1 protein_id gnl|my_center|LOCUS_33940 11804 10779 gene locus_tag LOCUS_33950 11804 10779 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941435.1 protein_id gnl|my_center|LOCUS_33950 12301 11819 gene locus_tag LOCUS_33960 12301 11819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 12561 14129 gene locus_tag LOCUS_33970 12561 14129 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391406.1 protein_id gnl|my_center|LOCUS_33970 15033 14275 gene locus_tag LOCUS_33980 15033 14275 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626528.1 protein_id gnl|my_center|LOCUS_33980 >Feature sequence174 220 1500 gene locus_tag LOCUS_33990 220 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 1649 2155 gene locus_tag LOCUS_34000 1649 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 2304 4136 gene locus_tag LOCUS_34010 2304 4136 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390914.1 protein_id gnl|my_center|LOCUS_34010 4149 5261 gene locus_tag LOCUS_34020 gene yejB 4149 5261 CDS product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390915.1 protein_id gnl|my_center|LOCUS_34020 6503 5271 gene locus_tag LOCUS_34030 6503 5271 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337262.1 protein_id gnl|my_center|LOCUS_34030 7303 6551 gene locus_tag LOCUS_34040 7303 6551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 8810 7668 gene locus_tag LOCUS_34050 8810 7668 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213498758.1 protein_id gnl|my_center|LOCUS_34050 10637 8814 gene locus_tag LOCUS_34060 10637 8814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 11764 10721 gene locus_tag LOCUS_34070 11764 10721 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937476.1 protein_id gnl|my_center|LOCUS_34070 12741 11761 gene locus_tag LOCUS_34080 12741 11761 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937477.1 protein_id gnl|my_center|LOCUS_34080 13663 12746 gene locus_tag LOCUS_34090 13663 12746 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455202.1 protein_id gnl|my_center|LOCUS_34090 14649 13660 gene locus_tag LOCUS_34100 14649 13660 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455219.1 protein_id gnl|my_center|LOCUS_34100 14588 14836 gene locus_tag LOCUS_34110 14588 14836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 >Feature sequence175 523 113 gene locus_tag LOCUS_34120 523 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 1541 489 gene locus_tag LOCUS_34130 1541 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 2340 1579 gene locus_tag LOCUS_34140 2340 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 2558 2797 gene locus_tag LOCUS_34150 2558 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 2816 4456 gene locus_tag LOCUS_34160 2816 4456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 4453 5691 gene locus_tag LOCUS_34170 4453 5691 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101181.1 protein_id gnl|my_center|LOCUS_34170 25094 5769 gene locus_tag LOCUS_34180 25094 5769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 26473 25127 gene locus_tag LOCUS_34190 26473 25127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 46875 26470 gene locus_tag LOCUS_34200 46875 26470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 49199 46887 gene locus_tag LOCUS_34210 gene fabD 49199 46887 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231811.1 protein_id gnl|my_center|LOCUS_34210 49510 49761 gene locus_tag LOCUS_34220 49510 49761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 49768 51744 gene locus_tag LOCUS_34230 gene asnB 49768 51744 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268959.1 protein_id gnl|my_center|LOCUS_34230 52707 51937 gene locus_tag LOCUS_34240 52707 51937 CDS product enoyl-CoA hydratase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886512.1 protein_id gnl|my_center|LOCUS_34240 53938 52700 gene locus_tag LOCUS_34250 53938 52700 CDS product beta-ketoacyl synthase N-terminal-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198265.1 protein_id gnl|my_center|LOCUS_34250 54164 53919 gene locus_tag LOCUS_34260 54164 53919 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198264.1 protein_id gnl|my_center|LOCUS_34260 55650 54382 gene locus_tag LOCUS_34270 55650 54382 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524093.1 protein_id gnl|my_center|LOCUS_34270 56933 55647 gene locus_tag LOCUS_34280 56933 55647 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078653353.1 protein_id gnl|my_center|LOCUS_34280 57744 56947 gene locus_tag LOCUS_34290 57744 56947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 57910 58740 gene locus_tag LOCUS_34300 57910 58740 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031095.1 protein_id gnl|my_center|LOCUS_34300 59676 58867 gene locus_tag LOCUS_34310 59676 58867 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187830.1 protein_id gnl|my_center|LOCUS_34310 59675 60649 gene locus_tag LOCUS_34320 59675 60649 CDS product acyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231814.1 protein_id gnl|my_center|LOCUS_34320 60855 61409 gene locus_tag LOCUS_34330 60855 61409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 61773 61573 gene locus_tag LOCUS_34340 61773 61573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 63118 61787 gene locus_tag LOCUS_34350 63118 61787 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938039.1 protein_id gnl|my_center|LOCUS_34350 64029 63130 gene locus_tag LOCUS_34360 64029 63130 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962731.1 protein_id gnl|my_center|LOCUS_34360 65715 64060 gene locus_tag LOCUS_34370 65715 64060 CDS product cyclic peptide export ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193739.1 protein_id gnl|my_center|LOCUS_34370 67370 65706 gene locus_tag LOCUS_34380 67370 65706 CDS product cyclic peptide export ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122388.1 protein_id gnl|my_center|LOCUS_34380 67817 69550 gene locus_tag LOCUS_34390 67817 69550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 70127 69522 gene locus_tag LOCUS_34400 70127 69522 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038981.1 protein_id gnl|my_center|LOCUS_34400 70311 71072 gene locus_tag LOCUS_34410 70311 71072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 71072 72802 gene locus_tag LOCUS_34420 71072 72802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028386.1 protein_id gnl|my_center|LOCUS_34420 72787 73782 gene locus_tag LOCUS_34430 72787 73782 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382988.1 protein_id gnl|my_center|LOCUS_34430 73772 74572 gene locus_tag LOCUS_34440 73772 74572 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382989.1 protein_id gnl|my_center|LOCUS_34440 74569 76119 gene locus_tag LOCUS_34450 74569 76119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 76116 77168 gene locus_tag LOCUS_34460 76116 77168 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168117700.1 protein_id gnl|my_center|LOCUS_34460 77218 77784 gene locus_tag LOCUS_34470 77218 77784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 78669 77869 gene locus_tag LOCUS_34480 78669 77869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 80517 78769 gene locus_tag LOCUS_34490 80517 78769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 82498 80783 gene locus_tag LOCUS_34500 82498 80783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 82932 82528 gene locus_tag LOCUS_34510 82932 82528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 83360 82932 gene locus_tag LOCUS_34520 83360 82932 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326173.1 protein_id gnl|my_center|LOCUS_34520 84021 83365 gene locus_tag LOCUS_34530 84021 83365 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940072.1 protein_id gnl|my_center|LOCUS_34530 84645 84190 gene locus_tag LOCUS_34540 84645 84190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 85456 84764 gene locus_tag LOCUS_34550 85456 84764 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173607.1 protein_id gnl|my_center|LOCUS_34550 86382 85459 gene locus_tag LOCUS_34560 86382 85459 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390277.1 protein_id gnl|my_center|LOCUS_34560 87383 86400 gene locus_tag LOCUS_34570 87383 86400 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390278.1 protein_id gnl|my_center|LOCUS_34570 88056 87406 gene locus_tag LOCUS_34580 88056 87406 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390279.1 protein_id gnl|my_center|LOCUS_34580 87956 88189 gene locus_tag LOCUS_34590 87956 88189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 88229 88729 gene locus_tag LOCUS_34600 88229 88729 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170040.1 protein_id gnl|my_center|LOCUS_34600 91400 88983 gene locus_tag LOCUS_34610 91400 88983 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389593.1 protein_id gnl|my_center|LOCUS_34610 >Feature sequence176 223 846 gene locus_tag LOCUS_34620 223 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 2236 884 gene locus_tag LOCUS_34630 2236 884 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339635.1 protein_id gnl|my_center|LOCUS_34630 3162 2233 gene locus_tag LOCUS_34640 3162 2233 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975164.1 protein_id gnl|my_center|LOCUS_34640 3474 4562 gene locus_tag LOCUS_34650 3474 4562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 4572 5663 gene locus_tag LOCUS_34660 4572 5663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 6809 5679 gene locus_tag LOCUS_34670 gene rlmN 6809 5679 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391076.1 protein_id gnl|my_center|LOCUS_34670 7114 7929 gene locus_tag LOCUS_34680 7114 7929 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391075.1 protein_id gnl|my_center|LOCUS_34680 8248 10434 gene locus_tag LOCUS_34690 8248 10434 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389756.1 protein_id gnl|my_center|LOCUS_34690 12458 10440 gene locus_tag LOCUS_34700 12458 10440 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470599.1 protein_id gnl|my_center|LOCUS_34700 12899 12474 gene locus_tag LOCUS_34710 12899 12474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 12947 14341 gene locus_tag LOCUS_34720 12947 14341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 14602 14802 gene locus_tag LOCUS_34730 14602 14802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 >Feature sequence177 366 61 gene locus_tag LOCUS_34740 366 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 858 1397 gene locus_tag LOCUS_34750 858 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 1776 1558 gene locus_tag LOCUS_34760 1776 1558 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084181.1 protein_id gnl|my_center|LOCUS_34760 3243 1882 gene locus_tag LOCUS_34770 gene glmM 3243 1882 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388855.1 protein_id gnl|my_center|LOCUS_34770 3411 6656 gene locus_tag LOCUS_34780 gene carB 3411 6656 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390636.1 protein_id gnl|my_center|LOCUS_34780 6785 7258 gene locus_tag LOCUS_34790 gene greA 6785 7258 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390637.1 protein_id gnl|my_center|LOCUS_34790 7809 7315 gene locus_tag LOCUS_34800 7809 7315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 8288 7806 gene locus_tag LOCUS_34810 gene pssD 8288 7806 CDS product PssD/Cps14F family polysaccharide biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143701.1 protein_id gnl|my_center|LOCUS_34810 9684 8302 gene locus_tag LOCUS_34820 9684 8302 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391460.1 protein_id gnl|my_center|LOCUS_34820 9671 11110 gene locus_tag LOCUS_34830 9671 11110 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388890.1 protein_id gnl|my_center|LOCUS_34830 11130 11963 gene locus_tag LOCUS_34840 11130 11963 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388454.1 protein_id gnl|my_center|LOCUS_34840 13222 11960 gene locus_tag LOCUS_34850 13222 11960 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390982.1 protein_id gnl|my_center|LOCUS_34850 13769 13356 gene locus_tag LOCUS_34860 13769 13356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 13931 14647 gene locus_tag LOCUS_34870 gene nth 13931 14647 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625878.1 protein_id gnl|my_center|LOCUS_34870 >Feature sequence178 103 4677 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcttcaatgaggccggggcattactgccccggaagg 5276 4974 gene locus_tag LOCUS_34880 gene cas2 5276 4974 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940736.1 protein_id gnl|my_center|LOCUS_34880 7129 5402 gene locus_tag LOCUS_34890 gene cas1 7129 5402 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940735.1 protein_id gnl|my_center|LOCUS_34890 8169 7147 gene locus_tag LOCUS_34900 8169 7147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 11087 8166 gene locus_tag LOCUS_34910 gene cas3u 11087 8166 CDS product type I-U CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930412.1 protein_id gnl|my_center|LOCUS_34910 12553 11084 gene locus_tag LOCUS_34920 gene csb2 12553 11084 CDS product type I-U CRISPR-associated protein Csb2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940732.1 protein_id gnl|my_center|LOCUS_34920 13794 12553 gene locus_tag LOCUS_34930 gene cas7u 13794 12553 CDS product type I-U CRISPR-associated RAMP protein Csb1/Cas7u inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940731.1 protein_id gnl|my_center|LOCUS_34930 >Feature sequence179 4597 14 gene locus_tag LOCUS_34940 4597 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 8510 4938 gene locus_tag LOCUS_34950 8510 4938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34950 13491 8530 gene locus_tag LOCUS_34960 13491 8530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34960 14621 14118 gene locus_tag LOCUS_34970 14621 14118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 >Feature sequence180 1023 1 gene locus_tag LOCUS_34980 1023 1 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201215949.1 protein_id gnl|my_center|LOCUS_34980 2193 1171 gene locus_tag LOCUS_34990 2193 1171 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201215949.1 protein_id gnl|my_center|LOCUS_34990 3197 2862 gene locus_tag LOCUS_35000 3197 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 4590 3220 gene locus_tag LOCUS_35010 4590 3220 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958618.1 protein_id gnl|my_center|LOCUS_35010 6875 4596 gene locus_tag LOCUS_35020 6875 4596 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938316.1 protein_id gnl|my_center|LOCUS_35020 8539 6872 gene locus_tag LOCUS_35030 8539 6872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 8917 9795 gene locus_tag LOCUS_35040 8917 9795 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391304.1 protein_id gnl|my_center|LOCUS_35040 9939 11231 gene locus_tag LOCUS_35050 gene ahcY 9939 11231 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947737.1 protein_id gnl|my_center|LOCUS_35050 11478 11822 gene locus_tag LOCUS_35060 11478 11822 CDS product DUF1476 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388472.1 protein_id gnl|my_center|LOCUS_35060 12671 11856 gene locus_tag LOCUS_35070 gene modA 12671 11856 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918217.1 protein_id gnl|my_center|LOCUS_35070 13176 12748 gene locus_tag LOCUS_35080 13176 12748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390795.1 protein_id gnl|my_center|LOCUS_35080 13344 13886 gene locus_tag LOCUS_35090 13344 13886 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974912.1 protein_id gnl|my_center|LOCUS_35090 >Feature sequence181 548 799 gene locus_tag LOCUS_35100 548 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 945 1373 gene locus_tag LOCUS_35110 945 1373 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838707.1 protein_id gnl|my_center|LOCUS_35110 1523 2695 gene locus_tag LOCUS_35120 1523 2695 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338153.1 protein_id gnl|my_center|LOCUS_35120 3011 4495 gene locus_tag LOCUS_35130 3011 4495 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331455.1 protein_id gnl|my_center|LOCUS_35130 4506 5360 gene locus_tag LOCUS_35140 4506 5360 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836249.1 protein_id gnl|my_center|LOCUS_35140 6101 5514 gene locus_tag LOCUS_35150 6101 5514 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948431.1 protein_id gnl|my_center|LOCUS_35150 6444 6175 gene locus_tag LOCUS_35160 6444 6175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 6744 6559 gene locus_tag LOCUS_35170 6744 6559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 7107 7298 gene locus_tag LOCUS_35180 7107 7298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 7941 7429 gene locus_tag LOCUS_35190 7941 7429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 8491 8054 gene locus_tag LOCUS_35200 8491 8054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 8790 8488 gene locus_tag LOCUS_35210 8790 8488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 9283 8981 gene locus_tag LOCUS_35220 9283 8981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 9222 11672 gene locus_tag LOCUS_35230 9222 11672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 11878 13422 gene locus_tag LOCUS_35240 11878 13422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 >Feature sequence182 678 2645 gene locus_tag LOCUS_35250 gene thrS 678 2645 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391234.1 protein_id gnl|my_center|LOCUS_35250 2719 3240 gene locus_tag LOCUS_35260 gene infC 2719 3240 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391235.1 protein_id gnl|my_center|LOCUS_35260 3355 4617 gene locus_tag LOCUS_35270 gene rnd 3355 4617 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389826.1 protein_id gnl|my_center|LOCUS_35270 5907 5155 gene locus_tag LOCUS_35280 5907 5155 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186447673.1 protein_id gnl|my_center|LOCUS_35280 6058 7059 gene locus_tag LOCUS_35290 6058 7059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 7077 7226 gene locus_tag LOCUS_35300 7077 7226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 7231 7479 gene locus_tag LOCUS_35310 7231 7479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 8735 7464 gene locus_tag LOCUS_35320 8735 7464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 9050 9664 gene locus_tag LOCUS_35330 9050 9664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 9676 10968 gene locus_tag LOCUS_35340 9676 10968 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069810832.1 protein_id gnl|my_center|LOCUS_35340 11119 11721 gene locus_tag LOCUS_35350 11119 11721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 11736 13088 gene locus_tag LOCUS_35360 11736 13088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 >Feature sequence183 2107 452 gene locus_tag LOCUS_35370 gene groL 2107 452 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388345.1 protein_id gnl|my_center|LOCUS_35370 2457 2170 gene locus_tag LOCUS_35380 gene groES 2457 2170 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388344.1 protein_id gnl|my_center|LOCUS_35380 2846 3178 gene locus_tag LOCUS_35390 2846 3178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 4037 3207 gene locus_tag LOCUS_35400 4037 3207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35400 5085 4066 gene locus_tag LOCUS_35410 5085 4066 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_35410 8927 5301 gene locus_tag LOCUS_35420 gene nifJ 8927 5301 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705395.1 protein_id gnl|my_center|LOCUS_35420 10707 9064 gene locus_tag LOCUS_35430 10707 9064 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705394.1 protein_id gnl|my_center|LOCUS_35430 11123 12334 gene locus_tag LOCUS_35440 11123 12334 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167641.1 protein_id gnl|my_center|LOCUS_35440 12604 12392 gene locus_tag LOCUS_35450 12604 12392 CDS product DUF3553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388277.1 protein_id gnl|my_center|LOCUS_35450 >Feature sequence184 523 1524 gene locus_tag LOCUS_35460 523 1524 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969981.1 protein_id gnl|my_center|LOCUS_35460 1694 3109 gene locus_tag LOCUS_35470 gene pyk 1694 3109 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390218.1 protein_id gnl|my_center|LOCUS_35470 3754 3398 gene locus_tag LOCUS_35480 3754 3398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 5168 3861 gene locus_tag LOCUS_35490 5168 3861 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389920.1 protein_id gnl|my_center|LOCUS_35490 6279 5191 gene locus_tag LOCUS_35500 6279 5191 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389921.1 protein_id gnl|my_center|LOCUS_35500 7165 6308 gene locus_tag LOCUS_35510 7165 6308 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389922.1 protein_id gnl|my_center|LOCUS_35510 7502 7170 gene locus_tag LOCUS_35520 7502 7170 CDS product nitrogenase-stabilizing/protective protein NifW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389923.1 protein_id gnl|my_center|LOCUS_35520 8740 7499 gene locus_tag LOCUS_35530 gene nifV 8740 7499 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389924.1 protein_id gnl|my_center|LOCUS_35530 9086 8760 gene locus_tag LOCUS_35540 9086 8760 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389926.1 protein_id gnl|my_center|LOCUS_35540 9433 10941 gene locus_tag LOCUS_35550 gene nifB 9433 10941 CDS product nitrogenase cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388749.1 protein_id gnl|my_center|LOCUS_35550 11000 11194 gene locus_tag LOCUS_35560 11000 11194 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533512.1 protein_id gnl|my_center|LOCUS_35560 11209 11505 gene locus_tag LOCUS_35570 11209 11505 CDS product nitrogen fixation protein NifZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388752.1 protein_id gnl|my_center|LOCUS_35570 11502 11717 gene locus_tag LOCUS_35580 gene nifT 11502 11717 CDS product putative nitrogen fixation protein NifT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388753.1 protein_id gnl|my_center|LOCUS_35580 12257 12517 gene locus_tag LOCUS_35590 12257 12517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_35590 >Feature sequence185 463 1311 gene locus_tag LOCUS_35600 463 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 1937 1407 gene locus_tag LOCUS_35610 1937 1407 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920110.1 protein_id gnl|my_center|LOCUS_35610 3066 2269 gene locus_tag LOCUS_35620 3066 2269 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531940.1 protein_id gnl|my_center|LOCUS_35620 3974 3063 gene locus_tag LOCUS_35630 3974 3063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 4678 3971 gene locus_tag LOCUS_35640 4678 3971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 5057 6274 gene locus_tag LOCUS_35650 5057 6274 CDS product putative manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029627571.1 protein_id gnl|my_center|LOCUS_35650 6774 6364 gene locus_tag LOCUS_35660 6774 6364 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388775.1 protein_id gnl|my_center|LOCUS_35660 7345 7869 gene locus_tag LOCUS_35670 7345 7869 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388978.1 protein_id gnl|my_center|LOCUS_35670 7866 9401 gene locus_tag LOCUS_35680 gene atpA 7866 9401 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388979.1 protein_id gnl|my_center|LOCUS_35680 9443 10336 gene locus_tag LOCUS_35690 9443 10336 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388980.1 protein_id gnl|my_center|LOCUS_35690 10465 11898 gene locus_tag LOCUS_35700 gene atpD 10465 11898 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388981.1 protein_id gnl|my_center|LOCUS_35700 12003 12407 gene locus_tag LOCUS_35710 12003 12407 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388982.1 protein_id gnl|my_center|LOCUS_35710 >Feature sequence186 114 494 gene locus_tag LOCUS_35720 114 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 491 1447 gene locus_tag LOCUS_35730 gene rapZ 491 1447 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470669.1 protein_id gnl|my_center|LOCUS_35730 1553 1954 gene locus_tag LOCUS_35740 1553 1954 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391194.1 protein_id gnl|my_center|LOCUS_35740 1959 2342 gene locus_tag LOCUS_35750 1959 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 2332 4245 gene locus_tag LOCUS_35760 gene ptsP 2332 4245 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391192.1 protein_id gnl|my_center|LOCUS_35760 4575 4333 gene locus_tag LOCUS_35770 4575 4333 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626599.1 protein_id gnl|my_center|LOCUS_35770 5581 4682 gene locus_tag LOCUS_35780 5581 4682 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929728.1 protein_id gnl|my_center|LOCUS_35780 6684 5578 gene locus_tag LOCUS_35790 gene aroC 6684 5578 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085417.1 protein_id gnl|my_center|LOCUS_35790 7561 6713 gene locus_tag LOCUS_35800 gene fabI 7561 6713 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390374.1 protein_id gnl|my_center|LOCUS_35800 7814 9139 gene locus_tag LOCUS_35810 7814 9139 CDS product YihY family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390375.1 protein_id gnl|my_center|LOCUS_35810 9619 10896 gene locus_tag LOCUS_35820 9619 10896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 11399 10881 gene locus_tag LOCUS_35830 11399 10881 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390931.1 protein_id gnl|my_center|LOCUS_35830 12349 11402 gene locus_tag LOCUS_35840 12349 11402 CDS product DUF1924 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390932.1 protein_id gnl|my_center|LOCUS_35840 12886 12392 gene locus_tag LOCUS_35850 12886 12392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 13167 14156 gene locus_tag LOCUS_35860 gene moaA 13167 14156 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969526.1 protein_id gnl|my_center|LOCUS_35860 14453 15520 gene locus_tag LOCUS_35870 gene fba 14453 15520 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388354.1 protein_id gnl|my_center|LOCUS_35870 17256 15964 gene locus_tag LOCUS_35880 gene purD 17256 15964 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388404.1 protein_id gnl|my_center|LOCUS_35880 17332 18969 gene locus_tag LOCUS_35890 gene xseA 17332 18969 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387920.1 protein_id gnl|my_center|LOCUS_35890 19319 19017 gene locus_tag LOCUS_35900 19319 19017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 21363 19762 gene locus_tag LOCUS_35910 21363 19762 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085661.1 protein_id gnl|my_center|LOCUS_35910 21924 22322 gene locus_tag LOCUS_35920 gene sdhC 21924 22322 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388957.1 protein_id gnl|my_center|LOCUS_35920 22344 22748 gene locus_tag LOCUS_35930 gene sdhD 22344 22748 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388958.1 protein_id gnl|my_center|LOCUS_35930 22756 24543 gene locus_tag LOCUS_35940 gene sdhA 22756 24543 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388959.1 protein_id gnl|my_center|LOCUS_35940 24640 25422 gene locus_tag LOCUS_35950 24640 25422 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388960.1 protein_id gnl|my_center|LOCUS_35950 25880 26473 gene locus_tag LOCUS_35960 25880 26473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 27094 26486 gene locus_tag LOCUS_35970 27094 26486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 27581 28021 gene locus_tag LOCUS_35980 27581 28021 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937587.1 protein_id gnl|my_center|LOCUS_35980 28934 28143 gene locus_tag LOCUS_35990 28934 28143 CDS product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390537.1 protein_id gnl|my_center|LOCUS_35990 30565 29132 gene locus_tag LOCUS_36000 30565 29132 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114294.1 protein_id gnl|my_center|LOCUS_36000 31853 30567 gene locus_tag LOCUS_36010 31853 30567 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114295.1 protein_id gnl|my_center|LOCUS_36010 33243 31846 gene locus_tag LOCUS_36020 33243 31846 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895572.1 protein_id gnl|my_center|LOCUS_36020 33462 34235 gene locus_tag LOCUS_36030 33462 34235 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083169.1 protein_id gnl|my_center|LOCUS_36030 34372 34914 gene locus_tag LOCUS_36040 34372 34914 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719485.1 protein_id gnl|my_center|LOCUS_36040 34911 36233 gene locus_tag LOCUS_36050 34911 36233 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719484.1 protein_id gnl|my_center|LOCUS_36050 36318 37430 gene locus_tag LOCUS_36060 36318 37430 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719483.1 protein_id gnl|my_center|LOCUS_36060 39034 37724 gene locus_tag LOCUS_36070 39034 37724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 39196 39915 gene locus_tag LOCUS_36080 39196 39915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 40019 40711 gene locus_tag LOCUS_36090 40019 40711 CDS product biliverdin-producing heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388111.1 protein_id gnl|my_center|LOCUS_36090 40708 43524 gene locus_tag LOCUS_36100 40708 43524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 43674 44636 gene locus_tag LOCUS_36110 43674 44636 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_36110 45112 44642 gene locus_tag LOCUS_36120 45112 44642 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388868.1 protein_id gnl|my_center|LOCUS_36120 45510 45109 gene locus_tag LOCUS_36130 45510 45109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626097.1 protein_id gnl|my_center|LOCUS_36130 45535 46566 gene locus_tag LOCUS_36140 45535 46566 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388866.1 protein_id gnl|my_center|LOCUS_36140 46728 47642 gene locus_tag LOCUS_36150 gene rpoH 46728 47642 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388865.1 protein_id gnl|my_center|LOCUS_36150 47851 48318 gene locus_tag LOCUS_36160 47851 48318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 48958 48428 gene locus_tag LOCUS_36170 gene ppa 48958 48428 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387907.1 protein_id gnl|my_center|LOCUS_36170 49267 50526 gene locus_tag LOCUS_36180 49267 50526 CDS product sarcosine oxidase subunit beta family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821029.1 protein_id gnl|my_center|LOCUS_36180 50556 50843 gene locus_tag LOCUS_36190 50556 50843 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229308.1 protein_id gnl|my_center|LOCUS_36190 50843 53896 gene locus_tag LOCUS_36200 50843 53896 CDS product sarcosine oxidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531141.1 protein_id gnl|my_center|LOCUS_36200 53889 54434 gene locus_tag LOCUS_36210 53889 54434 CDS product sarcosine oxidase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329815.1 protein_id gnl|my_center|LOCUS_36210 55851 54571 gene locus_tag LOCUS_36220 gene glcF 55851 54571 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401690.1 protein_id gnl|my_center|LOCUS_36220 57102 55855 gene locus_tag LOCUS_36230 57102 55855 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530351.1 protein_id gnl|my_center|LOCUS_36230 58613 57126 gene locus_tag LOCUS_36240 58613 57126 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530350.1 protein_id gnl|my_center|LOCUS_36240 58903 60312 gene locus_tag LOCUS_36250 58903 60312 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388441.1 protein_id gnl|my_center|LOCUS_36250 60344 61525 gene locus_tag LOCUS_36260 60344 61525 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440341.1 protein_id gnl|my_center|LOCUS_36260 61871 61545 gene locus_tag LOCUS_36270 61871 61545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 64212 62038 gene locus_tag LOCUS_36280 gene katG 64212 62038 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444101.1 protein_id gnl|my_center|LOCUS_36280 64979 64575 gene locus_tag LOCUS_36290 64979 64575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 66840 65260 gene locus_tag LOCUS_36300 gene lnt 66840 65260 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391521.1 protein_id gnl|my_center|LOCUS_36300 67832 66843 gene locus_tag LOCUS_36310 67832 66843 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391520.1 protein_id gnl|my_center|LOCUS_36310 68430 67807 gene locus_tag LOCUS_36320 gene ybeY 68430 67807 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391519.1 protein_id gnl|my_center|LOCUS_36320 69422 68427 gene locus_tag LOCUS_36330 69422 68427 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391518.1 protein_id gnl|my_center|LOCUS_36330 70825 69419 gene locus_tag LOCUS_36340 gene miaB 70825 69419 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391517.1 protein_id gnl|my_center|LOCUS_36340 71057 72034 gene locus_tag LOCUS_36350 71057 72034 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390938.1 protein_id gnl|my_center|LOCUS_36350 72034 73341 gene locus_tag LOCUS_36360 gene pyrC 72034 73341 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390939.1 protein_id gnl|my_center|LOCUS_36360 73370 73996 gene locus_tag LOCUS_36370 gene plsY 73370 73996 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390940.1 protein_id gnl|my_center|LOCUS_36370 74227 77280 gene locus_tag LOCUS_36380 74227 77280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 79286 77874 gene locus_tag LOCUS_36390 gene lpdA 79286 77874 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388970.1 protein_id gnl|my_center|LOCUS_36390 80746 79427 gene locus_tag LOCUS_36400 gene odhB 80746 79427 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083283.1 protein_id gnl|my_center|LOCUS_36400 81668 80856 gene locus_tag LOCUS_36410 81668 80856 CDS product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066993.1 protein_id gnl|my_center|LOCUS_36410 84668 81711 gene locus_tag LOCUS_36420 84668 81711 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388968.1 protein_id gnl|my_center|LOCUS_36420 84670 84897 gene locus_tag LOCUS_36430 84670 84897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 85485 84988 gene locus_tag LOCUS_36440 85485 84988 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389495.1 protein_id gnl|my_center|LOCUS_36440 86076 85531 gene locus_tag LOCUS_36450 gene coaD 86076 85531 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389496.1 protein_id gnl|my_center|LOCUS_36450 88865 86073 gene locus_tag LOCUS_36460 gene gyrA 88865 86073 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389497.1 protein_id gnl|my_center|LOCUS_36460 >Feature sequence187 260 36 gene locus_tag LOCUS_36470 260 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 765 304 gene locus_tag LOCUS_36480 765 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 2229 1066 gene locus_tag LOCUS_36490 2229 1066 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389837.1 protein_id gnl|my_center|LOCUS_36490 2612 2950 gene locus_tag LOCUS_36500 2612 2950 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389838.1 protein_id gnl|my_center|LOCUS_36500 3089 4498 gene locus_tag LOCUS_36510 gene glnA 3089 4498 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389839.1 protein_id gnl|my_center|LOCUS_36510 4800 6200 gene locus_tag LOCUS_36520 gene leuC 4800 6200 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388944.1 protein_id gnl|my_center|LOCUS_36520 7193 6489 gene locus_tag LOCUS_36530 7193 6489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 8574 7543 gene locus_tag LOCUS_36540 8574 7543 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625927.1 protein_id gnl|my_center|LOCUS_36540 8630 9238 gene locus_tag LOCUS_36550 8630 9238 CDS product DUF1285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440306.1 protein_id gnl|my_center|LOCUS_36550 9298 9924 gene locus_tag LOCUS_36560 9298 9924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 9909 10247 gene locus_tag LOCUS_36570 9909 10247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 10244 11626 gene locus_tag LOCUS_36580 10244 11626 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625924.1 protein_id gnl|my_center|LOCUS_36580 11757 12407 gene locus_tag LOCUS_36590 11757 12407 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257481.1 protein_id gnl|my_center|LOCUS_36590 >Feature sequence188 353 592 gene locus_tag LOCUS_36600 353 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 663 1184 gene locus_tag LOCUS_36610 663 1184 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389331.1 protein_id gnl|my_center|LOCUS_36610 1184 1495 gene locus_tag LOCUS_36620 1184 1495 CDS product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389330.1 protein_id gnl|my_center|LOCUS_36620 1495 1899 gene locus_tag LOCUS_36630 gene mnhG 1495 1899 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389329.1 protein_id gnl|my_center|LOCUS_36630 1903 2517 gene locus_tag LOCUS_36640 1903 2517 CDS product DUF4040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389328.1 protein_id gnl|my_center|LOCUS_36640 2520 2978 gene locus_tag LOCUS_36650 2520 2978 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389327.1 protein_id gnl|my_center|LOCUS_36650 2971 3348 gene locus_tag LOCUS_36660 2971 3348 CDS product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 protein_id gnl|my_center|LOCUS_36660 3355 4920 gene locus_tag LOCUS_36670 3355 4920 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389325.1 protein_id gnl|my_center|LOCUS_36670 4920 6473 gene locus_tag LOCUS_36680 4920 6473 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389324.1 protein_id gnl|my_center|LOCUS_36680 6470 6823 gene locus_tag LOCUS_36690 6470 6823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 6810 8504 gene locus_tag LOCUS_36700 6810 8504 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389322.1 protein_id gnl|my_center|LOCUS_36700 8699 8508 gene locus_tag LOCUS_36710 8699 8508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 9537 8740 gene locus_tag LOCUS_36720 9537 8740 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390517.1 protein_id gnl|my_center|LOCUS_36720 10051 9758 gene locus_tag LOCUS_36730 10051 9758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 11640 10504 gene locus_tag LOCUS_36740 11640 10504 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348847.1 protein_id gnl|my_center|LOCUS_36740 >Feature sequence189 180 105 gene locus_tag LOCUS_t00510 180 105 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 646 1644 gene locus_tag LOCUS_36750 646 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 1641 2354 gene locus_tag LOCUS_36760 1641 2354 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460802.1 protein_id gnl|my_center|LOCUS_36760 2351 5977 gene locus_tag LOCUS_36770 2351 5977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 3448 3377 gene locus_tag LOCUS_t00520 3448 3377 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8432 6600 gene locus_tag LOCUS_36780 8432 6600 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391166.1 protein_id gnl|my_center|LOCUS_36780 9367 8585 gene locus_tag LOCUS_36790 9367 8585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 9552 10067 gene locus_tag LOCUS_36800 9552 10067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 10191 10267 gene locus_tag LOCUS_t00530 10191 10267 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 10563 11732 gene locus_tag LOCUS_36810 10563 11732 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921453.1 protein_id gnl|my_center|LOCUS_36810 >Feature sequence190 712 512 gene locus_tag LOCUS_36820 712 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 971 1654 gene locus_tag LOCUS_36830 gene rimP 971 1654 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391525.1 protein_id gnl|my_center|LOCUS_36830 1753 3396 gene locus_tag LOCUS_36840 gene nusA 1753 3396 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391526.1 protein_id gnl|my_center|LOCUS_36840 3410 4339 gene locus_tag LOCUS_36850 3410 4339 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626660.1 protein_id gnl|my_center|LOCUS_36850 4404 7034 gene locus_tag LOCUS_36860 gene infB 4404 7034 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626661.1 protein_id gnl|my_center|LOCUS_36860 7118 7621 gene locus_tag LOCUS_36870 gene rbfA 7118 7621 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391529.1 protein_id gnl|my_center|LOCUS_36870 7611 8585 gene locus_tag LOCUS_36880 gene truB 7611 8585 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391530.1 protein_id gnl|my_center|LOCUS_36880 8706 8975 gene locus_tag LOCUS_36890 gene rpsO 8706 8975 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391531.1 protein_id gnl|my_center|LOCUS_36890 9339 11468 gene locus_tag LOCUS_36900 gene pnp 9339 11468 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391532.1 protein_id gnl|my_center|LOCUS_36900 >Feature sequence191 416 1849 gene locus_tag LOCUS_36910 gene gndA 416 1849 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222331.1 protein_id gnl|my_center|LOCUS_36910 2726 1896 gene locus_tag LOCUS_36920 2726 1896 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625959.1 protein_id gnl|my_center|LOCUS_36920 3022 4704 gene locus_tag LOCUS_36930 3022 4704 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388526.1 protein_id gnl|my_center|LOCUS_36930 4701 5804 gene locus_tag LOCUS_36940 4701 5804 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388525.1 protein_id gnl|my_center|LOCUS_36940 6437 5913 gene locus_tag LOCUS_36950 6437 5913 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390254.1 protein_id gnl|my_center|LOCUS_36950 7163 6759 gene locus_tag LOCUS_36960 7163 6759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 7426 7701 gene locus_tag LOCUS_36970 7426 7701 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086258.1 protein_id gnl|my_center|LOCUS_36970 8402 9391 gene locus_tag LOCUS_36980 8402 9391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 >Feature sequence192 1693 143 gene locus_tag LOCUS_36990 gene guaA 1693 143 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388108.1 protein_id gnl|my_center|LOCUS_36990 1923 2141 gene locus_tag LOCUS_37000 gene infA 1923 2141 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004617696.1 protein_id gnl|my_center|LOCUS_37000 2150 2764 gene locus_tag LOCUS_37010 2150 2764 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390578.1 protein_id gnl|my_center|LOCUS_37010 2761 4152 gene locus_tag LOCUS_37020 2761 4152 CDS product ribonuclease E/G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390577.1 protein_id gnl|my_center|LOCUS_37020 4245 4949 gene locus_tag LOCUS_37030 4245 4949 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810743.1 protein_id gnl|my_center|LOCUS_37030 5485 5093 gene locus_tag LOCUS_37040 5485 5093 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142729.1 protein_id gnl|my_center|LOCUS_37040 5719 5495 gene locus_tag LOCUS_37050 5719 5495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 5931 6494 gene locus_tag LOCUS_37060 5931 6494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 7336 6527 gene locus_tag LOCUS_37070 7336 6527 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388756.1 protein_id gnl|my_center|LOCUS_37070 8546 7410 gene locus_tag LOCUS_37080 8546 7410 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388757.1 protein_id gnl|my_center|LOCUS_37080 9728 8550 gene locus_tag LOCUS_37090 9728 8550 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388758.1 protein_id gnl|my_center|LOCUS_37090 >Feature sequence193 338 2536 gene locus_tag LOCUS_37100 338 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 3044 4582 gene locus_tag LOCUS_37110 3044 4582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 4699 5697 gene locus_tag LOCUS_37120 4699 5697 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389306.1 protein_id gnl|my_center|LOCUS_37120 5837 6691 gene locus_tag LOCUS_37130 gene sseA 5837 6691 CDS product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389305.1 protein_id gnl|my_center|LOCUS_37130 7378 6719 gene locus_tag LOCUS_37140 7378 6719 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330705.1 protein_id gnl|my_center|LOCUS_37140 7584 9167 gene locus_tag LOCUS_37150 7584 9167 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338253.1 protein_id gnl|my_center|LOCUS_37150 9595 9176 gene locus_tag LOCUS_37160 9595 9176 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391320.1 protein_id gnl|my_center|LOCUS_37160 >Feature sequence194 486 1802 gene locus_tag LOCUS_37170 486 1802 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947065.1 protein_id gnl|my_center|LOCUS_37170 1802 2686 gene locus_tag LOCUS_37180 1802 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 6269 2865 gene locus_tag LOCUS_37190 6269 2865 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_37190 7517 6312 gene locus_tag LOCUS_37200 7517 6312 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403493.1 protein_id gnl|my_center|LOCUS_37200 8137 7625 gene locus_tag LOCUS_37210 8137 7625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 8415 9344 gene locus_tag LOCUS_37220 8415 9344 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390366.1 protein_id gnl|my_center|LOCUS_37220 >Feature sequence195 285 986 gene locus_tag LOCUS_37230 285 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 1063 2085 gene locus_tag LOCUS_37240 gene desE 1063 2085 CDS product fatty acid desaturase DesE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399588.1 protein_id gnl|my_center|LOCUS_37240 2082 2966 gene locus_tag LOCUS_37250 2082 2966 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390563.1 protein_id gnl|my_center|LOCUS_37250 4252 3188 gene locus_tag LOCUS_37260 4252 3188 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938933.1 protein_id gnl|my_center|LOCUS_37260 4678 4319 gene locus_tag LOCUS_37270 4678 4319 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001175594.1 protein_id gnl|my_center|LOCUS_37270 5797 4739 gene locus_tag LOCUS_37280 gene arsB 5797 4739 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971664.1 protein_id gnl|my_center|LOCUS_37280 7090 5849 gene locus_tag LOCUS_37290 gene arsJ 7090 5849 CDS product organoarsenical effux MFS transporter ArsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798948.1 protein_id gnl|my_center|LOCUS_37290 8103 7087 gene locus_tag LOCUS_37300 8103 7087 CDS product ArsJ-associated glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255924.1 protein_id gnl|my_center|LOCUS_37300 9027 8140 gene locus_tag LOCUS_37310 9027 8140 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389204.1 protein_id gnl|my_center|LOCUS_37310 >Feature sequence196 522 1796 gene locus_tag LOCUS_37320 gene urtA 522 1796 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529436.1 protein_id gnl|my_center|LOCUS_37320 1908 3527 gene locus_tag LOCUS_37330 gene urtB 1908 3527 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976304.1 protein_id gnl|my_center|LOCUS_37330 3532 4647 gene locus_tag LOCUS_37340 gene urtC 3532 4647 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084267.1 protein_id gnl|my_center|LOCUS_37340 4651 5415 gene locus_tag LOCUS_37350 gene urtD 4651 5415 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972305.1 protein_id gnl|my_center|LOCUS_37350 5421 6200 gene locus_tag LOCUS_37360 gene urtE 5421 6200 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972304.1 protein_id gnl|my_center|LOCUS_37360 6422 7462 gene locus_tag LOCUS_37370 6422 7462 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730926.1 protein_id gnl|my_center|LOCUS_37370 8664 7513 gene locus_tag LOCUS_37380 8664 7513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 >Feature sequence197 375 986 gene locus_tag LOCUS_37390 375 986 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085436.1 protein_id gnl|my_center|LOCUS_37390 1316 1071 gene locus_tag LOCUS_37400 1316 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 2206 1406 gene locus_tag LOCUS_37410 2206 1406 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390702.1 protein_id gnl|my_center|LOCUS_37410 2430 2203 gene locus_tag LOCUS_37420 2430 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37420 2737 3798 gene locus_tag LOCUS_37430 2737 3798 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390700.1 protein_id gnl|my_center|LOCUS_37430 4260 4000 gene locus_tag LOCUS_37440 4260 4000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 4952 4260 gene locus_tag LOCUS_37450 4952 4260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 5712 4954 gene locus_tag LOCUS_37460 5712 4954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 5858 7423 gene locus_tag LOCUS_37470 gene cryB 5858 7423 CDS product cryptochrome/photolyase CryB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339023.1 protein_id gnl|my_center|LOCUS_37470 8042 7434 gene locus_tag LOCUS_37480 8042 7434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 8956 8099 gene locus_tag LOCUS_37490 gene pdxY 8956 8099 CDS product pyridoxal kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388954.1 protein_id gnl|my_center|LOCUS_37490 9136 10032 gene locus_tag LOCUS_37500 9136 10032 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388955.1 protein_id gnl|my_center|LOCUS_37500 10119 11198 gene locus_tag LOCUS_37510 10119 11198 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388956.1 protein_id gnl|my_center|LOCUS_37510 12291 11302 gene locus_tag LOCUS_37520 12291 11302 CDS product DUF3426 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391001.1 protein_id gnl|my_center|LOCUS_37520 12443 13243 gene locus_tag LOCUS_37530 gene ftsE 12443 13243 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626546.1 protein_id gnl|my_center|LOCUS_37530 13280 14173 gene locus_tag LOCUS_37540 13280 14173 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391003.1 protein_id gnl|my_center|LOCUS_37540 14197 14901 gene locus_tag LOCUS_37550 14197 14901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 14898 15620 gene locus_tag LOCUS_37560 14898 15620 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626547.1 protein_id gnl|my_center|LOCUS_37560 15850 18279 gene locus_tag LOCUS_37570 15850 18279 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339403.1 protein_id gnl|my_center|LOCUS_37570 19486 18593 gene locus_tag LOCUS_37580 gene hflC 19486 18593 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390051.1 protein_id gnl|my_center|LOCUS_37580 20700 19483 gene locus_tag LOCUS_37590 gene hflK 20700 19483 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390052.1 protein_id gnl|my_center|LOCUS_37590 20958 20707 gene locus_tag LOCUS_37600 20958 20707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 20924 22039 gene locus_tag LOCUS_37610 20924 22039 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390053.1 protein_id gnl|my_center|LOCUS_37610 22763 22032 gene locus_tag LOCUS_37620 22763 22032 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403241.1 protein_id gnl|my_center|LOCUS_37620 23867 22776 gene locus_tag LOCUS_37630 23867 22776 CDS product fructose-bisphosphate aldolase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529246.1 protein_id gnl|my_center|LOCUS_37630 24567 23869 gene locus_tag LOCUS_37640 24567 23869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 26024 24699 gene locus_tag LOCUS_37650 26024 24699 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720129.1 protein_id gnl|my_center|LOCUS_37650 26729 26151 gene locus_tag LOCUS_37660 26729 26151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 27605 26733 gene locus_tag LOCUS_37670 27605 26733 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061271.1 protein_id gnl|my_center|LOCUS_37670 27873 28847 gene locus_tag LOCUS_37680 gene pfkB 27873 28847 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336985.1 protein_id gnl|my_center|LOCUS_37680 29448 28807 gene locus_tag LOCUS_37690 gene ureG 29448 28807 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931336.1 protein_id gnl|my_center|LOCUS_37690 30212 29445 gene locus_tag LOCUS_37700 30212 29445 CDS product urease accessory UreF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084275.1 protein_id gnl|my_center|LOCUS_37700 30663 30151 gene locus_tag LOCUS_37710 30663 30151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 32379 30670 gene locus_tag LOCUS_37720 gene ureC 32379 30670 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329296.1 protein_id gnl|my_center|LOCUS_37720 32695 32423 gene locus_tag LOCUS_37730 32695 32423 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720474.1 protein_id gnl|my_center|LOCUS_37730 33011 32709 gene locus_tag LOCUS_37740 33011 32709 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525618.1 protein_id gnl|my_center|LOCUS_37740 33904 33038 gene locus_tag LOCUS_37750 33904 33038 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084270.1 protein_id gnl|my_center|LOCUS_37750 34112 35347 gene locus_tag LOCUS_37760 34112 35347 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395366.1 protein_id gnl|my_center|LOCUS_37760 35344 36612 gene locus_tag LOCUS_37770 35344 36612 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532461.1 protein_id gnl|my_center|LOCUS_37770 36899 36651 gene locus_tag LOCUS_37780 36899 36651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 37322 39637 gene locus_tag LOCUS_37790 37322 39637 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389289.1 protein_id gnl|my_center|LOCUS_37790 40008 41309 gene locus_tag LOCUS_37800 40008 41309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 42021 41335 gene locus_tag LOCUS_37810 42021 41335 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626425.1 protein_id gnl|my_center|LOCUS_37810 42799 42005 gene locus_tag LOCUS_37820 gene cbiQ 42799 42005 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626426.1 protein_id gnl|my_center|LOCUS_37820 43413 42796 gene locus_tag LOCUS_37830 43413 42796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 44057 43428 gene locus_tag LOCUS_37840 gene cbiM 44057 43428 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391247.1 protein_id gnl|my_center|LOCUS_37840 44497 44081 gene locus_tag LOCUS_37850 44497 44081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 44900 45226 gene locus_tag LOCUS_37860 44900 45226 CDS product nickel-sensing transcriptional repressor NcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196355.1 protein_id gnl|my_center|LOCUS_37860 45245 46078 gene locus_tag LOCUS_37870 45245 46078 CDS product nickel/cobalt efflux protein RcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095882.1 protein_id gnl|my_center|LOCUS_37870 47060 46149 gene locus_tag LOCUS_37880 47060 46149 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257650.1 protein_id gnl|my_center|LOCUS_37880 47171 48808 gene locus_tag LOCUS_37890 47171 48808 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257649.1 protein_id gnl|my_center|LOCUS_37890 48805 51363 gene locus_tag LOCUS_37900 48805 51363 CDS product DUF2309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257648.1 protein_id gnl|my_center|LOCUS_37900 51658 51425 gene locus_tag LOCUS_37910 51658 51425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 51845 52021 gene locus_tag LOCUS_37920 51845 52021 CDS product DUF1328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089300.1 protein_id gnl|my_center|LOCUS_37920 52079 52351 gene locus_tag LOCUS_37930 52079 52351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 52562 53224 gene locus_tag LOCUS_37940 52562 53224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 54436 53399 gene locus_tag LOCUS_37950 54436 53399 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404758.1 protein_id gnl|my_center|LOCUS_37950 55525 54575 gene locus_tag LOCUS_37960 55525 54575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37960 55954 55727 gene locus_tag LOCUS_37970 55954 55727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37970 56671 56099 gene locus_tag LOCUS_37980 56671 56099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 57065 56739 gene locus_tag LOCUS_37990 57065 56739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 57016 57315 gene locus_tag LOCUS_38000 57016 57315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 58030 57356 gene locus_tag LOCUS_38010 58030 57356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 58441 58920 gene locus_tag LOCUS_38020 58441 58920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 60340 58937 gene locus_tag LOCUS_38030 gene fumC 60340 58937 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089259.1 protein_id gnl|my_center|LOCUS_38030 61158 60376 gene locus_tag LOCUS_38040 61158 60376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 61802 61227 gene locus_tag LOCUS_38050 61802 61227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 61991 62914 gene locus_tag LOCUS_38060 gene prpB 61991 62914 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537804.1 protein_id gnl|my_center|LOCUS_38060 65122 63587 gene locus_tag LOCUS_38070 65122 63587 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389246.1 protein_id gnl|my_center|LOCUS_38070 65946 65179 gene locus_tag LOCUS_38080 65946 65179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 68260 65936 gene locus_tag LOCUS_38090 68260 65936 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918053.1 protein_id gnl|my_center|LOCUS_38090 68685 68317 gene locus_tag LOCUS_38100 68685 68317 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391348.1 protein_id gnl|my_center|LOCUS_38100 69302 68682 gene locus_tag LOCUS_38110 69302 68682 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391349.1 protein_id gnl|my_center|LOCUS_38110 69978 69286 gene locus_tag LOCUS_38120 69978 69286 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391350.1 protein_id gnl|my_center|LOCUS_38120 70598 70095 gene locus_tag LOCUS_38130 70598 70095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38130 72061 70640 gene locus_tag LOCUS_38140 72061 70640 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391352.1 protein_id gnl|my_center|LOCUS_38140 72876 72061 gene locus_tag LOCUS_38150 72876 72061 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391353.1 protein_id gnl|my_center|LOCUS_38150 73213 74799 gene locus_tag LOCUS_38160 73213 74799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 74934 74850 gene locus_tag LOCUS_t00540 74934 74850 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 75627 75046 gene locus_tag LOCUS_38170 75627 75046 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387993.1 protein_id gnl|my_center|LOCUS_38170 75931 75686 gene locus_tag LOCUS_38180 75931 75686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 76191 75961 gene locus_tag LOCUS_38190 76191 75961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 79148 76410 gene locus_tag LOCUS_38200 gene secA 79148 76410 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387988.1 protein_id gnl|my_center|LOCUS_38200 79454 80311 gene locus_tag LOCUS_38210 79454 80311 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388154.1 protein_id gnl|my_center|LOCUS_38210 80325 81557 gene locus_tag LOCUS_38220 gene argJ 80325 81557 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388153.1 protein_id gnl|my_center|LOCUS_38220 81538 82563 gene locus_tag LOCUS_38230 81538 82563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 82700 82957 gene locus_tag LOCUS_38240 82700 82957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 83117 83875 gene locus_tag LOCUS_38250 83117 83875 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388151.1 protein_id gnl|my_center|LOCUS_38250 84126 84740 gene locus_tag LOCUS_38260 gene rpsD 84126 84740 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388459.1 protein_id gnl|my_center|LOCUS_38260 85360 84896 gene locus_tag LOCUS_38270 85360 84896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 85960 85364 gene locus_tag LOCUS_38280 85960 85364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38280